From 8231da563c810ce210ce309ee1a022bad22a1e13 Mon Sep 17 00:00:00 2001 From: "Arnold D. Robbins" Date: Tue, 25 Oct 2016 21:38:59 +0300 Subject: Remove info files from repo. No need to keep updating them. --- doc/gawkinet.info | 4406 ----------------------------------------------------- 1 file changed, 4406 deletions(-) delete mode 100644 doc/gawkinet.info (limited to 'doc/gawkinet.info') diff --git a/doc/gawkinet.info b/doc/gawkinet.info deleted file mode 100644 index d5a7abf8..00000000 --- a/doc/gawkinet.info +++ /dev/null @@ -1,4406 +0,0 @@ -This is gawkinet.info, produced by makeinfo version 6.1 from -gawkinet.texi. - -This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the -4.1.4 (or later) version of the GNU implementation of AWK. - - - Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software -Foundation, Inc. - - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", the Front-Cover -texts being (a) (see below), and with the Back-Cover Texts being (b) -(see below). A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. "A GNU Manual" - - b. "You have the freedom to copy and modify this GNU manual. Buying - copies from the FSF supports it in developing GNU and promoting - software freedom." -INFO-DIR-SECTION Network applications -START-INFO-DIR-ENTRY -* Gawkinet: (gawkinet). TCP/IP Internetworking With 'gawk'. -END-INFO-DIR-ENTRY - - This file documents the networking features in GNU 'awk'. - - This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the -4.1.4 (or later) version of the GNU implementation of AWK. - - - Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software -Foundation, Inc. - - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", the Front-Cover -texts being (a) (see below), and with the Back-Cover Texts being (b) -(see below). A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. "A GNU Manual" - - b. "You have the freedom to copy and modify this GNU manual. Buying - copies from the FSF supports it in developing GNU and promoting - software freedom." - - -File: gawkinet.info, Node: Top, Next: Preface, Prev: (dir), Up: (dir) - -General Introduction -******************** - -This file documents the networking features in GNU Awk ('gawk') version -4.0 and later. - - This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the -4.1.4 (or later) version of the GNU implementation of AWK. - - - Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software -Foundation, Inc. - - - Permission is granted to copy, distribute and/or modify this document -under the terms of the GNU Free Documentation License, Version 1.3 or -any later version published by the Free Software Foundation; with the -Invariant Sections being "GNU General Public License", the Front-Cover -texts being (a) (see below), and with the Back-Cover Texts being (b) -(see below). A copy of the license is included in the section entitled -"GNU Free Documentation License". - - a. "A GNU Manual" - - b. "You have the freedom to copy and modify this GNU manual. Buying - copies from the FSF supports it in developing GNU and promoting - software freedom." - -* Menu: - -* Preface:: About this document. -* Introduction:: About networking. -* Using Networking:: Some examples. -* Some Applications and Techniques:: More extended examples. -* Links:: Where to find the stuff mentioned in this - document. -* GNU Free Documentation License:: The license for this document. -* Index:: The index. - -* Stream Communications:: Sending data streams. -* Datagram Communications:: Sending self-contained messages. -* The TCP/IP Protocols:: How these models work in the Internet. -* Basic Protocols:: The basic protocols. -* Ports:: The idea behind ports. -* Making Connections:: Making TCP/IP connections. -* Gawk Special Files:: How to do 'gawk' networking. -* Special File Fields:: The fields in the special file name. -* Comparing Protocols:: Differences between the protocols. -* File /inet/tcp:: The TCP special file. -* File /inet/udp:: The UDP special file. -* TCP Connecting:: Making a TCP connection. -* Troubleshooting:: Troubleshooting TCP/IP connections. -* Interacting:: Interacting with a service. -* Setting Up:: Setting up a service. -* Email:: Reading email. -* Web page:: Reading a Web page. -* Primitive Service:: A primitive Web service. -* Interacting Service:: A Web service with interaction. -* CGI Lib:: A simple CGI library. -* Simple Server:: A simple Web server. -* Caveats:: Network programming caveats. -* Challenges:: Where to go from here. -* PANIC:: An Emergency Web Server. -* GETURL:: Retrieving Web Pages. -* REMCONF:: Remote Configuration Of Embedded Systems. -* URLCHK:: Look For Changed Web Pages. -* WEBGRAB:: Extract Links From A Page. -* STATIST:: Graphing A Statistical Distribution. -* MAZE:: Walking Through A Maze In Virtual Reality. -* MOBAGWHO:: A Simple Mobile Agent. -* STOXPRED:: Stock Market Prediction As A Service. -* PROTBASE:: Searching Through A Protein Database. - - -File: gawkinet.info, Node: Preface, Next: Introduction, Prev: Top, Up: Top - -Preface -******* - -In May of 1997, Ju"rgen Kahrs felt the need for network access from -'awk', and, with a little help from me, set about adding features to do -this for 'gawk'. At that time, he wrote the bulk of this Info file. - - The code and documentation were added to the 'gawk' 3.1 development -tree, and languished somewhat until I could finally get down to some -serious work on that version of 'gawk'. This finally happened in the -middle of 2000. - - Meantime, Ju"rgen wrote an article about the Internet special files -and '|&' operator for 'Linux Journal', and made a networking patch for -the production versions of 'gawk' available from his home page. In -August of 2000 (for 'gawk' 3.0.6), this patch also made it to the main -GNU 'ftp' distribution site. - - For release with 'gawk', I edited Ju"rgen's prose for English grammar -and style, as he is not a native English speaker. I also rearranged the -material somewhat for what I felt was a better order of presentation, -and (re)wrote some of the introductory material. - - The majority of this document and the code are his work, and the high -quality and interesting ideas speak for themselves. It is my hope that -these features will be of significant value to the 'awk' community. - - -Arnold Robbins -Nof Ayalon, ISRAEL -March, 2001 - - -File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Preface, Up: Top - -1 Networking Concepts -********************* - -This major node provides a (necessarily) brief introduction to computer -networking concepts. For many applications of 'gawk' to TCP/IP -networking, we hope that this is enough. For more advanced tasks, you -will need deeper background, and it may be necessary to switch to -lower-level programming in C or C++. - - There are two real-life models for the way computers send messages to -each other over a network. While the analogies are not perfect, they -are close enough to convey the major concepts. These two models are the -phone system (reliable byte-stream communications), and the postal -system (best-effort datagrams). - -* Menu: - -* Stream Communications:: Sending data streams. -* Datagram Communications:: Sending self-contained messages. -* The TCP/IP Protocols:: How these models work in the Internet. -* Making Connections:: Making TCP/IP connections. - - -File: gawkinet.info, Node: Stream Communications, Next: Datagram Communications, Prev: Introduction, Up: Introduction - -1.1 Reliable Byte-streams (Phone Calls) -======================================= - -When you make a phone call, the following steps occur: - - 1. You dial a number. - - 2. The phone system connects to the called party, telling them there - is an incoming call. (Their phone rings.) - - 3. The other party answers the call, or, in the case of a computer - network, refuses to answer the call. - - 4. Assuming the other party answers, the connection between you is now - a "duplex" (two-way), "reliable" (no data lost), sequenced (data - comes out in the order sent) data stream. - - 5. You and your friend may now talk freely, with the phone system - moving the data (your voices) from one end to the other. From your - point of view, you have a direct end-to-end connection with the - person on the other end. - - The same steps occur in a duplex reliable computer networking -connection. There is considerably more overhead in setting up the -communications, but once it's done, data moves in both directions, -reliably, in sequence. - - -File: gawkinet.info, Node: Datagram Communications, Next: The TCP/IP Protocols, Prev: Stream Communications, Up: Introduction - -1.2 Best-effort Datagrams (Mailed Letters) -========================================== - -Suppose you mail three different documents to your office on the other -side of the country on two different days. Doing so entails the -following. - - 1. Each document travels in its own envelope. - - 2. Each envelope contains both the sender and the recipient address. - - 3. Each envelope may travel a different route to its destination. - - 4. The envelopes may arrive in a different order from the one in which - they were sent. - - 5. One or more may get lost in the mail. (Although, fortunately, this - does not occur very often.) - - 6. In a computer network, one or more "packets" may also arrive - multiple times. (This doesn't happen with the postal system!) - - The important characteristics of datagram communications, like those -of the postal system are thus: - - * Delivery is "best effort;" the data may never get there. - - * Each message is self-contained, including the source and - destination addresses. - - * Delivery is _not_ sequenced; packets may arrive out of order, - and/or multiple times. - - * Unlike the phone system, overhead is considerably lower. It is not - necessary to set up the call first. - - The price the user pays for the lower overhead of datagram -communications is exactly the lower reliability; it is often necessary -for user-level protocols that use datagram communications to add their -own reliability features on top of the basic communications. - - -File: gawkinet.info, Node: The TCP/IP Protocols, Next: Making Connections, Prev: Datagram Communications, Up: Introduction - -1.3 The Internet Protocols -========================== - -The Internet Protocol Suite (usually referred to as just TCP/IP)(1) -consists of a number of different protocols at different levels or -"layers." For our purposes, three protocols provide the fundamental -communications mechanisms. All other defined protocols are referred to -as user-level protocols (e.g., HTTP, used later in this Info file). - -* Menu: - -* Basic Protocols:: The basic protocols. -* Ports:: The idea behind ports. - - ---------- Footnotes ---------- - - (1) It should be noted that although the Internet seems to have -conquered the world, there are other networking protocol suites in -existence and in use. - - -File: gawkinet.info, Node: Basic Protocols, Next: Ports, Prev: The TCP/IP Protocols, Up: The TCP/IP Protocols - -1.3.1 The Basic Internet Protocols ----------------------------------- - -IP - The Internet Protocol. This protocol is almost never used directly - by applications. It provides the basic packet delivery and routing - infrastructure of the Internet. Much like the phone company's - switching centers or the Post Office's trucks, it is not of much - day-to-day interest to the regular user (or programmer). It - happens to be a best effort datagram protocol. In the early - twenty-first century, there are two versions of this protocol in - use: - - IPv4 - The original version of the Internet Protocol, with 32-bit - addresses, on which most of the current Internet is based. - - IPv6 - The "next generation" of the Internet Protocol, with 128-bit - addresses. This protocol is in wide use in certain parts of - the world, but has not yet replaced IPv4.(1) - - Versions of the other protocols that sit "atop" IP exist for both - IPv4 and IPv6. However, as the IPv6 versions are fundamentally the - same as the original IPv4 versions, we will not distinguish further - between them. - -UDP - The User Datagram Protocol. This is a best effort datagram - protocol. It provides a small amount of extra reliability over IP, - and adds the notion of "ports", described in *note TCP and UDP - Ports: Ports. - -TCP - The Transmission Control Protocol. This is a duplex, reliable, - sequenced byte-stream protocol, again layered on top of IP, and - also providing the notion of ports. This is the protocol that you - will most likely use when using 'gawk' for network programming. - - All other user-level protocols use either TCP or UDP to do their -basic communications. Examples are SMTP (Simple Mail Transfer -Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer -Protocol). - - ---------- Footnotes ---------- - - (1) There isn't an IPv5. - - -File: gawkinet.info, Node: Ports, Prev: Basic Protocols, Up: The TCP/IP Protocols - -1.3.2 TCP and UDP Ports ------------------------ - -In the postal system, the address on an envelope indicates a physical -location, such as a residence or office building. But there may be more -than one person at the location; thus you have to further quantify the -recipient by putting a person or company name on the envelope. - - In the phone system, one phone number may represent an entire -company, in which case you need a person's extension number in order to -reach that individual directly. Or, when you call a home, you have to -say, "May I please speak to ..." before talking to the person directly. - - IP networking provides the concept of addressing. An IP address -represents a particular computer, but no more. In order to reach the -mail service on a system, or the FTP or WWW service on a system, you -must have some way to further specify which service you want. In the -Internet Protocol suite, this is done with "port numbers", which -represent the services, much like an extension number used with a phone -number. - - Port numbers are 16-bit integers. Unix and Unix-like systems reserve -ports below 1024 for "well known" services, such as SMTP, FTP, and HTTP. -Numbers 1024 and above may be used by any application, although there is -no promise made that a particular port number is always available. - - -File: gawkinet.info, Node: Making Connections, Prev: The TCP/IP Protocols, Up: Introduction - -1.4 Making TCP/IP Connections (And Some Terminology) -==================================================== - -Two terms come up repeatedly when discussing networking: "client" and -"server". For now, we'll discuss these terms at the "connection level", -when first establishing connections between two processes on different -systems over a network. (Once the connection is established, the higher -level, or "application level" protocols, such as HTTP or FTP, determine -who is the client and who is the server. Often, it turns out that the -client and server are the same in both roles.) - - The "server" is the system providing the service, such as the web -server or email server. It is the "host" (system) which is _connected -to_ in a transaction. For this to work though, the server must be -expecting connections. Much as there has to be someone at the office -building to answer the phone(1), the server process (usually) has to be -started first and be waiting for a connection. - - The "client" is the system requesting the service. It is the system -_initiating the connection_ in a transaction. (Just as when you pick up -the phone to call an office or store.) - - In the TCP/IP framework, each end of a connection is represented by a -pair of (ADDRESS, PORT) pairs. For the duration of the connection, the -ports in use at each end are unique, and cannot be used simultaneously -by other processes on the same system. (Only after closing a connection -can a new one be built up on the same port. This is contrary to the -usual behavior of fully developed web servers which have to avoid -situations in which they are not reachable. We have to pay this price -in order to enjoy the benefits of a simple communication paradigm in -'gawk'.) - - Furthermore, once the connection is established, communications are -"synchronous".(2) I.e., each end waits on the other to finish -transmitting, before replying. This is much like two people in a phone -conversation. While both could talk simultaneously, doing so usually -doesn't work too well. - - In the case of TCP, the synchronicity is enforced by the protocol -when sending data. Data writes "block" until the data have been -received on the other end. For both TCP and UDP, data reads block until -there is incoming data waiting to be read. This is summarized in the -following table, where an "X" indicates that the given action blocks. - -TCP X X -UDP X - - ---------- Footnotes ---------- - - (1) In the days before voice mail systems! - - (2) For the technically savvy, data reads block--if there's no -incoming data, the program is made to wait until there is, instead of -receiving a "there's no data" error return. - - -File: gawkinet.info, Node: Using Networking, Next: Some Applications and Techniques, Prev: Introduction, Up: Top - -2 Networking With 'gawk' -************************ - -The 'awk' programming language was originally developed as a -pattern-matching language for writing short programs to perform data -manipulation tasks. 'awk''s strength is the manipulation of textual -data that is stored in files. It was never meant to be used for -networking purposes. To exploit its features in a networking context, -it's necessary to use an access mode for network connections that -resembles the access of files as closely as possible. - - 'awk' is also meant to be a prototyping language. It is used to -demonstrate feasibility and to play with features and user interfaces. -This can be done with file-like handling of network connections. 'gawk' -trades the lack of many of the advanced features of the TCP/IP family of -protocols for the convenience of simple connection handling. The -advanced features are available when programming in C or Perl. In fact, -the network programming in this major node is very similar to what is -described in books such as 'Internet Programming with Python', 'Advanced -Perl Programming', or 'Web Client Programming with Perl'. - - However, you can do the programming here without first having to -learn object-oriented ideology; underlying languages such as Tcl/Tk, -Perl, Python; or all of the libraries necessary to extend these -languages before they are ready for the Internet. - - This major node demonstrates how to use the TCP protocol. The UDP -protocol is much less important for most users. - -* Menu: - -* Gawk Special Files:: How to do 'gawk' networking. -* TCP Connecting:: Making a TCP connection. -* Troubleshooting:: Troubleshooting TCP/IP connections. -* Interacting:: Interacting with a service. -* Setting Up:: Setting up a service. -* Email:: Reading email. -* Web page:: Reading a Web page. -* Primitive Service:: A primitive Web service. -* Interacting Service:: A Web service with interaction. -* Simple Server:: A simple Web server. -* Caveats:: Network programming caveats. -* Challenges:: Where to go from here. - - -File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Using Networking, Up: Using Networking - -2.1 'gawk''s Networking Mechanisms -================================== - -The '|&' operator for use in communicating with a "coprocess" is -described in *note Two-way Communications With Another Process: -(gawk)Two-way I/O. It shows how to do two-way I/O to a separate process, -sending it data with 'print' or 'printf' and reading data with -'getline'. If you haven't read it already, you should detour there to -do so. - - 'gawk' transparently extends the two-way I/O mechanism to simple -networking through the use of special file names. When a "coprocess" -that matches the special files we are about to describe is started, -'gawk' creates the appropriate network connection, and then two-way I/O -proceeds as usual. - - At the C, C++, and Perl level, networking is accomplished via -"sockets", an Application Programming Interface (API) originally -developed at the University of California at Berkeley that is now used -almost universally for TCP/IP networking. Socket level programming, -while fairly straightforward, requires paying attention to a number of -details, as well as using binary data. It is not well-suited for use -from a high-level language like 'awk'. The special files provided in -'gawk' hide the details from the programmer, making things much simpler -and easier to use. - - The special file name for network access is made up of several -fields, all of which are mandatory: - - /NET-TYPE/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT - - The NET-TYPE field lets you specify IPv4 versus IPv6, or lets you -allow the system to choose. - -* Menu: - -* Special File Fields:: The fields in the special file name. -* Comparing Protocols:: Differences between the protocols. - - -File: gawkinet.info, Node: Special File Fields, Next: Comparing Protocols, Prev: Gawk Special Files, Up: Gawk Special Files - -2.1.1 The Fields of the Special File Name ------------------------------------------ - -This node explains the meaning of all the other fields, as well as the -range of values and the defaults. All of the fields are mandatory. To -let the system pick a value, or if the field doesn't apply to the -protocol, specify it as '0': - -NET-TYPE - This is one of 'inet4' for IPv4, 'inet6' for IPv6, or 'inet' to use - the system default (which is likely to be IPv4). For the rest of - this document, we will use the generic '/inet' in our descriptions - of how 'gawk''s networking works. - -PROTOCOL - Determines which member of the TCP/IP family of protocols is - selected to transport the data across the network. There are two - possible values (always written in lowercase): 'tcp' and 'udp'. - The exact meaning of each is explained later in this node. - -LOCALPORT - Determines which port on the local machine is used to communicate - across the network. Application-level clients usually use '0' to - indicate they do not care which local port is used--instead they - specify a remote port to connect to. It is vital for - application-level servers to use a number different from '0' here - because their service has to be available at a specific publicly - known port number. It is possible to use a name from - '/etc/services' here. - -HOSTNAME - Determines which remote host is to be at the other end of the - connection. Application-level servers must fill this field with a - '0' to indicate their being open for all other hosts to connect to - them and enforce connection level server behavior this way. It is - not possible for an application-level server to restrict its - availability to one remote host by entering a host name here. - Application-level clients must enter a name different from '0'. - The name can be either symbolic (e.g., 'jpl-devvax.jpl.nasa.gov') - or numeric (e.g., '128.149.1.143'). - -REMOTEPORT - Determines which port on the remote machine is used to communicate - across the network. For '/inet/tcp' and '/inet/udp', - application-level clients _must_ use a number other than '0' to - indicate to which port on the remote machine they want to connect. - Application-level servers must not fill this field with a '0'. - Instead they specify a local port to which clients connect. It is - possible to use a name from '/etc/services' here. - - Experts in network programming will notice that the usual -client/server asymmetry found at the level of the socket API is not -visible here. This is for the sake of simplicity of the high-level -concept. If this asymmetry is necessary for your application, use -another language. For 'gawk', it is more important to enable users to -write a client program with a minimum of code. What happens when first -accessing a network connection is seen in the following pseudocode: - - if ((name of remote host given) && (other side accepts connection)) { - rendez-vous successful; transmit with getline or print - } else { - if ((other side did not accept) && (localport == 0)) - exit unsuccessful - if (TCP) { - set up a server accepting connections - this means waiting for the client on the other side to connect - } else - ready - } - - The exact behavior of this algorithm depends on the values of the -fields of the special file name. When in doubt, *note Table 2.1: -table-inet-components. gives you the combinations of values and their -meaning. If this table is too complicated, focus on the three lines -printed in *bold*. All the examples in *note Networking With 'gawk': -Using Networking, use only the patterns printed in bold letters. - -PROTOCOL LOCAL HOST NAME REMOTE RESULTING CONNECTION-LEVEL - PORT PORT BEHAVIOR ------------------------------------------------------------------------------- -*tcp* *0* *x* *x* *Dedicated client, fails if - immediately connecting to a - server on the other side - fails* -udp 0 x x Dedicated client -*tcp, *x* *x* *x* *Client, switches to -udp* dedicated server if - necessary* -*tcp, *x* *0* *0* *Dedicated server* -udp* -tcp, udp x x 0 Invalid -tcp, udp 0 0 x Invalid -tcp, udp x 0 x Invalid -tcp, udp 0 0 0 Invalid -tcp, udp 0 x 0 Invalid - -Table 2.1: /inet Special File Components - - In general, TCP is the preferred mechanism to use. It is the -simplest protocol to understand and to use. Use UDP only if -circumstances demand low-overhead. - - -File: gawkinet.info, Node: Comparing Protocols, Prev: Special File Fields, Up: Gawk Special Files - -2.1.2 Comparing Protocols -------------------------- - -This node develops a pair of programs (sender and receiver) that do -nothing but send a timestamp from one machine to another. The sender -and the receiver are implemented with each of the two protocols -available and demonstrate the differences between them. - -* Menu: - -* File /inet/tcp:: The TCP special file. -* File /inet/udp:: The UDP special file. - - -File: gawkinet.info, Node: File /inet/tcp, Next: File /inet/udp, Prev: Comparing Protocols, Up: Comparing Protocols - -2.1.2.1 '/inet/tcp' -................... - -Once again, always use TCP. (Use UDP when low overhead is a necessity, -and use RAW for network experimentation.) The first example is the -sender program: - - # Server - BEGIN { - print strftime() |& "/inet/tcp/8888/0/0" - close("/inet/tcp/8888/0/0") - } - - The receiver is very simple: - - # Client - BEGIN { - "/inet/tcp/0/localhost/8888" |& getline - print $0 - close("/inet/tcp/0/localhost/8888") - } - - TCP guarantees that the bytes arrive at the receiving end in exactly -the same order that they were sent. No byte is lost (except for broken -connections), doubled, or out of order. Some overhead is necessary to -accomplish this, but this is the price to pay for a reliable service. -It does matter which side starts first. The sender/server has to be -started first, and it waits for the receiver to read a line. - - -File: gawkinet.info, Node: File /inet/udp, Prev: File /inet/tcp, Up: Comparing Protocols - -2.1.2.2 '/inet/udp' -................... - -The server and client programs that use UDP are almost identical to -their TCP counterparts; only the PROTOCOL has changed. As before, it -does matter which side starts first. The receiving side blocks and -waits for the sender. In this case, the receiver/client has to be -started first: - - # Server - BEGIN { - print strftime() |& "/inet/udp/8888/0/0" - close("/inet/udp/8888/0/0") - } - - The receiver is almost identical to the TCP receiver: - - # Client - BEGIN { - print "hi!" |& "/inet/udp/0/localhost/8888" - "/inet/udp/0/localhost/8888" |& getline - print $0 - close("/inet/udp/0/localhost/8888") - } - - In the case of UDP, the initial 'print' command is the one that -actually sends data so that there is a connection. UDP and "connection" -sounds strange to anyone who has learned that UDP is a connectionless -protocol. Here, "connection" means that the 'connect()' system call has -completed its work and completed the "association" between a certain -socket and an IP address. Thus there are subtle differences between -'connect()' for TCP and UDP; see the man page for details.(1) - - UDP cannot guarantee that the datagrams at the receiving end will -arrive in exactly the same order they were sent. Some datagrams could -be lost, some doubled, and some out of order. But no overhead is -necessary to accomplish this. This unreliable behavior is good enough -for tasks such as data acquisition, logging, and even stateless services -like the original versions of NFS. - - ---------- Footnotes ---------- - - (1) This subtlety is just one of many details that are hidden in the -socket API, invisible and intractable for the 'gawk' user. The -developers are currently considering how to rework the network -facilities to make them easier to understand and use. - - -File: gawkinet.info, Node: TCP Connecting, Next: Troubleshooting, Prev: Gawk Special Files, Up: Using Networking - -2.2 Establishing a TCP Connection -================================= - -Let's observe a network connection at work. Type in the following -program and watch the output. Within a second, it connects via TCP -('/inet/tcp') to the machine it is running on ('localhost') and asks the -service 'daytime' on the machine what time it is: - - BEGIN { - "/inet/tcp/0/localhost/daytime" |& getline - print $0 - close("/inet/tcp/0/localhost/daytime") - } - - Even experienced 'awk' users will find the second line strange in two -respects: - - * A special file is used as a shell command that pipes its output - into 'getline'. One would rather expect to see the special file - being read like any other file ('getline < - "/inet/tcp/0/localhost/daytime")'. - - * The operator '|&' has not been part of any 'awk' implementation - (until now). It is actually the only extension of the 'awk' - language needed (apart from the special files) to introduce network - access. - - The '|&' operator was introduced in 'gawk' 3.1 in order to overcome -the crucial restriction that access to files and pipes in 'awk' is -always unidirectional. It was formerly impossible to use both access -modes on the same file or pipe. Instead of changing the whole concept -of file access, the '|&' operator behaves exactly like the usual pipe -operator except for two additions: - - * Normal shell commands connected to their 'gawk' program with a '|&' - pipe can be accessed bidirectionally. The '|&' turns out to be a - quite general, useful, and natural extension of 'awk'. - - * Pipes that consist of a special file name for network connections - are not executed as shell commands. Instead, they can be read and - written to, just like a full-duplex network connection. - - In the earlier example, the '|&' operator tells 'getline' to read a -line from the special file '/inet/tcp/0/localhost/daytime'. We could -also have printed a line into the special file. But instead we just -read a line with the time, printed it, and closed the connection. -(While we could just let 'gawk' close the connection by finishing the -program, in this Info file we are pedantic and always explicitly close -the connections.) - - -File: gawkinet.info, Node: Troubleshooting, Next: Interacting, Prev: TCP Connecting, Up: Using Networking - -2.3 Troubleshooting Connection Problems -======================================= - -It may well be that for some reason the program shown in the previous -example does not run on your machine. When looking at possible reasons -for this, you will learn much about typical problems that arise in -network programming. First of all, your implementation of 'gawk' may -not support network access because it is a pre-3.1 version or you do not -have a network interface in your machine. Perhaps your machine uses -some other protocol, such as DECnet or Novell's IPX. For the rest of -this major node, we will assume you work on a Unix machine that supports -TCP/IP. If the previous example program does not run on your machine, it -may help to replace the name 'localhost' with the name of your machine -or its IP address. If it does, you could replace 'localhost' with the -name of another machine in your vicinity--this way, the program connects -to another machine. Now you should see the date and time being printed -by the program, otherwise your machine may not support the 'daytime' -service. Try changing the service to 'chargen' or 'ftp'. This way, the -program connects to other services that should give you some response. -If you are curious, you should have a look at your '/etc/services' file. -It could look like this: - - # /etc/services: - # - # Network services, Internet style - # - # Name Number/Protocol Alternate name # Comments - - echo 7/tcp - echo 7/udp - discard 9/tcp sink null - discard 9/udp sink null - daytime 13/tcp - daytime 13/udp - chargen 19/tcp ttytst source - chargen 19/udp ttytst source - ftp 21/tcp - telnet 23/tcp - smtp 25/tcp mail - finger 79/tcp - www 80/tcp http # WorldWideWeb HTTP - www 80/udp # HyperText Transfer Protocol - pop-2 109/tcp postoffice # POP version 2 - pop-2 109/udp - pop-3 110/tcp # POP version 3 - pop-3 110/udp - nntp 119/tcp readnews untp # USENET News - irc 194/tcp # Internet Relay Chat - irc 194/udp - ... - - Here, you find a list of services that traditional Unix machines -usually support. If your GNU/Linux machine does not do so, it may be -that these services are switched off in some startup script. Systems -running some flavor of Microsoft Windows usually do _not_ support these -services. Nevertheless, it _is_ possible to do networking with 'gawk' -on Microsoft Windows.(1) The first column of the file gives the name of -the service, and the second column gives a unique number and the -protocol that one can use to connect to this service. The rest of the -line is treated as a comment. You see that some services ('echo') -support TCP as well as UDP. - - ---------- Footnotes ---------- - - (1) Microsoft preferred to ignore the TCP/IP family of protocols -until 1995. Then came the rise of the Netscape browser as a landmark -"killer application." Microsoft added TCP/IP support and their own -browser to Microsoft Windows 95 at the last minute. They even -back-ported their TCP/IP implementation to Microsoft Windows for -Workgroups 3.11, but it was a rather rudimentary and half-hearted -implementation. Nevertheless, the equivalent of '/etc/services' resides -under 'C:\WINNT\system32\drivers\etc\services' on Microsoft Windows 2000 -and Microsoft Windows XP. - - -File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking - -2.4 Interacting with a Network Service -====================================== - -The next program makes use of the possibility to really interact with a -network service by printing something into the special file. It asks -the so-called 'finger' service if a user of the machine is logged in. -When testing this program, try to change 'localhost' to some other -machine name in your local network: - - BEGIN { - NetService = "/inet/tcp/0/localhost/finger" - print "NAME" |& NetService - while ((NetService |& getline) > 0) - print $0 - close(NetService) - } - - After telling the service on the machine which user to look for, the -program repeatedly reads lines that come as a reply. When no more lines -are coming (because the service has closed the connection), the program -also closes the connection. Try replacing '"NAME"' with your login name -(or the name of someone else logged in). For a list of all users -currently logged in, replace NAME with an empty string ('""'). - - The final 'close()' command could be safely deleted from the above -script, because the operating system closes any open connection by -default when a script reaches the end of execution. In order to avoid -portability problems, it is best to always close connections explicitly. -With the Linux kernel, for example, proper closing results in flushing -of buffers. Letting the close happen by default may result in -discarding buffers. - - When looking at '/etc/services' you may have noticed that the -'daytime' service is also available with 'udp'. In the earlier example, -change 'tcp' to 'udp', and change 'finger' to 'daytime'. After starting -the modified program, you see the expected day and time message. The -program then hangs, because it waits for more lines coming from the -service. However, they never come. This behavior is a consequence of -the differences between TCP and UDP. When using UDP, neither party is -automatically informed about the other closing the connection. -Continuing to experiment this way reveals many other subtle differences -between TCP and UDP. To avoid such trouble, one should always remember -the advice Douglas E. Comer and David Stevens give in Volume III of -their series 'Internetworking With TCP' (page 14): - - When designing client-server applications, beginners are strongly - advised to use TCP because it provides reliable, - connection-oriented communication. Programs only use UDP if the - application protocol handles reliability, the application requires - hardware broadcast or multicast, or the application cannot tolerate - virtual circuit overhead. - - -File: gawkinet.info, Node: Setting Up, Next: Email, Prev: Interacting, Up: Using Networking - -2.5 Setting Up a Service -======================== - -The preceding programs behaved as clients that connect to a server -somewhere on the Internet and request a particular service. Now we set -up such a service to mimic the behavior of the 'daytime' service. Such -a server does not know in advance who is going to connect to it over the -network. Therefore, we cannot insert a name for the host to connect to -in our special file name. - - Start the following program in one window. Notice that the service -does not have the name 'daytime', but the number '8888'. From looking -at '/etc/services', you know that names like 'daytime' are just -mnemonics for predetermined 16-bit integers. Only the system -administrator ('root') could enter our new service into '/etc/services' -with an appropriate name. Also notice that the service name has to be -entered into a different field of the special file name because we are -setting up a server, not a client: - - BEGIN { - print strftime() |& "/inet/tcp/8888/0/0" - close("/inet/tcp/8888/0/0") - } - - Now open another window on the same machine. Copy the client program -given as the first example (*note Establishing a TCP Connection: TCP -Connecting.) to a new file and edit it, changing the name 'daytime' to -'8888'. Then start the modified client. You should get a reply like -this: - - Sat Sep 27 19:08:16 CEST 1997 - -Both programs explicitly close the connection. - - Now we will intentionally make a mistake to see what happens when the -name '8888' (the so-called port) is already used by another service. -Start the server program in both windows. The first one works, but the -second one complains that it could not open the connection. Each port -on a single machine can only be used by one server program at a time. -Now terminate the server program and change the name '8888' to 'echo'. -After restarting it, the server program does not run any more, and you -know why: there is already an 'echo' service running on your machine. -But even if this isn't true, you would not get your own 'echo' server -running on a Unix machine, because the ports with numbers smaller than -1024 ('echo' is at port 7) are reserved for 'root'. On machines running -some flavor of Microsoft Windows, there is no restriction that reserves -ports 1 to 1024 for a privileged user; hence, you can start an 'echo' -server there. - - Turning this short server program into something really useful is -simple. Imagine a server that first reads a file name from the client -through the network connection, then does something with the file and -sends a result back to the client. The server-side processing could be: - - BEGIN { - NetService = "/inet/tcp/8888/0/0" - NetService |& getline - CatPipe = ("cat " $1) # sets $0 and the fields - while ((CatPipe | getline) > 0) - print $0 |& NetService - close(NetService) - } - -and we would have a remote copying facility. Such a server reads the -name of a file from any client that connects to it and transmits the -contents of the named file across the net. The server-side processing -could also be the execution of a command that is transmitted across the -network. From this example, you can see how simple it is to open up a -security hole on your machine. If you allow clients to connect to your -machine and execute arbitrary commands, anyone would be free to do 'rm --rf *'. - - -File: gawkinet.info, Node: Email, Next: Web page, Prev: Setting Up, Up: Using Networking - -2.6 Reading Email -================= - -The distribution of email is usually done by dedicated email servers -that communicate with your machine using special protocols. To receive -email, we will use the Post Office Protocol (POP). Sending can be done -with the much older Simple Mail Transfer Protocol (SMTP). - - When you type in the following program, replace the EMAILHOST by the -name of your local email server. Ask your administrator if the server -has a POP service, and then use its name or number in the program below. -Now the program is ready to connect to your email server, but it will -not succeed in retrieving your mail because it does not yet know your -login name or password. Replace them in the program and it shows you -the first email the server has in store: - - BEGIN { - POPService = "/inet/tcp/0/EMAILHOST/pop3" - RS = ORS = "\r\n" - print "user NAME" |& POPService - POPService |& getline - print "pass PASSWORD" |& POPService - POPService |& getline - print "retr 1" |& POPService - POPService |& getline - if ($1 != "+OK") exit - print "quit" |& POPService - RS = "\r\n\\.\r\n" - POPService |& getline - print $0 - close(POPService) - } - - The record separators 'RS' and 'ORS' are redefined because the -protocol (POP) requires CR-LF to separate lines. After identifying -yourself to the email service, the command 'retr 1' instructs the -service to send the first of all your email messages in line. If the -service replies with something other than '+OK', the program exits; -maybe there is no email. Otherwise, the program first announces that it -intends to finish reading email, and then redefines 'RS' in order to -read the entire email as multiline input in one record. From the POP -RFC, we know that the body of the email always ends with a single line -containing a single dot. The program looks for this using 'RS = -"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it -quits. You can invoke this program as often as you like; it does not -delete the message it reads, but instead leaves it on the server. - - -File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking - -2.7 Reading a Web Page -====================== - -Retrieving a web page from a web server is as simple as retrieving email -from an email server. We only have to use a similar, but not identical, -protocol and a different port. The name of the protocol is HyperText -Transfer Protocol (HTTP) and the port number is usually 80. As in the -preceding node, ask your administrator about the name of your local web -server or proxy web server and its port number for HTTP requests. - - The following program employs a rather crude approach toward -retrieving a web page. It uses the prehistoric syntax of HTTP 0.9, -which almost all web servers still support. The most noticeable thing -about it is that the program directs the request to the local proxy -server whose name you insert in the special file name (which in turn -calls 'www.yahoo.com'): - - BEGIN { - RS = ORS = "\r\n" - HttpService = "/inet/tcp/0/PROXY/80" - print "GET http://www.yahoo.com" |& HttpService - while ((HttpService |& getline) > 0) - print $0 - close(HttpService) - } - - Again, lines are separated by a redefined 'RS' and 'ORS'. The 'GET' -request that we send to the server is the only kind of HTTP request that -existed when the web was created in the early 1990s. HTTP calls this -'GET' request a "method," which tells the service to transmit a web page -(here the home page of the Yahoo! search engine). Version 1.0 added -the request methods 'HEAD' and 'POST'. The current version of HTTP is -1.1,(1) and knows the additional request methods 'OPTIONS', 'PUT', -'DELETE', and 'TRACE'. You can fill in any valid web address, and the -program prints the HTML code of that page to your screen. - - Notice the similarity between the responses of the POP and HTTP -services. First, you get a header that is terminated by an empty line, -and then you get the body of the page in HTML. The lines of the headers -also have the same form as in POP. There is the name of a parameter, -then a colon, and finally the value of that parameter. - - Images ('.png' or '.gif' files) can also be retrieved this way, but -then you get binary data that should be redirected into a file. Another -application is calling a CGI (Common Gateway Interface) script on some -server. CGI scripts are used when the contents of a web page are not -constant, but generated instantly at the moment you send a request for -the page. For example, to get a detailed report about the current -quotes of Motorola stock shares, call a CGI script at Yahoo! with the -following: - - get = "GET http://quote.yahoo.com/q?s=MOT&d=t" - print get |& HttpService - - You can also request weather reports this way. - - ---------- Footnotes ---------- - - (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was -initially specified in RFC 2068. In June 1999, RFC 2068 was made -obsolete by RFC 2616, an update without any substantial changes. - - -File: gawkinet.info, Node: Primitive Service, Next: Interacting Service, Prev: Web page, Up: Using Networking - -2.8 A Primitive Web Service -=========================== - -Now we know enough about HTTP to set up a primitive web service that -just says '"Hello, world"' when someone connects to it with a browser. -Compared to the situation in the preceding node, our program changes the -role. It tries to behave just like the server we have observed. Since -we are setting up a server here, we have to insert the port number in -the 'localport' field of the special file name. The other two fields -(HOSTNAME and REMOTEPORT) have to contain a '0' because we do not know -in advance which host will connect to our service. - - In the early 1990s, all a server had to do was send an HTML document -and close the connection. Here, we adhere to the modern syntax of HTTP. -The steps are as follows: - - 1. Send a status line telling the web browser that everything is okay. - - 2. Send a line to tell the browser how many bytes follow in the body - of the message. This was not necessary earlier because both - parties knew that the document ended when the connection closed. - Nowadays it is possible to stay connected after the transmission of - one web page. This is to avoid the network traffic necessary for - repeatedly establishing TCP connections for requesting several - images. Thus, there is the need to tell the receiving party how - many bytes will be sent. The header is terminated as usual with an - empty line. - - 3. Send the '"Hello, world"' body in HTML. The useless 'while' loop - swallows the request of the browser. We could actually omit the - loop, and on most machines the program would still work. First, - start the following program: - - BEGIN { - RS = ORS = "\r\n" - HttpService = "/inet/tcp/8080/0/0" - Hello = "" \ - "A Famous Greeting" \ - "

Hello, world

" - Len = length(Hello) + length(ORS) - print "HTTP/1.0 200 OK" |& HttpService - print "Content-Length: " Len ORS |& HttpService - print Hello |& HttpService - while ((HttpService |& getline) > 0) - continue; - close(HttpService) - } - - Now, on the same machine, start your favorite browser and let it -point to (the browser needs to know on which -port our server is listening for requests). If this does not work, the -browser probably tries to connect to a proxy server that does not know -your machine. If so, change the browser's configuration so that the -browser does not try to use a proxy to connect to your machine. - - -File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking - -2.9 A Web Service with Interaction -================================== - -This node shows how to set up a simple web server. The subnode is a -library file that we will use with all the examples in *note Some -Applications and Techniques::. - -* Menu: - -* CGI Lib:: A simple CGI library. - - Setting up a web service that allows user interaction is more -difficult and shows us the limits of network access in 'gawk'. In this -node, we develop a main program (a 'BEGIN' pattern and its action) that -will become the core of event-driven execution controlled by a graphical -user interface (GUI). Each HTTP event that the user triggers by some -action within the browser is received in this central procedure. -Parameters and menu choices are extracted from this request, and an -appropriate measure is taken according to the user's choice. For -example: - - BEGIN { - if (MyHost == "") { - "uname -n" | getline MyHost - close("uname -n") - } - if (MyPort == 0) MyPort = 8080 - HttpService = "/inet/tcp/" MyPort "/0/0" - MyPrefix = "http://" MyHost ":" MyPort - SetUpServer() - while ("awk" != "complex") { - # header lines are terminated this way - RS = ORS = "\r\n" - Status = 200 # this means OK - Reason = "OK" - Header = TopHeader - Document = TopDoc - Footer = TopFooter - if (GETARG["Method"] == "GET") { - HandleGET() - } else if (GETARG["Method"] == "HEAD") { - # not yet implemented - } else if (GETARG["Method"] != "") { - print "bad method", GETARG["Method"] - } - Prompt = Header Document Footer - print "HTTP/1.0", Status, Reason |& HttpService - print "Connection: Close" |& HttpService - print "Pragma: no-cache" |& HttpService - len = length(Prompt) + length(ORS) - print "Content-length:", len |& HttpService - print ORS Prompt |& HttpService - # ignore all the header lines - while ((HttpService |& getline) > 0) - ; - # stop talking to this client - close(HttpService) - # wait for new client request - HttpService |& getline - # do some logging - print systime(), strftime(), $0 - # read request parameters - CGI_setup($1, $2, $3) - } - } - - This web server presents menu choices in the form of HTML links. -Therefore, it has to tell the browser the name of the host it is -residing on. When starting the server, the user may supply the name of -the host from the command line with 'gawk -v MyHost="Rumpelstilzchen"'. -If the user does not do this, the server looks up the name of the host -it is running on for later use as a web address in HTML documents. The -same applies to the port number. These values are inserted later into -the HTML content of the web pages to refer to the home system. - - Each server that is built around this core has to initialize some -application-dependent variables (such as the default home page) in a -procedure 'SetUpServer()', which is called immediately before entering -the infinite loop of the server. For now, we will write an instance -that initiates a trivial interaction. With this home page, the client -user can click on two possible choices, and receive the current date -either in human-readable format or in seconds since 1970: - - function SetUpServer() { - TopHeader = "" - TopHeader = TopHeader \ - "My name is GAWK, GNU AWK" - TopDoc = "

\ - Do you prefer your date human or \ - POSIXed?

" ORS ORS - TopFooter = "" - } - - On the first run through the main loop, the default line terminators -are set and the default home page is copied to the actual home page. -Since this is the first run, 'GETARG["Method"]' is not initialized yet, -hence the case selection over the method does nothing. Now that the -home page is initialized, the server can start communicating to a client -browser. - - It does so by printing the HTTP header into the network connection -('print ... |& HttpService'). This command blocks execution of the -server script until a client connects. If this server script is -compared with the primitive one we wrote before, you will notice two -additional lines in the header. The first instructs the browser to -close the connection after each request. The second tells the browser -that it should never try to _remember_ earlier requests that had -identical web addresses (no caching). Otherwise, it could happen that -the browser retrieves the time of day in the previous example just once, -and later it takes the web page from the cache, always displaying the -same time of day although time advances each second. - - Having supplied the initial home page to the browser with a valid -document stored in the parameter 'Prompt', it closes the connection and -waits for the next request. When the request comes, a log line is -printed that allows us to see which request the server receives. The -final step in the loop is to call the function 'CGI_setup()', which -reads all the lines of the request (coming from the browser), processes -them, and stores the transmitted parameters in the array 'PARAM'. The -complete text of these application-independent functions can be found in -*note A Simple CGI Library: CGI Lib. For now, we use a simplified -version of 'CGI_setup()': - - function CGI_setup( method, uri, version, i) { - delete GETARG; delete MENU; delete PARAM - GETARG["Method"] = $1 - GETARG["URI"] = $2 - GETARG["Version"] = $3 - i = index($2, "?") - # is there a "?" indicating a CGI request? - if (i > 0) { - split(substr($2, 1, i-1), MENU, "[/:]") - split(substr($2, i+1), PARAM, "&") - for (i in PARAM) { - j = index(PARAM[i], "=") - GETARG[substr(PARAM[i], 1, j-1)] = \ - substr(PARAM[i], j+1) - } - } else { # there is no "?", no need for splitting PARAMs - split($2, MENU, "[/:]") - } - } - - At first, the function clears all variables used for global storage -of request parameters. The rest of the function serves the purpose of -filling the global parameters with the extracted new values. To -accomplish this, the name of the requested resource is split into parts -and stored for later evaluation. If the request contains a '?', then -the request has CGI variables seamlessly appended to the web address. -Everything in front of the '?' is split up into menu items, and -everything behind the '?' is a list of 'VARIABLE=VALUE' pairs (separated -by '&') that also need splitting. This way, CGI variables are isolated -and stored. This procedure lacks recognition of special characters that -are transmitted in coded form(1). Here, any optional request header and -body parts are ignored. We do not need header parameters and the -request body. However, when refining our approach or working with the -'POST' and 'PUT' methods, reading the header and body becomes -inevitable. Header parameters should then be stored in a global array -as well as the body. - - On each subsequent run through the main loop, one request from a -browser is received, evaluated, and answered according to the user's -choice. This can be done by letting the value of the HTTP method guide -the main loop into execution of the procedure 'HandleGET()', which -evaluates the user's choice. In this case, we have only one -hierarchical level of menus, but in the general case, menus are nested. -The menu choices at each level are separated by '/', just as in file -names. Notice how simple it is to construct menus of arbitrary depth: - - function HandleGET() { - if ( MENU[2] == "human") { - Footer = strftime() TopFooter - } else if (MENU[2] == "POSIX") { - Footer = systime() TopFooter - } - } - - The disadvantage of this approach is that our server is slow and can -handle only one request at a time. Its main advantage, however, is that -the server consists of just one 'gawk' program. No need for installing -an 'httpd', and no need for static separate HTML files, CGI scripts, or -'root' privileges. This is rapid prototyping. This program can be -started on the same host that runs your browser. Then let your browser -point to . - - It is also possible to include images into the HTML pages. Most -browsers support the not very well-known '.xbm' format, which may -contain only monochrome pictures but is an ASCII format. Binary images -are possible but not so easy to handle. Another way of including images -is to generate them with a tool such as GNUPlot, by calling the tool -with the 'system()' function or through a pipe. - - ---------- Footnotes ---------- - - (1) As defined in RFC 2068. - - -File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service - -2.9.1 A Simple CGI Library --------------------------- - - HTTP is like being married: you have to be able to handle whatever - you're given, while being very careful what you send back. - Phil Smith III, - - - In *note A Web Service with Interaction: Interacting Service, we saw -the function 'CGI_setup()' as part of the web server "core logic" -framework. The code presented there handles almost everything necessary -for CGI requests. One thing it doesn't do is handle encoded characters -in the requests. For example, an '&' is encoded as a percent sign -followed by the hexadecimal value: '%26'. These encoded values should -be decoded. Following is a simple library to perform these tasks. This -code is used for all web server examples used throughout the rest of -this Info file. If you want to use it for your own web server, store -the source code into a file named 'inetlib.awk'. Then you can include -these functions into your code by placing the following statement into -your program (on the first line of your script): - - @include inetlib.awk - -But beware, this mechanism is only possible if you invoke your web -server script with 'igawk' instead of the usual 'awk' or 'gawk'. Here -is the code: - - # CGI Library and core of a web server - # Global arrays - # GETARG --- arguments to CGI GET command - # MENU --- menu items (path names) - # PARAM --- parameters of form x=y - - # Optional variable MyHost contains host address - # Optional variable MyPort contains port number - # Needs TopHeader, TopDoc, TopFooter - # Sets MyPrefix, HttpService, Status, Reason - - BEGIN { - if (MyHost == "") { - "uname -n" | getline MyHost - close("uname -n") - } - if (MyPort == 0) MyPort = 8080 - HttpService = "/inet/tcp/" MyPort "/0/0" - MyPrefix = "http://" MyHost ":" MyPort - SetUpServer() - while ("awk" != "complex") { - # header lines are terminated this way - RS = ORS = "\r\n" - Status = 200 # this means OK - Reason = "OK" - Header = TopHeader - Document = TopDoc - Footer = TopFooter - if (GETARG["Method"] == "GET") { - HandleGET() - } else if (GETARG["Method"] == "HEAD") { - # not yet implemented - } else if (GETARG["Method"] != "") { - print "bad method", GETARG["Method"] - } - Prompt = Header Document Footer - print "HTTP/1.0", Status, Reason |& HttpService - print "Connection: Close" |& HttpService - print "Pragma: no-cache" |& HttpService - len = length(Prompt) + length(ORS) - print "Content-length:", len |& HttpService - print ORS Prompt |& HttpService - # ignore all the header lines - while ((HttpService |& getline) > 0) - continue - # stop talking to this client - close(HttpService) - # wait for new client request - HttpService |& getline - # do some logging - print systime(), strftime(), $0 - CGI_setup($1, $2, $3) - } - } - - function CGI_setup( method, uri, version, i) - { - delete GETARG - delete MENU - delete PARAM - GETARG["Method"] = method - GETARG["URI"] = uri - GETARG["Version"] = version - - i = index(uri, "?") - if (i > 0) { # is there a "?" indicating a CGI request? - split(substr(uri, 1, i-1), MENU, "[/:]") - split(substr(uri, i+1), PARAM, "&") - for (i in PARAM) { - PARAM[i] = _CGI_decode(PARAM[i]) - j = index(PARAM[i], "=") - GETARG[substr(PARAM[i], 1, j-1)] = \ - substr(PARAM[i], j+1) - } - } else { # there is no "?", no need for splitting PARAMs - split(uri, MENU, "[/:]") - } - for (i in MENU) # decode characters in path - if (i > 4) # but not those in host name - MENU[i] = _CGI_decode(MENU[i]) - } - - This isolates details in a single function, 'CGI_setup()'. Decoding -of encoded characters is pushed off to a helper function, -'_CGI_decode()'. The use of the leading underscore ('_') in the -function name is intended to indicate that it is an "internal" function, -although there is nothing to enforce this: - - function _CGI_decode(str, hexdigs, i, pre, code1, code2, - val, result) - { - hexdigs = "123456789abcdef" - - i = index(str, "%") - if (i == 0) # no work to do - return str - - do { - pre = substr(str, 1, i-1) # part before %xx - code1 = substr(str, i+1, 1) # first hex digit - code2 = substr(str, i+2, 1) # second hex digit - str = substr(str, i+3) # rest of string - - code1 = tolower(code1) - code2 = tolower(code2) - val = index(hexdigs, code1) * 16 \ - + index(hexdigs, code2) - - result = result pre sprintf("%c", val) - i = index(str, "%") - } while (i != 0) - if (length(str) > 0) - result = result str - return result - } - - This works by splitting the string apart around an encoded character. -The two digits are converted to lowercase characters and looked up in a -string of hex digits. Note that '0' is not in the string on purpose; -'index()' returns zero when it's not found, automatically giving the -correct value! Once the hexadecimal value is converted from characters -in a string into a numerical value, 'sprintf()' converts the value back -into a real character. The following is a simple test harness for the -above functions: - - BEGIN { - CGI_setup("GET", - "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ - "&percent=a %25 sign", - "1.0") - for (i in MENU) - printf "MENU[\"%s\"] = %s\n", i, MENU[i] - for (i in PARAM) - printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] - for (i in GETARG) - printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] - } - - And this is the result when we run it: - - $ gawk -f testserv.awk - -| MENU["4"] = www.gnu.org - -| MENU["5"] = cgi-bin - -| MENU["6"] = foo - -| MENU["1"] = http - -| MENU["2"] = - -| MENU["3"] = - -| PARAM["1"] = p1=stuff - -| PARAM["2"] = p2=stuff&junk - -| PARAM["3"] = percent=a % sign - -| GETARG["p1"] = stuff - -| GETARG["percent"] = a % sign - -| GETARG["p2"] = stuff&junk - -| GETARG["Method"] = GET - -| GETARG["Version"] = 1.0 - -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff& - p2=stuff%26junk&percent=a %25 sign - - -File: gawkinet.info, Node: Simple Server, Next: Caveats, Prev: Interacting Service, Up: Using Networking - -2.10 A Simple Web Server -======================== - -In the preceding node, we built the core logic for event-driven GUIs. -In this node, we finally extend the core to a real application. No one -would actually write a commercial web server in 'gawk', but it is -instructive to see that it is feasible in principle. - - The application is ELIZA, the famous program by Joseph Weizenbaum -that mimics the behavior of a professional psychotherapist when talking -to you. Weizenbaum would certainly object to this description, but this -is part of the legend around ELIZA. Take the site-independent core logic -and append the following code: - - function SetUpServer() { - SetUpEliza() - TopHeader = \ - "An HTTP-based System with GAWK\ - \ - " - TopDoc = "\ -

Please choose one of the following actions:

\ -
" - TopFooter = "" - } - - 'SetUpServer()' is similar to the previous example, except for -calling another function, 'SetUpEliza()'. This approach can be used to -implement other kinds of servers. The only changes needed to do so are -hidden in the functions 'SetUpServer()' and 'HandleGET()'. Perhaps it -might be necessary to implement other HTTP methods. The 'igawk' program -that comes with 'gawk' may be useful for this process. - - When extending this example to a complete application, the first -thing to do is to implement the function 'SetUpServer()' to initialize -the HTML pages and some variables. These initializations determine the -way your HTML pages look (colors, titles, menu items, etc.). - - The function 'HandleGET()' is a nested case selection that decides -which page the user wants to see next. Each nesting level refers to a -menu level of the GUI. Each case implements a certain action of the -menu. On the deepest level of case selection, the handler essentially -knows what the user wants and stores the answer into the variable that -holds the HTML page contents: - - function HandleGET() { - # A real HTTP server would treat some parts of the URI as a file name. - # We take parts of the URI as menu choices and go on accordingly. - if(MENU[2] == "AboutServer") { - Document = "This is not a CGI script.\ - This is an httpd, an HTML file, and a CGI script all \ - in one GAWK script. It needs no separate www-server, \ - no installation, and no root privileges.\ -

To run it, do this:

    \ -
  • start this script with \"gawk -f httpserver.awk\",
  • \ -
  • and on the same host let your www browser open location\ - \"http://localhost:8080\"
  • \ -
\

\ Details of HTTP come from:

    \ -
  • Hethmon: Illustrated Guide to HTTP

    \ -
  • RFC 2068

JK 14.9.1997

" - } else if (MENU[2] == "AboutELIZA") { - Document = "This is an implementation of the famous ELIZA\ - program by Joseph Weizenbaum. It is written in GAWK and\ - uses an HTML GUI." - } else if (MENU[2] == "StartELIZA") { - gsub(/\+/, " ", GETARG["YouSay"]) - # Here we also have to substitute coded special characters - Document = "
" \ - "

" ElizaSays(GETARG["YouSay"]) "

\ -

\ -

" - } - } - - Now we are down to the heart of ELIZA, so you can see how it works. -Initially the user does not say anything; then ELIZA resets its money -counter and asks the user to tell what comes to mind open heartedly. -The subsequent answers are converted to uppercase characters and stored -for later comparison. ELIZA presents the bill when being confronted -with a sentence that contains the phrase "shut up." Otherwise, it looks -for keywords in the sentence, conjugates the rest of the sentence, -remembers the keyword for later use, and finally selects an answer from -the set of possible answers: - - function ElizaSays(YouSay) { - if (YouSay == "") { - cost = 0 - answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" - } else { - q = toupper(YouSay) - gsub("'", "", q) - if(q == qold) { - answer = "PLEASE DONT REPEAT YOURSELF !" - } else { - if (index(q, "SHUT UP") > 0) { - answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ - int(100*rand()+30+cost/100) - } else { - qold = q - w = "-" # no keyword recognized yet - for (i in k) { # search for keywords - if (index(q, i) > 0) { - w = i - break - } - } - if (w == "-") { # no keyword, take old subject - w = wold - subj = subjold - } else { # find subject - subj = substr(q, index(q, w) + length(w)+1) - wold = w - subjold = subj # remember keyword and subject - } - for (i in conj) - gsub(i, conj[i], q) # conjugation - # from all answers to this keyword, select one randomly - answer = r[indices[int(split(k[w], indices) * rand()) + 1]] - # insert subject into answer - gsub("_", subj, answer) - } - } - } - cost += length(answer) # for later payment : 1 cent per character - return answer - } - - In the long but simple function 'SetUpEliza()', you can see tables -for conjugation, keywords, and answers.(1) The associative array 'k' -contains indices into the array of answers 'r'. To choose an answer, -ELIZA just picks an index randomly: - - function SetUpEliza() { - srand() - wold = "-" - subjold = " " - - # table for conjugation - conj[" ARE " ] = " AM " - conj["WERE " ] = "WAS " - conj[" YOU " ] = " I " - conj["YOUR " ] = "MY " - conj[" IVE " ] =\ - conj[" I HAVE " ] = " YOU HAVE " - conj[" YOUVE " ] =\ - conj[" YOU HAVE "] = " I HAVE " - conj[" IM " ] =\ - conj[" I AM " ] = " YOU ARE " - conj[" YOURE " ] =\ - conj[" YOU ARE " ] = " I AM " - - # table of all answers - r[1] = "DONT YOU BELIEVE THAT I CAN _" - r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" - ... - - # table for looking up answers that - # fit to a certain keyword - k["CAN YOU"] = "1 2 3" - k["CAN I"] = "4 5" - k["YOU ARE"] =\ - k["YOURE"] = "6 7 8 9" - ... - } - - Some interesting remarks and details (including the original source -code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has -a page with a collection of ELIZA-like programs. Many of them are -written in Java, some of them disclosing the Java source code, and a few -even explain how to modify the Java source code. - - ---------- Footnotes ---------- - - (1) The version shown here is abbreviated. The full version comes -with the 'gawk' distribution. - - -File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking - -2.11 Network Programming Caveats -================================ - -By now it should be clear that debugging a networked application is more -complicated than debugging a single-process single-hosted application. -The behavior of a networked application sometimes looks noncausal -because it is not reproducible in a strong sense. Whether a network -application works or not sometimes depends on the following: - - * How crowded the underlying network is - - * If the party at the other end is running or not - - * The state of the party at the other end - - The most difficult problems for a beginner arise from the hidden -states of the underlying network. After closing a TCP connection, it's -often necessary to wait a short while before reopening the connection. -Even more difficult is the establishment of a connection that previously -ended with a "broken pipe." Those connections have to "time out" for a -minute or so before they can reopen. Check this with the command -'netstat -a', which provides a list of still "active" connections. - - -File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking - -2.12 Where To Go From Here -========================== - -Now, you have learned enough to build your own application. You could, -for example, take part in the Loebner Contest to win $100,000. The -Loebner Prize is the first formal instantiation of a Turing Test. Hugh -Loebner agreed with The Cambridge Center for Behavioral Studies to -underwrite a contest designed to implement the Turing Test. Dr. Loebner -pledged a Grand Prize of $100,000 for the first computer whose responses -were indistinguishable from a human's. Each year an annual prize of -$2000 and a bronze medal is awarded to the _most_ human computer. The -winner of the annual contest is the best entry relative to other entries -that year, irrespective of how good it is in an absolute sense. Here is -an example of a conversation with the winning program of 1997: - - (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE] - [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40] - PROGRAM[10:39:20]Hi, my name is Catherine, what's yours? - JUDGE02[10:39:36]My name is Nathan. - PROGRAM[10:39:37]Well, it's nice to meet you, Nathan. - PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian - PROGRAM[10:40:03]couple who came out at a White House party on Sunday? - JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it? - PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover - PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very - PROGRAM[10:41:21]embarrassed? - JUDGE02[10:41:37]You tell me. I didn't see it. - PROGRAM[10:41:38]Are you still a Friend of Bill Clinton? - JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture. - PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he - PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity, - PROGRAM[10:42:51]wouldnt you say--can it all be bad luck? - JUDGE02[10:43:20]I asked you if you knew anything about sculpture. - PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with - PROGRAM[10:43:36]everyone waiting to see how much his friends have said about - PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something - PROGRAM[10:44:01]dramatic actually happen? - JUDGE02[10:44:19]Do you know what sculpture is? - PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I - PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I - PROGRAM[10:44:51]must say. - JUDGE02[10:45:26]Have you ever been to the Salmagundi Club? - PROGRAM[10:45:29]Never. to go back to the original discussion Time to get - PROGRAM[10:45:43]off this one I think and onto something more down to earth! - JUDGE02[10:46:20]What is more down to earth than art? - PROGRAM[10:46:21]I don't know what -- to be honest. - - PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the - PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a - PROGRAM[10:47:03]man? " - JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are" - JUDGE02[10:48:10]from another play the name of which I cannot remember. - PROGRAM[10:48:12]What, if anything, do you enjoy about being a man? - JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender. - PROGRAM[10:49:02]Do you think of yourself as being attractive? - - This program insists on always speaking about the same story around -Bill Clinton. You see, even a program with a rather narrow mind can -behave so much like a human being that it can win this prize. It is -quite common to let these programs talk to each other via network -connections. But during the competition itself, the program and its -computer have to be present at the place the competition is held. We -all would love to see a 'gawk' program win in such an event. Maybe it -is up to you to accomplish this? - - Some other ideas for useful networked applications: - * Read the file 'doc/awkforai.txt' in the 'gawk' distribution. It - was written by Ronald P. Loui (at the time, Associate Professor of - Computer Science, at Washington University in St. Louis, - ) and summarizes why he taught 'gawk' to - students of Artificial Intelligence. Here are some passages from - the text: - - The GAWK manual can be consumed in a single lab session and - the language can be mastered by the next morning by the - average student. GAWK's automatic initialization, implicit - coercion, I/O support and lack of pointers forgive many of the - mistakes that young programmers are likely to make. Those who - have seen C but not mastered it are happy to see that GAWK - retains some of the same sensibilities while adding what must - be regarded as spoonsful of syntactic sugar. - ... - There are further simple answers. Probably the best is the - fact that increasingly, undergraduate AI programming is - involving the Web. Oren Etzioni (University of Washington, - Seattle) has for a while been arguing that the "softbot" is - replacing the mechanical engineers' robot as the most - glamorous AI testbed. If the artifact whose behavior needs to - be controlled in an intelligent way is the software agent, - then a language that is well-suited to controlling the - software environment is the appropriate language. That would - imply a scripting language. If the robot is KAREL, then the - right language is "turn left; turn right." If the robot is - Netscape, then the right language is something that can - generate 'netscape -remote - 'openURL(http://cs.wustl.edu/~loui)'' with elan. - ... - AI programming requires high-level thinking. There have - always been a few gifted programmers who can write high-level - programs in assembly language. Most however need the ambient - abstraction to have a higher floor. - ... - Second, inference is merely the expansion of notation. No - matter whether the logic that underlies an AI program is - fuzzy, probabilistic, deontic, defeasible, or deductive, the - logic merely defines how strings can be transformed into other - strings. A language that provides the best support for string - processing in the end provides the best support for logic, for - the exploration of various logics, and for most forms of - symbolic processing that AI might choose to call "reasoning" - instead of "logic." The implication is that PROLOG, which - saves the AI programmer from having to write a unifier, saves - perhaps two dozen lines of GAWK code at the expense of - strongly biasing the logic and representational expressiveness - of any approach. - - Now that 'gawk' itself can connect to the Internet, it should be - obvious that it is suitable for writing intelligent web agents. - - * 'awk' is strong at pattern recognition and string processing. So, - it is well suited to the classic problem of language translation. - A first try could be a program that knows the 100 most frequent - English words and their counterparts in German or French. The - service could be implemented by regularly reading email with the - program above, replacing each word by its translation and sending - the translation back via SMTP. Users would send English email to - their translation service and get back a translated email message - in return. As soon as this works, more effort can be spent on a - real translation program. - - * Another dialogue-oriented application (on the verge of ridicule) is - the email "support service." Troubled customers write an email to - an automatic 'gawk' service that reads the email. It looks for - keywords in the mail and assembles a reply email accordingly. By - carefully investigating the email header, and repeating these - keywords through the reply email, it is rather simple to give the - customer a feeling that someone cares. Ideally, such a service - would search a database of previous cases for solutions. If none - exists, the database could, for example, consist of all the - newsgroups, mailing lists and FAQs on the Internet. - - -File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top - -3 Some Applications and Techniques -********************************** - -In this major node, we look at a number of self-contained scripts, with -an emphasis on concise networking. Along the way, we work towards -creating building blocks that encapsulate often needed functions of the -networking world, show new techniques that broaden the scope of problems -that can be solved with 'gawk', and explore leading edge technology that -may shape the future of networking. - - We often refer to the site-independent core of the server that we -built in *note A Simple Web Server: Simple Server. When building new -and nontrivial servers, we always copy this building block and append -new instances of the two functions 'SetUpServer()' and 'HandleGET()'. - - This makes a lot of sense, since this scheme of event-driven -execution provides 'gawk' with an interface to the most widely accepted -standard for GUIs: the web browser. Now, 'gawk' can rival even Tcl/Tk. - - Tcl and 'gawk' have much in common. Both are simple scripting -languages that allow us to quickly solve problems with short programs. -But Tcl has Tk on top of it, and 'gawk' had nothing comparable up to -now. While Tcl needs a large and ever-changing library (Tk, which was -bound to the X Window System until recently), 'gawk' needs just the -networking interface and some kind of browser on the client's side. -Besides better portability, the most important advantage of this -approach (embracing well-established standards such HTTP and HTML) is -that _we do not need to change the language_. We let others do the work -of fighting over protocols and standards. We can use HTML, JavaScript, -VRML, or whatever else comes along to do our work. - -* Menu: - -* PANIC:: An Emergency Web Server. -* GETURL:: Retrieving Web Pages. -* REMCONF:: Remote Configuration Of Embedded Systems. -* URLCHK:: Look For Changed Web Pages. -* WEBGRAB:: Extract Links From A Page. -* STATIST:: Graphing A Statistical Distribution. -* MAZE:: Walking Through A Maze In Virtual Reality. -* MOBAGWHO:: A Simple Mobile Agent. -* STOXPRED:: Stock Market Prediction As A Service. -* PROTBASE:: Searching Through A Protein Database. - - -File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques - -3.1 PANIC: An Emergency Web Server -================================== - -At first glance, the '"Hello, world"' example in *note A Primitive Web -Service: Primitive Service, seems useless. By adding just a few lines, -we can turn it into something useful. - - The PANIC program tells everyone who connects that the local site is -not working. When a web server breaks down, it makes a difference if -customers get a strange "network unreachable" message, or a short -message telling them that the server has a problem. In such an -emergency, the hard disk and everything on it (including the regular web -service) may be unavailable. Rebooting the web server off a diskette -makes sense in this setting. - - To use the PANIC program as an emergency web server, all you need are -the 'gawk' executable and the program below on a diskette. By default, -it connects to port 8080. A different value may be supplied on the -command line: - - BEGIN { - RS = ORS = "\r\n" - if (MyPort == 0) MyPort = 8080 - HttpService = "/inet/tcp/" MyPort "/0/0" - Hello = "Out Of Service" \ - "

" \ - "This site is temporarily out of service." \ - "

" - Len = length(Hello) + length(ORS) - while ("awk" != "complex") { - print "HTTP/1.0 200 OK" |& HttpService - print "Content-Length: " Len ORS |& HttpService - print Hello |& HttpService - while ((HttpService |& getline) > 0) - continue; - close(HttpService) - } - } - - -File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques - -3.2 GETURL: Retrieving Web Pages -================================ - -GETURL is a versatile building block for shell scripts that need to -retrieve files from the Internet. It takes a web address as a -command-line parameter and tries to retrieve the contents of this -address. The contents are printed to standard output, while the header -is printed to '/dev/stderr'. A surrounding shell script could analyze -the contents and extract the text or the links. An ASCII browser could -be written around GETURL. But more interestingly, web robots are -straightforward to write on top of GETURL. On the Internet, you can find -several programs of the same name that do the same job. They are -usually much more complex internally and at least 10 times longer. - - At first, GETURL checks if it was called with exactly one web -address. Then, it checks if the user chose to use a special proxy -server whose name is handed over in a variable. By default, it is -assumed that the local machine serves as proxy. GETURL uses the 'GET' -method by default to access the web page. By handing over the name of a -different method (such as 'HEAD'), it is possible to choose a different -behavior. With the 'HEAD' method, the user does not receive the body of -the page content, but does receive the header: - - BEGIN { - if (ARGC != 2) { - print "GETURL - retrieve Web page via HTTP 1.0" - print "IN:\n the URL as a command-line parameter" - print "PARAM(S):\n -v Proxy=MyProxy" - print "OUT:\n the page content on stdout" - print " the page header on stderr" - print "JK 16.05.1997" - print "ADR 13.08.2000" - exit - } - URL = ARGV[1]; ARGV[1] = "" - if (Proxy == "") Proxy = "127.0.0.1" - if (ProxyPort == 0) ProxyPort = 80 - if (Method == "") Method = "GET" - HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort - ORS = RS = "\r\n\r\n" - print Method " " URL " HTTP/1.0" |& HttpService - HttpService |& getline Header - print Header > "/dev/stderr" - while ((HttpService |& getline) > 0) - printf "%s", $0 - close(HttpService) - } - - This program can be changed as needed, but be careful with the last -lines. Make sure transmission of binary data is not corrupted by -additional line breaks. Even as it is now, the byte sequence -'"\r\n\r\n"' would disappear if it were contained in binary data. Don't -get caught in a trap when trying a quick fix on this one. - - -File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques - -3.3 REMCONF: Remote Configuration of Embedded Systems -===================================================== - -Today, you often find powerful processors in embedded systems. -Dedicated network routers and controllers for all kinds of machinery are -examples of embedded systems. Processors like the Intel 80x86 or the -AMD Elan are able to run multitasking operating systems, such as XINU or -GNU/Linux in embedded PCs. These systems are small and usually do not -have a keyboard or a display. Therefore it is difficult to set up their -configuration. There are several widespread ways to set them up: - - * DIP switches - - * Read Only Memories such as EPROMs - - * Serial lines or some kind of keyboard - - * Network connections via 'telnet' or SNMP - - * HTTP connections with HTML GUIs - - In this node, we look at a solution that uses HTTP connections to -control variables of an embedded system that are stored in a file. -Since embedded systems have tight limits on resources like memory, it is -difficult to employ advanced techniques such as SNMP and HTTP servers. -'gawk' fits in quite nicely with its single executable which needs just -a short script to start working. The following program stores the -variables in a file, and a concurrent process in the embedded system may -read the file. The program uses the site-independent part of the simple -web server that we developed in *note A Web Service with Interaction: -Interacting Service. As mentioned there, all we have to do is to write -two new procedures 'SetUpServer()' and 'HandleGET()': - - function SetUpServer() { - TopHeader = "Remote Configuration" - TopDoc = "\ -

Please choose one of the following actions:

\ - " - TopFooter = "" - if (ConfigFile == "") ConfigFile = "config.asc" - } - - The function 'SetUpServer()' initializes the top level HTML texts as -usual. It also initializes the name of the file that contains the -configuration parameters and their values. In case the user supplies a -name from the command line, that name is used. The file is expected to -contain one parameter per line, with the name of the parameter in column -one and the value in column two. - - The function 'HandleGET()' reflects the structure of the menu tree as -usual. The first menu choice tells the user what this is all about. -The second choice reads the configuration file line by line and stores -the parameters and their values. Notice that the record separator for -this file is '"\n"', in contrast to the record separator for HTTP. The -third menu choice builds an HTML table to show the contents of the -configuration file just read. The fourth choice does the real work of -changing parameters, and the last one just saves the configuration into -a file: - - function HandleGET() { - if(MENU[2] == "AboutServer") { - Document = "This is a GUI for remote configuration of an\ - embedded system. It is is implemented as one GAWK script." - } else if (MENU[2] == "ReadConfig") { - RS = "\n" - while ((getline < ConfigFile) > 0) - config[$1] = $2; - close(ConfigFile) - RS = "\r\n" - Document = "Configuration has been read." - } else if (MENU[2] == "CheckConfig") { - Document = "" - for (i in config) - Document = Document "" \ - "" - Document = Document "
" i "" config[i] "
" - } else if (MENU[2] == "ChangeConfig") { - if ("Param" in GETARG) { # any parameter to set? - if (GETARG["Param"] in config) { # is parameter valid? - config[GETARG["Param"]] = GETARG["Value"] - Document = (GETARG["Param"] " = " GETARG["Value"] ".") - } else { - Document = "Parameter " GETARG["Param"] " is invalid." - } - } else { - Document = "

Change one parameter

\ - \ - \ - \ - \ -
ParameterValue
" - } - } else if (MENU[2] == "SaveConfig") { - for (i in config) - printf("%s %s\n", i, config[i]) > ConfigFile - close(ConfigFile) - Document = "Configuration has been saved." - } - } - - We could also view the configuration file as a database. From this -point of view, the previous program acts like a primitive database -server. Real SQL database systems also make a service available by -providing a TCP port that clients can connect to. But the application -level protocols they use are usually proprietary and also change from -time to time. This is also true for the protocol that MiniSQL uses. - - -File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques - -3.4 URLCHK: Look for Changed Web Pages -====================================== - -Most people who make heavy use of Internet resources have a large -bookmark file with pointers to interesting web sites. It is impossible -to regularly check by hand if any of these sites have changed. A -program is needed to automatically look at the headers of web pages and -tell which ones have changed. URLCHK does the comparison after using -GETURL with the 'HEAD' method to retrieve the header. - - Like GETURL, this program first checks that it is called with exactly -one command-line parameter. URLCHK also takes the same command-line -variables 'Proxy' and 'ProxyPort' as GETURL, because these variables are -handed over to GETURL for each URL that gets checked. The one and only -parameter is the name of a file that contains one line for each URL. In -the first column, we find the URL, and the second and third columns hold -the length of the URL's body when checked for the two last times. Now, -we follow this plan: - - 1. Read the URLs from the file and remember their most recent lengths - - 2. Delete the contents of the file - - 3. For each URL, check its new length and write it into the file - - 4. If the most recent and the new length differ, tell the user - - It may seem a bit peculiar to read the URLs from a file together with -their two most recent lengths, but this approach has several advantages. -You can call the program again and again with the same file. After -running the program, you can regenerate the changed URLs by extracting -those lines that differ in their second and third columns: - - BEGIN { - if (ARGC != 2) { - print "URLCHK - check if URLs have changed" - print "IN:\n the file with URLs as a command-line parameter" - print " file contains URL, old length, new length" - print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" - print "OUT:\n same as file with URLs" - print "JK 02.03.1998" - exit - } - URLfile = ARGV[1]; ARGV[1] = "" - if (Proxy != "") Proxy = " -v Proxy=" Proxy - if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort - while ((getline < URLfile) > 0) - Length[$1] = $3 + 0 - close(URLfile) # now, URLfile is read in and can be updated - GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " - for (i in Length) { - GetThisHeader = GetHeader i " 2>&1" - while ((GetThisHeader | getline) > 0) - if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 - close(GetThisHeader) - print i, Length[i], NewLength > URLfile - if (Length[i] != NewLength) # report only changed URLs - print i, Length[i], NewLength - } - close(URLfile) - } - - Another thing that may look strange is the way GETURL is called. -Before calling GETURL, we have to check if the proxy variables need to -be passed on. If so, we prepare strings that will become part of the -command line later. In 'GetHeader()', we store these strings together -with the longest part of the command line. Later, in the loop over the -URLs, 'GetHeader()' is appended with the URL and a redirection operator -to form the command that reads the URL's header over the Internet. -GETURL always produces the headers over '/dev/stderr'. That is the -reason why we need the redirection operator to have the header piped in. - - This program is not perfect because it assumes that changing URLs -results in changed lengths, which is not necessarily true. A more -advanced approach is to look at some other header line that holds time -information. But, as always when things get a bit more complicated, -this is left as an exercise to the reader. - - -File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques - -3.5 WEBGRAB: Extract Links from a Page -====================================== - -Sometimes it is necessary to extract links from web pages. Browsers do -it, web robots do it, and sometimes even humans do it. Since we have a -tool like GETURL at hand, we can solve this problem with some help from -the Bourne shell: - - BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" } - RT != "" { - command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ - " > doc" NR ".html") - print command - } - - Notice that the regular expression for URLs is rather crude. A -precise regular expression is much more complex. But this one works -rather well. One problem is that it is unable to find internal links of -an HTML document. Another problem is that 'ftp', 'telnet', 'news', -'mailto', and other kinds of links are missing in the regular -expression. However, it is straightforward to add them, if doing so is -necessary for other tasks. - - This program reads an HTML file and prints all the HTTP links that it -finds. It relies on 'gawk''s ability to use regular expressions as -record separators. With 'RS' set to a regular expression that matches -links, the second action is executed each time a non-empty link is -found. We can find the matching link itself in 'RT'. - - The action could use the 'system()' function to let another GETURL -retrieve the page, but here we use a different approach. This simple -program prints shell commands that can be piped into 'sh' for execution. -This way it is possible to first extract the links, wrap shell commands -around them, and pipe all the shell commands into a file. After editing -the file, execution of the file retrieves exactly those files that we -really need. In case we do not want to edit, we can retrieve all the -pages like this: - - gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh - - After this, you will find the contents of all referenced documents in -files named 'doc*.html' even if they do not contain HTML code. The most -annoying thing is that we always have to pass the proxy to GETURL. If -you do not like to see the headers of the web pages appear on the -screen, you can redirect them to '/dev/null'. Watching the headers -appear can be quite interesting, because it reveals interesting details -such as which web server the companies use. Now, it is clear how the -clever marketing people use web robots to determine the market shares of -Microsoft and Netscape in the web server market. - - Port 80 of any web server is like a small hole in a repellent -firewall. After attaching a browser to port 80, we usually catch a -glimpse of the bright side of the server (its home page). With a tool -like GETURL at hand, we are able to discover some of the more concealed -or even "indecent" services (i.e., lacking conformity to standards of -quality). It can be exciting to see the fancy CGI scripts that lie -there, revealing the inner workings of the server, ready to be called: - - * With a command such as: - - gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/ - - some servers give you a directory listing of the CGI files. - Knowing the names, you can try to call some of them and watch for - useful results. Sometimes there are executables in such - directories (such as Perl interpreters) that you may call remotely. - If there are subdirectories with configuration data of the web - server, this can also be quite interesting to read. - - * The well-known Apache web server usually has its CGI files in the - directory '/cgi-bin'. There you can often find the scripts - 'test-cgi' and 'printenv'. Both tell you some things about the - current connection and the installation of the web server. Just - call: - - gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi - gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv - - * Sometimes it is even possible to retrieve system files like the web - server's log file--possibly containing customer data--or even the - file '/etc/passwd'. (We don't recommend this!) - - *Caution:* Although this may sound funny or simply irrelevant, we are -talking about severe security holes. Try to explore your own system -this way and make sure that none of the above reveals too much -information about your system. - - -File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques - -3.6 STATIST: Graphing a Statistical Distribution -================================================ - -In the HTTP server examples we've shown thus far, we never present an -image to the browser and its user. Presenting images is one task. -Generating images that reflect some user input and presenting these -dynamically generated images is another. In this node, we use GNUPlot -for generating '.png', '.ps', or '.gif' files.(1) - - The program we develop takes the statistical parameters of two -samples and computes the t-test statistics. As a result, we get the -probabilities that the means and the variances of both samples are the -same. In order to let the user check plausibility, the program presents -an image of the distributions. The statistical computation follows -'Numerical Recipes in C: The Art of Scientific Computing' by William H. -Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery. -Since 'gawk' does not have a built-in function for the computation of -the beta function, we use the 'ibeta()' function of GNUPlot. As a side -effect, we learn how to use GNUPlot as a sophisticated calculator. The -comparison of means is done as in 'tutest', paragraph 14.2, page 613, -and the comparison of variances is done as in 'ftest', page 611 in -'Numerical Recipes'. - - As usual, we take the site-independent code for servers and append -our own functions 'SetUpServer()' and 'HandleGET()': - - function SetUpServer() { - TopHeader = "Statistics with GAWK" - TopDoc = "\ -

Please choose one of the following actions:

\ - " - TopFooter = "" - GnuPlot = "gnuplot 2>&1" - m1=m2=0; v1=v2=1; n1=n2=10 - } - - Here, you see the menu structure that the user sees. Later, we will -see how the program structure of the 'HandleGET()' function reflects the -menu structure. What is missing here is the link for the image we -generate. In an event-driven environment, request, generation, and -delivery of images are separated. - - Notice the way we initialize the 'GnuPlot' command string for the -pipe. By default, GNUPlot outputs the generated image via standard -output, as well as the results of 'print'(ed) calculations via standard -error. The redirection causes standard error to be mixed into standard -output, enabling us to read results of calculations with 'getline'. By -initializing the statistical parameters with some meaningful defaults, -we make sure the user gets an image the first time he uses the program. - - Following is the rather long function 'HandleGET()', which implements -the contents of this service by reacting to the different kinds of -requests from the browser. Before you start playing with this script, -make sure that your browser supports JavaScript and that it also has -this option switched on. The script uses a short snippet of JavaScript -code for delayed opening of a window with an image. A more detailed -explanation follows: - - function HandleGET() { - if(MENU[2] == "AboutServer") { - Document = "This is a GUI for a statistical computation.\ - It compares means and variances of two distributions.\ - It is implemented as one GAWK script and uses GNUPLOT." - } else if (MENU[2] == "EnterParameters") { - Document = "" - if ("m1" in GETARG) { # are there parameters to compare? - Document = Document "" - m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] - m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] - t = (m1-m2)/sqrt(v1/n1+v2/n2) - df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \ - + (v2/n2)*(v2/n2) /(n2-1)) - if (v1>v2) { - f = v1/v2 - df1 = n1 - 1 - df2 = n2 - 1 - } else { - f = v2/v1 - df1 = n2 - 1 - df2 = n1 - 1 - } - print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot - print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \ - df2/(df2+df1*f) ")" |& GnuPlot - print "print pt, pF" |& GnuPlot - RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF - print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot - print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot - print "set term png small color" |& GnuPlot - #print "set term postscript color" |& GnuPlot - #print "set term gif medium size 320,240" |& GnuPlot - print "set yrange[-0.3:]" |& GnuPlot - print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot - print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot - print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ - mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot - print "quit" |& GnuPlot - GnuPlot |& getline Image - while ((GnuPlot |& getline) > 0) - Image = Image RS $0 - close(GnuPlot) - } - Document = Document "\ -

Do these samples have the same Gaussian distribution?

\ -
\ - \ - - \ - - \ - - \ - \ - - \ - - \ - - \ - \ -
1. Mean 1. Variance1. Count
2. Mean 2. Variance2. Count

" - } else if (MENU[2] ~ "Image") { - Reason = "OK" ORS "Content-type: image/png" - #Reason = "OK" ORS "Content-type: application/x-postscript" - #Reason = "OK" ORS "Content-type: image/gif" - Header = Footer = "" - Document = Image - } - } - - As usual, we give a short description of the service in the first -menu choice. The third menu choice shows us that generation and -presentation of an image are two separate actions. While the latter -takes place quite instantly in the third menu choice, the former takes -place in the much longer second choice. Image data passes from the -generating action to the presenting action via the variable 'Image' that -contains a complete '.png' image, which is otherwise stored in a file. -If you prefer '.ps' or '.gif' images over the default '.png' images, you -may select these options by uncommenting the appropriate lines. But -remember to do so in two places: when telling GNUPlot which kind of -images to generate, and when transmitting the image at the end of the -program. - - Looking at the end of the program, the way we pass the 'Content-type' -to the browser is a bit unusual. It is appended to the 'OK' of the -first header line to make sure the type information becomes part of the -header. The other variables that get transmitted across the network are -made empty, because in this case we do not have an HTML document to -transmit, but rather raw image data to contain in the body. - - Most of the work is done in the second menu choice. It starts with a -strange JavaScript code snippet. When first implementing this server, -we used a short '""' here. But then -browsers got smarter and tried to improve on speed by requesting the -image and the HTML code at the same time. When doing this, the browser -tries to build up a connection for the image request while the request -for the HTML text is not yet completed. The browser tries to connect to -the 'gawk' server on port 8080 while port 8080 is still in use for -transmission of the HTML text. The connection for the image cannot be -built up, so the image appears as "broken" in the browser window. We -solved this problem by telling the browser to open a separate window for -the image, but only after a delay of 1000 milliseconds. By this time, -the server should be ready for serving the next request. - - But there is one more subtlety in the JavaScript code. Each time the -JavaScript code opens a window for the image, the name of the image is -appended with a timestamp ('systime()'). Why this constant change of -name for the image? Initially, we always named the image 'Image', but -then the Netscape browser noticed the name had _not_ changed since the -previous request and displayed the previous image (caching behavior). -The server core is implemented so that browsers are told _not_ to cache -anything. Obviously HTTP requests do not always work as expected. One -way to circumvent the cache of such overly smart browsers is to change -the name of the image with each request. These three lines of -JavaScript caused us a lot of trouble. - - The rest can be broken down into two phases. At first, we check if -there are statistical parameters. When the program is first started, -there usually are no parameters because it enters the page coming from -the top menu. Then, we only have to present the user a form that he can -use to change statistical parameters and submit them. Subsequently, the -submission of the form causes the execution of the first phase because -_now_ there _are_ parameters to handle. - - Now that we have parameters, we know there will be an image -available. Therefore we insert the JavaScript code here to initiate the -opening of the image in a separate window. Then, we prepare some -variables that will be passed to GNUPlot for calculation of the -probabilities. Prior to reading the results, we must temporarily change -'RS' because GNUPlot separates lines with newlines. After instructing -GNUPlot to generate a '.png' (or '.ps' or '.gif') image, we initiate the -insertion of some text, explaining the resulting probabilities. The -final 'plot' command actually generates the image data. This raw binary -has to be read in carefully without adding, changing, or deleting a -single byte. Hence the unusual initialization of 'Image' and completion -with a 'while' loop. - - When using this server, it soon becomes clear that it is far from -being perfect. It mixes source code of six scripting languages or -protocols: - - * GNU 'awk' implements a server for the protocol: - * HTTP which transmits: - * HTML text which contains a short piece of: - * JavaScript code opening a separate window. - * A Bourne shell script is used for piping commands into: - * GNUPlot to generate the image to be opened. - - After all this work, the GNUPlot image opens in the JavaScript window -where it can be viewed by the user. - - It is probably better not to mix up so many different languages. The -result is not very readable. Furthermore, the statistical part of the -server does not take care of invalid input. Among others, using -negative variances will cause invalid results. - - ---------- Footnotes ---------- - - (1) Due to licensing problems, the default installation of GNUPlot -disables the generation of '.gif' files. If your installed version does -not accept 'set term gif', just download and install the most recent -version of GNUPlot and the GD library (http://www.boutell.com/gd/) by -Thomas Boutell. Otherwise you still have the chance to generate some -ASCII-art style images with GNUPlot by using 'set term dumb'. (We tried -it and it worked.) - - -File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques - -3.7 MAZE: Walking Through a Maze In Virtual Reality -=================================================== - - In the long run, every program becomes rococo, and then rubble. - Alan Perlis - - By now, we know how to present arbitrary 'Content-type's to a -browser. In this node, our server will present a 3D world to our -browser. The 3D world is described in a scene description language -(VRML, Virtual Reality Modeling Language) that allows us to travel -through a perspective view of a 2D maze with our browser. Browsers with -a VRML plugin enable exploration of this technology. We could do one of -those boring 'Hello world' examples here, that are usually presented -when introducing novices to VRML. If you have never written any VRML -code, have a look at the VRML FAQ. Presenting a static VRML scene is a -bit trivial; in order to expose 'gawk''s new capabilities, we will -present a dynamically generated VRML scene. The function -'SetUpServer()' is very simple because it only sets the default HTML -page and initializes the random number generator. As usual, the -surrounding server lets you browse the maze. - - function SetUpServer() { - TopHeader = "Walk through a maze" - TopDoc = "\ -

Please choose one of the following actions:

\ - " - TopFooter = "" - srand() - } - - The function 'HandleGET()' is a bit longer because it first computes -the maze and afterwards generates the VRML code that is sent across the -network. As shown in the STATIST example (*note STATIST::), we set the -type of the content to VRML and then store the VRML representation of -the maze as the page content. We assume that the maze is stored in a 2D -array. Initially, the maze consists of walls only. Then, we add an -entry and an exit to the maze and let the rest of the work be done by -the function 'MakeMaze()'. Now, only the wall fields are left in the -maze. By iterating over the these fields, we generate one line of VRML -code for each wall field. - - function HandleGET() { - if (MENU[2] == "AboutServer") { - Document = "If your browser has a VRML 2 plugin,\ - this server shows you a simple VRML scene." - } else if (MENU[2] == "VRMLtest") { - XSIZE = YSIZE = 11 # initially, everything is wall - for (y = 0; y < YSIZE; y++) - for (x = 0; x < XSIZE; x++) - Maze[x, y] = "#" - delete Maze[0, 1] # entry is not wall - delete Maze[XSIZE-1, YSIZE-2] # exit is not wall - MakeMaze(1, 1) - Document = "\ - #VRML V2.0 utf8\n\ - Group {\n\ - children [\n\ - PointLight {\n\ - ambientIntensity 0.2\n\ - color 0.7 0.7 0.7\n\ - location 0.0 8.0 10.0\n\ - }\n\ - DEF B1 Background {\n\ - skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ - skyAngle 1.6\n\ - groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ - groundAngle [ 1.2 1.57 ]\n\ - }\n\ - DEF Wall Shape {\n\ - geometry Box {size 1 1 1}\n\ - appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\ - }\n\ - DEF Entry Viewpoint {\n\ - position 0.5 1.0 5.0\n\ - orientation 0.0 0.0 -1.0 0.52\n\ - }\n" - for (i in Maze) { - split(i, t, SUBSEP) - Document = Document " Transform { translation " - Document = Document t[1] " 0 -" t[2] " children USE Wall }\n" - } - Document = Document " ] # end of group for world\n}" - Reason = "OK" ORS "Content-type: model/vrml" - Header = Footer = "" - } - } - - Finally, we have a look at 'MakeMaze()', the function that generates -the 'Maze' array. When entered, this function assumes that the array -has been initialized so that each element represents a wall element and -the maze is initially full of wall elements. Only the entrance and the -exit of the maze should have been left free. The parameters of the -function tell us which element must be marked as not being a wall. -After this, we take a look at the four neighboring elements and remember -which we have already treated. Of all the neighboring elements, we take -one at random and walk in that direction. Therefore, the wall element -in that direction has to be removed and then, we call the function -recursively for that element. The maze is only completed if we iterate -the above procedure for _all_ neighboring elements (in random order) and -for our present element by recursively calling the function for the -present element. This last iteration could have been done in a loop, -but it is done much simpler recursively. - - Notice that elements with coordinates that are both odd are assumed -to be on our way through the maze and the generating process cannot -terminate as long as there is such an element not being 'delete'd. All -other elements are potentially part of the wall. - - function MakeMaze(x, y) { - delete Maze[x, y] # here we are, we have no wall here - p = 0 # count unvisited fields in all directions - if (x-2 SUBSEP y in Maze) d[p++] = "-x" - if (x SUBSEP y-2 in Maze) d[p++] = "-y" - if (x+2 SUBSEP y in Maze) d[p++] = "+x" - if (x SUBSEP y+2 in Maze) d[p++] = "+y" - if (p>0) { # if there are unvisited fields, go there - p = int(p*rand()) # choose one unvisited field at random - if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y) - } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2) - } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y) - } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2) - } # we are back from recursion - MakeMaze(x, y); # try again while there are unvisited fields - } - } - - -File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques - -3.8 MOBAGWHO: a Simple Mobile Agent -=================================== - - There are two ways of constructing a software design: One way is to - make it so simple that there are obviously no deficiencies, and the - other way is to make it so complicated that there are no obvious - deficiencies. - C. A. R. Hoare - - A "mobile agent" is a program that can be dispatched from a computer -and transported to a remote server for execution. This is called -"migration", which means that a process on another system is started -that is independent from its originator. Ideally, it wanders through a -network while working for its creator or owner. In places like the UMBC -Agent Web, people are quite confident that (mobile) agents are a -software engineering paradigm that enables us to significantly increase -the efficiency of our work. Mobile agents could become the mediators -between users and the networking world. For an unbiased view at this -technology, see the remarkable paper 'Mobile Agents: Are they a good -idea?'.(1) - - When trying to migrate a process from one system to another, a server -process is needed on the receiving side. Depending on the kind of -server process, several ways of implementation come to mind. How the -process is implemented depends upon the kind of server process: - - * HTTP can be used as the protocol for delivery of the migrating - process. In this case, we use a common web server as the receiving - server process. A universal CGI script mediates between migrating - process and web server. Each server willing to accept migrating - agents makes this universal service available. HTTP supplies the - 'POST' method to transfer some data to a file on the web server. - When a CGI script is called remotely with the 'POST' method instead - of the usual 'GET' method, data is transmitted from the client - process to the standard input of the server's CGI script. So, to - implement a mobile agent, we must not only write the agent program - to start on the client side, but also the CGI script to receive the - agent on the server side. - - * The 'PUT' method can also be used for migration. HTTP does not - require a CGI script for migration via 'PUT'. However, with common - web servers there is no advantage to this solution, because web - servers such as Apache require explicit activation of a special - 'PUT' script. - - * 'Agent Tcl' pursues a different course; it relies on a dedicated - server process with a dedicated protocol specialized for receiving - mobile agents. - - Our agent example abuses a common web server as a migration tool. -So, it needs a universal CGI script on the receiving side (the web -server). The receiving script is activated with a 'POST' request when -placed into a location like '/httpd/cgi-bin/PostAgent.sh'. Make sure -that the server system uses a version of 'gawk' that supports network -access (Version 3.1 or later; verify with 'gawk --version'). - - #!/bin/sh - MobAg=/tmp/MobileAgent.$$ - # direct script to mobile agent file - cat > $MobAg - # execute agent concurrently - gawk -f $MobAg $MobAg > /dev/null & - # HTTP header, terminator and body - gawk 'BEGIN { print "\r\nAgent started" }' - rm $MobAg # delete script file of agent - - By making its process id ('$$') part of the unique file name, the -script avoids conflicts between concurrent instances of the script. -First, all lines from standard input (the mobile agent's source code) -are copied into this unique file. Then, the agent is started as a -concurrent process and a short message reporting this fact is sent to -the submitting client. Finally, the script file of the mobile agent is -removed because it is no longer needed. Although it is a short script, -there are several noteworthy points: - -Security - _There is none_. In fact, the CGI script should never be made - available on a server that is part of the Internet because everyone - would be allowed to execute arbitrary commands with it. This - behavior is acceptable only when performing rapid prototyping. - -Self-Reference - Each migrating instance of an agent is started in a way that - enables it to read its own source code from standard input and use - the code for subsequent migrations. This is necessary because it - needs to treat the agent's code as data to transmit. 'gawk' is not - the ideal language for such a job. Lisp and Tcl are more suitable - because they do not make a distinction between program code and - data. - -Independence - After migration, the agent is not linked to its former home in any - way. By reporting 'Agent started', it waves "Goodbye" to its - origin. The originator may choose to terminate or not. - - The originating agent itself is started just like any other -command-line script, and reports the results on standard output. By -letting the name of the original host migrate with the agent, the agent -that migrates to a host far away from its origin can report the result -back home. Having arrived at the end of the journey, the agent -establishes a connection and reports the results. This is the reason -for determining the name of the host with 'uname -n' and storing it in -'MyOrigin' for later use. We may also set variables with the '-v' -option from the command line. This interactivity is only of importance -in the context of starting a mobile agent; therefore this 'BEGIN' -pattern and its action do not take part in migration: - - BEGIN { - if (ARGC != 2) { - print "MOBAG - a simple mobile agent" - print "CALL:\n gawk -f mobag.awk mobag.awk" - print "IN:\n the name of this script as a command-line parameter" - print "PARAM:\n -v MyOrigin=myhost.com" - print "OUT:\n the result on stdout" - print "JK 29.03.1998 01.04.1998" - exit - } - if (MyOrigin == "") { - "uname -n" | getline MyOrigin - close("uname -n") - } - } - - Since 'gawk' cannot manipulate and transmit parts of the program -directly, the source code is read and stored in strings. Therefore, the -program scans itself for the beginning and the ending of functions. -Each line in between is appended to the code string until the end of the -function has been reached. A special case is this part of the program -itself. It is not a function. Placing a similar framework around it -causes it to be treated like a function. Notice that this mechanism -works for all the functions of the source code, but it cannot guarantee -that the order of the functions is preserved during migration: - - #ReadMySelf - /^function / { FUNC = $2 } - /^END/ || /^#ReadMySelf/ { FUNC = $1 } - FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 } - (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \ - { FUNC = "" } - #EndOfMySelf - - The web server code in *note A Web Service with Interaction: -Interacting Service, was first developed as a site-independent core. -Likewise, the 'gawk'-based mobile agent starts with an agent-independent -core, to which can be appended application-dependent functions. What -follows is the only application-independent function needed for the -mobile agent: - - function migrate(Destination, MobCode, Label) { - MOBVAR["Label"] = Label - MOBVAR["Destination"] = Destination - RS = ORS = "\r\n" - HttpService = "/inet/tcp/0/" Destination - for (i in MOBFUN) - MobCode = (MobCode "\n" MOBFUN[i]) - MobCode = MobCode "\n\nBEGIN {" - for (i in MOBVAR) - MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") - MobCode = MobCode "\n}\n" - print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService - print "Content-length:", length(MobCode) ORS |& HttpService - printf "%s", MobCode |& HttpService - while ((HttpService |& getline) > 0) - print $0 - close(HttpService) - } - - The 'migrate()' function prepares the aforementioned strings -containing the program code and transmits them to a server. A -consequence of this modular approach is that the 'migrate()' function -takes some parameters that aren't needed in this application, but that -will be in future ones. Its mandatory parameter 'Destination' holds the -name (or IP address) of the server that the agent wants as a host for -its code. The optional parameter 'MobCode' may contain some 'gawk' code -that is inserted during migration in front of all other code. The -optional parameter 'Label' may contain a string that tells the agent -what to do in program execution after arrival at its new home site. One -of the serious obstacles in implementing a framework for mobile agents -is that it does not suffice to migrate the code. It is also necessary -to migrate the state of execution of the agent. In contrast to 'Agent -Tcl', this program does not try to migrate the complete set of -variables. The following conventions are used: - - * Each variable in an agent program is local to the current host and - does _not_ migrate. - - * The array 'MOBFUN' shown above is an exception. It is handled by - the function 'migrate()' and does migrate with the application. - - * The other exception is the array 'MOBVAR'. Each variable that - takes part in migration has to be an element of this array. - 'migrate()' also takes care of this. - - Now it's clear what happens to the 'Label' parameter of the function -'migrate()'. It is copied into 'MOBVAR["Label"]' and travels alongside -the other data. Since travelling takes place via HTTP, records must be -separated with '"\r\n"' in 'RS' and 'ORS' as usual. The code assembly -for migration takes place in three steps: - - * Iterate over 'MOBFUN' to collect all functions verbatim. - - * Prepare a 'BEGIN' pattern and put assignments to mobile variables - into the action part. - - * Transmission itself resembles GETURL: the header with the request - and the 'Content-length' is followed by the body. In case there is - any reply over the network, it is read completely and echoed to - standard output to avoid irritating the server. - - The application-independent framework is now almost complete. What -follows is the 'END' pattern that is executed when the mobile agent has -finished reading its own code. First, it checks whether it is already -running on a remote host or not. In case initialization has not yet -taken place, it starts 'MyInit()'. Otherwise (later, on a remote host), -it starts 'MyJob()': - - END { - if (ARGC != 2) exit # stop when called with wrong parameters - if (MyOrigin != "") # is this the originating host? - MyInit() # if so, initialize the application - else # we are on a host with migrated data - MyJob() # so we do our job - } - - All that's left to extend the framework into a complete application -is to write two application-specific functions: 'MyInit()' and -'MyJob()'. Keep in mind that the former is executed once on the -originating host, while the latter is executed after each migration: - - function MyInit() { - MOBVAR["MyOrigin"] = MyOrigin - MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" - split(MOBVAR["Machines"], Machines) # which host is the first? - migrate(Machines[1], "", "") # go to the first host - while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result - print $0 # print result - close("/inet/tcp/8080/0/0") - } - - As mentioned earlier, this agent takes the name of its origin -('MyOrigin') with it. Then, it takes the name of its first destination -and goes there for further work. Notice that this name has the port -number of the web server appended to the name of the server, because the -function 'migrate()' needs it this way to create the 'HttpService' -variable. Finally, it waits for the result to arrive. The 'MyJob()' -function runs on the remote host: - - function MyJob() { - # forget this host - sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) - MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" - while (("who" | getline) > 0) # who is logged in? - MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 - close("who") - if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit? - split(MOBVAR["Machines"], Machines) # which host is next? - migrate(Machines[1], "", "") # go there - } else { # no more machines - gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin - print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" - close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") - } - } - - After migrating, the first thing to do in 'MyJob()' is to delete the -name of the current host from the list of hosts to visit. Now, it is -time to start the real work by appending the host's name to the result -string, and reading line by line who is logged in on this host. A very -annoying circumstance is the fact that the elements of 'MOBVAR' cannot -hold the newline character ('"\n"'). If they did, migration of this -string did not work because the string didn't obey the syntax rule for a -string in 'gawk'. 'SUBSEP' is used as a temporary replacement. If the -list of hosts to visit holds at least one more entry, the agent migrates -to that place to go on working there. Otherwise, we replace the -'SUBSEP's with a newline character in the resulting string, and report -it to the originating host, whose name is stored in -'MOBVAR["MyOrigin"]'. - - ---------- Footnotes ---------- - - (1) - - -File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques - -3.9 STOXPRED: Stock Market Prediction As A Service -================================================== - - Far out in the uncharted backwaters of the unfashionable end of the - Western Spiral arm of the Galaxy lies a small unregarded yellow - sun. - - Orbiting this at a distance of roughly ninety-two million miles is - an utterly insignificant little blue-green planet whose - ape-descendent life forms are so amazingly primitive that they - still think digital watches are a pretty neat idea. - - This planet has -- or rather had -- a problem, which was this: most - of the people living on it were unhappy for pretty much of the - time. Many solutions were suggested for this problem, but most of - these were largely concerned with the movements of small green - pieces of paper, which is odd because it wasn't the small green - pieces of paper that were unhappy. - Douglas Adams, 'The Hitch Hiker's Guide to the Galaxy' - - Valuable services on the Internet are usually _not_ implemented as -mobile agents. There are much simpler ways of implementing services. -All Unix systems provide, for example, the 'cron' service. Unix system -users can write a list of tasks to be done each day, each week, twice a -day, or just once. The list is entered into a file named 'crontab'. -For example, to distribute a newsletter on a daily basis this way, use -'cron' for calling a script each day early in the morning. - - # run at 8 am on weekdays, distribute the newsletter - 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1 - - The script first looks for interesting information on the Internet, -assembles it in a nice form and sends the results via email to the -customers. - - The following is an example of a primitive newsletter on stock market -prediction. It is a report which first tries to predict the change of -each share in the Dow Jones Industrial Index for the particular day. -Then it mentions some especially promising shares as well as some shares -which look remarkably bad on that day. The report ends with the usual -disclaimer which tells every child _not_ to try this at home and hurt -anybody. - - Good morning Uncle Scrooge, - - This is your daily stock market report for Monday, October 16, 2000. - Here are the predictions for today: - - AA neutral - GE up - JNJ down - MSFT neutral - ... - UTX up - DD down - IBM up - MO down - WMT up - DIS up - INTC up - MRK down - XOM down - EK down - IP down - - The most promising shares for today are these: - - INTC http://biz.yahoo.com/n/i/intc.html - - The stock shares to avoid today are these: - - EK http://biz.yahoo.com/n/e/ek.html - IP http://biz.yahoo.com/n/i/ip.html - DD http://biz.yahoo.com/n/d/dd.html - ... - - The script as a whole is rather long. In order to ease the pain of -studying other people's source code, we have broken the script up into -meaningful parts which are invoked one after the other. The basic -structure of the script is as follows: - - BEGIN { - Init() - ReadQuotes() - CleanUp() - Prediction() - Report() - SendMail() - } - - The earlier parts store data into variables and arrays which are -subsequently used by later parts of the script. The 'Init()' function -first checks if the script is invoked correctly (without any -parameters). If not, it informs the user of the correct usage. What -follows are preparations for the retrieval of the historical quote data. -The names of the 30 stock shares are stored in an array 'name' along -with the current date in 'day', 'month', and 'year'. - - All users who are separated from the Internet by a firewall and have -to direct their Internet accesses to a proxy must supply the name of the -proxy to this script with the '-v Proxy=NAME' option. For most users, -the default proxy and port number should suffice. - - function Init() { - if (ARGC != 1) { - print "STOXPRED - daily stock share prediction" - print "IN:\n no parameters, nothing on stdin" - print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" - print "OUT:\n commented predictions as email" - print "JK 09.10.2000" - exit - } - # Remember ticker symbols from Dow Jones Industrial Index - StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ - SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ - MRK XOM EK IP", name); - # Remember the current date as the end of the time series - day = strftime("%d") - month = strftime("%m") - year = strftime("%Y") - if (Proxy == "") Proxy = "chart.yahoo.com" - if (ProxyPort == 0) ProxyPort = 80 - YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort - } - - There are two really interesting parts in the script. One is the -function which reads the historical stock quotes from an Internet -server. The other is the one that does the actual prediction. In the -following function we see how the quotes are read from the Yahoo server. -The data which comes from the server is in CSV format (comma-separated -values): - - Date,Open,High,Low,Close,Volume - 9-Oct-00,22.75,22.75,21.375,22.375,7888500 - 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 - 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 - - Lines contain values of the same time instant, whereas columns are -separated by commas and contain the kind of data that is described in -the header (first) line. At first, 'gawk' is instructed to separate -columns by commas ('FS = ","'). In the loop that follows, a connection -to the Yahoo server is first opened, then a download takes place, and -finally the connection is closed. All this happens once for each ticker -symbol. In the body of this loop, an Internet address is built up as a -string according to the rules of the Yahoo server. The starting and -ending date are chosen to be exactly the same, but one year apart in the -past. All the action is initiated within the 'printf' command which -transmits the request for data to the Yahoo server. - - In the inner loop, the server's data is first read and then scanned -line by line. Only lines which have six columns and the name of a month -in the first column contain relevant data. This data is stored in the -two-dimensional array 'quote'; one dimension being time, the other being -the ticker symbol. During retrieval of the first stock's data, the -calendar names of the time instances are stored in the array 'day' -because we need them later. - - function ReadQuotes() { - # Retrieve historical data for each ticker symbol - FS = "," - for (stock = 1; stock <= StockCount; stock++) { - URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ - "&a=" month "&b=" day "&c=" year-1 \ - "&d=" month "&e=" day "&f=" year \ - "g=d&q=q&y=0&z=" name[stock] "&x=.csv" - printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData - while ((YahooData |& getline) > 0) { - if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) { - if (stock == 1) - days[++daycount] = $1; - quote[$1, stock] = $5 - } - } - close(YahooData) - } - FS = " " - } - - Now that we _have_ the data, it can be checked once again to make -sure that no individual stock is missing or invalid, and that all the -stock quotes are aligned correctly. Furthermore, we renumber the time -instances. The most recent day gets day number 1 and all other days get -consecutive numbers. All quotes are rounded toward the nearest whole -number in US Dollars. - - function CleanUp() { - # clean up time series; eliminate incomplete data sets - for (d = 1; d <= daycount; d++) { - for (stock = 1; stock <= StockCount; stock++) - if (! ((days[d], stock) in quote)) - stock = StockCount + 10 - if (stock > StockCount + 1) - continue - datacount++ - for (stock = 1; stock <= StockCount; stock++) - data[datacount, stock] = int(0.5 + quote[days[d], stock]) - } - delete quote - delete days - } - - Now we have arrived at the second really interesting part of the -whole affair. What we present here is a very primitive prediction -algorithm: _If a stock fell yesterday, assume it will also fall today; -if it rose yesterday, assume it will rise today_. (Feel free to replace -this algorithm with a smarter one.) If a stock changed in the same -direction on two consecutive days, this is an indication which should be -highlighted. Two-day advances are stored in 'hot' and two-day declines -in 'avoid'. - - The rest of the function is a sanity check. It counts the number of -correct predictions in relation to the total number of predictions one -could have made in the year before. - - function Prediction() { - # Predict each ticker symbol by prolonging yesterday's trend - for (stock = 1; stock <= StockCount; stock++) { - if (data[1, stock] > data[2, stock]) { - predict[stock] = "up" - } else if (data[1, stock] < data[2, stock]) { - predict[stock] = "down" - } else { - predict[stock] = "neutral" - } - if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) - hot[stock] = 1 - if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) - avoid[stock] = 1 - } - # Do a plausibility check: how many predictions proved correct? - for (s = 1; s <= StockCount; s++) { - for (d = 1; d <= datacount-2; d++) { - if (data[d+1, s] > data[d+2, s]) { - UpCount++ - } else if (data[d+1, s] < data[d+2, s]) { - DownCount++ - } else { - NeutralCount++ - } - if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) || - ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) || - ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) - CorrectCount++ - } - } - } - - At this point the hard work has been done: the array 'predict' -contains the predictions for all the ticker symbols. It is up to the -function 'Report()' to find some nice words to introduce the desired -information. - - function Report() { - # Generate report - report = "\nThis is your daily " - report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" - report = report "Here are the predictions for today:\n\n" - for (stock = 1; stock <= StockCount; stock++) - report = report "\t" name[stock] "\t" predict[stock] "\n" - for (stock in hot) { - if (HotCount++ == 0) - report = report "\nThe most promising shares for today are these:\n\n" - report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ - tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" - } - for (stock in avoid) { - if (AvoidCount++ == 0) - report = report "\nThe stock shares to avoid today are these:\n\n" - report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ - tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" - } - report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 - report = report " losers. When using this kind\nof prediction scheme for" - report = report " the 12 months which lie behind us,\nwe get " UpCount - report = report " 'ups' and " DownCount " 'downs' and " NeutralCount - report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount - report = report " predictions " CorrectCount " proved correct next day.\n" - report = report "A success rate of "\ - int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" - report = report "Random choice would have produced a 33% success rate.\n" - report = report "Disclaimer: Like every other prediction of the stock\n" - report = report "market, this report is, of course, complete nonsense.\n" - report = report "If you are stupid enough to believe these predictions\n" - report = report "you should visit a doctor who can treat your ailment." - } - - The function 'SendMail()' goes through the list of customers and -opens a pipe to the 'mail' command for each of them. Each one receives -an email message with a proper subject heading and is addressed with his -full name. - - function SendMail() { - # send report to customers - customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge" - customer["more@utopia.org" ] = "Sir Thomas More" - customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza" - customer["marx@highgate.uk" ] = "Karl Marx" - customer["keynes@the.long.run" ] = "John Maynard Keynes" - customer["bierce@devil.hell.org" ] = "Ambrose Bierce" - customer["laplace@paris.fr" ] = "Pierre Simon de Laplace" - for (c in customer) { - MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c - print "Good morning " customer[c] "," | MailPipe - print report "\n.\n" | MailPipe - close(MailPipe) - } - } - - Be patient when running the script by hand. Retrieving the data for -all the ticker symbols and sending the emails may take several minutes -to complete, depending upon network traffic and the speed of the -available Internet link. The quality of the prediction algorithm is -likely to be disappointing. Try to find a better one. Should you find -one with a success rate of more than 50%, please tell us about it! It -is only for the sake of curiosity, of course. ':-)' - - -File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques - -3.10 PROTBASE: Searching Through A Protein Database -=================================================== - - Hoare's Law of Large Problems: Inside every large problem is a - small problem struggling to get out. - - Yahoo's database of stock market data is just one among the many -large databases on the Internet. Another one is located at NCBI -(National Center for Biotechnology Information). Established in 1988 as -a national resource for molecular biology information, NCBI creates -public databases, conducts research in computational biology, develops -software tools for analyzing genome data, and disseminates biomedical -information. In this section, we look at one of NCBI's public services, -which is called BLAST (Basic Local Alignment Search Tool). - - You probably know that the information necessary for reproducing -living cells is encoded in the genetic material of the cells. The -genetic material is a very long chain of four base nucleotides. It is -the order of appearance (the sequence) of nucleotides which contains the -information about the substance to be produced. Scientists in -biotechnology often find a specific fragment, determine the nucleotide -sequence, and need to know where the sequence at hand comes from. This -is where the large databases enter the game. At NCBI, databases store -the knowledge about which sequences have ever been found and where they -have been found. When the scientist sends his sequence to the BLAST -service, the server looks for regions of genetic material in its -database which look the most similar to the delivered nucleotide -sequence. After a search time of some seconds or minutes the server -sends an answer to the scientist. In order to make access simple, NCBI -chose to offer their database service through popular Internet -protocols. There are four basic ways to use the so-called BLAST -services: - - * The easiest way to use BLAST is through the web. Users may simply - point their browsers at the NCBI home page and link to the BLAST - pages. NCBI provides a stable URL that may be used to perform - BLAST searches without interactive use of a web browser. This is - what we will do later in this section. A demonstration client and - a 'README' file demonstrate how to access this URL. - - * Currently, 'blastcl3' is the standard network BLAST client. You - can download 'blastcl3' from the anonymous FTP location. - - * BLAST 2.0 can be run locally as a full executable and can be used - to run BLAST searches against private local databases, or - downloaded copies of the NCBI databases. BLAST 2.0 executables may - be found on the NCBI anonymous FTP server. - - * The NCBI BLAST Email server is the best option for people without - convenient access to the web. A similarity search can be performed - by sending a properly formatted mail message containing the - nucleotide or protein query sequence to . - The query sequence is compared against the specified database using - the BLAST algorithm and the results are returned in an email - message. For more information on formulating email BLAST searches, - you can send a message consisting of the word "HELP" to the same - address, . - - Our starting point is the demonstration client mentioned in the first -option. The 'README' file that comes along with the client explains the -whole process in a nutshell. In the rest of this section, we first show -what such requests look like. Then we show how to use 'gawk' to -implement a client in about 10 lines of code. Finally, we show how to -interpret the result returned from the service. - - Sequences are expected to be represented in the standard IUB/IUPAC -amino acid and nucleic acid codes, with these exceptions: lower-case -letters are accepted and are mapped into upper-case; a single hyphen or -dash can be used to represent a gap of indeterminate length; and in -amino acid sequences, 'U' and '*' are acceptable letters (see below). -Before submitting a request, any numerical digits in the query sequence -should either be removed or replaced by appropriate letter codes (e.g., -'N' for unknown nucleic acid residue or 'X' for unknown amino acid -residue). The nucleic acid codes supported are: - - A --> adenosine M --> A C (amino) - C --> cytidine S --> G C (strong) - G --> guanine W --> A T (weak) - T --> thymidine B --> G T C - U --> uridine D --> G A T - R --> G A (purine) H --> A C T - Y --> T C (pyrimidine) V --> G C A - K --> G T (keto) N --> A G C T (any) - - gap of indeterminate length - - Now you know the alphabet of nucleotide sequences. The last two -lines of the following example query show you such a sequence, which is -obviously made up only of elements of the alphabet just described. -Store this example query into a file named 'protbase.request'. You are -now ready to send it to the server with the demonstration client. - - PROGRAM blastn - DATALIB month - EXPECT 0.75 - BEGIN - >GAWK310 the gawking gene GNU AWK - tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat - caccaccatggacagcaaa - - The actual search request begins with the mandatory parameter -'PROGRAM' in the first column followed by the value 'blastn' (the name -of the program) for searching nucleic acids. The next line contains the -mandatory search parameter 'DATALIB' with the value 'month' for the -newest nucleic acid sequences. The third line contains an optional -'EXPECT' parameter and the value desired for it. The fourth line -contains the mandatory 'BEGIN' directive, followed by the query sequence -in FASTA/Pearson format. Each line of information must be less than 80 -characters in length. - - The "month" database contains all new or revised sequences released -in the last 30 days and is useful for searching against new sequences. -There are five different blast programs, 'blastn' being the one that -compares a nucleotide query sequence against a nucleotide sequence -database. - - The last server directive that must appear in every request is the -'BEGIN' directive. The query sequence should immediately follow the -'BEGIN' directive and must appear in FASTA/Pearson format. A sequence -in FASTA/Pearson format begins with a single-line description. The -description line, which is required, is distinguished from the lines of -sequence data that follow it by having a greater-than ('>') symbol in -the first column. For the purposes of the BLAST server, the text of the -description is arbitrary. - - If you prefer to use a client written in 'gawk', just store the -following 10 lines of code into a file named 'protbase.awk' and use this -client instead. Invoke it with 'gawk -f protbase.awk protbase.request'. -Then wait a minute and watch the result coming in. In order to -replicate the demonstration client's behavior as closely as possible, -this client does not use a proxy server. We could also have extended -the client program in *note Retrieving Web Pages: GETURL, to implement -the client request from 'protbase.awk' as a special case. - - { request = request "\n" $0 } - - END { - BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" - printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService - printf "Content-Length: " length(request) "\n\n" |& BLASTService - printf request |& BLASTService - while ((BLASTService |& getline) > 0) - print $0 - close(BLASTService) - } - - The demonstration client from NCBI is 214 lines long (written in C) -and it is not immediately obvious what it does. Our client is so short -that it _is_ obvious what it does. First it loops over all lines of the -query and stores the whole query into a variable. Then the script -establishes an Internet connection to the NCBI server and transmits the -query by framing it with a proper HTTP request. Finally it receives and -prints the complete result coming from the server. - - Now, let us look at the result. It begins with an HTTP header, which -you can ignore. Then there are some comments about the query having -been filtered to avoid spuriously high scores. After this, there is a -reference to the paper that describes the software being used for -searching the data base. After a repetition of the original query's -description we find the list of significant alignments: - - Sequences producing significant alignments: (bits) Value - - gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 - gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 - emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 - emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 - emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 - emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 - gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 - - This means that the query sequence was found in seven human -chromosomes. But the value 0.20 (20%) means that the probability of an -accidental match is rather high (20%) in all cases and should be taken -into account. You may wonder what the first column means. It is a key -to the specific database in which this occurrence was found. The unique -sequence identifiers reported in the search results can be used as -sequence retrieval keys via the NCBI server. The syntax of sequence -header lines used by the NCBI BLAST server depends on the database from -which each sequence was obtained. The table below lists the identifiers -for the databases from which the sequences were derived. - - Database Name Identifier Syntax - ============================ ======================== - GenBank gb|accession|locus - EMBL Data Library emb|accession|locus - DDBJ, DNA Database of Japan dbj|accession|locus - NBRF PIR pir||entry - Protein Research Foundation prf||name - SWISS-PROT sp|accession|entry name - Brookhaven Protein Data Bank pdb|entry|chain - Kabat's Sequences of Immuno... gnl|kabat|identifier - Patents pat|country|number - GenInfo Backbone Id bbs|number - - For example, an identifier might be 'gb|AC021182.14|AC021182', where -the 'gb' tag indicates that the identifier refers to a GenBank sequence, -'AC021182.14' is its GenBank ACCESSION, and 'AC021182' is the GenBank -LOCUS. The identifier contains no spaces, so that a space indicates the -end of the identifier. - - Let us continue in the result listing. Each of the seven alignments -mentioned above is subsequently described in detail. We will have a -closer look at the first of them. - - >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4 - unordered pieces - Length = 176383 - - Score = 38.2 bits (19), Expect = 0.20 - Identities = 19/19 (100%) - Strand = Plus / Plus - - Query: 35 tggtgaagtgtgtttcttg 53 - ||||||||||||||||||| - Sbjct: 69786 tggtgaagtgtgtttcttg 69804 - - This alignment was located on the human chromosome 7. The fragment -on which part of the query was found had a total length of 176383. Only -19 of the nucleotides matched and the matching sequence ran from -character 35 to 53 in the query sequence and from 69786 to 69804 in the -fragment on chromosome 7. If you are still reading at this point, you -are probably interested in finding out more about Computational Biology -and you might appreciate the following hints. - - 1. There is a book called 'Introduction to Computational Biology' by - Michael S. Waterman, which is worth reading if you are seriously - interested. You can find a good book review on the Internet. - - 2. While Waterman's book can explain to you the algorithms employed - internally in the database search engines, most practitioners - prefer to approach the subject differently. The applied side of - Computational Biology is called Bioinformatics, and emphasizes the - tools available for day-to-day work as well as how to actually - _use_ them. One of the very few affordable books on Bioinformatics - is 'Developing Bioinformatics Computer Skills'. - - 3. The sequences _gawk_ and _gnuawk_ are in widespread use in the - genetic material of virtually every earthly living being. Let us - take this as a clear indication that the divine creator has - intended 'gawk' to prevail over other scripting languages such as - 'perl', 'tcl', or 'python' which are not even proper sequences. - (:-) - - -File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top - -4 Related Links -*************** - -This section lists the URLs for various items discussed in this major -node. They are presented in the order in which they appear. - -'Internet Programming with Python' - - -'Advanced Perl Programming' - - -'Web Client Programming with Perl' - - -Richard Stevens's home page and book - - -The SPAK home page - - -Volume III of 'Internetworking with TCP/IP', by Comer and Stevens - - -XBM Graphics File Format - - -GNUPlot - - -Mark Humphrys' Eliza page - - -Yahoo! Eliza Information - - -Java versions of Eliza - - -Java versions of Eliza with source code - - -Eliza Programs with Explanations - - -Loebner Contest - - -Tck/Tk Information - - -Intel 80x86 Processors - - -AMD Elan Processors - - -XINU - - -GNU/Linux - - -Embedded PCs - - -MiniSQL - - -Market Share Surveys - - -'Numerical Recipes in C: The Art of Scientific Computing' - - -VRML - - -The VRML FAQ - - -The UMBC Agent Web - - -Apache Web Server - - -National Center for Biotechnology Information (NCBI) - - -Basic Local Alignment Search Tool (BLAST) - - -NCBI Home Page - - -BLAST Pages - - -BLAST Demonstration Client - - -BLAST anonymous FTP location - - -BLAST 2.0 Executables - - -IUB/IUPAC Amino Acid and Nucleic Acid Codes - - -FASTA/Pearson Format - - -Fasta/Pearson Sequence in Java - - -Book Review of 'Introduction to Computational Biology' - - -'Developing Bioinformatics Computer Skills' - - - -File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top - -GNU Free Documentation License -****************************** - - Version 1.3, 3 November 2008 - - Copyright (C) 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc. - - - Everyone is permitted to copy and distribute verbatim copies - of this license document, but changing it is not allowed. - - 0. PREAMBLE - - The purpose of this License is to make a manual, textbook, or other - functional and useful document "free" in the sense of freedom: to - assure everyone the effective freedom to copy and redistribute it, - with or without modifying it, either commercially or - noncommercially. Secondarily, this License preserves for the - author and publisher a way to get credit for their work, while not - being considered responsible for modifications made by others. - - This License is a kind of "copyleft", which means that derivative - works of the document must themselves be free in the same sense. - It complements the GNU General Public License, which is a copyleft - license designed for free software. - - We have designed this License in order to use it for manuals for - free software, because free software needs free documentation: a - free program should come with manuals providing the same freedoms - that the software does. But this License is not limited to - software manuals; it can be used for any textual work, regardless - of subject matter or whether it is published as a printed book. We - recommend this License principally for works whose purpose is - instruction or reference. - - 1. APPLICABILITY AND DEFINITIONS - - This License applies to any manual or other work, in any medium, - that contains a notice placed by the copyright holder saying it can - be distributed under the terms of this License. Such a notice - grants a world-wide, royalty-free license, unlimited in duration, - to use that work under the conditions stated herein. The - "Document", below, refers to any such manual or work. Any member - of the public is a licensee, and is addressed as "you". You accept - the license if you copy, modify or distribute the work in a way - requiring permission under copyright law. - - A "Modified Version" of the Document means any work containing the - Document or a portion of it, either copied verbatim, or with - modifications and/or translated into another language. - - A "Secondary Section" is a named appendix or a front-matter section - of the Document that deals exclusively with the relationship of the - publishers or authors of the Document to the Document's overall - subject (or to related matters) and contains nothing that could - fall directly within that overall subject. (Thus, if the Document - is in part a textbook of mathematics, a Secondary Section may not - explain any mathematics.) The relationship could be a matter of - historical connection with the subject or with related matters, or - of legal, commercial, philosophical, ethical or political position - regarding them. - - The "Invariant Sections" are certain Secondary Sections whose - titles are designated, as being those of Invariant Sections, in the - notice that says that the Document is released under this License. - If a section does not fit the above definition of Secondary then it - is not allowed to be designated as Invariant. The Document may - contain zero Invariant Sections. If the Document does not identify - any Invariant Sections then there are none. - - The "Cover Texts" are certain short passages of text that are - listed, as Front-Cover Texts or Back-Cover Texts, in the notice - that says that the Document is released under this License. A - Front-Cover Text may be at most 5 words, and a Back-Cover Text may - be at most 25 words. - - A "Transparent" copy of the Document means a machine-readable copy, - represented in a format whose specification is available to the - general public, that is suitable for revising the document - straightforwardly with generic text editors or (for images composed - of pixels) generic paint programs or (for drawings) some widely - available drawing editor, and that is suitable for input to text - formatters or for automatic translation to a variety of formats - suitable for input to text formatters. A copy made in an otherwise - Transparent file format whose markup, or absence of markup, has - been arranged to thwart or discourage subsequent modification by - readers is not Transparent. An image format is not Transparent if - used for any substantial amount of text. A copy that is not - "Transparent" is called "Opaque". - - Examples of suitable formats for Transparent copies include plain - ASCII without markup, Texinfo input format, LaTeX input format, - SGML or XML using a publicly available DTD, and standard-conforming - simple HTML, PostScript or PDF designed for human modification. - Examples of transparent image formats include PNG, XCF and JPG. - Opaque formats include proprietary formats that can be read and - edited only by proprietary word processors, SGML or XML for which - the DTD and/or processing tools are not generally available, and - the machine-generated HTML, PostScript or PDF produced by some word - processors for output purposes only. - - The "Title Page" means, for a printed book, the title page itself, - plus such following pages as are needed to hold, legibly, the - material this License requires to appear in the title page. For - works in formats which do not have any title page as such, "Title - Page" means the text near the most prominent appearance of the - work's title, preceding the beginning of the body of the text. - - The "publisher" means any person or entity that distributes copies - of the Document to the public. - - A section "Entitled XYZ" means a named subunit of the Document - whose title either is precisely XYZ or contains XYZ in parentheses - following text that translates XYZ in another language. (Here XYZ - stands for a specific section name mentioned below, such as - "Acknowledgements", "Dedications", "Endorsements", or "History".) - To "Preserve the Title" of such a section when you modify the - Document means that it remains a section "Entitled XYZ" according - to this definition. - - The Document may include Warranty Disclaimers next to the notice - which states that this License applies to the Document. These - Warranty Disclaimers are considered to be included by reference in - this License, but only as regards disclaiming warranties: any other - implication that these Warranty Disclaimers may have is void and - has no effect on the meaning of this License. - - 2. VERBATIM COPYING - - You may copy and distribute the Document in any medium, either - commercially or noncommercially, provided that this License, the - copyright notices, and the license notice saying this License - applies to the Document are reproduced in all copies, and that you - add no other conditions whatsoever to those of this License. You - may not use technical measures to obstruct or control the reading - or further copying of the copies you make or distribute. However, - you may accept compensation in exchange for copies. If you - distribute a large enough number of copies you must also follow the - conditions in section 3. - - You may also lend copies, under the same conditions stated above, - and you may publicly display copies. - - 3. COPYING IN QUANTITY - - If you publish printed copies (or copies in media that commonly - have printed covers) of the Document, numbering more than 100, and - the Document's license notice requires Cover Texts, you must - enclose the copies in covers that carry, clearly and legibly, all - these Cover Texts: Front-Cover Texts on the front cover, and - Back-Cover Texts on the back cover. Both covers must also clearly - and legibly identify you as the publisher of these copies. The - front cover must present the full title with all words of the title - equally prominent and visible. You may add other material on the - covers in addition. Copying with changes limited to the covers, as - long as they preserve the title of the Document and satisfy these - conditions, can be treated as verbatim copying in other respects. - - If the required texts for either cover are too voluminous to fit - legibly, you should put the first ones listed (as many as fit - reasonably) on the actual cover, and continue the rest onto - adjacent pages. - - If you publish or distribute Opaque copies of the Document - numbering more than 100, you must either include a machine-readable - Transparent copy along with each Opaque copy, or state in or with - each Opaque copy a computer-network location from which the general - network-using public has access to download using public-standard - network protocols a complete Transparent copy of the Document, free - of added material. If you use the latter option, you must take - reasonably prudent steps, when you begin distribution of Opaque - copies in quantity, to ensure that this Transparent copy will - remain thus accessible at the stated location until at least one - year after the last time you distribute an Opaque copy (directly or - through your agents or retailers) of that edition to the public. - - It is requested, but not required, that you contact the authors of - the Document well before redistributing any large number of copies, - to give them a chance to provide you with an updated version of the - Document. - - 4. MODIFICATIONS - - You may copy and distribute a Modified Version of the Document - under the conditions of sections 2 and 3 above, provided that you - release the Modified Version under precisely this License, with the - Modified Version filling the role of the Document, thus licensing - distribution and modification of the Modified Version to whoever - possesses a copy of it. In addition, you must do these things in - the Modified Version: - - A. Use in the Title Page (and on the covers, if any) a title - distinct from that of the Document, and from those of previous - versions (which should, if there were any, be listed in the - History section of the Document). You may use the same title - as a previous version if the original publisher of that - version gives permission. - - B. List on the Title Page, as authors, one or more persons or - entities responsible for authorship of the modifications in - the Modified Version, together with at least five of the - principal authors of the Document (all of its principal - authors, if it has fewer than five), unless they release you - from this requirement. - - C. State on the Title page the name of the publisher of the - Modified Version, as the publisher. - - D. Preserve all the copyright notices of the Document. - - E. Add an appropriate copyright notice for your modifications - adjacent to the other copyright notices. - - F. Include, immediately after the copyright notices, a license - notice giving the public permission to use the Modified - Version under the terms of this License, in the form shown in - the Addendum below. - - G. Preserve in that license notice the full lists of Invariant - Sections and required Cover Texts given in the Document's - license notice. - - H. Include an unaltered copy of this License. - - I. Preserve the section Entitled "History", Preserve its Title, - and add to it an item stating at least the title, year, new - authors, and publisher of the Modified Version as given on the - Title Page. If there is no section Entitled "History" in the - Document, create one stating the title, year, authors, and - publisher of the Document as given on its Title Page, then add - an item describing the Modified Version as stated in the - previous sentence. - - J. Preserve the network location, if any, given in the Document - for public access to a Transparent copy of the Document, and - likewise the network locations given in the Document for - previous versions it was based on. These may be placed in the - "History" section. You may omit a network location for a work - that was published at least four years before the Document - itself, or if the original publisher of the version it refers - to gives permission. - - K. For any section Entitled "Acknowledgements" or "Dedications", - Preserve the Title of the section, and preserve in the section - all the substance and tone of each of the contributor - acknowledgements and/or dedications given therein. - - L. Preserve all the Invariant Sections of the Document, unaltered - in their text and in their titles. Section numbers or the - equivalent are not considered part of the section titles. - - M. Delete any section Entitled "Endorsements". Such a section - may not be included in the Modified Version. - - N. Do not retitle any existing section to be Entitled - "Endorsements" or to conflict in title with any Invariant - Section. - - O. Preserve any Warranty Disclaimers. - - If the Modified Version includes new front-matter sections or - appendices that qualify as Secondary Sections and contain no - material copied from the Document, you may at your option designate - some or all of these sections as invariant. To do this, add their - titles to the list of Invariant Sections in the Modified Version's - license notice. These titles must be distinct from any other - section titles. - - You may add a section Entitled "Endorsements", provided it contains - nothing but endorsements of your Modified Version by various - parties--for example, statements of peer review or that the text - has been approved by an organization as the authoritative - definition of a standard. - - You may add a passage of up to five words as a Front-Cover Text, - and a passage of up to 25 words as a Back-Cover Text, to the end of - the list of Cover Texts in the Modified Version. Only one passage - of Front-Cover Text and one of Back-Cover Text may be added by (or - through arrangements made by) any one entity. If the Document - already includes a cover text for the same cover, previously added - by you or by arrangement made by the same entity you are acting on - behalf of, you may not add another; but you may replace the old - one, on explicit permission from the previous publisher that added - the old one. - - The author(s) and publisher(s) of the Document do not by this - License give permission to use their names for publicity for or to - assert or imply endorsement of any Modified Version. - - 5. COMBINING DOCUMENTS - - You may combine the Document with other documents released under - this License, under the terms defined in section 4 above for - modified versions, provided that you include in the combination all - of the Invariant Sections of all of the original documents, - unmodified, and list them all as Invariant Sections of your - combined work in its license notice, and that you preserve all - their Warranty Disclaimers. - - The combined work need only contain one copy of this License, and - multiple identical Invariant Sections may be replaced with a single - copy. If there are multiple Invariant Sections with the same name - but different contents, make the title of each such section unique - by adding at the end of it, in parentheses, the name of the - original author or publisher of that section if known, or else a - unique number. Make the same adjustment to the section titles in - the list of Invariant Sections in the license notice of the - combined work. - - In the combination, you must combine any sections Entitled - "History" in the various original documents, forming one section - Entitled "History"; likewise combine any sections Entitled - "Acknowledgements", and any sections Entitled "Dedications". You - must delete all sections Entitled "Endorsements." - - 6. COLLECTIONS OF DOCUMENTS - - You may make a collection consisting of the Document and other - documents released under this License, and replace the individual - copies of this License in the various documents with a single copy - that is included in the collection, provided that you follow the - rules of this License for verbatim copying of each of the documents - in all other respects. - - You may extract a single document from such a collection, and - distribute it individually under this License, provided you insert - a copy of this License into the extracted document, and follow this - License in all other respects regarding verbatim copying of that - document. - - 7. AGGREGATION WITH INDEPENDENT WORKS - - A compilation of the Document or its derivatives with other - separate and independent documents or works, in or on a volume of a - storage or distribution medium, is called an "aggregate" if the - copyright resulting from the compilation is not used to limit the - legal rights of the compilation's users beyond what the individual - works permit. When the Document is included in an aggregate, this - License does not apply to the other works in the aggregate which - are not themselves derivative works of the Document. - - If the Cover Text requirement of section 3 is applicable to these - copies of the Document, then if the Document is less than one half - of the entire aggregate, the Document's Cover Texts may be placed - on covers that bracket the Document within the aggregate, or the - electronic equivalent of covers if the Document is in electronic - form. Otherwise they must appear on printed covers that bracket - the whole aggregate. - - 8. TRANSLATION - - Translation is considered a kind of modification, so you may - distribute translations of the Document under the terms of section - 4. Replacing Invariant Sections with translations requires special - permission from their copyright holders, but you may include - translations of some or all Invariant Sections in addition to the - original versions of these Invariant Sections. You may include a - translation of this License, and all the license notices in the - Document, and any Warranty Disclaimers, provided that you also - include the original English version of this License and the - original versions of those notices and disclaimers. In case of a - disagreement between the translation and the original version of - this License or a notice or disclaimer, the original version will - prevail. - - If a section in the Document is Entitled "Acknowledgements", - "Dedications", or "History", the requirement (section 4) to - Preserve its Title (section 1) will typically require changing the - actual title. - - 9. TERMINATION - - You may not copy, modify, sublicense, or distribute the Document - except as expressly provided under this License. Any attempt - otherwise to copy, modify, sublicense, or distribute it is void, - and will automatically terminate your rights under this License. - - However, if you cease all violation of this License, then your - license from a particular copyright holder is reinstated (a) - provisionally, unless and until the copyright holder explicitly and - finally terminates your license, and (b) permanently, if the - copyright holder fails to notify you of the violation by some - reasonable means prior to 60 days after the cessation. - - Moreover, your license from a particular copyright holder is - reinstated permanently if the copyright holder notifies you of the - violation by some reasonable means, this is the first time you have - received notice of violation of this License (for any work) from - that copyright holder, and you cure the violation prior to 30 days - after your receipt of the notice. - - Termination of your rights under this section does not terminate - the licenses of parties who have received copies or rights from you - under this License. If your rights have been terminated and not - permanently reinstated, receipt of a copy of some or all of the - same material does not give you any rights to use it. - - 10. FUTURE REVISIONS OF THIS LICENSE - - The Free Software Foundation may publish new, revised versions of - the GNU Free Documentation License from time to time. Such new - versions will be similar in spirit to the present version, but may - differ in detail to address new problems or concerns. See - . - - Each version of the License is given a distinguishing version - number. If the Document specifies that a particular numbered - version of this License "or any later version" applies to it, you - have the option of following the terms and conditions either of - that specified version or of any later version that has been - published (not as a draft) by the Free Software Foundation. If the - Document does not specify a version number of this License, you may - choose any version ever published (not as a draft) by the Free - Software Foundation. If the Document specifies that a proxy can - decide which future versions of this License can be used, that - proxy's public statement of acceptance of a version permanently - authorizes you to choose that version for the Document. - - 11. RELICENSING - - "Massive Multiauthor Collaboration Site" (or "MMC Site") means any - World Wide Web server that publishes copyrightable works and also - provides prominent facilities for anybody to edit those works. A - public wiki that anybody can edit is an example of such a server. - A "Massive Multiauthor Collaboration" (or "MMC") contained in the - site means any set of copyrightable works thus published on the MMC - site. - - "CC-BY-SA" means the Creative Commons Attribution-Share Alike 3.0 - license published by Creative Commons Corporation, a not-for-profit - corporation with a principal place of business in San Francisco, - California, as well as future copyleft versions of that license - published by that same organization. - - "Incorporate" means to publish or republish a Document, in whole or - in part, as part of another Document. - - An MMC is "eligible for relicensing" if it is licensed under this - License, and if all works that were first published under this - License somewhere other than this MMC, and subsequently - incorporated in whole or in part into the MMC, (1) had no cover - texts or invariant sections, and (2) were thus incorporated prior - to November 1, 2008. - - The operator of an MMC Site may republish an MMC contained in the - site under CC-BY-SA on the same site at any time before August 1, - 2009, provided the MMC is eligible for relicensing. - -ADDENDUM: How to use this License for your documents -==================================================== - -To use this License in a document you have written, include a copy of -the License in the document and put the following copyright and license -notices just after the title page: - - Copyright (C) YEAR YOUR NAME. - Permission is granted to copy, distribute and/or modify this document - under the terms of the GNU Free Documentation License, Version 1.3 - or any later version published by the Free Software Foundation; - with no Invariant Sections, no Front-Cover Texts, and no Back-Cover - Texts. A copy of the license is included in the section entitled ``GNU - Free Documentation License''. - - If you have Invariant Sections, Front-Cover Texts and Back-Cover -Texts, replace the "with...Texts." line with this: - - with the Invariant Sections being LIST THEIR TITLES, with - the Front-Cover Texts being LIST, and with the Back-Cover Texts - being LIST. - - If you have Invariant Sections without Cover Texts, or some other -combination of the three, merge those two alternatives to suit the -situation. - - If your document contains nontrivial examples of program code, we -recommend releasing these examples in parallel under your choice of free -software license, such as the GNU General Public License, to permit -their use in free software. - - -File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top - -Index -***** - -[index] -* Menu: - -* /inet/ files (gawk): Gawk Special Files. (line 34) -* /inet/tcp special files (gawk): File /inet/tcp. (line 6) -* /inet/udp special files (gawk): File /inet/udp. (line 6) -* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25) -* advanced features, network connections: Troubleshooting. (line 6) -* agent: Challenges. (line 75) -* agent <1>: MOBAGWHO. (line 6) -* AI: Challenges. (line 75) -* apache: WEBGRAB. (line 72) -* apache <1>: MOBAGWHO. (line 42) -* Bioinformatics: PROTBASE. (line 227) -* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6) -* blocking: Making Connections. (line 35) -* Boutell, Thomas: STATIST. (line 6) -* CGI (Common Gateway Interface): MOBAGWHO. (line 42) -* CGI (Common Gateway Interface), dynamic web pages and: Web page. - (line 45) -* CGI (Common Gateway Interface), library: CGI Lib. (line 11) -* clients: Making Connections. (line 21) -* Clinton, Bill: Challenges. (line 58) -* Common Gateway Interface, See CGI: Web page. (line 45) -* Computational Biology: PROTBASE. (line 227) -* contest: Challenges. (line 6) -* cron utility: STOXPRED. (line 23) -* CSV format: STOXPRED. (line 128) -* Dow Jones Industrial Index: STOXPRED. (line 44) -* ELIZA program: Simple Server. (line 11) -* ELIZA program <1>: Simple Server. (line 178) -* email: Email. (line 11) -* FASTA/Pearson format: PROTBASE. (line 102) -* FDL (Free Documentation License): GNU Free Documentation License. - (line 6) -* filenames, for network access: Gawk Special Files. (line 29) -* files, /inet/ (gawk): Gawk Special Files. (line 34) -* files, /inet/tcp (gawk): File /inet/tcp. (line 6) -* files, /inet/udp (gawk): File /inet/udp. (line 6) -* finger utility: Setting Up. (line 22) -* Free Documentation License (FDL): GNU Free Documentation License. - (line 6) -* FTP (File Transfer Protocol): Basic Protocols. (line 45) -* gawk, networking: Using Networking. (line 6) -* gawk, networking, connections: Special File Fields. (line 53) -* gawk, networking, connections <1>: TCP Connecting. (line 6) -* gawk, networking, filenames: Gawk Special Files. (line 29) -* gawk, networking, See Also email: Email. (line 6) -* gawk, networking, service, establishing: Setting Up. (line 6) -* gawk, networking, troubleshooting: Caveats. (line 6) -* gawk, web and, See web service: Interacting Service. (line 6) -* getline command: TCP Connecting. (line 11) -* GETURL program: GETURL. (line 6) -* GIF image format: Web page. (line 45) -* GIF image format <1>: STATIST. (line 6) -* GNU Free Documentation License: GNU Free Documentation License. - (line 6) -* GNU/Linux: Troubleshooting. (line 54) -* GNU/Linux <1>: Interacting. (line 27) -* GNU/Linux <2>: REMCONF. (line 6) -* GNUPlot utility: Interacting Service. (line 189) -* GNUPlot utility <1>: STATIST. (line 6) -* Hoare, C.A.R.: MOBAGWHO. (line 6) -* Hoare, C.A.R. <1>: PROTBASE. (line 6) -* hostname field: Special File Fields. (line 34) -* HTML (Hypertext Markup Language): Web page. (line 29) -* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 45) -* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6) -* HTTP (Hypertext Transfer Protocol), record separators and: Web page. - (line 29) -* HTTP server, core logic: Interacting Service. (line 6) -* HTTP server, core logic <1>: Interacting Service. (line 24) -* Humphrys, Mark: Simple Server. (line 178) -* Hypertext Markup Language (HTML): Web page. (line 29) -* Hypertext Transfer Protocol, See HTTP: Web page. (line 6) -* image format: STATIST. (line 6) -* images, in web pages: Interacting Service. (line 189) -* images, retrieving over networks: Web page. (line 45) -* input/output, two-way, See Also gawk, networking: Gawk Special Files. - (line 19) -* Internet, See networks: Interacting. (line 48) -* JavaScript: STATIST. (line 56) -* Linux: Troubleshooting. (line 54) -* Linux <1>: Interacting. (line 27) -* Linux <2>: REMCONF. (line 6) -* Lisp: MOBAGWHO. (line 98) -* localport field: Gawk Special Files. (line 34) -* Loebner, Hugh: Challenges. (line 6) -* Loui, Ronald: Challenges. (line 75) -* MAZE: MAZE. (line 6) -* Microsoft Windows: WEBGRAB. (line 43) -* Microsoft Windows, networking: Troubleshooting. (line 54) -* Microsoft Windows, networking, ports: Setting Up. (line 37) -* MiniSQL: REMCONF. (line 109) -* MOBAGWHO program: MOBAGWHO. (line 6) -* NCBI, National Center for Biotechnology Information: PROTBASE. - (line 6) -* network type field: Special File Fields. (line 11) -* networks, gawk and: Using Networking. (line 6) -* networks, gawk and, connections: Special File Fields. (line 53) -* networks, gawk and, connections <1>: TCP Connecting. (line 6) -* networks, gawk and, filenames: Gawk Special Files. (line 29) -* networks, gawk and, See Also email: Email. (line 6) -* networks, gawk and, service, establishing: Setting Up. (line 6) -* networks, gawk and, troubleshooting: Caveats. (line 6) -* networks, ports, reserved: Setting Up. (line 37) -* networks, ports, specifying: Special File Fields. (line 24) -* networks, See Also web pages: PANIC. (line 6) -* Numerical Recipes: STATIST. (line 24) -* ORS variable, HTTP and: Web page. (line 29) -* ORS variable, POP and: Email. (line 36) -* PANIC program: PANIC. (line 6) -* Perl: Using Networking. (line 14) -* Perl, gawk networking and: Using Networking. (line 24) -* Perlis, Alan: MAZE. (line 6) -* pipes, networking and: TCP Connecting. (line 30) -* PNG image format: Web page. (line 45) -* PNG image format <1>: STATIST. (line 6) -* POP (Post Office Protocol): Email. (line 6) -* POP (Post Office Protocol) <1>: Email. (line 36) -* Post Office Protocol (POP): Email. (line 6) -* PostScript: STATIST. (line 138) -* PROLOG: Challenges. (line 75) -* PROTBASE: PROTBASE. (line 6) -* protocol field: Special File Fields. (line 17) -* PS image format: STATIST. (line 6) -* Python: Using Networking. (line 14) -* Python, gawk networking and: Using Networking. (line 24) -* record separators, HTTP and: Web page. (line 29) -* record separators, POP and: Email. (line 36) -* REMCONF program: REMCONF. (line 6) -* remoteport field: Gawk Special Files. (line 34) -* RFC 1939: Email. (line 6) -* RFC 1939 <1>: Email. (line 36) -* RFC 1945: Web page. (line 29) -* RFC 2068: Web page. (line 6) -* RFC 2068 <1>: Interacting Service. (line 104) -* RFC 2616: Web page. (line 6) -* RFC 821: Email. (line 6) -* robot: Challenges. (line 84) -* robot <1>: WEBGRAB. (line 6) -* RS variable, HTTP and: Web page. (line 29) -* RS variable, POP and: Email. (line 36) -* servers: Making Connections. (line 14) -* servers <1>: Setting Up. (line 22) -* servers, as hosts: Special File Fields. (line 34) -* servers, HTTP: Interacting Service. (line 6) -* servers, web: Simple Server. (line 6) -* Simple Mail Transfer Protocol (SMTP): Email. (line 6) -* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 45) -* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6) -* STATIST program: STATIST. (line 6) -* STOXPRED program: STOXPRED. (line 6) -* synchronous communications: Making Connections. (line 35) -* Tcl/Tk: Using Networking. (line 14) -* Tcl/Tk, gawk and: Using Networking. (line 24) -* Tcl/Tk, gawk and <1>: Some Applications and Techniques. - (line 22) -* TCP (Transmission Control Protocol): Using Networking. (line 29) -* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6) -* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting. - (line 6) -* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48) -* TCP/IP, network type, selecting: Special File Fields. (line 11) -* TCP/IP, protocols, selecting: Special File Fields. (line 17) -* TCP/IP, sockets and: Gawk Special Files. (line 19) -* Transmission Control Protocol, See TCP: Using Networking. (line 29) -* troubleshooting, gawk, networks: Caveats. (line 6) -* troubleshooting, networks, connections: Troubleshooting. (line 6) -* troubleshooting, networks, timeouts: Caveats. (line 18) -* UDP (User Datagram Protocol): File /inet/udp. (line 6) -* UDP (User Datagram Protocol), TCP and: Interacting. (line 48) -* Unix, network ports and: Setting Up. (line 37) -* URLCHK program: URLCHK. (line 6) -* User Datagram Protocol, See UDP: File /inet/udp. (line 6) -* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25) -* VRML: MAZE. (line 6) -* web browsers, See web service: Interacting Service. (line 6) -* web pages: Web page. (line 6) -* web pages, images in: Interacting Service. (line 189) -* web pages, retrieving: GETURL. (line 6) -* web servers: Simple Server. (line 6) -* web service: Primitive Service. (line 6) -* web service <1>: PANIC. (line 6) -* WEBGRAB program: WEBGRAB. (line 6) -* Weizenbaum, Joseph: Simple Server. (line 11) -* XBM image format: Interacting Service. (line 189) -* Yahoo!: REMCONF. (line 6) -* Yahoo! <1>: STOXPRED. (line 6) - - - -Tag Table: -Node: Top2022 -Node: Preface5665 -Node: Introduction7040 -Node: Stream Communications8066 -Node: Datagram Communications9240 -Node: The TCP/IP Protocols10870 -Ref: The TCP/IP Protocols-Footnote-111554 -Node: Basic Protocols11711 -Ref: Basic Protocols-Footnote-113756 -Node: Ports13785 -Node: Making Connections15192 -Ref: Making Connections-Footnote-117750 -Ref: Making Connections-Footnote-217797 -Node: Using Networking17978 -Node: Gawk Special Files20301 -Node: Special File Fields22110 -Ref: table-inet-components26003 -Node: Comparing Protocols27312 -Node: File /inet/tcp27846 -Node: File /inet/udp28874 -Ref: File /inet/udp-Footnote-130573 -Node: TCP Connecting30827 -Node: Troubleshooting33173 -Ref: Troubleshooting-Footnote-136232 -Node: Interacting36805 -Node: Setting Up39545 -Node: Email43048 -Node: Web page45380 -Ref: Web page-Footnote-148197 -Node: Primitive Service48395 -Node: Interacting Service51136 -Ref: Interacting Service-Footnote-160303 -Node: CGI Lib60335 -Node: Simple Server67310 -Ref: Simple Server-Footnote-175053 -Node: Caveats75154 -Node: Challenges76299 -Node: Some Applications and Techniques84997 -Node: PANIC87462 -Node: GETURL89186 -Node: REMCONF91819 -Node: URLCHK97314 -Node: WEBGRAB101166 -Node: STATIST105628 -Ref: STATIST-Footnote-1117377 -Node: MAZE117822 -Node: MOBAGWHO124029 -Ref: MOBAGWHO-Footnote-1138047 -Node: STOXPRED138102 -Node: PROTBASE152390 -Node: Links165506 -Node: GNU Free Documentation License168939 -Node: Index194059 - -End Tag Table -- cgit v1.2.3