diff options
author | Arnold D. Robbins <arnold@skeeve.com> | 2021-01-25 20:48:46 +0200 |
---|---|---|
committer | Arnold D. Robbins <arnold@skeeve.com> | 2021-01-25 20:48:46 +0200 |
commit | e02e38ad7bd54ced8baa24cca6e931a62b0c1deb (patch) | |
tree | 62bd754667f2c85c36640899093366d36444a846 /doc/wordlist4 | |
parent | d8c6a45489bcc9d0125ce0e2c76e3f1a42e5ef46 (diff) | |
download | egawk-e02e38ad7bd54ced8baa24cca6e931a62b0c1deb.tar.gz egawk-e02e38ad7bd54ced8baa24cca6e931a62b0c1deb.tar.bz2 egawk-e02e38ad7bd54ced8baa24cca6e931a62b0c1deb.zip |
Fix some spelling errors in the doc, update word lists.
Diffstat (limited to 'doc/wordlist4')
-rw-r--r-- | doc/wordlist4 | 63 |
1 files changed, 63 insertions, 0 deletions
diff --git a/doc/wordlist4 b/doc/wordlist4 index f267327a..e3fe646b 100644 --- a/doc/wordlist4 +++ b/doc/wordlist4 @@ -14,10 +14,12 @@ Ayalon BGCOLOR BLASTService BR +BitMap Boutell CC CELLPADDING CEST +CET CGI CNN CSV @@ -36,6 +38,7 @@ DECnet DEF DONT DTD +DarkFinger Degeneres DownCount EK @@ -76,6 +79,7 @@ Hoare's HotCount HttpService Humphrys +Humphrys's HyperText IM IMG @@ -127,11 +131,13 @@ MyOrigin MyPort MyPrefix MyProxy +NBK NBRF NCBI NCBI's NF NR +Nace NetService NeutralCount NewLength @@ -161,6 +167,7 @@ PostScript Pragma Prez ProxyPort +QUIC REMCONF RFCs RP @@ -173,7 +180,9 @@ SA SBC SNMP SPAK +SPDY SRC +SSRNYG STARTOFRANGE STATIST STOXPRED @@ -202,6 +211,7 @@ UMBC URI URLCHK URLfile +USB UTX UpCount VLINK @@ -213,6 +223,7 @@ WINNT WMT Waterman's Weizenbaum +WinDir WorldWideWeb XBM XCF @@ -226,7 +237,9 @@ YOUVE YSIZE YahooData YouSay +ab abcdef +abs acm adelphia adenosine @@ -234,6 +247,8 @@ advperl ai ambientIntensity amd +andrew +arihuang arnold asc ascii @@ -242,7 +257,9 @@ au awk awkforai awkinet +awklib bbs +berkeley bierce bigskip bioskills @@ -256,6 +273,9 @@ boutell br caccaccatggacagcaaa canberra +catpipeclient +catpipeserver +cewing cgi cgilib ch @@ -264,6 +284,8 @@ charset chayden chrisc cindex +cmu +codeanticode codon columnfractions com @@ -284,6 +306,8 @@ cytidine dartmouth datacount daycount +daytimeclient +daytimeserver dbj dcu dd @@ -303,7 +327,11 @@ dir dircategory direntry dist +dl +doi +downloader ducktown +eda edu eg ek @@ -312,9 +340,12 @@ emailhost emb embedpc emph +en endfile +english epd evenheading +exe exp fakenode fasta @@ -331,15 +362,18 @@ fr fsbassociates fsf ftest +fulldisclosure gawcon gawkinet gawknet gawnetf gd +genebee geninfo getline geturl gif +github gnl gnuawk gnuplot @@ -362,17 +396,20 @@ httpd https httpserver hughes +hughestech humphrys iX ibeta ibm ie +ietf ifhtml ifinfo ifnotinfo ifnottex iftex igawk +igw inet inetlib inmargin @@ -383,7 +420,9 @@ intel interline introcb invsqrt +io ip +ips irc iso java @@ -391,14 +430,17 @@ jp jpl kabat kazusa +kbd keto keynes +knowledgecenter kohala laplace len lflashlight li libc +libgd lifeisgood lineo linespace @@ -407,11 +449,15 @@ localhost localport loebner loui +mailpopclient mailto marx +microsoft mkdir mobag moritz +msql +msu multiline multitable myhost @@ -430,6 +476,7 @@ netgawk netscape netstat nih +nist nl nlm nntp @@ -442,6 +489,7 @@ nph nr nthese nwe +ocf oddheading offinterlineskip openURL @@ -455,6 +503,7 @@ pdb pdict perl pir +plaintext png postoffice pre @@ -478,6 +527,7 @@ remoteport rendez retr rf +rfc rflashlight rhf rm @@ -486,8 +536,10 @@ rvices samp sapiens sc +scitable scriptics sd +seclists seealso seeentry serv @@ -497,6 +549,7 @@ setchapternewpage setfilename settitle sez +sg shtml skeeve skyAngle @@ -511,6 +564,7 @@ spinoza spoonsful sprintf srand +stackexchange statist stderr stdin @@ -519,6 +573,7 @@ stoxdata stoxpred str strftime +su subentry subj subjold @@ -535,10 +590,13 @@ tcl tcp tcpcon tcpip +technet technicalinfo +techrepublic testserv tex texinfo +tf tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat tggtgaagtgtgtttcttg thischapter @@ -549,6 +607,7 @@ titlepage tjhsst tmp tolower +topicpage toupper ttytst tutest @@ -585,9 +644,13 @@ webclient webgrab webser webserx +wikipedia +windowsserver +wnace wold wotsit wouldnt +ws wustl www xbm |