aboutsummaryrefslogtreecommitdiffstats
path: root/doc
diff options
context:
space:
mode:
authorArnold D. Robbins <arnold@skeeve.com>2016-10-25 21:40:16 +0300
committerArnold D. Robbins <arnold@skeeve.com>2016-10-25 21:40:16 +0300
commit24e562f07cb9c6d70f49eeb9a74ffba8101ba834 (patch)
tree24ed74f7ff9f6eb8dbb866e09bd9d4d23d0b39e8 /doc
parente56b6eabe183ed5fa1352ef0f5f49fb6d894578c (diff)
parent8231da563c810ce210ce309ee1a022bad22a1e13 (diff)
downloadegawk-24e562f07cb9c6d70f49eeb9a74ffba8101ba834.tar.gz
egawk-24e562f07cb9c6d70f49eeb9a74ffba8101ba834.tar.bz2
egawk-24e562f07cb9c6d70f49eeb9a74ffba8101ba834.zip
Merge branch 'master' into feature/nocopy
Diffstat (limited to 'doc')
-rw-r--r--doc/ChangeLog7
-rw-r--r--doc/gawk.15
-rw-r--r--doc/gawk.info35733
-rw-r--r--doc/gawk.texi134
-rw-r--r--doc/gawkinet.info4406
-rw-r--r--doc/gawktexi.in66
6 files changed, 200 insertions, 40151 deletions
diff --git a/doc/ChangeLog b/doc/ChangeLog
index 305fc8e4..a3069283 100644
--- a/doc/ChangeLog
+++ b/doc/ChangeLog
@@ -1,3 +1,10 @@
+2016-10-25 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawktexi.in: Document that negative arguments are not allowed
+ for bitwise functions. Add a sidebar explaining it a bit and
+ also showing the difference with and without -M.
+ * gawk.1: Document that negative arguments are not allowed.
+
2016-10-23 Arnold D. Robbins <arnold@skeeve.com>
* gawktexi.in: Remove references to MS-DOS and OS/2,
diff --git a/doc/gawk.1 b/doc/gawk.1
index 751f8b89..22b41f34 100644
--- a/doc/gawk.1
+++ b/doc/gawk.1
@@ -3181,6 +3181,11 @@ values to
.B uintmax_t
integers, doing the operation, and then converting the
result back to floating point.
+.PP
+.BR NOTE :
+Passing negative operands to any of these functions causes
+a fatal error.
+.PP
The functions are:
.TP "\w'\fBrshift(\fIval\fB, \fIcount\fB)\fR'u+2n"
\fBand(\fIv1\fB, \fIv2 \fR[, ...]\fB)\fR
diff --git a/doc/gawk.info b/doc/gawk.info
deleted file mode 100644
index 1faa775c..00000000
--- a/doc/gawk.info
+++ /dev/null
@@ -1,35733 +0,0 @@
-This is gawk.info, produced by makeinfo version 6.1 from gawk.texi.
-
-Copyright (C) 1989, 1991, 1992, 1993, 1996-2005, 2007, 2009-2016
-Free Software Foundation, Inc.
-
-
- This is Edition 4.1 of 'GAWK: Effective AWK Programming: A User's
-Guide for GNU Awk', for the 4.1.4 (or later) version of the GNU
-implementation of AWK.
-
- Permission is granted to copy, distribute and/or modify this document
-under the terms of the GNU Free Documentation License, Version 1.3 or
-any later version published by the Free Software Foundation; with the
-Invariant Sections being "GNU General Public License", with the
-Front-Cover Texts being "A GNU Manual", and with the Back-Cover Texts as
-in (a) below. A copy of the license is included in the section entitled
-"GNU Free Documentation License".
-
- a. The FSF's Back-Cover Text is: "You have the freedom to copy and
- modify this GNU manual."
-INFO-DIR-SECTION Text creation and manipulation
-START-INFO-DIR-ENTRY
-* Gawk: (gawk). A text scanning and processing language.
-END-INFO-DIR-ENTRY
-
-INFO-DIR-SECTION Individual utilities
-START-INFO-DIR-ENTRY
-* awk: (gawk)Invoking gawk. Text scanning and processing.
-END-INFO-DIR-ENTRY
-
-
-File: gawk.info, Node: Top, Next: Foreword3, Up: (dir)
-
-General Introduction
-********************
-
-This file documents 'awk', a program that you can use to select
-particular records in a file and perform operations upon them.
-
- Copyright (C) 1989, 1991, 1992, 1993, 1996-2005, 2007, 2009-2016
-Free Software Foundation, Inc.
-
-
- This is Edition 4.1 of 'GAWK: Effective AWK Programming: A User's
-Guide for GNU Awk', for the 4.1.4 (or later) version of the GNU
-implementation of AWK.
-
- Permission is granted to copy, distribute and/or modify this document
-under the terms of the GNU Free Documentation License, Version 1.3 or
-any later version published by the Free Software Foundation; with the
-Invariant Sections being "GNU General Public License", with the
-Front-Cover Texts being "A GNU Manual", and with the Back-Cover Texts as
-in (a) below. A copy of the license is included in the section entitled
-"GNU Free Documentation License".
-
- a. The FSF's Back-Cover Text is: "You have the freedom to copy and
- modify this GNU manual."
-
-* Menu:
-
-* Foreword3:: Some nice words about this
- Info file.
-* Foreword4:: More nice words.
-* Preface:: What this Info file is about; brief
- history and acknowledgments.
-* Getting Started:: A basic introduction to using
- 'awk'. How to run an 'awk'
- program. Command-line syntax.
-* Invoking Gawk:: How to run 'gawk'.
-* Regexp:: All about matching things using regular
- expressions.
-* Reading Files:: How to read files and manipulate fields.
-* Printing:: How to print using 'awk'. Describes
- the 'print' and 'printf'
- statements. Also describes redirection of
- output.
-* Expressions:: Expressions are the basic building blocks
- of statements.
-* Patterns and Actions:: Overviews of patterns and actions.
-* Arrays:: The description and use of arrays. Also
- includes array-oriented control statements.
-* Functions:: Built-in and user-defined functions.
-* Library Functions:: A Library of 'awk' Functions.
-* Sample Programs:: Many 'awk' programs with complete
- explanations.
-* Advanced Features:: Stuff for advanced users, specific to
- 'gawk'.
-* Internationalization:: Getting 'gawk' to speak your
- language.
-* Debugger:: The 'gawk' debugger.
-* Arbitrary Precision Arithmetic:: Arbitrary precision arithmetic with
- 'gawk'.
-* Dynamic Extensions:: Adding new built-in functions to
- 'gawk'.
-* Language History:: The evolution of the 'awk'
- language.
-* Installation:: Installing 'gawk' under various
- operating systems.
-* Notes:: Notes about adding things to 'gawk'
- and possible future work.
-* Basic Concepts:: A very quick introduction to programming
- concepts.
-* Glossary:: An explanation of some unfamiliar terms.
-* Copying:: Your right to copy and distribute
- 'gawk'.
-* GNU Free Documentation License:: The license for this Info file.
-* Index:: Concept and Variable Index.
-
-* History:: The history of 'gawk' and
- 'awk'.
-* Names:: What name to use to find
- 'awk'.
-* This Manual:: Using this Info file. Includes
- sample input files that you can use.
-* Conventions:: Typographical Conventions.
-* Manual History:: Brief history of the GNU project and
- this Info file.
-* How To Contribute:: Helping to save the world.
-* Acknowledgments:: Acknowledgments.
-* Running gawk:: How to run 'gawk' programs;
- includes command-line syntax.
-* One-shot:: Running a short throwaway
- 'awk' program.
-* Read Terminal:: Using no input files (input from the
- keyboard instead).
-* Long:: Putting permanent 'awk'
- programs in files.
-* Executable Scripts:: Making self-contained 'awk'
- programs.
-* Comments:: Adding documentation to 'gawk'
- programs.
-* Quoting:: More discussion of shell quoting
- issues.
-* DOS Quoting:: Quoting in Windows Batch Files.
-* Sample Data Files:: Sample data files for use in the
- 'awk' programs illustrated in
- this Info file.
-* Very Simple:: A very simple example.
-* Two Rules:: A less simple one-line example using
- two rules.
-* More Complex:: A more complex example.
-* Statements/Lines:: Subdividing or combining statements
- into lines.
-* Other Features:: Other Features of 'awk'.
-* When:: When to use 'gawk' and when to
- use other things.
-* Intro Summary:: Summary of the introduction.
-* Command Line:: How to run 'awk'.
-* Options:: Command-line options and their
- meanings.
-* Other Arguments:: Input file names and variable
- assignments.
-* Naming Standard Input:: How to specify standard input with
- other files.
-* Environment Variables:: The environment variables
- 'gawk' uses.
-* AWKPATH Variable:: Searching directories for
- 'awk' programs.
-* AWKLIBPATH Variable:: Searching directories for
- 'awk' shared libraries.
-* Other Environment Variables:: The environment variables.
-* Exit Status:: 'gawk''s exit status.
-* Include Files:: Including other files into your
- program.
-* Loading Shared Libraries:: Loading shared libraries into your
- program.
-* Obsolete:: Obsolete Options and/or features.
-* Undocumented:: Undocumented Options and Features.
-* Invoking Summary:: Invocation summary.
-* Regexp Usage:: How to Use Regular Expressions.
-* Escape Sequences:: How to write nonprinting characters.
-* Regexp Operators:: Regular Expression Operators.
-* Bracket Expressions:: What can go between '[...]'.
-* Leftmost Longest:: How much text matches.
-* Computed Regexps:: Using Dynamic Regexps.
-* GNU Regexp Operators:: Operators specific to GNU software.
-* Case-sensitivity:: How to do case-insensitive matching.
-* Strong Regexp Constants:: Strongly typed regexp constants.
-* Regexp Summary:: Regular expressions summary.
-* Records:: Controlling how data is split into
- records.
-* awk split records:: How standard 'awk' splits
- records.
-* gawk split records:: How 'gawk' splits records.
-* Fields:: An introduction to fields.
-* Nonconstant Fields:: Nonconstant Field Numbers.
-* Changing Fields:: Changing the Contents of a Field.
-* Field Separators:: The field separator and how to change
- it.
-* Default Field Splitting:: How fields are normally separated.
-* Regexp Field Splitting:: Using regexps as the field separator.
-* Single Character Fields:: Making each character a separate
- field.
-* Command Line Field Separator:: Setting 'FS' from the command
- line.
-* Full Line Fields:: Making the full line be a single
- field.
-* Field Splitting Summary:: Some final points and a summary table.
-* Constant Size:: Reading constant width data.
-* Splitting By Content:: Defining Fields By Content
-* Multiple Line:: Reading multiline records.
-* Getline:: Reading files under explicit program
- control using the 'getline'
- function.
-* Plain Getline:: Using 'getline' with no
- arguments.
-* Getline/Variable:: Using 'getline' into a variable.
-* Getline/File:: Using 'getline' from a file.
-* Getline/Variable/File:: Using 'getline' into a variable
- from a file.
-* Getline/Pipe:: Using 'getline' from a pipe.
-* Getline/Variable/Pipe:: Using 'getline' into a variable
- from a pipe.
-* Getline/Coprocess:: Using 'getline' from a coprocess.
-* Getline/Variable/Coprocess:: Using 'getline' into a variable
- from a coprocess.
-* Getline Notes:: Important things to know about
- 'getline'.
-* Getline Summary:: Summary of 'getline' Variants.
-* Read Timeout:: Reading input with a timeout.
-* Retrying Input:: Retrying input after certain errors.
-* Command-line directories:: What happens if you put a directory on
- the command line.
-* Input Summary:: Input summary.
-* Input Exercises:: Exercises.
-* Print:: The 'print' statement.
-* Print Examples:: Simple examples of 'print'
- statements.
-* Output Separators:: The output separators and how to
- change them.
-* OFMT:: Controlling Numeric Output With
- 'print'.
-* Printf:: The 'printf' statement.
-* Basic Printf:: Syntax of the 'printf' statement.
-* Control Letters:: Format-control letters.
-* Format Modifiers:: Format-specification modifiers.
-* Printf Examples:: Several examples.
-* Redirection:: How to redirect output to multiple
- files and pipes.
-* Special FD:: Special files for I/O.
-* Special Files:: File name interpretation in
- 'gawk'. 'gawk' allows
- access to inherited file descriptors.
-* Other Inherited Files:: Accessing other open files with
- 'gawk'.
-* Special Network:: Special files for network
- communications.
-* Special Caveats:: Things to watch out for.
-* Close Files And Pipes:: Closing Input and Output Files and
- Pipes.
-* Nonfatal:: Enabling Nonfatal Output.
-* Output Summary:: Output summary.
-* Output Exercises:: Exercises.
-* Values:: Constants, Variables, and Regular
- Expressions.
-* Constants:: String, numeric and regexp constants.
-* Scalar Constants:: Numeric and string constants.
-* Nondecimal-numbers:: What are octal and hex numbers.
-* Regexp Constants:: Regular Expression constants.
-* Using Constant Regexps:: When and how to use a regexp constant.
-* Variables:: Variables give names to values for
- later use.
-* Using Variables:: Using variables in your programs.
-* Assignment Options:: Setting variables on the command line
- and a summary of command-line syntax.
- This is an advanced method of input.
-* Conversion:: The conversion of strings to numbers
- and vice versa.
-* Strings And Numbers:: How 'awk' Converts Between
- Strings And Numbers.
-* Locale influences conversions:: How the locale may affect conversions.
-* All Operators:: 'gawk''s operators.
-* Arithmetic Ops:: Arithmetic operations ('+',
- '-', etc.)
-* Concatenation:: Concatenating strings.
-* Assignment Ops:: Changing the value of a variable or a
- field.
-* Increment Ops:: Incrementing the numeric value of a
- variable.
-* Truth Values and Conditions:: Testing for true and false.
-* Truth Values:: What is "true" and what is
- "false".
-* Typing and Comparison:: How variables acquire types and how
- this affects comparison of numbers and
- strings with '<', etc.
-* Variable Typing:: String type versus numeric type.
-* Comparison Operators:: The comparison operators.
-* POSIX String Comparison:: String comparison with POSIX rules.
-* Boolean Ops:: Combining comparison expressions using
- boolean operators '||' ("or"),
- '&&' ("and") and '!'
- ("not").
-* Conditional Exp:: Conditional expressions select between
- two subexpressions under control of a
- third subexpression.
-* Function Calls:: A function call is an expression.
-* Precedence:: How various operators nest.
-* Locales:: How the locale affects things.
-* Expressions Summary:: Expressions summary.
-* Pattern Overview:: What goes into a pattern.
-* Regexp Patterns:: Using regexps as patterns.
-* Expression Patterns:: Any expression can be used as a
- pattern.
-* Ranges:: Pairs of patterns specify record
- ranges.
-* BEGIN/END:: Specifying initialization and cleanup
- rules.
-* Using BEGIN/END:: How and why to use BEGIN/END rules.
-* I/O And BEGIN/END:: I/O issues in BEGIN/END rules.
-* BEGINFILE/ENDFILE:: Two special patterns for advanced
- control.
-* Empty:: The empty pattern, which matches every
- record.
-* Using Shell Variables:: How to use shell variables with
- 'awk'.
-* Action Overview:: What goes into an action.
-* Statements:: Describes the various control
- statements in detail.
-* If Statement:: Conditionally execute some
- 'awk' statements.
-* While Statement:: Loop until some condition is
- satisfied.
-* Do Statement:: Do specified action while looping
- until some condition is satisfied.
-* For Statement:: Another looping statement, that
- provides initialization and increment
- clauses.
-* Switch Statement:: Switch/case evaluation for conditional
- execution of statements based on a
- value.
-* Break Statement:: Immediately exit the innermost
- enclosing loop.
-* Continue Statement:: Skip to the end of the innermost
- enclosing loop.
-* Next Statement:: Stop processing the current input
- record.
-* Nextfile Statement:: Stop processing the current file.
-* Exit Statement:: Stop execution of 'awk'.
-* Built-in Variables:: Summarizes the predefined variables.
-* User-modified:: Built-in variables that you change to
- control 'awk'.
-* Auto-set:: Built-in variables where 'awk'
- gives you information.
-* ARGC and ARGV:: Ways to use 'ARGC' and
- 'ARGV'.
-* Pattern Action Summary:: Patterns and Actions summary.
-* Array Basics:: The basics of arrays.
-* Array Intro:: Introduction to Arrays
-* Reference to Elements:: How to examine one element of an
- array.
-* Assigning Elements:: How to change an element of an array.
-* Array Example:: Basic Example of an Array
-* Scanning an Array:: A variation of the 'for'
- statement. It loops through the
- indices of an array's existing
- elements.
-* Controlling Scanning:: Controlling the order in which arrays
- are scanned.
-* Numeric Array Subscripts:: How to use numbers as subscripts in
- 'awk'.
-* Uninitialized Subscripts:: Using Uninitialized variables as
- subscripts.
-* Delete:: The 'delete' statement removes an
- element from an array.
-* Multidimensional:: Emulating multidimensional arrays in
- 'awk'.
-* Multiscanning:: Scanning multidimensional arrays.
-* Arrays of Arrays:: True multidimensional arrays.
-* Arrays Summary:: Summary of arrays.
-* Built-in:: Summarizes the built-in functions.
-* Calling Built-in:: How to call built-in functions.
-* Numeric Functions:: Functions that work with numbers,
- including 'int()', 'sin()'
- and 'rand()'.
-* String Functions:: Functions for string manipulation,
- such as 'split()', 'match()'
- and 'sprintf()'.
-* Gory Details:: More than you want to know about
- '\' and '&' with
- 'sub()', 'gsub()', and
- 'gensub()'.
-* I/O Functions:: Functions for files and shell
- commands.
-* Time Functions:: Functions for dealing with timestamps.
-* Bitwise Functions:: Functions for bitwise operations.
-* Type Functions:: Functions for type information.
-* I18N Functions:: Functions for string translation.
-* User-defined:: Describes User-defined functions in
- detail.
-* Definition Syntax:: How to write definitions and what they
- mean.
-* Function Example:: An example function definition and
- what it does.
-* Function Caveats:: Things to watch out for.
-* Calling A Function:: Don't use spaces.
-* Variable Scope:: Controlling variable scope.
-* Pass By Value/Reference:: Passing parameters.
-* Return Statement:: Specifying the value a function
- returns.
-* Dynamic Typing:: How variable types can change at
- runtime.
-* Indirect Calls:: Choosing the function to call at
- runtime.
-* Functions Summary:: Summary of functions.
-* Library Names:: How to best name private global
- variables in library functions.
-* General Functions:: Functions that are of general use.
-* Strtonum Function:: A replacement for the built-in
- 'strtonum()' function.
-* Assert Function:: A function for assertions in
- 'awk' programs.
-* Round Function:: A function for rounding if
- 'sprintf()' does not do it
- correctly.
-* Cliff Random Function:: The Cliff Random Number Generator.
-* Ordinal Functions:: Functions for using characters as
- numbers and vice versa.
-* Join Function:: A function to join an array into a
- string.
-* Getlocaltime Function:: A function to get formatted times.
-* Readfile Function:: A function to read an entire file at
- once.
-* Shell Quoting:: A function to quote strings for the
- shell.
-* Data File Management:: Functions for managing command-line
- data files.
-* Filetrans Function:: A function for handling data file
- transitions.
-* Rewind Function:: A function for rereading the current
- file.
-* File Checking:: Checking that data files are readable.
-* Empty Files:: Checking for zero-length files.
-* Ignoring Assigns:: Treating assignments as file names.
-* Getopt Function:: A function for processing command-line
- arguments.
-* Passwd Functions:: Functions for getting user
- information.
-* Group Functions:: Functions for getting group
- information.
-* Walking Arrays:: A function to walk arrays of arrays.
-* Library Functions Summary:: Summary of library functions.
-* Library Exercises:: Exercises.
-* Running Examples:: How to run these examples.
-* Clones:: Clones of common utilities.
-* Cut Program:: The 'cut' utility.
-* Egrep Program:: The 'egrep' utility.
-* Id Program:: The 'id' utility.
-* Split Program:: The 'split' utility.
-* Tee Program:: The 'tee' utility.
-* Uniq Program:: The 'uniq' utility.
-* Wc Program:: The 'wc' utility.
-* Miscellaneous Programs:: Some interesting 'awk'
- programs.
-* Dupword Program:: Finding duplicated words in a
- document.
-* Alarm Program:: An alarm clock.
-* Translate Program:: A program similar to the 'tr'
- utility.
-* Labels Program:: Printing mailing labels.
-* Word Sorting:: A program to produce a word usage
- count.
-* History Sorting:: Eliminating duplicate entries from a
- history file.
-* Extract Program:: Pulling out programs from Texinfo
- source files.
-* Simple Sed:: A Simple Stream Editor.
-* Igawk Program:: A wrapper for 'awk' that
- includes files.
-* Anagram Program:: Finding anagrams from a dictionary.
-* Signature Program:: People do amazing things with too much
- time on their hands.
-* Programs Summary:: Summary of programs.
-* Programs Exercises:: Exercises.
-* Nondecimal Data:: Allowing nondecimal input data.
-* Array Sorting:: Facilities for controlling array
- traversal and sorting arrays.
-* Controlling Array Traversal:: How to use PROCINFO["sorted_in"].
-* Array Sorting Functions:: How to use 'asort()' and
- 'asorti()'.
-* Two-way I/O:: Two-way communications with another
- process.
-* TCP/IP Networking:: Using 'gawk' for network
- programming.
-* Profiling:: Profiling your 'awk' programs.
-* Advanced Features Summary:: Summary of advanced features.
-* I18N and L10N:: Internationalization and Localization.
-* Explaining gettext:: How GNU 'gettext' works.
-* Programmer i18n:: Features for the programmer.
-* Translator i18n:: Features for the translator.
-* String Extraction:: Extracting marked strings.
-* Printf Ordering:: Rearranging 'printf' arguments.
-* I18N Portability:: 'awk'-level portability
- issues.
-* I18N Example:: A simple i18n example.
-* Gawk I18N:: 'gawk' is also
- internationalized.
-* I18N Summary:: Summary of I18N stuff.
-* Debugging:: Introduction to 'gawk'
- debugger.
-* Debugging Concepts:: Debugging in General.
-* Debugging Terms:: Additional Debugging Concepts.
-* Awk Debugging:: Awk Debugging.
-* Sample Debugging Session:: Sample debugging session.
-* Debugger Invocation:: How to Start the Debugger.
-* Finding The Bug:: Finding the Bug.
-* List of Debugger Commands:: Main debugger commands.
-* Breakpoint Control:: Control of Breakpoints.
-* Debugger Execution Control:: Control of Execution.
-* Viewing And Changing Data:: Viewing and Changing Data.
-* Execution Stack:: Dealing with the Stack.
-* Debugger Info:: Obtaining Information about the
- Program and the Debugger State.
-* Miscellaneous Debugger Commands:: Miscellaneous Commands.
-* Readline Support:: Readline support.
-* Limitations:: Limitations and future plans.
-* Debugging Summary:: Debugging summary.
-* Computer Arithmetic:: A quick intro to computer math.
-* Math Definitions:: Defining terms used.
-* MPFR features:: The MPFR features in 'gawk'.
-* FP Math Caution:: Things to know.
-* Inexactness of computations:: Floating point math is not exact.
-* Inexact representation:: Numbers are not exactly represented.
-* Comparing FP Values:: How to compare floating point values.
-* Errors accumulate:: Errors get bigger as they go.
-* Getting Accuracy:: Getting more accuracy takes some work.
-* Try To Round:: Add digits and round.
-* Setting precision:: How to set the precision.
-* Setting the rounding mode:: How to set the rounding mode.
-* Arbitrary Precision Integers:: Arbitrary Precision Integer Arithmetic
- with 'gawk'.
-* POSIX Floating Point Problems:: Standards Versus Existing Practice.
-* Floating point summary:: Summary of floating point discussion.
-* Extension Intro:: What is an extension.
-* Plugin License:: A note about licensing.
-* Extension Mechanism Outline:: An outline of how it works.
-* Extension API Description:: A full description of the API.
-* Extension API Functions Introduction:: Introduction to the API functions.
-* General Data Types:: The data types.
-* Memory Allocation Functions:: Functions for allocating memory.
-* Constructor Functions:: Functions for creating values.
-* Registration Functions:: Functions to register things with
- 'gawk'.
-* Extension Functions:: Registering extension functions.
-* Exit Callback Functions:: Registering an exit callback.
-* Extension Version String:: Registering a version string.
-* Input Parsers:: Registering an input parser.
-* Output Wrappers:: Registering an output wrapper.
-* Two-way processors:: Registering a two-way processor.
-* Printing Messages:: Functions for printing messages.
-* Updating ERRNO:: Functions for updating 'ERRNO'.
-* Requesting Values:: How to get a value.
-* Accessing Parameters:: Functions for accessing parameters.
-* Symbol Table Access:: Functions for accessing global
- variables.
-* Symbol table by name:: Accessing variables by name.
-* Symbol table by cookie:: Accessing variables by "cookie".
-* Cached values:: Creating and using cached values.
-* Array Manipulation:: Functions for working with arrays.
-* Array Data Types:: Data types for working with arrays.
-* Array Functions:: Functions for working with arrays.
-* Flattening Arrays:: How to flatten arrays.
-* Creating Arrays:: How to create and populate arrays.
-* Redirection API:: How to access and manipulate redirections.
-* Extension API Variables:: Variables provided by the API.
-* Extension Versioning:: API Version information.
-* Extension API Informational Variables:: Variables providing information about
- 'gawk''s invocation.
-* Extension API Boilerplate:: Boilerplate code for using the API.
-* Finding Extensions:: How 'gawk' finds compiled
- extensions.
-* Extension Example:: Example C code for an extension.
-* Internal File Description:: What the new functions will do.
-* Internal File Ops:: The code for internal file operations.
-* Using Internal File Ops:: How to use an external extension.
-* Extension Samples:: The sample extensions that ship with
- 'gawk'.
-* Extension Sample File Functions:: The file functions sample.
-* Extension Sample Fnmatch:: An interface to 'fnmatch()'.
-* Extension Sample Fork:: An interface to 'fork()' and
- other process functions.
-* Extension Sample Inplace:: Enabling in-place file editing.
-* Extension Sample Ord:: Character to value to character
- conversions.
-* Extension Sample Readdir:: An interface to 'readdir()'.
-* Extension Sample Revout:: Reversing output sample output
- wrapper.
-* Extension Sample Rev2way:: Reversing data sample two-way
- processor.
-* Extension Sample Read write array:: Serializing an array to a file.
-* Extension Sample Readfile:: Reading an entire file into a string.
-* Extension Sample Time:: An interface to 'gettimeofday()'
- and 'sleep()'.
-* Extension Sample API Tests:: Tests for the API.
-* gawkextlib:: The 'gawkextlib' project.
-* Extension summary:: Extension summary.
-* Extension Exercises:: Exercises.
-* V7/SVR3.1:: The major changes between V7 and
- System V Release 3.1.
-* SVR4:: Minor changes between System V
- Releases 3.1 and 4.
-* POSIX:: New features from the POSIX standard.
-* BTL:: New features from Brian Kernighan's
- version of 'awk'.
-* POSIX/GNU:: The extensions in 'gawk' not
- in POSIX 'awk'.
-* Feature History:: The history of the features in
- 'gawk'.
-* Common Extensions:: Common Extensions Summary.
-* Ranges and Locales:: How locales used to affect regexp
- ranges.
-* Contributors:: The major contributors to
- 'gawk'.
-* History summary:: History summary.
-* Gawk Distribution:: What is in the 'gawk'
- distribution.
-* Getting:: How to get the distribution.
-* Extracting:: How to extract the distribution.
-* Distribution contents:: What is in the distribution.
-* Unix Installation:: Installing 'gawk' under
- various versions of Unix.
-* Quick Installation:: Compiling 'gawk' under Unix.
-* Shell Startup Files:: Shell convenience functions.
-* Additional Configuration Options:: Other compile-time options.
-* Configuration Philosophy:: How it's all supposed to work.
-* Non-Unix Installation:: Installation on Other Operating
- Systems.
-* PC Installation:: Installing and Compiling 'gawk' on
- Microsoft Windows.
-* PC Binary Installation:: Installing a prepared distribution.
-* PC Compiling:: Compiling 'gawk' for Windows32.
-* PC Using:: Running 'gawk' on Windows32.
-* Cygwin:: Building and running 'gawk'
- for Cygwin.
-* MSYS:: Using 'gawk' In The MSYS
- Environment.
-* VMS Installation:: Installing 'gawk' on VMS.
-* VMS Compilation:: How to compile 'gawk' under
- VMS.
-* VMS Dynamic Extensions:: Compiling 'gawk' dynamic
- extensions on VMS.
-* VMS Installation Details:: How to install 'gawk' under
- VMS.
-* VMS Running:: How to run 'gawk' under VMS.
-* VMS GNV:: The VMS GNV Project.
-* VMS Old Gawk:: An old version comes with some VMS
- systems.
-* Bugs:: Reporting Problems and Bugs.
-* Bug address:: Where to send reports to.
-* Usenet:: Where not to send reports to.
-* Maintainers:: Maintainers of non-*nix ports.
-* Other Versions:: Other freely available 'awk'
- implementations.
-* Installation summary:: Summary of installation.
-* Compatibility Mode:: How to disable certain 'gawk'
- extensions.
-* Additions:: Making Additions To 'gawk'.
-* Accessing The Source:: Accessing the Git repository.
-* Adding Code:: Adding code to the main body of
- 'gawk'.
-* New Ports:: Porting 'gawk' to a new
- operating system.
-* Derived Files:: Why derived files are kept in the Git
- repository.
-* Future Extensions:: New features that may be implemented
- one day.
-* Implementation Limitations:: Some limitations of the
- implementation.
-* Extension Design:: Design notes about the extension API.
-* Old Extension Problems:: Problems with the old mechanism.
-* Extension New Mechanism Goals:: Goals for the new mechanism.
-* Extension Other Design Decisions:: Some other design decisions.
-* Extension Future Growth:: Some room for future growth.
-* Old Extension Mechanism:: Some compatibility for old extensions.
-* Notes summary:: Summary of implementation notes.
-* Basic High Level:: The high level view.
-* Basic Data Typing:: A very quick intro to data types.
-
- To my parents, for their love, and for the wonderful example they set
-for me.
-
- To my wife Miriam, for making me complete. Thank you for building
-your life together with me.
-
- To our children Chana, Rivka, Nachum and Malka, for enrichening our
-lives in innumerable ways.
-
-
-File: gawk.info, Node: Foreword3, Next: Foreword4, Prev: Top, Up: Top
-
-Foreword to the Third Edition
-*****************************
-
-Arnold Robbins and I are good friends. We were introduced in 1990 by
-circumstances--and our favorite programming language, AWK. The
-circumstances started a couple of years earlier. I was working at a new
-job and noticed an unplugged Unix computer sitting in the corner. No
-one knew how to use it, and neither did I. However, a couple of days
-later, it was running, and I was 'root' and the one-and-only user. That
-day, I began the transition from statistician to Unix programmer.
-
- On one of many trips to the library or bookstore in search of books
-on Unix, I found the gray AWK book, a.k.a. Alfred V. Aho, Brian W.
-Kernighan, and Peter J. Weinberger's 'The AWK Programming Language'
-(Addison-Wesley, 1988). 'awk''s simple programming paradigm--find a
-pattern in the input and then perform an action--often reduced complex
-or tedious data manipulations to a few lines of code. I was excited to
-try my hand at programming in AWK.
-
- Alas, the 'awk' on my computer was a limited version of the language
-described in the gray book. I discovered that my computer had "old
-'awk'" and the book described "new 'awk'." I learned that this was
-typical; the old version refused to step aside or relinquish its name.
-If a system had a new 'awk', it was invariably called 'nawk', and few
-systems had it. The best way to get a new 'awk' was to 'ftp' the source
-code for 'gawk' from 'prep.ai.mit.edu'. 'gawk' was a version of new
-'awk' written by David Trueman and Arnold, and available under the GNU
-General Public License.
-
- (Incidentally, it's no longer difficult to find a new 'awk'. 'gawk'
-ships with GNU/Linux, and you can download binaries or source code for
-almost any system; my wife uses 'gawk' on her VMS box.)
-
- My Unix system started out unplugged from the wall; it certainly was
-not plugged into a network. So, oblivious to the existence of 'gawk'
-and the Unix community in general, and desiring a new 'awk', I wrote my
-own, called 'mawk'. Before I was finished, I knew about 'gawk', but it
-was too late to stop, so I eventually posted to a 'comp.sources'
-newsgroup.
-
- A few days after my posting, I got a friendly email from Arnold
-introducing himself. He suggested we share design and algorithms and
-attached a draft of the POSIX standard so that I could update 'mawk' to
-support language extensions added after publication of 'The AWK
-Programming Language'.
-
- Frankly, if our roles had been reversed, I would not have been so
-open and we probably would have never met. I'm glad we did meet. He is
-an AWK expert's AWK expert and a genuinely nice person. Arnold
-contributes significant amounts of his expertise and time to the Free
-Software Foundation.
-
- This book is the 'gawk' reference manual, but at its core it is a
-book about AWK programming that will appeal to a wide audience. It is a
-definitive reference to the AWK language as defined by the 1987 Bell
-Laboratories release and codified in the 1992 POSIX Utilities standard.
-
- On the other hand, the novice AWK programmer can study a wealth of
-practical programs that emphasize the power of AWK's basic idioms:
-data-driven control flow, pattern matching with regular expressions, and
-associative arrays. Those looking for something new can try out
-'gawk''s interface to network protocols via special '/inet' files.
-
- The programs in this book make clear that an AWK program is typically
-much smaller and faster to develop than a counterpart written in C.
-Consequently, there is often a payoff to prototyping an algorithm or
-design in AWK to get it running quickly and expose problems early.
-Often, the interpreted performance is adequate and the AWK prototype
-becomes the product.
-
- The new 'pgawk' (profiling 'gawk'), produces program execution
-counts. I recently experimented with an algorithm that for n lines of
-input, exhibited ~ C n^2 performance, while theory predicted ~ C n log n
-behavior. A few minutes poring over the 'awkprof.out' profile
-pinpointed the problem to a single line of code. 'pgawk' is a welcome
-addition to my programmer's toolbox.
-
- Arnold has distilled over a decade of experience writing and using
-AWK programs, and developing 'gawk', into this book. If you use AWK or
-want to learn how, then read this book.
-
- Michael Brennan
- Author of 'mawk'
- March 2001
-
-
-File: gawk.info, Node: Foreword4, Next: Preface, Prev: Foreword3, Up: Top
-
-Foreword to the Fourth Edition
-******************************
-
-Some things don't change. Thirteen years ago I wrote: "If you use AWK
-or want to learn how, then read this book." True then, and still true
-today.
-
- Learning to use a programming language is about more than mastering
-the syntax. One needs to acquire an understanding of how to use the
-features of the language to solve practical programming problems. A
-focus of this book is many examples that show how to use AWK.
-
- Some things do change. Our computers are much faster and have more
-memory. Consequently, speed and storage inefficiencies of a high-level
-language matter less. Prototyping in AWK and then rewriting in C for
-performance reasons happens less, because more often the prototype is
-fast enough.
-
- Of course, there are computing operations that are best done in C or
-C++. With 'gawk' 4.1 and later, you do not have to choose between
-writing your program in AWK or in C/C++. You can write most of your
-program in AWK and the aspects that require C/C++ capabilities can be
-written in C/C++, and then the pieces glued together when the 'gawk'
-module loads the C/C++ module as a dynamic plug-in. *note Dynamic
-Extensions::, has all the details, and, as expected, many examples to
-help you learn the ins and outs.
-
- I enjoy programming in AWK and had fun (re)reading this book. I
-think you will too.
-
- Michael Brennan
- Author of 'mawk'
- October 2014
-
-
-File: gawk.info, Node: Preface, Next: Getting Started, Prev: Foreword4, Up: Top
-
-Preface
-*******
-
-Several kinds of tasks occur repeatedly when working with text files.
-You might want to extract certain lines and discard the rest. Or you
-may need to make changes wherever certain patterns appear, but leave the
-rest of the file alone. Such jobs are often easy with 'awk'. The 'awk'
-utility interprets a special-purpose programming language that makes it
-easy to handle simple data-reformatting jobs.
-
- The GNU implementation of 'awk' is called 'gawk'; if you invoke it
-with the proper options or environment variables, it is fully compatible
-with the POSIX(1) specification of the 'awk' language and with the Unix
-version of 'awk' maintained by Brian Kernighan. This means that all
-properly written 'awk' programs should work with 'gawk'. So most of the
-time, we don't distinguish between 'gawk' and other 'awk'
-implementations.
-
- Using 'awk' you can:
-
- * Manage small, personal databases
-
- * Generate reports
-
- * Validate data
-
- * Produce indexes and perform other document-preparation tasks
-
- * Experiment with algorithms that you can adapt later to other
- computer languages
-
- In addition, 'gawk' provides facilities that make it easy to:
-
- * Extract bits and pieces of data for processing
-
- * Sort data
-
- * Perform simple network communications
-
- * Profile and debug 'awk' programs
-
- * Extend the language with functions written in C or C++
-
- This Info file teaches you about the 'awk' language and how you can
-use it effectively. You should already be familiar with basic system
-commands, such as 'cat' and 'ls',(2) as well as basic shell facilities,
-such as input/output (I/O) redirection and pipes.
-
- Implementations of the 'awk' language are available for many
-different computing environments. This Info file, while describing the
-'awk' language in general, also describes the particular implementation
-of 'awk' called 'gawk' (which stands for "GNU 'awk'"). 'gawk' runs on a
-broad range of Unix systems, ranging from Intel-architecture PC-based
-computers up through large-scale systems. 'gawk' has also been ported
-to Mac OS X, Microsoft Windows (all versions), and OpenVMS.(3)
-
-* Menu:
-
-* History:: The history of 'gawk' and
- 'awk'.
-* Names:: What name to use to find 'awk'.
-* This Manual:: Using this Info file. Includes sample
- input files that you can use.
-* Conventions:: Typographical Conventions.
-* Manual History:: Brief history of the GNU project and this
- Info file.
-* How To Contribute:: Helping to save the world.
-* Acknowledgments:: Acknowledgments.
-
- ---------- Footnotes ----------
-
- (1) The 2008 POSIX standard is accessible online at
-<http://www.opengroup.org/onlinepubs/9699919799/>.
-
- (2) These utilities are available on POSIX-compliant systems, as well
-as on traditional Unix-based systems. If you are using some other
-operating system, you still need to be familiar with the ideas of I/O
-redirection and pipes.
-
- (3) Some other, obsolete systems to which 'gawk' was once ported are
-no longer supported and the code for those systems has been removed.
-
-
-File: gawk.info, Node: History, Next: Names, Up: Preface
-
-History of 'awk' and 'gawk'
-===========================
-
- Recipe for a Programming Language
-
- 1 part 'egrep' 1 part 'snobol'
- 2 parts 'ed' 3 parts C
-
- Blend all parts well using 'lex' and 'yacc'. Document minimally and
-release.
-
- After eight years, add another part 'egrep' and two more parts C.
-Document very well and release.
-
- The name 'awk' comes from the initials of its designers: Alfred V.
-Aho, Peter J. Weinberger, and Brian W. Kernighan. The original version
-of 'awk' was written in 1977 at AT&T Bell Laboratories. In 1985, a new
-version made the programming language more powerful, introducing
-user-defined functions, multiple input streams, and computed regular
-expressions. This new version became widely available with Unix System
-V Release 3.1 (1987). The version in System V Release 4 (1989) added
-some new features and cleaned up the behavior in some of the "dark
-corners" of the language. The specification for 'awk' in the POSIX
-Command Language and Utilities standard further clarified the language.
-Both the 'gawk' designers and the original 'awk' designers at Bell
-Laboratories provided feedback for the POSIX specification.
-
- Paul Rubin wrote 'gawk' in 1986. Jay Fenlason completed it, with
-advice from Richard Stallman. John Woods contributed parts of the code
-as well. In 1988 and 1989, David Trueman, with help from me, thoroughly
-reworked 'gawk' for compatibility with the newer 'awk'. Circa 1994, I
-became the primary maintainer. Current development focuses on bug
-fixes, performance improvements, standards compliance, and,
-occasionally, new features.
-
- In May 1997, Ju"rgen Kahrs felt the need for network access from
-'awk', and with a little help from me, set about adding features to do
-this for 'gawk'. At that time, he also wrote the bulk of 'TCP/IP
-Internetworking with 'gawk'' (a separate document, available as part of
-the 'gawk' distribution). His code finally became part of the main
-'gawk' distribution with 'gawk' version 3.1.
-
- John Haque rewrote the 'gawk' internals, in the process providing an
-'awk'-level debugger. This version became available as 'gawk' version
-4.0 in 2011.
-
- *Note Contributors:: for a full list of those who have made important
-contributions to 'gawk'.
-
-
-File: gawk.info, Node: Names, Next: This Manual, Prev: History, Up: Preface
-
-A Rose by Any Other Name
-========================
-
-The 'awk' language has evolved over the years. Full details are
-provided in *note Language History::. The language described in this
-Info file is often referred to as "new 'awk'." By analogy, the original
-version of 'awk' is referred to as "old 'awk'."
-
- On most current systems, when you run the 'awk' utility you get some
-version of new 'awk'.(1) If your system's standard 'awk' is the old
-one, you will see something like this if you try the test program:
-
- $ awk 1 /dev/null
- error-> awk: syntax error near line 1
- error-> awk: bailing out near line 1
-
-In this case, you should find a version of new 'awk', or just install
-'gawk'!
-
- Throughout this Info file, whenever we refer to a language feature
-that should be available in any complete implementation of POSIX 'awk',
-we simply use the term 'awk'. When referring to a feature that is
-specific to the GNU implementation, we use the term 'gawk'.
-
- ---------- Footnotes ----------
-
- (1) Only Solaris systems still use an old 'awk' for the default 'awk'
-utility. A more modern 'awk' lives in '/usr/xpg6/bin' on these systems.
-
-
-File: gawk.info, Node: This Manual, Next: Conventions, Prev: Names, Up: Preface
-
-Using This Book
-===============
-
-The term 'awk' refers to a particular program as well as to the language
-you use to tell this program what to do. When we need to be careful, we
-call the language "the 'awk' language," and the program "the 'awk'
-utility." This Info file explains both how to write programs in the
-'awk' language and how to run the 'awk' utility. The term "'awk'
-program" refers to a program written by you in the 'awk' programming
-language.
-
- Primarily, this Info file explains the features of 'awk' as defined
-in the POSIX standard. It does so in the context of the 'gawk'
-implementation. While doing so, it also attempts to describe important
-differences between 'gawk' and other 'awk' implementations.(1) Finally,
-it notes any 'gawk' features that are not in the POSIX standard for
-'awk'.
-
- There are sidebars scattered throughout the Info file. They add a
-more complete explanation of points that are relevant, but not likely to
-be of interest on first reading. All appear in the index, under the
-heading "sidebar."
-
- Most of the time, the examples use complete 'awk' programs. Some of
-the more advanced minor nodes show only the part of the 'awk' program
-that illustrates the concept being described.
-
- Although this Info file is aimed principally at people who have not
-been exposed to 'awk', there is a lot of information here that even the
-'awk' expert should find useful. In particular, the description of
-POSIX 'awk' and the example programs in *note Library Functions::, and
-in *note Sample Programs::, should be of interest.
-
- This Info file is split into several parts, as follows:
-
- * Part I describes the 'awk' language and the 'gawk' program in
- detail. It starts with the basics, and continues through all of
- the features of 'awk'. It contains the following chapters:
-
- - *note Getting Started::, provides the essentials you need to
- know to begin using 'awk'.
-
- - *note Invoking Gawk::, describes how to run 'gawk', the
- meaning of its command-line options, and how it finds 'awk'
- program source files.
-
- - *note Regexp::, introduces regular expressions in general, and
- in particular the flavors supported by POSIX 'awk' and 'gawk'.
-
- - *note Reading Files::, describes how 'awk' reads your data.
- It introduces the concepts of records and fields, as well as
- the 'getline' command. I/O redirection is first described
- here. Network I/O is also briefly introduced here.
-
- - *note Printing::, describes how 'awk' programs can produce
- output with 'print' and 'printf'.
-
- - *note Expressions::, describes expressions, which are the
- basic building blocks for getting most things done in a
- program.
-
- - *note Patterns and Actions::, describes how to write patterns
- for matching records, actions for doing something when a
- record is matched, and the predefined variables 'awk' and
- 'gawk' use.
-
- - *note Arrays::, covers 'awk''s one-and-only data structure:
- the associative array. Deleting array elements and whole
- arrays is described, as well as sorting arrays in 'gawk'. The
- major node also describes how 'gawk' provides arrays of
- arrays.
-
- - *note Functions::, describes the built-in functions 'awk' and
- 'gawk' provide, as well as how to define your own functions.
- It also discusses how 'gawk' lets you call functions
- indirectly.
-
- * Part II shows how to use 'awk' and 'gawk' for problem solving.
- There is lots of code here for you to read and learn from. This
- part contains the following chapters:
-
- - *note Library Functions::, provides a number of functions
- meant to be used from main 'awk' programs.
-
- - *note Sample Programs::, provides many sample 'awk' programs.
-
- Reading these two chapters allows you to see 'awk' solving real
- problems.
-
- * Part III focuses on features specific to 'gawk'. It contains the
- following chapters:
-
- - *note Advanced Features::, describes a number of advanced
- features. Of particular note are the abilities to control the
- order of array traversal, have two-way communications with
- another process, perform TCP/IP networking, and profile your
- 'awk' programs.
-
- - *note Internationalization::, describes special features for
- translating program messages into different languages at
- runtime.
-
- - *note Debugger::, describes the 'gawk' debugger.
-
- - *note Arbitrary Precision Arithmetic::, describes advanced
- arithmetic facilities.
-
- - *note Dynamic Extensions::, describes how to add new variables
- and functions to 'gawk' by writing extensions in C or C++.
-
- * Part IV provides the appendices, the Glossary, and two licenses
- that cover the 'gawk' source code and this Info file, respectively.
- It contains the following appendices:
-
- - *note Language History::, describes how the 'awk' language has
- evolved since its first release to the present. It also
- describes how 'gawk' has acquired features over time.
-
- - *note Installation::, describes how to get 'gawk', how to
- compile it on POSIX-compatible systems, and how to compile and
- use it on different non-POSIX systems. It also describes how
- to report bugs in 'gawk' and where to get other freely
- available 'awk' implementations.
-
- - *note Notes::, describes how to disable 'gawk''s extensions,
- as well as how to contribute new code to 'gawk', and some
- possible future directions for 'gawk' development.
-
- - *note Basic Concepts::, provides some very cursory background
- material for those who are completely unfamiliar with computer
- programming.
-
- The *note Glossary::, defines most, if not all, of the
- significant terms used throughout the Info file. If you find
- terms that you aren't familiar with, try looking them up here.
-
- - *note Copying::, and *note GNU Free Documentation License::,
- present the licenses that cover the 'gawk' source code and
- this Info file, respectively.
-
- ---------- Footnotes ----------
-
- (1) All such differences appear in the index under the entry
-"differences in 'awk' and 'gawk'."
-
-
-File: gawk.info, Node: Conventions, Next: Manual History, Prev: This Manual, Up: Preface
-
-Typographical Conventions
-=========================
-
-This Info file is written in Texinfo
-(http://www.gnu.org/software/texinfo/), the GNU documentation formatting
-language. A single Texinfo source file is used to produce both the
-printed and online versions of the documentation. This minor node
-briefly documents the typographical conventions used in Texinfo.
-
- Examples you would type at the command line are preceded by the
-common shell primary and secondary prompts, '$' and '>'. Input that you
-type is shown 'like this'. Output from the command is preceded by the
-glyph "-|". This typically represents the command's standard output.
-Error messages and other output on the command's standard error are
-preceded by the glyph "error->". For example:
-
- $ echo hi on stdout
- -| hi on stdout
- $ echo hello on stderr 1>&2
- error-> hello on stderr
-
- Characters that you type at the keyboard look 'like this'. In
-particular, there are special characters called "control characters."
-These are characters that you type by holding down both the 'CONTROL'
-key and another key, at the same time. For example, a 'Ctrl-d' is typed
-by first pressing and holding the 'CONTROL' key, next pressing the 'd'
-key, and finally releasing both keys.
-
- For the sake of brevity, throughout this Info file, we refer to Brian
-Kernighan's version of 'awk' as "BWK 'awk'." (*Note Other Versions::
-for information on his and other versions.)
-
-Dark Corners
-------------
-
- Dark corners are basically fractal--no matter how much you
- illuminate, there's always a smaller but darker one.
- -- _Brian Kernighan_
-
- Until the POSIX standard (and 'GAWK: Effective AWK Programming'),
-many features of 'awk' were either poorly documented or not documented
-at all. Descriptions of such features (often called "dark corners") are
-noted in this Info file with "(d.c.)." They also appear in the index
-under the heading "dark corner."
-
- But, as noted by the opening quote, any coverage of dark corners is
-by definition incomplete.
-
- Extensions to the standard 'awk' language that are supported by more
-than one 'awk' implementation are marked "(c.e.)," and listed in the
-index under "common extensions" and "extensions, common."
-
-
-File: gawk.info, Node: Manual History, Next: How To Contribute, Prev: Conventions, Up: Preface
-
-The GNU Project and This Book
-=============================
-
-The Free Software Foundation (FSF) is a nonprofit organization dedicated
-to the production and distribution of freely distributable software. It
-was founded by Richard M. Stallman, the author of the original Emacs
-editor. GNU Emacs is the most widely used version of Emacs today.
-
- The GNU(1) Project is an ongoing effort on the part of the Free
-Software Foundation to create a complete, freely distributable,
-POSIX-compliant computing environment. The FSF uses the GNU General
-Public License (GPL) to ensure that its software's source code is always
-available to the end user. A copy of the GPL is included for your
-reference (*note Copying::). The GPL applies to the C language source
-code for 'gawk'. To find out more about the FSF and the GNU Project
-online, see the GNU Project's home page (http://www.gnu.org). This Info
-file may also be read from GNU's website
-(http://www.gnu.org/software/gawk/manual/).
-
- A shell, an editor (Emacs), highly portable optimizing C, C++, and
-Objective-C compilers, a symbolic debugger and dozens of large and small
-utilities (such as 'gawk'), have all been completed and are freely
-available. The GNU operating system kernel (the HURD), has been
-released but remains in an early stage of development.
-
- Until the GNU operating system is more fully developed, you should
-consider using GNU/Linux, a freely distributable, Unix-like operating
-system for Intel, Power Architecture, Sun SPARC, IBM S/390, and other
-systems.(2) Many GNU/Linux distributions are available for download
-from the Internet.
-
- The Info file itself has gone through multiple previous editions.
-Paul Rubin wrote the very first draft of 'The GAWK Manual'; it was
-around 40 pages long. Diane Close and Richard Stallman improved it,
-yielding a version that was around 90 pages and barely described the
-original, "old" version of 'awk'.
-
- I started working with that version in the fall of 1988. As work on
-it progressed, the FSF published several preliminary versions (numbered
-0.X). In 1996, edition 1.0 was released with 'gawk' 3.0.0. The FSF
-published the first two editions under the title 'The GNU Awk User's
-Guide'.
-
- This edition maintains the basic structure of the previous editions.
-For FSF edition 4.0, the content was thoroughly reviewed and updated.
-All references to 'gawk' versions prior to 4.0 were removed. Of
-significant note for that edition was the addition of *note Debugger::.
-
- For FSF edition 4.1, the content has been reorganized into parts, and
-the major new additions are *note Arbitrary Precision Arithmetic::, and
-*note Dynamic Extensions::.
-
- This Info file will undoubtedly continue to evolve. If you find an
-error in the Info file, please report it! *Note Bugs:: for information
-on submitting problem reports electronically.
-
- ---------- Footnotes ----------
-
- (1) GNU stands for "GNU's Not Unix."
-
- (2) The terminology "GNU/Linux" is explained in the *note Glossary::.
-
-
-File: gawk.info, Node: How To Contribute, Next: Acknowledgments, Prev: Manual History, Up: Preface
-
-How to Contribute
-=================
-
-As the maintainer of GNU 'awk', I once thought that I would be able to
-manage a collection of publicly available 'awk' programs and I even
-solicited contributions. Making things available on the Internet helps
-keep the 'gawk' distribution down to manageable size.
-
- The initial collection of material, such as it is, is still available
-at <ftp://ftp.freefriends.org/arnold/Awkstuff>. In the hopes of doing
-something more broad, I acquired the 'awk.info' domain.
-
- However, I found that I could not dedicate enough time to managing
-contributed code: the archive did not grow and the domain went unused
-for several years.
-
- Late in 2008, a volunteer took on the task of setting up an
-'awk'-related website--<http://awk.info>--and did a very nice job.
-
- If you have written an interesting 'awk' program, or have written a
-'gawk' extension that you would like to share with the rest of the
-world, please see <http://awk.info/?contribute> for how to contribute it
-to the website.
-
-
-File: gawk.info, Node: Acknowledgments, Prev: How To Contribute, Up: Preface
-
-Acknowledgments
-===============
-
-The initial draft of 'The GAWK Manual' had the following
-acknowledgments:
-
- Many people need to be thanked for their assistance in producing
- this manual. Jay Fenlason contributed many ideas and sample
- programs. Richard Mlynarik and Robert Chassell gave helpful
- comments on drafts of this manual. The paper 'A Supplemental
- Document for AWK' by John W. Pierce of the Chemistry Department at
- UC San Diego, pinpointed several issues relevant both to 'awk'
- implementation and to this manual, that would otherwise have
- escaped us.
-
- I would like to acknowledge Richard M. Stallman, for his vision of a
-better world and for his courage in founding the FSF and starting the
-GNU Project.
-
- Earlier editions of this Info file had the following
-acknowledgements:
-
- The following people (in alphabetical order) provided helpful
- comments on various versions of this book: Rick Adams, Dr. Nelson
- H.F. Beebe, Karl Berry, Dr. Michael Brennan, Rich Burridge, Claire
- Cloutier, Diane Close, Scott Deifik, Christopher ("Topher") Eliot,
- Jeffrey Friedl, Dr. Darrel Hankerson, Michal Jaegermann, Dr.
- Richard J. LeBlanc, Michael Lijewski, Pat Rankin, Miriam Robbins,
- Mary Sheehan, and Chuck Toporek.
-
- Robert J. Chassell provided much valuable advice on the use of
- Texinfo. He also deserves special thanks for convincing me _not_
- to title this Info file 'How to Gawk Politely'. Karl Berry helped
- significantly with the TeX part of Texinfo.
-
- I would like to thank Marshall and Elaine Hartholz of Seattle and
- Dr. Bert and Rita Schreiber of Detroit for large amounts of quiet
- vacation time in their homes, which allowed me to make significant
- progress on this Info file and on 'gawk' itself.
-
- Phil Hughes of SSC contributed in a very important way by loaning
- me his laptop GNU/Linux system, not once, but twice, which allowed
- me to do a lot of work while away from home.
-
- David Trueman deserves special credit; he has done a yeoman job of
- evolving 'gawk' so that it performs well and without bugs.
- Although he is no longer involved with 'gawk', working with him on
- this project was a significant pleasure.
-
- The intrepid members of the GNITS mailing list, and most notably
- Ulrich Drepper, provided invaluable help and feedback for the
- design of the internationalization features.
-
- Chuck Toporek, Mary Sheehan, and Claire Cloutier of O'Reilly &
- Associates contributed significant editorial help for this Info
- file for the 3.1 release of 'gawk'.
-
- Dr. Nelson Beebe, Andreas Buening, Dr. Manuel Collado, Antonio
-Colombo, Stephen Davies, Scott Deifik, Akim Demaille, Daniel Richard G.,
-Darrel Hankerson, Michal Jaegermann, Ju"rgen Kahrs, Stepan Kasal, John
-Malmberg, Dave Pitts, Chet Ramey, Pat Rankin, Andrew Schorr, Corinna
-Vinschen, and Eli Zaretskii (in alphabetical order) make up the current
-'gawk' "crack portability team." Without their hard work and help,
-'gawk' would not be nearly the robust, portable program it is today. It
-has been and continues to be a pleasure working with this team of fine
-people.
-
- Notable code and documentation contributions were made by a number of
-people. *Note Contributors:: for the full list.
-
- Thanks to Michael Brennan for the Forewords.
-
- Thanks to Patrice Dumas for the new 'makeinfo' program. Thanks to
-Karl Berry, who continues to work to keep the Texinfo markup language
-sane.
-
- Robert P.J. Day, Michael Brennan, and Brian Kernighan kindly acted as
-reviewers for the 2015 edition of this Info file. Their feedback helped
-improve the final work.
-
- I would also like to thank Brian Kernighan for his invaluable
-assistance during the testing and debugging of 'gawk', and for his
-ongoing help and advice in clarifying numerous points about the
-language. We could not have done nearly as good a job on either 'gawk'
-or its documentation without his help.
-
- Brian is in a class by himself as a programmer and technical author.
-I have to thank him (yet again) for his ongoing friendship and for being
-a role model to me for close to 30 years! Having him as a reviewer is
-an exciting privilege. It has also been extremely humbling...
-
- I must thank my wonderful wife, Miriam, for her patience through the
-many versions of this project, for her proofreading, and for sharing me
-with the computer. I would like to thank my parents for their love, and
-for the grace with which they raised and educated me. Finally, I also
-must acknowledge my gratitude to G-d, for the many opportunities He has
-sent my way, as well as for the gifts He has given me with which to take
-advantage of those opportunities.
-
-
-Arnold Robbins
-Nof Ayalon
-Israel
-February 2015
-
-
-File: gawk.info, Node: Getting Started, Next: Invoking Gawk, Prev: Preface, Up: Top
-
-1 Getting Started with 'awk'
-****************************
-
-The basic function of 'awk' is to search files for lines (or other units
-of text) that contain certain patterns. When a line matches one of the
-patterns, 'awk' performs specified actions on that line. 'awk'
-continues to process input lines in this way until it reaches the end of
-the input files.
-
- Programs in 'awk' are different from programs in most other
-languages, because 'awk' programs are "data driven" (i.e., you describe
-the data you want to work with and then what to do when you find it).
-Most other languages are "procedural"; you have to describe, in great
-detail, every step the program should take. When working with
-procedural languages, it is usually much harder to clearly describe the
-data your program will process. For this reason, 'awk' programs are
-often refreshingly easy to read and write.
-
- When you run 'awk', you specify an 'awk' "program" that tells 'awk'
-what to do. The program consists of a series of "rules" (it may also
-contain "function definitions", an advanced feature that we will ignore
-for now; *note User-defined::). Each rule specifies one pattern to
-search for and one action to perform upon finding the pattern.
-
- Syntactically, a rule consists of a "pattern" followed by an
-"action". The action is enclosed in braces to separate it from the
-pattern. Newlines usually separate rules. Therefore, an 'awk' program
-looks like this:
-
- PATTERN { ACTION }
- PATTERN { ACTION }
- ...
-
-* Menu:
-
-* Running gawk:: How to run 'gawk' programs; includes
- command-line syntax.
-* Sample Data Files:: Sample data files for use in the 'awk'
- programs illustrated in this Info file.
-* Very Simple:: A very simple example.
-* Two Rules:: A less simple one-line example using two
- rules.
-* More Complex:: A more complex example.
-* Statements/Lines:: Subdividing or combining statements into
- lines.
-* Other Features:: Other Features of 'awk'.
-* When:: When to use 'gawk' and when to use
- other things.
-* Intro Summary:: Summary of the introduction.
-
-
-File: gawk.info, Node: Running gawk, Next: Sample Data Files, Up: Getting Started
-
-1.1 How to Run 'awk' Programs
-=============================
-
-There are several ways to run an 'awk' program. If the program is
-short, it is easiest to include it in the command that runs 'awk', like
-this:
-
- awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ...
-
- When the program is long, it is usually more convenient to put it in
-a file and run it with a command like this:
-
- awk -f PROGRAM-FILE INPUT-FILE1 INPUT-FILE2 ...
-
- This minor node discusses both mechanisms, along with several
-variations of each.
-
-* Menu:
-
-* One-shot:: Running a short throwaway 'awk'
- program.
-* Read Terminal:: Using no input files (input from the keyboard
- instead).
-* Long:: Putting permanent 'awk' programs in
- files.
-* Executable Scripts:: Making self-contained 'awk' programs.
-* Comments:: Adding documentation to 'gawk'
- programs.
-* Quoting:: More discussion of shell quoting issues.
-
-
-File: gawk.info, Node: One-shot, Next: Read Terminal, Up: Running gawk
-
-1.1.1 One-Shot Throwaway 'awk' Programs
----------------------------------------
-
-Once you are familiar with 'awk', you will often type in simple programs
-the moment you want to use them. Then you can write the program as the
-first argument of the 'awk' command, like this:
-
- awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ...
-
-where PROGRAM consists of a series of patterns and actions, as described
-earlier.
-
- This command format instructs the "shell", or command interpreter, to
-start 'awk' and use the PROGRAM to process records in the input file(s).
-There are single quotes around PROGRAM so the shell won't interpret any
-'awk' characters as special shell characters. The quotes also cause the
-shell to treat all of PROGRAM as a single argument for 'awk', and allow
-PROGRAM to be more than one line long.
-
- This format is also useful for running short or medium-sized 'awk'
-programs from shell scripts, because it avoids the need for a separate
-file for the 'awk' program. A self-contained shell script is more
-reliable because there are no other files to misplace.
-
- Later in this chapter, in *note Very Simple::, we'll see examples of
-several short, self-contained programs.
-
-
-File: gawk.info, Node: Read Terminal, Next: Long, Prev: One-shot, Up: Running gawk
-
-1.1.2 Running 'awk' Without Input Files
----------------------------------------
-
-You can also run 'awk' without any input files. If you type the
-following command line:
-
- awk 'PROGRAM'
-
-'awk' applies the PROGRAM to the "standard input", which usually means
-whatever you type on the keyboard. This continues until you indicate
-end-of-file by typing 'Ctrl-d'. (On non-POSIX operating systems, the
-end-of-file character may be different.)
-
- As an example, the following program prints a friendly piece of
-advice (from Douglas Adams's 'The Hitchhiker's Guide to the Galaxy'), to
-keep you from worrying about the complexities of computer programming:
-
- $ awk 'BEGIN { print "Don\47t Panic!" }'
- -| Don't Panic!
-
- 'awk' executes statements associated with 'BEGIN' before reading any
-input. If there are no other statements in your program, as is the case
-here, 'awk' just stops, instead of trying to read input it doesn't know
-how to process. The '\47' is a magic way (explained later) of getting a
-single quote into the program, without having to engage in ugly shell
-quoting tricks.
-
- NOTE: If you use Bash as your shell, you should execute the command
- 'set +H' before running this program interactively, to disable the
- C shell-style command history, which treats '!' as a special
- character. We recommend putting this command into your personal
- startup file.
-
- This next simple 'awk' program emulates the 'cat' utility; it copies
-whatever you type on the keyboard to its standard output (why this works
-is explained shortly):
-
- $ awk '{ print }'
- Now is the time for all good men
- -| Now is the time for all good men
- to come to the aid of their country.
- -| to come to the aid of their country.
- Four score and seven years ago, ...
- -| Four score and seven years ago, ...
- What, me worry?
- -| What, me worry?
- Ctrl-d
-
-
-File: gawk.info, Node: Long, Next: Executable Scripts, Prev: Read Terminal, Up: Running gawk
-
-1.1.3 Running Long Programs
----------------------------
-
-Sometimes 'awk' programs are very long. In these cases, it is more
-convenient to put the program into a separate file. In order to tell
-'awk' to use that file for its program, you type:
-
- awk -f SOURCE-FILE INPUT-FILE1 INPUT-FILE2 ...
-
- The '-f' instructs the 'awk' utility to get the 'awk' program from
-the file SOURCE-FILE (*note Options::). Any file name can be used for
-SOURCE-FILE. For example, you could put the program:
-
- BEGIN { print "Don't Panic!" }
-
-into the file 'advice'. Then this command:
-
- awk -f advice
-
-does the same thing as this one:
-
- awk 'BEGIN { print "Don\47t Panic!" }'
-
-This was explained earlier (*note Read Terminal::). Note that you don't
-usually need single quotes around the file name that you specify with
-'-f', because most file names don't contain any of the shell's special
-characters. Notice that in 'advice', the 'awk' program did not have
-single quotes around it. The quotes are only needed for programs that
-are provided on the 'awk' command line. (Also, placing the program in a
-file allows us to use a literal single quote in the program text,
-instead of the magic '\47'.)
-
- If you want to clearly identify an 'awk' program file as such, you
-can add the extension '.awk' to the file name. This doesn't affect the
-execution of the 'awk' program but it does make "housekeeping" easier.
-
-
-File: gawk.info, Node: Executable Scripts, Next: Comments, Prev: Long, Up: Running gawk
-
-1.1.4 Executable 'awk' Programs
--------------------------------
-
-Once you have learned 'awk', you may want to write self-contained 'awk'
-scripts, using the '#!' script mechanism. You can do this on many
-systems.(1) For example, you could update the file 'advice' to look
-like this:
-
- #! /bin/awk -f
-
- BEGIN { print "Don't Panic!" }
-
-After making this file executable (with the 'chmod' utility), simply
-type 'advice' at the shell and the system arranges to run 'awk' as if
-you had typed 'awk -f advice':
-
- $ chmod +x advice
- $ advice
- -| Don't Panic!
-
-(We assume you have the current directory in your shell's search path
-variable [typically '$PATH']. If not, you may need to type './advice'
-at the shell.)
-
- Self-contained 'awk' scripts are useful when you want to write a
-program that users can invoke without their having to know that the
-program is written in 'awk'.
-
- Understanding '#!'
-
- 'awk' is an "interpreted" language. This means that the 'awk'
-utility reads your program and then processes your data according to the
-instructions in your program. (This is different from a "compiled"
-language such as C, where your program is first compiled into machine
-code that is executed directly by your system's processor.) The 'awk'
-utility is thus termed an "interpreter". Many modern languages are
-interpreted.
-
- The line beginning with '#!' lists the full file name of an
-interpreter to run and a single optional initial command-line argument
-to pass to that interpreter. The operating system then runs the
-interpreter with the given argument and the full argument list of the
-executed program. The first argument in the list is the full file name
-of the 'awk' program. The rest of the argument list contains either
-options to 'awk', or data files, or both. (Note that on many systems
-'awk' may be found in '/usr/bin' instead of in '/bin'.)
-
- Some systems limit the length of the interpreter name to 32
-characters. Often, this can be dealt with by using a symbolic link.
-
- You should not put more than one argument on the '#!' line after the
-path to 'awk'. It does not work. The operating system treats the rest
-of the line as a single argument and passes it to 'awk'. Doing this
-leads to confusing behavior--most likely a usage diagnostic of some sort
-from 'awk'.
-
- Finally, the value of 'ARGV[0]' (*note Built-in Variables::) varies
-depending upon your operating system. Some systems put 'awk' there,
-some put the full pathname of 'awk' (such as '/bin/awk'), and some put
-the name of your script ('advice'). (d.c.) Don't rely on the value of
-'ARGV[0]' to provide your script name.
-
- ---------- Footnotes ----------
-
- (1) The '#!' mechanism works on GNU/Linux systems, BSD-based systems,
-and commercial Unix systems.
-
-
-File: gawk.info, Node: Comments, Next: Quoting, Prev: Executable Scripts, Up: Running gawk
-
-1.1.5 Comments in 'awk' Programs
---------------------------------
-
-A "comment" is some text that is included in a program for the sake of
-human readers; it is not really an executable part of the program.
-Comments can explain what the program does and how it works. Nearly all
-programming languages have provisions for comments, as programs are
-typically hard to understand without them.
-
- In the 'awk' language, a comment starts with the number sign
-character ('#') and continues to the end of the line. The '#' does not
-have to be the first character on the line. The 'awk' language ignores
-the rest of a line following a number sign. For example, we could have
-put the following into 'advice':
-
- # This program prints a nice, friendly message. It helps
- # keep novice users from being afraid of the computer.
- BEGIN { print "Don't Panic!" }
-
- You can put comment lines into keyboard-composed throwaway 'awk'
-programs, but this usually isn't very useful; the purpose of a comment
-is to help you or another person understand the program when reading it
-at a later time.
-
- CAUTION: As mentioned in *note One-shot::, you can enclose short to
- medium-sized programs in single quotes, in order to keep your shell
- scripts self-contained. When doing so, _don't_ put an apostrophe
- (i.e., a single quote) into a comment (or anywhere else in your
- program). The shell interprets the quote as the closing quote for
- the entire program. As a result, usually the shell prints a
- message about mismatched quotes, and if 'awk' actually runs, it
- will probably print strange messages about syntax errors. For
- example, look at the following:
-
- $ awk 'BEGIN { print "hello" } # let's be cute'
- >
-
- The shell sees that the first two quotes match, and that a new
- quoted object begins at the end of the command line. It therefore
- prompts with the secondary prompt, waiting for more input. With
- Unix 'awk', closing the quoted string produces this result:
-
- $ awk '{ print "hello" } # let's be cute'
- > '
- error-> awk: can't open file be
- error-> source line number 1
-
- Putting a backslash before the single quote in 'let's' wouldn't
- help, because backslashes are not special inside single quotes.
- The next node describes the shell's quoting rules.
-
-
-File: gawk.info, Node: Quoting, Prev: Comments, Up: Running gawk
-
-1.1.6 Shell Quoting Issues
---------------------------
-
-* Menu:
-
-* DOS Quoting:: Quoting in Windows Batch Files.
-
-For short to medium-length 'awk' programs, it is most convenient to
-enter the program on the 'awk' command line. This is best done by
-enclosing the entire program in single quotes. This is true whether you
-are entering the program interactively at the shell prompt, or writing
-it as part of a larger shell script:
-
- awk 'PROGRAM TEXT' INPUT-FILE1 INPUT-FILE2 ...
-
- Once you are working with the shell, it is helpful to have a basic
-knowledge of shell quoting rules. The following rules apply only to
-POSIX-compliant, Bourne-style shells (such as Bash, the GNU Bourne-Again
-Shell). If you use the C shell, you're on your own.
-
- Before diving into the rules, we introduce a concept that appears
-throughout this Info file, which is that of the "null", or empty,
-string.
-
- The null string is character data that has no value. In other words,
-it is empty. It is written in 'awk' programs like this: '""'. In the
-shell, it can be written using single or double quotes: '""' or ''''.
-Although the null string has no characters in it, it does exist. For
-example, consider this command:
-
- $ echo ""
-
-Here, the 'echo' utility receives a single argument, even though that
-argument has no characters in it. In the rest of this Info file, we use
-the terms "null string" and "empty string" interchangeably. Now, on to
-the quoting rules:
-
- * Quoted items can be concatenated with nonquoted items as well as
- with other quoted items. The shell turns everything into one
- argument for the command.
-
- * Preceding any single character with a backslash ('\') quotes that
- character. The shell removes the backslash and passes the quoted
- character on to the command.
-
- * Single quotes protect everything between the opening and closing
- quotes. The shell does no interpretation of the quoted text,
- passing it on verbatim to the command. It is _impossible_ to embed
- a single quote inside single-quoted text. Refer back to *note
- Comments:: for an example of what happens if you try.
-
- * Double quotes protect most things between the opening and closing
- quotes. The shell does at least variable and command substitution
- on the quoted text. Different shells may do additional kinds of
- processing on double-quoted text.
-
- Because certain characters within double-quoted text are processed
- by the shell, they must be "escaped" within the text. Of note are
- the characters '$', '`', '\', and '"', all of which must be
- preceded by a backslash within double-quoted text if they are to be
- passed on literally to the program. (The leading backslash is
- stripped first.) Thus, the example seen in *note Read Terminal:::
-
- awk 'BEGIN { print "Don\47t Panic!" }'
-
- could instead be written this way:
-
- $ awk "BEGIN { print \"Don't Panic!\" }"
- -| Don't Panic!
-
- Note that the single quote is not special within double quotes.
-
- * Null strings are removed when they occur as part of a non-null
- command-line argument, while explicit null objects are kept. For
- example, to specify that the field separator 'FS' should be set to
- the null string, use:
-
- awk -F "" 'PROGRAM' FILES # correct
-
- Don't use this:
-
- awk -F"" 'PROGRAM' FILES # wrong!
-
- In the second case, 'awk' attempts to use the text of the program
- as the value of 'FS', and the first file name as the text of the
- program! This results in syntax errors at best, and confusing
- behavior at worst.
-
- Mixing single and double quotes is difficult. You have to resort to
-shell quoting tricks, like this:
-
- $ awk 'BEGIN { print "Here is a single quote <'"'"'>" }'
- -| Here is a single quote <'>
-
-This program consists of three concatenated quoted strings. The first
-and the third are single-quoted, and the second is double-quoted.
-
- This can be "simplified" to:
-
- $ awk 'BEGIN { print "Here is a single quote <'\''>" }'
- -| Here is a single quote <'>
-
-Judge for yourself which of these two is the more readable.
-
- Another option is to use double quotes, escaping the embedded,
-'awk'-level double quotes:
-
- $ awk "BEGIN { print \"Here is a single quote <'>\" }"
- -| Here is a single quote <'>
-
-This option is also painful, because double quotes, backslashes, and
-dollar signs are very common in more advanced 'awk' programs.
-
- A third option is to use the octal escape sequence equivalents (*note
-Escape Sequences::) for the single- and double-quote characters, like
-so:
-
- $ awk 'BEGIN { print "Here is a single quote <\47>" }'
- -| Here is a single quote <'>
- $ awk 'BEGIN { print "Here is a double quote <\42>" }'
- -| Here is a double quote <">
-
-This works nicely, but you should comment clearly what the escapes mean.
-
- A fourth option is to use command-line variable assignment, like
-this:
-
- $ awk -v sq="'" 'BEGIN { print "Here is a single quote <" sq ">" }'
- -| Here is a single quote <'>
-
- (Here, the two string constants and the value of 'sq' are
-concatenated into a single string that is printed by 'print'.)
-
- If you really need both single and double quotes in your 'awk'
-program, it is probably best to move it into a separate file, where the
-shell won't be part of the picture and you can say what you mean.
-
-
-File: gawk.info, Node: DOS Quoting, Up: Quoting
-
-1.1.6.1 Quoting in MS-Windows Batch Files
-.........................................
-
-Although this Info file generally only worries about POSIX systems and
-the POSIX shell, the following issue arises often enough for many users
-that it is worth addressing.
-
- The "shells" on Microsoft Windows systems use the double-quote
-character for quoting, and make it difficult or impossible to include an
-escaped double-quote character in a command-line script. The following
-example, courtesy of Jeroen Brink, shows how to print all lines in a
-file surrounded by double quotes:
-
- gawk "{ print \"\042\" $0 \"\042\" }" FILE
-
-
-File: gawk.info, Node: Sample Data Files, Next: Very Simple, Prev: Running gawk, Up: Getting Started
-
-1.2 Data files for the Examples
-===============================
-
-Many of the examples in this Info file take their input from two sample
-data files. The first, 'mail-list', represents a list of peoples' names
-together with their email addresses and information about those people.
-The second data file, called 'inventory-shipped', contains information
-about monthly shipments. In both files, each line is considered to be
-one "record".
-
- In 'mail-list', each record contains the name of a person, his/her
-phone number, his/her email address, and a code for his/her relationship
-with the author of the list. The columns are aligned using spaces. An
-'A' in the last column means that the person is an acquaintance. An 'F'
-in the last column means that the person is a friend. An 'R' means that
-the person is a relative:
-
- Amelia 555-5553 amelia.zodiacusque@gmail.com F
- Anthony 555-3412 anthony.asserturo@hotmail.com A
- Becky 555-7685 becky.algebrarum@gmail.com A
- Bill 555-1675 bill.drowning@hotmail.com A
- Broderick 555-0542 broderick.aliquotiens@yahoo.com R
- Camilla 555-2912 camilla.infusarum@skynet.be R
- Fabius 555-1234 fabius.undevicesimus@ucb.edu F
- Julie 555-6699 julie.perscrutabor@skeeve.com F
- Martin 555-6480 martin.codicibus@hotmail.com A
- Samuel 555-3430 samuel.lanceolis@shu.edu A
- Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R
-
- The data file 'inventory-shipped' represents information about
-shipments during the year. Each record contains the month, the number
-of green crates shipped, the number of red boxes shipped, the number of
-orange bags shipped, and the number of blue packages shipped,
-respectively. There are 16 entries, covering the 12 months of last year
-and the first four months of the current year. An empty line separates
-the data for the two years:
-
- Jan 13 25 15 115
- Feb 15 32 24 226
- Mar 15 24 34 228
- Apr 31 52 63 420
- May 16 34 29 208
- Jun 31 42 75 492
- Jul 24 34 67 436
- Aug 15 34 47 316
- Sep 13 55 37 277
- Oct 29 54 68 525
- Nov 20 87 82 577
- Dec 17 35 61 401
-
- Jan 21 36 64 620
- Feb 26 58 80 652
- Mar 24 75 70 495
- Apr 21 70 74 514
-
- The sample files are included in the 'gawk' distribution, in the
-directory 'awklib/eg/data'.
-
-
-File: gawk.info, Node: Very Simple, Next: Two Rules, Prev: Sample Data Files, Up: Getting Started
-
-1.3 Some Simple Examples
-========================
-
-The following command runs a simple 'awk' program that searches the
-input file 'mail-list' for the character string 'li' (a grouping of
-characters is usually called a "string"; the term "string" is based on
-similar usage in English, such as "a string of pearls" or "a string of
-cars in a train"):
-
- awk '/li/ { print $0 }' mail-list
-
-When lines containing 'li' are found, they are printed because
-'print $0' means print the current line. (Just 'print' by itself means
-the same thing, so we could have written that instead.)
-
- You will notice that slashes ('/') surround the string 'li' in the
-'awk' program. The slashes indicate that 'li' is the pattern to search
-for. This type of pattern is called a "regular expression", which is
-covered in more detail later (*note Regexp::). The pattern is allowed
-to match parts of words. There are single quotes around the 'awk'
-program so that the shell won't interpret any of it as special shell
-characters.
-
- Here is what this program prints:
-
- $ awk '/li/ { print $0 }' mail-list
- -| Amelia 555-5553 amelia.zodiacusque@gmail.com F
- -| Broderick 555-0542 broderick.aliquotiens@yahoo.com R
- -| Julie 555-6699 julie.perscrutabor@skeeve.com F
- -| Samuel 555-3430 samuel.lanceolis@shu.edu A
-
- In an 'awk' rule, either the pattern or the action can be omitted,
-but not both. If the pattern is omitted, then the action is performed
-for _every_ input line. If the action is omitted, the default action is
-to print all lines that match the pattern.
-
- Thus, we could leave out the action (the 'print' statement and the
-braces) in the previous example and the result would be the same: 'awk'
-prints all lines matching the pattern 'li'. By comparison, omitting the
-'print' statement but retaining the braces makes an empty action that
-does nothing (i.e., no lines are printed).
-
- Many practical 'awk' programs are just a line or two long. Following
-is a collection of useful, short programs to get you started. Some of
-these programs contain constructs that haven't been covered yet. (The
-description of the program will give you a good idea of what is going
-on, but you'll need to read the rest of the Info file to become an 'awk'
-expert!) Most of the examples use a data file named 'data'. This is
-just a placeholder; if you use these programs yourself, substitute your
-own file names for 'data'. For future reference, note that there is
-often more than one way to do things in 'awk'. At some point, you may
-want to look back at these examples and see if you can come up with
-different ways to do the same things shown here:
-
- * Print every line that is longer than 80 characters:
-
- awk 'length($0) > 80' data
-
- The sole rule has a relational expression as its pattern and has no
- action--so it uses the default action, printing the record.
-
- * Print the length of the longest input line:
-
- awk '{ if (length($0) > max) max = length($0) }
- END { print max }' data
-
- The code associated with 'END' executes after all input has been
- read; it's the other side of the coin to 'BEGIN'.
-
- * Print the length of the longest line in 'data':
-
- expand data | awk '{ if (x < length($0)) x = length($0) }
- END { print "maximum line length is " x }'
-
- This example differs slightly from the previous one: the input is
- processed by the 'expand' utility to change TABs into spaces, so
- the widths compared are actually the right-margin columns, as
- opposed to the number of input characters on each line.
-
- * Print every line that has at least one field:
-
- awk 'NF > 0' data
-
- This is an easy way to delete blank lines from a file (or rather,
- to create a new file similar to the old file but from which the
- blank lines have been removed).
-
- * Print seven random numbers from 0 to 100, inclusive:
-
- awk 'BEGIN { for (i = 1; i <= 7; i++)
- print int(101 * rand()) }'
-
- * Print the total number of bytes used by FILES:
-
- ls -l FILES | awk '{ x += $5 }
- END { print "total bytes: " x }'
-
- * Print the total number of kilobytes used by FILES:
-
- ls -l FILES | awk '{ x += $5 }
- END { print "total K-bytes:", x / 1024 }'
-
- * Print a sorted list of the login names of all users:
-
- awk -F: '{ print $1 }' /etc/passwd | sort
-
- * Count the lines in a file:
-
- awk 'END { print NR }' data
-
- * Print the even-numbered lines in the data file:
-
- awk 'NR % 2 == 0' data
-
- If you used the expression 'NR % 2 == 1' instead, the program would
- print the odd-numbered lines.
-
-
-File: gawk.info, Node: Two Rules, Next: More Complex, Prev: Very Simple, Up: Getting Started
-
-1.4 An Example with Two Rules
-=============================
-
-The 'awk' utility reads the input files one line at a time. For each
-line, 'awk' tries the patterns of each rule. If several patterns match,
-then several actions execute in the order in which they appear in the
-'awk' program. If no patterns match, then no actions run.
-
- After processing all the rules that match the line (and perhaps there
-are none), 'awk' reads the next line. (However, *note Next Statement::
-and also *note Nextfile Statement::.) This continues until the program
-reaches the end of the file. For example, the following 'awk' program
-contains two rules:
-
- /12/ { print $0 }
- /21/ { print $0 }
-
-The first rule has the string '12' as the pattern and 'print $0' as the
-action. The second rule has the string '21' as the pattern and also has
-'print $0' as the action. Each rule's action is enclosed in its own
-pair of braces.
-
- This program prints every line that contains the string '12' _or_ the
-string '21'. If a line contains both strings, it is printed twice, once
-by each rule.
-
- This is what happens if we run this program on our two sample data
-files, 'mail-list' and 'inventory-shipped':
-
- $ awk '/12/ { print $0 }
- > /21/ { print $0 }' mail-list inventory-shipped
- -| Anthony 555-3412 anthony.asserturo@hotmail.com A
- -| Camilla 555-2912 camilla.infusarum@skynet.be R
- -| Fabius 555-1234 fabius.undevicesimus@ucb.edu F
- -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R
- -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R
- -| Jan 21 36 64 620
- -| Apr 21 70 74 514
-
-Note how the line beginning with 'Jean-Paul' in 'mail-list' was printed
-twice, once for each rule.
-
-
-File: gawk.info, Node: More Complex, Next: Statements/Lines, Prev: Two Rules, Up: Getting Started
-
-1.5 A More Complex Example
-==========================
-
-Now that we've mastered some simple tasks, let's look at what typical
-'awk' programs do. This example shows how 'awk' can be used to
-summarize, select, and rearrange the output of another utility. It uses
-features that haven't been covered yet, so don't worry if you don't
-understand all the details:
-
- ls -l | awk '$6 == "Nov" { sum += $5 }
- END { print sum }'
-
- This command prints the total number of bytes in all the files in the
-current directory that were last modified in November (of any year).
-The 'ls -l' part of this example is a system command that gives you a
-listing of the files in a directory, including each file's size and the
-date the file was last modified. Its output looks like this:
-
- -rw-r--r-- 1 arnold user 1933 Nov 7 13:05 Makefile
- -rw-r--r-- 1 arnold user 10809 Nov 7 13:03 awk.h
- -rw-r--r-- 1 arnold user 983 Apr 13 12:14 awk.tab.h
- -rw-r--r-- 1 arnold user 31869 Jun 15 12:20 awkgram.y
- -rw-r--r-- 1 arnold user 22414 Nov 7 13:03 awk1.c
- -rw-r--r-- 1 arnold user 37455 Nov 7 13:03 awk2.c
- -rw-r--r-- 1 arnold user 27511 Dec 9 13:07 awk3.c
- -rw-r--r-- 1 arnold user 7989 Nov 7 13:03 awk4.c
-
-The first field contains read-write permissions, the second field
-contains the number of links to the file, and the third field identifies
-the file's owner. The fourth field identifies the file's group. The
-fifth field contains the file's size in bytes. The sixth, seventh, and
-eighth fields contain the month, day, and time, respectively, that the
-file was last modified. Finally, the ninth field contains the file
-name.
-
- The '$6 == "Nov"' in our 'awk' program is an expression that tests
-whether the sixth field of the output from 'ls -l' matches the string
-'Nov'. Each time a line has the string 'Nov' for its sixth field, 'awk'
-performs the action 'sum += $5'. This adds the fifth field (the file's
-size) to the variable 'sum'. As a result, when 'awk' has finished
-reading all the input lines, 'sum' is the total of the sizes of the
-files whose lines matched the pattern. (This works because 'awk'
-variables are automatically initialized to zero.)
-
- After the last line of output from 'ls' has been processed, the 'END'
-rule executes and prints the value of 'sum'. In this example, the value
-of 'sum' is 80600.
-
- These more advanced 'awk' techniques are covered in later minor nodes
-(*note Action Overview::). Before you can move on to more advanced
-'awk' programming, you have to know how 'awk' interprets your input and
-displays your output. By manipulating fields and using 'print'
-statements, you can produce some very useful and impressive-looking
-reports.
-
-
-File: gawk.info, Node: Statements/Lines, Next: Other Features, Prev: More Complex, Up: Getting Started
-
-1.6 'awk' Statements Versus Lines
-=================================
-
-Most often, each line in an 'awk' program is a separate statement or
-separate rule, like this:
-
- awk '/12/ { print $0 }
- /21/ { print $0 }' mail-list inventory-shipped
-
- However, 'gawk' ignores newlines after any of the following symbols
-and keywords:
-
- , { ? : || && do else
-
-A newline at any other point is considered the end of the statement.(1)
-
- If you would like to split a single statement into two lines at a
-point where a newline would terminate it, you can "continue" it by
-ending the first line with a backslash character ('\'). The backslash
-must be the final character on the line in order to be recognized as a
-continuation character. A backslash is allowed anywhere in the
-statement, even in the middle of a string or regular expression. For
-example:
-
- awk '/This regular expression is too long, so continue it\
- on the next line/ { print $1 }'
-
-We have generally not used backslash continuation in our sample
-programs. 'gawk' places no limit on the length of a line, so backslash
-continuation is never strictly necessary; it just makes programs more
-readable. For this same reason, as well as for clarity, we have kept
-most statements short in the programs presented throughout the Info
-file. Backslash continuation is most useful when your 'awk' program is
-in a separate source file instead of entered from the command line. You
-should also note that many 'awk' implementations are more particular
-about where you may use backslash continuation. For example, they may
-not allow you to split a string constant using backslash continuation.
-Thus, for maximum portability of your 'awk' programs, it is best not to
-split your lines in the middle of a regular expression or a string.
-
- CAUTION: _Backslash continuation does not work as described with
- the C shell._ It works for 'awk' programs in files and for
- one-shot programs, _provided_ you are using a POSIX-compliant
- shell, such as the Unix Bourne shell or Bash. But the C shell
- behaves differently! There you must use two backslashes in a row,
- followed by a newline. Note also that when using the C shell,
- _every_ newline in your 'awk' program must be escaped with a
- backslash. To illustrate:
-
- % awk 'BEGIN { \
- ? print \\
- ? "hello, world" \
- ? }'
- -| hello, world
-
- Here, the '%' and '?' are the C shell's primary and secondary
- prompts, analogous to the standard shell's '$' and '>'.
-
- Compare the previous example to how it is done with a
- POSIX-compliant shell:
-
- $ awk 'BEGIN {
- > print \
- > "hello, world"
- > }'
- -| hello, world
-
- 'awk' is a line-oriented language. Each rule's action has to begin
-on the same line as the pattern. To have the pattern and action on
-separate lines, you _must_ use backslash continuation; there is no other
-option.
-
- Another thing to keep in mind is that backslash continuation and
-comments do not mix. As soon as 'awk' sees the '#' that starts a
-comment, it ignores _everything_ on the rest of the line. For example:
-
- $ gawk 'BEGIN { print "dont panic" # a friendly \
- > BEGIN rule
- > }'
- error-> gawk: cmd. line:2: BEGIN rule
- error-> gawk: cmd. line:2: ^ syntax error
-
-In this case, it looks like the backslash would continue the comment
-onto the next line. However, the backslash-newline combination is never
-even noticed because it is "hidden" inside the comment. Thus, the
-'BEGIN' is noted as a syntax error.
-
- When 'awk' statements within one rule are short, you might want to
-put more than one of them on a line. This is accomplished by separating
-the statements with a semicolon (';'). This also applies to the rules
-themselves. Thus, the program shown at the start of this minor node
-could also be written this way:
-
- /12/ { print $0 } ; /21/ { print $0 }
-
- NOTE: The requirement that states that rules on the same line must
- be separated with a semicolon was not in the original 'awk'
- language; it was added for consistency with the treatment of
- statements within an action.
-
- ---------- Footnotes ----------
-
- (1) The '?' and ':' referred to here is the three-operand conditional
-expression described in *note Conditional Exp::. Splitting lines after
-'?' and ':' is a minor 'gawk' extension; if '--posix' is specified
-(*note Options::), then this extension is disabled.
-
-
-File: gawk.info, Node: Other Features, Next: When, Prev: Statements/Lines, Up: Getting Started
-
-1.7 Other Features of 'awk'
-===========================
-
-The 'awk' language provides a number of predefined, or "built-in",
-variables that your programs can use to get information from 'awk'.
-There are other variables your program can set as well to control how
-'awk' processes your data.
-
- In addition, 'awk' provides a number of built-in functions for doing
-common computational and string-related operations. 'gawk' provides
-built-in functions for working with timestamps, performing bit
-manipulation, for runtime string translation (internationalization),
-determining the type of a variable, and array sorting.
-
- As we develop our presentation of the 'awk' language, we will
-introduce most of the variables and many of the functions. They are
-described systematically in *note Built-in Variables:: and in *note
-Built-in::.
-
-
-File: gawk.info, Node: When, Next: Intro Summary, Prev: Other Features, Up: Getting Started
-
-1.8 When to Use 'awk'
-=====================
-
-Now that you've seen some of what 'awk' can do, you might wonder how
-'awk' could be useful for you. By using utility programs, advanced
-patterns, field separators, arithmetic statements, and other selection
-criteria, you can produce much more complex output. The 'awk' language
-is very useful for producing reports from large amounts of raw data,
-such as summarizing information from the output of other utility
-programs like 'ls'. (*Note More Complex::.)
-
- Programs written with 'awk' are usually much smaller than they would
-be in other languages. This makes 'awk' programs easy to compose and
-use. Often, 'awk' programs can be quickly composed at your keyboard,
-used once, and thrown away. Because 'awk' programs are interpreted, you
-can avoid the (usually lengthy) compilation part of the typical
-edit-compile-test-debug cycle of software development.
-
- Complex programs have been written in 'awk', including a complete
-retargetable assembler for eight-bit microprocessors (*note Glossary::,
-for more information), and a microcode assembler for a special-purpose
-Prolog computer. The original 'awk''s capabilities were strained by
-tasks of such complexity, but modern versions are more capable.
-
- If you find yourself writing 'awk' scripts of more than, say, a few
-hundred lines, you might consider using a different programming
-language. The shell is good at string and pattern matching; in
-addition, it allows powerful use of the system utilities. Python offers
-a nice balance between high-level ease of programming and access to
-system facilities.(1)
-
- ---------- Footnotes ----------
-
- (1) Other popular scripting languages include Ruby and Perl.
-
-
-File: gawk.info, Node: Intro Summary, Prev: When, Up: Getting Started
-
-1.9 Summary
-===========
-
- * Programs in 'awk' consist of PATTERN-ACTION pairs.
-
- * An ACTION without a PATTERN always runs. The default ACTION for a
- pattern without one is '{ print $0 }'.
-
- * Use either 'awk 'PROGRAM' FILES' or 'awk -f PROGRAM-FILE FILES' to
- run 'awk'.
-
- * You may use the special '#!' header line to create 'awk' programs
- that are directly executable.
-
- * Comments in 'awk' programs start with '#' and continue to the end
- of the same line.
-
- * Be aware of quoting issues when writing 'awk' programs as part of a
- larger shell script (or MS-Windows batch file).
-
- * You may use backslash continuation to continue a source line.
- Lines are automatically continued after a comma, open brace,
- question mark, colon, '||', '&&', 'do', and 'else'.
-
-
-File: gawk.info, Node: Invoking Gawk, Next: Regexp, Prev: Getting Started, Up: Top
-
-2 Running 'awk' and 'gawk'
-**************************
-
-This major node covers how to run 'awk', both POSIX-standard and
-'gawk'-specific command-line options, and what 'awk' and 'gawk' do with
-nonoption arguments. It then proceeds to cover how 'gawk' searches for
-source files, reading standard input along with other files, 'gawk''s
-environment variables, 'gawk''s exit status, using include files, and
-obsolete and undocumented options and/or features.
-
- Many of the options and features described here are discussed in more
-detail later in the Info file; feel free to skip over things in this
-major node that don't interest you right now.
-
-* Menu:
-
-* Command Line:: How to run 'awk'.
-* Options:: Command-line options and their meanings.
-* Other Arguments:: Input file names and variable assignments.
-* Naming Standard Input:: How to specify standard input with other
- files.
-* Environment Variables:: The environment variables 'gawk' uses.
-* Exit Status:: 'gawk''s exit status.
-* Include Files:: Including other files into your program.
-* Loading Shared Libraries:: Loading shared libraries into your program.
-* Obsolete:: Obsolete Options and/or features.
-* Undocumented:: Undocumented Options and Features.
-* Invoking Summary:: Invocation summary.
-
-
-File: gawk.info, Node: Command Line, Next: Options, Up: Invoking Gawk
-
-2.1 Invoking 'awk'
-==================
-
-There are two ways to run 'awk'--with an explicit program or with one or
-more program files. Here are templates for both of them; items enclosed
-in [...] in these templates are optional:
-
- 'awk' [OPTIONS] '-f' PROGFILE ['--'] FILE ...
- 'awk' [OPTIONS] ['--'] ''PROGRAM'' FILE ...
-
- In addition to traditional one-letter POSIX-style options, 'gawk'
-also supports GNU long options.
-
- It is possible to invoke 'awk' with an empty program:
-
- awk '' datafile1 datafile2
-
-Doing so makes little sense, though; 'awk' exits silently when given an
-empty program. (d.c.) If '--lint' has been specified on the command
-line, 'gawk' issues a warning that the program is empty.
-
-
-File: gawk.info, Node: Options, Next: Other Arguments, Prev: Command Line, Up: Invoking Gawk
-
-2.2 Command-Line Options
-========================
-
-Options begin with a dash and consist of a single character. GNU-style
-long options consist of two dashes and a keyword. The keyword can be
-abbreviated, as long as the abbreviation allows the option to be
-uniquely identified. If the option takes an argument, either the
-keyword is immediately followed by an equals sign ('=') and the
-argument's value, or the keyword and the argument's value are separated
-by whitespace. If a particular option with a value is given more than
-once, it is the last value that counts.
-
- Each long option for 'gawk' has a corresponding POSIX-style short
-option. The long and short options are interchangeable in all contexts.
-The following list describes options mandated by the POSIX standard:
-
-'-F FS'
-'--field-separator FS'
- Set the 'FS' variable to FS (*note Field Separators::).
-
-'-f SOURCE-FILE'
-'--file SOURCE-FILE'
- Read the 'awk' program source from SOURCE-FILE instead of in the
- first nonoption argument. This option may be given multiple times;
- the 'awk' program consists of the concatenation of the contents of
- each specified SOURCE-FILE.
-
-'-v VAR=VAL'
-'--assign VAR=VAL'
- Set the variable VAR to the value VAL _before_ execution of the
- program begins. Such variable values are available inside the
- 'BEGIN' rule (*note Other Arguments::).
-
- The '-v' option can only set one variable, but it can be used more
- than once, setting another variable each time, like this: 'awk
- -v foo=1 -v bar=2 ...'.
-
- CAUTION: Using '-v' to set the values of the built-in
- variables may lead to surprising results. 'awk' will reset
- the values of those variables as it needs to, possibly
- ignoring any initial value you may have given.
-
-'-W GAWK-OPT'
- Provide an implementation-specific option. This is the POSIX
- convention for providing implementation-specific options. These
- options also have corresponding GNU-style long options. Note that
- the long options may be abbreviated, as long as the abbreviations
- remain unique. The full list of 'gawk'-specific options is
- provided next.
-
-'--'
- Signal the end of the command-line options. The following
- arguments are not treated as options even if they begin with '-'.
- This interpretation of '--' follows the POSIX argument parsing
- conventions.
-
- This is useful if you have file names that start with '-', or in
- shell scripts, if you have file names that will be specified by the
- user that could start with '-'. It is also useful for passing
- options on to the 'awk' program; see *note Getopt Function::.
-
- The following list describes 'gawk'-specific options:
-
-'-b'
-'--characters-as-bytes'
- Cause 'gawk' to treat all input data as single-byte characters. In
- addition, all output written with 'print' or 'printf' is treated as
- single-byte characters.
-
- Normally, 'gawk' follows the POSIX standard and attempts to process
- its input data according to the current locale (*note Locales::).
- This can often involve converting multibyte characters into wide
- characters (internally), and can lead to problems or confusion if
- the input data does not contain valid multibyte characters. This
- option is an easy way to tell 'gawk', "Hands off my data!"
-
-'-c'
-'--traditional'
- Specify "compatibility mode", in which the GNU extensions to the
- 'awk' language are disabled, so that 'gawk' behaves just like BWK
- 'awk'. *Note POSIX/GNU::, which summarizes the extensions. Also
- see *note Compatibility Mode::.
-
-'-C'
-'--copyright'
- Print the short version of the General Public License and then
- exit.
-
-'-d'[FILE]
-'--dump-variables'['='FILE]
- Print a sorted list of global variables, their types, and final
- values to FILE. If no FILE is provided, print this list to a file
- named 'awkvars.out' in the current directory. No space is allowed
- between the '-d' and FILE, if FILE is supplied.
-
- Having a list of all global variables is a good way to look for
- typographical errors in your programs. You would also use this
- option if you have a large program with a lot of functions, and you
- want to be sure that your functions don't inadvertently use global
- variables that you meant to be local. (This is a particularly easy
- mistake to make with simple variable names like 'i', 'j', etc.)
-
-'-D'[FILE]
-'--debug'['='FILE]
- Enable debugging of 'awk' programs (*note Debugging::). By
- default, the debugger reads commands interactively from the
- keyboard (standard input). The optional FILE argument allows you
- to specify a file with a list of commands for the debugger to
- execute noninteractively. No space is allowed between the '-D' and
- FILE, if FILE is supplied.
-
-'-e' PROGRAM-TEXT
-'--source' PROGRAM-TEXT
- Provide program source code in the PROGRAM-TEXT. This option
- allows you to mix source code in files with source code that you
- enter on the command line. This is particularly useful when you
- have library functions that you want to use from your command-line
- programs (*note AWKPATH Variable::).
-
-'-E' FILE
-'--exec' FILE
- Similar to '-f', read 'awk' program text from FILE. There are two
- differences from '-f':
-
- * This option terminates option processing; anything else on the
- command line is passed on directly to the 'awk' program.
-
- * Command-line variable assignments of the form 'VAR=VALUE' are
- disallowed.
-
- This option is particularly necessary for World Wide Web CGI
- applications that pass arguments through the URL; using this option
- prevents a malicious (or other) user from passing in options,
- assignments, or 'awk' source code (via '-e') to the CGI
- application.(1) This option should be used with '#!' scripts
- (*note Executable Scripts::), like so:
-
- #! /usr/local/bin/gawk -E
-
- AWK PROGRAM HERE ...
-
-'-g'
-'--gen-pot'
- Analyze the source program and generate a GNU 'gettext' portable
- object template file on standard output for all string constants
- that have been marked for translation. *Note
- Internationalization::, for information about this option.
-
-'-h'
-'--help'
- Print a "usage" message summarizing the short- and long-style
- options that 'gawk' accepts and then exit.
-
-'-i' SOURCE-FILE
-'--include' SOURCE-FILE
- Read an 'awk' source library from SOURCE-FILE. This option is
- completely equivalent to using the '@include' directive inside your
- program. It is very similar to the '-f' option, but there are two
- important differences. First, when '-i' is used, the program
- source is not loaded if it has been previously loaded, whereas with
- '-f', 'gawk' always loads the file. Second, because this option is
- intended to be used with code libraries, 'gawk' does not recognize
- such files as constituting main program input. Thus, after
- processing an '-i' argument, 'gawk' still expects to find the main
- source code via the '-f' option or on the command line.
-
-'-l' EXT
-'--load' EXT
- Load a dynamic extension named EXT. Extensions are stored as
- system shared libraries. This option searches for the library
- using the 'AWKLIBPATH' environment variable. The correct library
- suffix for your platform will be supplied by default, so it need
- not be specified in the extension name. The extension
- initialization routine should be named 'dl_load()'. An alternative
- is to use the '@load' keyword inside the program to load a shared
- library. This advanced feature is described in detail in *note
- Dynamic Extensions::.
-
-'-L'[VALUE]
-'--lint'['='VALUE]
- Warn about constructs that are dubious or nonportable to other
- 'awk' implementations. No space is allowed between the '-L' and
- VALUE, if VALUE is supplied. Some warnings are issued when 'gawk'
- first reads your program. Others are issued at runtime, as your
- program executes. With an optional argument of 'fatal', lint
- warnings become fatal errors. This may be drastic, but its use
- will certainly encourage the development of cleaner 'awk' programs.
- With an optional argument of 'invalid', only warnings about things
- that are actually invalid are issued. (This is not fully
- implemented yet.)
-
- Some warnings are only printed once, even if the dubious constructs
- they warn about occur multiple times in your 'awk' program. Thus,
- when eliminating problems pointed out by '--lint', you should take
- care to search for all occurrences of each inappropriate construct.
- As 'awk' programs are usually short, doing so is not burdensome.
-
-'-M'
-'--bignum'
- Select arbitrary-precision arithmetic on numbers. This option has
- no effect if 'gawk' is not compiled to use the GNU MPFR and MP
- libraries (*note Arbitrary Precision Arithmetic::).
-
-'-n'
-'--non-decimal-data'
- Enable automatic interpretation of octal and hexadecimal values in
- input data (*note Nondecimal Data::).
-
- CAUTION: This option can severely break old programs. Use
- with care. Also note that this option may disappear in a
- future version of 'gawk'.
-
-'-N'
-'--use-lc-numeric'
- Force the use of the locale's decimal point character when parsing
- numeric input data (*note Locales::).
-
-'-o'[FILE]
-'--pretty-print'['='FILE]
- Enable pretty-printing of 'awk' programs. Implies '--no-optimize'.
- By default, the output program is created in a file named
- 'awkprof.out' (*note Profiling::). The optional FILE argument
- allows you to specify a different file name for the output. No
- space is allowed between the '-o' and FILE, if FILE is supplied.
-
- NOTE: In the past, this option would also execute your
- program. This is no longer the case.
-
-'-O'
-'--optimize'
- Enable 'gawk''s default optimizations on the internal
- representation of the program. At the moment, this includes simple
- constant folding and tail recursion elimination in function calls.
-
- These optimizations are enabled by default. This option remains
- primarily for backwards compatibility. However, it may be used to
- cancel the effect of an earlier '-s' option (see later in this
- list).
-
-'-p'[FILE]
-'--profile'['='FILE]
- Enable profiling of 'awk' programs (*note Profiling::). Implies
- '--no-optimize'. By default, profiles are created in a file named
- 'awkprof.out'. The optional FILE argument allows you to specify a
- different file name for the profile file. No space is allowed
- between the '-p' and FILE, if FILE is supplied.
-
- The profile contains execution counts for each statement in the
- program in the left margin, and function call counts for each
- function.
-
-'-P'
-'--posix'
- Operate in strict POSIX mode. This disables all 'gawk' extensions
- (just like '--traditional') and disables all extensions not allowed
- by POSIX. *Note Common Extensions:: for a summary of the extensions
- in 'gawk' that are disabled by this option. Also, the following
- additional restrictions apply:
-
- * Newlines are not allowed after '?' or ':' (*note Conditional
- Exp::).
-
- * Specifying '-Ft' on the command line does not set the value of
- 'FS' to be a single TAB character (*note Field Separators::).
-
- * The locale's decimal point character is used for parsing input
- data (*note Locales::).
-
- If you supply both '--traditional' and '--posix' on the command
- line, '--posix' takes precedence. 'gawk' issues a warning if both
- options are supplied.
-
-'-r'
-'--re-interval'
- Allow interval expressions (*note Regexp Operators::) in regexps.
- This is now 'gawk''s default behavior. Nevertheless, this option
- remains (both for backward compatibility and for use in combination
- with '--traditional').
-
-'-s'
-'--no-optimize'
- Disable 'gawk''s default optimizations on the internal
- representation of the program.
-
-'-S'
-'--sandbox'
- Disable the 'system()' function, input redirections with 'getline',
- output redirections with 'print' and 'printf', and dynamic
- extensions. This is particularly useful when you want to run 'awk'
- scripts from questionable sources and need to make sure the scripts
- can't access your system (other than the specified input data
- file).
-
-'-t'
-'--lint-old'
- Warn about constructs that are not available in the original
- version of 'awk' from Version 7 Unix (*note V7/SVR3.1::).
-
-'-V'
-'--version'
- Print version information for this particular copy of 'gawk'. This
- allows you to determine if your copy of 'gawk' is up to date with
- respect to whatever the Free Software Foundation is currently
- distributing. It is also useful for bug reports (*note Bugs::).
-
- As long as program text has been supplied, any other options are
-flagged as invalid with a warning message but are otherwise ignored.
-
- In compatibility mode, as a special case, if the value of FS supplied
-to the '-F' option is 't', then 'FS' is set to the TAB character
-('"\t"'). This is true only for '--traditional' and not for '--posix'
-(*note Field Separators::).
-
- The '-f' option may be used more than once on the command line. If
-it is, 'awk' reads its program source from all of the named files, as if
-they had been concatenated together into one big file. This is useful
-for creating libraries of 'awk' functions. These functions can be
-written once and then retrieved from a standard place, instead of having
-to be included in each individual program. The '-i' option is similar
-in this regard. (As mentioned in *note Definition Syntax::, function
-names must be unique.)
-
- With standard 'awk', library functions can still be used, even if the
-program is entered at the keyboard, by specifying '-f /dev/tty'. After
-typing your program, type 'Ctrl-d' (the end-of-file character) to
-terminate it. (You may also use '-f -' to read program source from the
-standard input, but then you will not be able to also use the standard
-input as a source of data.)
-
- Because it is clumsy using the standard 'awk' mechanisms to mix
-source file and command-line 'awk' programs, 'gawk' provides the '-e'
-option. This does not require you to preempt the standard input for
-your source code; it allows you to easily mix command-line and library
-source code (*note AWKPATH Variable::). As with '-f', the '-e' and '-i'
-options may also be used multiple times on the command line.
-
- If no '-f' or '-e' option is specified, then 'gawk' uses the first
-nonoption command-line argument as the text of the program source code.
-
- If the environment variable 'POSIXLY_CORRECT' exists, then 'gawk'
-behaves in strict POSIX mode, exactly as if you had supplied '--posix'.
-Many GNU programs look for this environment variable to suppress
-extensions that conflict with POSIX, but 'gawk' behaves differently: it
-suppresses all extensions, even those that do not conflict with POSIX,
-and behaves in strict POSIX mode. If '--lint' is supplied on the
-command line and 'gawk' turns on POSIX mode because of
-'POSIXLY_CORRECT', then it issues a warning message indicating that
-POSIX mode is in effect. You would typically set this variable in your
-shell's startup file. For a Bourne-compatible shell (such as Bash), you
-would add these lines to the '.profile' file in your home directory:
-
- POSIXLY_CORRECT=true
- export POSIXLY_CORRECT
-
- For a C shell-compatible shell,(2) you would add this line to the
-'.login' file in your home directory:
-
- setenv POSIXLY_CORRECT true
-
- Having 'POSIXLY_CORRECT' set is not recommended for daily use, but it
-is good for testing the portability of your programs to other
-environments.
-
- ---------- Footnotes ----------
-
- (1) For more detail, please see Section 4.4 of RFC 3875
-(http://www.ietf.org/rfc/rfc3875). Also see the explanatory note sent
-to the 'gawk' bug mailing list
-(http://lists.gnu.org/archive/html/bug-gawk/2014-11/msg00022.html).
-
- (2) Not recommended.
-
-
-File: gawk.info, Node: Other Arguments, Next: Naming Standard Input, Prev: Options, Up: Invoking Gawk
-
-2.3 Other Command-Line Arguments
-================================
-
-Any additional arguments on the command line are normally treated as
-input files to be processed in the order specified. However, an
-argument that has the form 'VAR=VALUE', assigns the value VALUE to the
-variable VAR--it does not specify a file at all. (See *note Assignment
-Options::.) In the following example, COUNT=1 is a variable assignment,
-not a file name:
-
- awk -f program.awk file1 count=1 file2
-
- All the command-line arguments are made available to your 'awk'
-program in the 'ARGV' array (*note Built-in Variables::). Command-line
-options and the program text (if present) are omitted from 'ARGV'. All
-other arguments, including variable assignments, are included. As each
-element of 'ARGV' is processed, 'gawk' sets 'ARGIND' to the index in
-'ARGV' of the current element.
-
- Changing 'ARGC' and 'ARGV' in your 'awk' program lets you control how
-'awk' processes the input files; this is described in more detail in
-*note ARGC and ARGV::.
-
- The distinction between file name arguments and variable-assignment
-arguments is made when 'awk' is about to open the next input file. At
-that point in execution, it checks the file name to see whether it is
-really a variable assignment; if so, 'awk' sets the variable instead of
-reading a file.
-
- Therefore, the variables actually receive the given values after all
-previously specified files have been read. In particular, the values of
-variables assigned in this fashion are _not_ available inside a 'BEGIN'
-rule (*note BEGIN/END::), because such rules are run before 'awk' begins
-scanning the argument list.
-
- The variable values given on the command line are processed for
-escape sequences (*note Escape Sequences::). (d.c.)
-
- In some very early implementations of 'awk', when a variable
-assignment occurred before any file names, the assignment would happen
-_before_ the 'BEGIN' rule was executed. 'awk''s behavior was thus
-inconsistent; some command-line assignments were available inside the
-'BEGIN' rule, while others were not. Unfortunately, some applications
-came to depend upon this "feature." When 'awk' was changed to be more
-consistent, the '-v' option was added to accommodate applications that
-depended upon the old behavior.
-
- The variable assignment feature is most useful for assigning to
-variables such as 'RS', 'OFS', and 'ORS', which control input and output
-formats, before scanning the data files. It is also useful for
-controlling state if multiple passes are needed over a data file. For
-example:
-
- awk 'pass == 1 { PASS 1 STUFF }
- pass == 2 { PASS 2 STUFF }' pass=1 mydata pass=2 mydata
-
- Given the variable assignment feature, the '-F' option for setting
-the value of 'FS' is not strictly necessary. It remains for historical
-compatibility.
-
-
-File: gawk.info, Node: Naming Standard Input, Next: Environment Variables, Prev: Other Arguments, Up: Invoking Gawk
-
-2.4 Naming Standard Input
-=========================
-
-Often, you may wish to read standard input together with other files.
-For example, you may wish to read one file, read standard input coming
-from a pipe, and then read another file.
-
- The way to name the standard input, with all versions of 'awk', is to
-use a single, standalone minus sign or dash, '-'. For example:
-
- SOME_COMMAND | awk -f myprog.awk file1 - file2
-
-Here, 'awk' first reads 'file1', then it reads the output of
-SOME_COMMAND, and finally it reads 'file2'.
-
- You may also use '"-"' to name standard input when reading files with
-'getline' (*note Getline/File::).
-
- In addition, 'gawk' allows you to specify the special file name
-'/dev/stdin', both on the command line and with 'getline'. Some other
-versions of 'awk' also support this, but it is not standard. (Some
-operating systems provide a '/dev/stdin' file in the filesystem;
-however, 'gawk' always processes this file name itself.)
-
-
-File: gawk.info, Node: Environment Variables, Next: Exit Status, Prev: Naming Standard Input, Up: Invoking Gawk
-
-2.5 The Environment Variables 'gawk' Uses
-=========================================
-
-A number of environment variables influence how 'gawk' behaves.
-
-* Menu:
-
-* AWKPATH Variable:: Searching directories for 'awk'
- programs.
-* AWKLIBPATH Variable:: Searching directories for 'awk' shared
- libraries.
-* Other Environment Variables:: The environment variables.
-
-
-File: gawk.info, Node: AWKPATH Variable, Next: AWKLIBPATH Variable, Up: Environment Variables
-
-2.5.1 The 'AWKPATH' Environment Variable
-----------------------------------------
-
-The previous minor node described how 'awk' program files can be named
-on the command line with the '-f' option. In most 'awk'
-implementations, you must supply a precise pathname for each program
-file, unless the file is in the current directory. But with 'gawk', if
-the file name supplied to the '-f' or '-i' options does not contain a
-directory separator '/', then 'gawk' searches a list of directories
-(called the "search path") one by one, looking for a file with the
-specified name.
-
- The search path is a string consisting of directory names separated
-by colons.(1) 'gawk' gets its search path from the 'AWKPATH'
-environment variable. If that variable does not exist, or if it has an
-empty value, 'gawk' uses a default path (described shortly).
-
- The search path feature is particularly helpful for building
-libraries of useful 'awk' functions. The library files can be placed in
-a standard directory in the default path and then specified on the
-command line with a short file name. Otherwise, you would have to type
-the full file name for each file.
-
- By using the '-i' or '-f' options, your command-line 'awk' programs
-can use facilities in 'awk' library files (*note Library Functions::).
-Path searching is not done if 'gawk' is in compatibility mode. This is
-true for both '--traditional' and '--posix'. *Note Options::.
-
- If the source code file is not found after the initial search, the
-path is searched again after adding the suffix '.awk' to the file name.
-
- 'gawk''s path search mechanism is similar to the shell's. (See 'The
-Bourne-Again SHell manual' (http://www.gnu.org/software/bash/manual/).)
-It treats a null entry in the path as indicating the current directory.
-(A null entry is indicated by starting or ending the path with a colon
-or by placing two colons next to each other ['::'].)
-
- NOTE: To include the current directory in the path, either place
- '.' as an entry in the path or write a null entry in the path.
-
- Different past versions of 'gawk' would also look explicitly in the
- current directory, either before or after the path search. As of
- version 4.1.2, this no longer happens; if you wish to look in the
- current directory, you must include '.' either as a separate entry
- or as a null entry in the search path.
-
- The default value for 'AWKPATH' is '.:/usr/local/share/awk'.(2)
-Since '.' is included at the beginning, 'gawk' searches first in the
-current directory and then in '/usr/local/share/awk'. In practice, this
-means that you will rarely need to change the value of 'AWKPATH'.
-
- *Note Shell Startup Files::, for information on functions that help
-to manipulate the 'AWKPATH' variable.
-
- 'gawk' places the value of the search path that it used into
-'ENVIRON["AWKPATH"]'. This provides access to the actual search path
-value from within an 'awk' program.
-
- Although you can change 'ENVIRON["AWKPATH"]' within your 'awk'
-program, this has no effect on the running program's behavior. This
-makes sense: the 'AWKPATH' environment variable is used to find the
-program source files. Once your program is running, all the files have
-been found, and 'gawk' no longer needs to use 'AWKPATH'.
-
- ---------- Footnotes ----------
-
- (1) Semicolons on MS-Windows.
-
- (2) Your version of 'gawk' may use a different directory; it will
-depend upon how 'gawk' was built and installed. The actual directory is
-the value of '$(datadir)' generated when 'gawk' was configured. You
-probably don't need to worry about this, though.
-
-
-File: gawk.info, Node: AWKLIBPATH Variable, Next: Other Environment Variables, Prev: AWKPATH Variable, Up: Environment Variables
-
-2.5.2 The 'AWKLIBPATH' Environment Variable
--------------------------------------------
-
-The 'AWKLIBPATH' environment variable is similar to the 'AWKPATH'
-variable, but it is used to search for loadable extensions (stored as
-system shared libraries) specified with the '-l' option rather than for
-source files. If the extension is not found, the path is searched again
-after adding the appropriate shared library suffix for the platform.
-For example, on GNU/Linux systems, the suffix '.so' is used. The search
-path specified is also used for extensions loaded via the '@load'
-keyword (*note Loading Shared Libraries::).
-
- If 'AWKLIBPATH' does not exist in the environment, or if it has an
-empty value, 'gawk' uses a default path; this is typically
-'/usr/local/lib/gawk', although it can vary depending upon how 'gawk'
-was built.
-
- *Note Shell Startup Files::, for information on functions that help
-to manipulate the 'AWKLIBPATH' variable.
-
- 'gawk' places the value of the search path that it used into
-'ENVIRON["AWKLIBPATH"]'. This provides access to the actual search path
-value from within an 'awk' program.
-
-
-File: gawk.info, Node: Other Environment Variables, Prev: AWKLIBPATH Variable, Up: Environment Variables
-
-2.5.3 Other Environment Variables
----------------------------------
-
-A number of other environment variables affect 'gawk''s behavior, but
-they are more specialized. Those in the following list are meant to be
-used by regular users:
-
-'GAWK_MSEC_SLEEP'
- Specifies the interval between connection retries, in milliseconds.
- On systems that do not support the 'usleep()' system call, the
- value is rounded up to an integral number of seconds.
-
-'GAWK_READ_TIMEOUT'
- Specifies the time, in milliseconds, for 'gawk' to wait for input
- before returning with an error. *Note Read Timeout::.
-
-'GAWK_SOCK_RETRIES'
- Controls the number of times 'gawk' attempts to retry a two-way
- TCP/IP (socket) connection before giving up. *Note TCP/IP
- Networking::. Note that when nonfatal I/O is enabled (*note
- Nonfatal::), 'gawk' only tries to open a TCP/IP socket once.
-
-'POSIXLY_CORRECT'
- Causes 'gawk' to switch to POSIX-compatibility mode, disabling all
- traditional and GNU extensions. *Note Options::.
-
- The environment variables in the following list are meant for use by
-the 'gawk' developers for testing and tuning. They are subject to
-change. The variables are:
-
-'AWKBUFSIZE'
- This variable only affects 'gawk' on POSIX-compliant systems. With
- a value of 'exact', 'gawk' uses the size of each input file as the
- size of the memory buffer to allocate for I/O. Otherwise, the value
- should be a number, and 'gawk' uses that number as the size of the
- buffer to allocate. (When this variable is not set, 'gawk' uses
- the smaller of the file's size and the "default" blocksize, which
- is usually the filesystem's I/O blocksize.)
-
-'AWK_HASH'
- If this variable exists with a value of 'gst', 'gawk' switches to
- using the hash function from GNU Smalltalk for managing arrays.
- This function may be marginally faster than the standard function.
-
-'AWKREADFUNC'
- If this variable exists, 'gawk' switches to reading source files
- one line at a time, instead of reading in blocks. This exists for
- debugging problems on filesystems on non-POSIX operating systems
- where I/O is performed in records, not in blocks.
-
-'GAWK_MSG_SRC'
- If this variable exists, 'gawk' includes the file name and line
- number within the 'gawk' source code from which warning and/or
- fatal messages are generated. Its purpose is to help isolate the
- source of a message, as there are multiple places that produce the
- same warning or error message.
-
-'GAWK_LOCALE_DIR'
- Specifies the location of compiled message object files for 'gawk'
- itself. This is passed to the 'bindtextdomain()' function when
- 'gawk' starts up.
-
-'GAWK_NO_DFA'
- If this variable exists, 'gawk' does not use the DFA regexp matcher
- for "does it match" kinds of tests. This can cause 'gawk' to be
- slower. Its purpose is to help isolate differences between the two
- regexp matchers that 'gawk' uses internally. (There aren't
- supposed to be differences, but occasionally theory and practice
- don't coordinate with each other.)
-
-'GAWK_STACKSIZE'
- This specifies the amount by which 'gawk' should grow its internal
- evaluation stack, when needed.
-
-'INT_CHAIN_MAX'
- This specifies intended maximum number of items 'gawk' will
- maintain on a hash chain for managing arrays indexed by integers.
-
-'STR_CHAIN_MAX'
- This specifies intended maximum number of items 'gawk' will
- maintain on a hash chain for managing arrays indexed by strings.
-
-'TIDYMEM'
- If this variable exists, 'gawk' uses the 'mtrace()' library calls
- from the GNU C library to help track down possible memory leaks.
-
-
-File: gawk.info, Node: Exit Status, Next: Include Files, Prev: Environment Variables, Up: Invoking Gawk
-
-2.6 'gawk''s Exit Status
-========================
-
-If the 'exit' statement is used with a value (*note Exit Statement::),
-then 'gawk' exits with the numeric value given to it.
-
- Otherwise, if there were no problems during execution, 'gawk' exits
-with the value of the C constant 'EXIT_SUCCESS'. This is usually zero.
-
- If an error occurs, 'gawk' exits with the value of the C constant
-'EXIT_FAILURE'. This is usually one.
-
- If 'gawk' exits because of a fatal error, the exit status is two. On
-non-POSIX systems, this value may be mapped to 'EXIT_FAILURE'.
-
-
-File: gawk.info, Node: Include Files, Next: Loading Shared Libraries, Prev: Exit Status, Up: Invoking Gawk
-
-2.7 Including Other Files into Your Program
-===========================================
-
-This minor node describes a feature that is specific to 'gawk'.
-
- The '@include' keyword can be used to read external 'awk' source
-files. This gives you the ability to split large 'awk' source files
-into smaller, more manageable pieces, and also lets you reuse common
-'awk' code from various 'awk' scripts. In other words, you can group
-together 'awk' functions used to carry out specific tasks into external
-files. These files can be used just like function libraries, using the
-'@include' keyword in conjunction with the 'AWKPATH' environment
-variable. Note that source files may also be included using the '-i'
-option.
-
- Let's see an example. We'll start with two (trivial) 'awk' scripts,
-namely 'test1' and 'test2'. Here is the 'test1' script:
-
- BEGIN {
- print "This is script test1."
- }
-
-and here is 'test2':
-
- @include "test1"
- BEGIN {
- print "This is script test2."
- }
-
- Running 'gawk' with 'test2' produces the following result:
-
- $ gawk -f test2
- -| This is script test1.
- -| This is script test2.
-
- 'gawk' runs the 'test2' script, which includes 'test1' using the
-'@include' keyword. So, to include external 'awk' source files, you
-just use '@include' followed by the name of the file to be included,
-enclosed in double quotes.
-
- NOTE: Keep in mind that this is a language construct and the file
- name cannot be a string variable, but rather just a literal string
- constant in double quotes.
-
- The files to be included may be nested; e.g., given a third script,
-namely 'test3':
-
- @include "test2"
- BEGIN {
- print "This is script test3."
- }
-
-Running 'gawk' with the 'test3' script produces the following results:
-
- $ gawk -f test3
- -| This is script test1.
- -| This is script test2.
- -| This is script test3.
-
- The file name can, of course, be a pathname. For example:
-
- @include "../io_funcs"
-
-and:
-
- @include "/usr/awklib/network"
-
-are both valid. The 'AWKPATH' environment variable can be of great
-value when using '@include'. The same rules for the use of the
-'AWKPATH' variable in command-line file searches (*note AWKPATH
-Variable::) apply to '@include' also.
-
- This is very helpful in constructing 'gawk' function libraries. If
-you have a large script with useful, general-purpose 'awk' functions,
-you can break it down into library files and put those files in a
-special directory. You can then include those "libraries," either by
-using the full pathnames of the files, or by setting the 'AWKPATH'
-environment variable accordingly and then using '@include' with just the
-file part of the full pathname. Of course, you can keep library files
-in more than one directory; the more complex the working environment is,
-the more directories you may need to organize the files to be included.
-
- Given the ability to specify multiple '-f' options, the '@include'
-mechanism is not strictly necessary. However, the '@include' keyword
-can help you in constructing self-contained 'gawk' programs, thus
-reducing the need for writing complex and tedious command lines. In
-particular, '@include' is very useful for writing CGI scripts to be run
-from web pages.
-
- As mentioned in *note AWKPATH Variable::, the current directory is
-always searched first for source files, before searching in 'AWKPATH';
-this also applies to files named with '@include'.
-
-
-File: gawk.info, Node: Loading Shared Libraries, Next: Obsolete, Prev: Include Files, Up: Invoking Gawk
-
-2.8 Loading Dynamic Extensions into Your Program
-================================================
-
-This minor node describes a feature that is specific to 'gawk'.
-
- The '@load' keyword can be used to read external 'awk' extensions
-(stored as system shared libraries). This allows you to link in
-compiled code that may offer superior performance and/or give you access
-to extended capabilities not supported by the 'awk' language. The
-'AWKLIBPATH' variable is used to search for the extension. Using
-'@load' is completely equivalent to using the '-l' command-line option.
-
- If the extension is not initially found in 'AWKLIBPATH', another
-search is conducted after appending the platform's default shared
-library suffix to the file name. For example, on GNU/Linux systems, the
-suffix '.so' is used:
-
- $ gawk '@load "ordchr"; BEGIN {print chr(65)}'
- -| A
-
-This is equivalent to the following example:
-
- $ gawk -lordchr 'BEGIN {print chr(65)}'
- -| A
-
-For command-line usage, the '-l' option is more convenient, but '@load'
-is useful for embedding inside an 'awk' source file that requires access
-to an extension.
-
- *note Dynamic Extensions::, describes how to write extensions (in C
-or C++) that can be loaded with either '@load' or the '-l' option. It
-also describes the 'ordchr' extension.
-
-
-File: gawk.info, Node: Obsolete, Next: Undocumented, Prev: Loading Shared Libraries, Up: Invoking Gawk
-
-2.9 Obsolete Options and/or Features
-====================================
-
-This minor node describes features and/or command-line options from
-previous releases of 'gawk' that either are not available in the current
-version or are still supported but deprecated (meaning that they will
-_not_ be in the next release).
-
- The process-related special files '/dev/pid', '/dev/ppid',
-'/dev/pgrpid', and '/dev/user' were deprecated in 'gawk' 3.1, but still
-worked. As of version 4.0, they are no longer interpreted specially by
-'gawk'. (Use 'PROCINFO' instead; see *note Auto-set::.)
-
-
-File: gawk.info, Node: Undocumented, Next: Invoking Summary, Prev: Obsolete, Up: Invoking Gawk
-
-2.10 Undocumented Options and Features
-======================================
-
- Use the Source, Luke!
- -- _Obi-Wan_
-
- This minor node intentionally left blank.
-
-
-File: gawk.info, Node: Invoking Summary, Prev: Undocumented, Up: Invoking Gawk
-
-2.11 Summary
-============
-
- * Use either 'awk 'PROGRAM' FILES' or 'awk -f PROGRAM-FILE FILES' to
- run 'awk'.
-
- * The three standard options for all versions of 'awk' are '-f',
- '-F', and '-v'. 'gawk' supplies these and many others, as well as
- corresponding GNU-style long options.
-
- * Nonoption command-line arguments are usually treated as file names,
- unless they have the form 'VAR=VALUE', in which case they are taken
- as variable assignments to be performed at that point in processing
- the input.
-
- * All nonoption command-line arguments, excluding the program text,
- are placed in the 'ARGV' array. Adjusting 'ARGC' and 'ARGV'
- affects how 'awk' processes input.
-
- * You can use a single minus sign ('-') to refer to standard input on
- the command line. 'gawk' also lets you use the special file name
- '/dev/stdin'.
-
- * 'gawk' pays attention to a number of environment variables.
- 'AWKPATH', 'AWKLIBPATH', and 'POSIXLY_CORRECT' are the most
- important ones.
-
- * 'gawk''s exit status conveys information to the program that
- invoked it. Use the 'exit' statement from within an 'awk' program
- to set the exit status.
-
- * 'gawk' allows you to include other 'awk' source files into your
- program using the '@include' statement and/or the '-i' and '-f'
- command-line options.
-
- * 'gawk' allows you to load additional functions written in C or C++
- using the '@load' statement and/or the '-l' option. (This advanced
- feature is described later, in *note Dynamic Extensions::.)
-
-
-File: gawk.info, Node: Regexp, Next: Reading Files, Prev: Invoking Gawk, Up: Top
-
-3 Regular Expressions
-*********************
-
-A "regular expression", or "regexp", is a way of describing a set of
-strings. Because regular expressions are such a fundamental part of
-'awk' programming, their format and use deserve a separate major node.
-
- A regular expression enclosed in slashes ('/') is an 'awk' pattern
-that matches every input record whose text belongs to that set. The
-simplest regular expression is a sequence of letters, numbers, or both.
-Such a regexp matches any string that contains that sequence. Thus, the
-regexp 'foo' matches any string containing 'foo'. Thus, the pattern
-'/foo/' matches any input record containing the three adjacent
-characters 'foo' _anywhere_ in the record. Other kinds of regexps let
-you specify more complicated classes of strings.
-
-* Menu:
-
-* Regexp Usage:: How to Use Regular Expressions.
-* Escape Sequences:: How to write nonprinting characters.
-* Regexp Operators:: Regular Expression Operators.
-* Bracket Expressions:: What can go between '[...]'.
-* Leftmost Longest:: How much text matches.
-* Computed Regexps:: Using Dynamic Regexps.
-* GNU Regexp Operators:: Operators specific to GNU software.
-* Case-sensitivity:: How to do case-insensitive matching.
-* Strong Regexp Constants:: Strongly typed regexp constants.
-* Regexp Summary:: Regular expressions summary.
-
-
-File: gawk.info, Node: Regexp Usage, Next: Escape Sequences, Up: Regexp
-
-3.1 How to Use Regular Expressions
-==================================
-
-A regular expression can be used as a pattern by enclosing it in
-slashes. Then the regular expression is tested against the entire text
-of each record. (Normally, it only needs to match some part of the text
-in order to succeed.) For example, the following prints the second
-field of each record where the string 'li' appears anywhere in the
-record:
-
- $ awk '/li/ { print $2 }' mail-list
- -| 555-5553
- -| 555-0542
- -| 555-6699
- -| 555-3430
-
- Regular expressions can also be used in matching expressions. These
-expressions allow you to specify the string to match against; it need
-not be the entire current input record. The two operators '~' and '!~'
-perform regular expression comparisons. Expressions using these
-operators can be used as patterns, or in 'if', 'while', 'for', and 'do'
-statements. (*Note Statements::.) For example, the following is true
-if the expression EXP (taken as a string) matches REGEXP:
-
- EXP ~ /REGEXP/
-
-This example matches, or selects, all input records with the uppercase
-letter 'J' somewhere in the first field:
-
- $ awk '$1 ~ /J/' inventory-shipped
- -| Jan 13 25 15 115
- -| Jun 31 42 75 492
- -| Jul 24 34 67 436
- -| Jan 21 36 64 620
-
- So does this:
-
- awk '{ if ($1 ~ /J/) print }' inventory-shipped
-
- This next example is true if the expression EXP (taken as a character
-string) does _not_ match REGEXP:
-
- EXP !~ /REGEXP/
-
- The following example matches, or selects, all input records whose
-first field _does not_ contain the uppercase letter 'J':
-
- $ awk '$1 !~ /J/' inventory-shipped
- -| Feb 15 32 24 226
- -| Mar 15 24 34 228
- -| Apr 31 52 63 420
- -| May 16 34 29 208
- ...
-
- When a regexp is enclosed in slashes, such as '/foo/', we call it a
-"regexp constant", much like '5.27' is a numeric constant and '"foo"' is
-a string constant.
-
-
-File: gawk.info, Node: Escape Sequences, Next: Regexp Operators, Prev: Regexp Usage, Up: Regexp
-
-3.2 Escape Sequences
-====================
-
-Some characters cannot be included literally in string constants
-('"foo"') or regexp constants ('/foo/'). Instead, they should be
-represented with "escape sequences", which are character sequences
-beginning with a backslash ('\'). One use of an escape sequence is to
-include a double-quote character in a string constant. Because a plain
-double quote ends the string, you must use '\"' to represent an actual
-double-quote character as a part of the string. For example:
-
- $ awk 'BEGIN { print "He said \"hi!\" to her." }'
- -| He said "hi!" to her.
-
- The backslash character itself is another character that cannot be
-included normally; you must write '\\' to put one backslash in the
-string or regexp. Thus, the string whose contents are the two
-characters '"' and '\' must be written '"\"\\"'.
-
- Other escape sequences represent unprintable characters such as TAB
-or newline. There is nothing to stop you from entering most unprintable
-characters directly in a string constant or regexp constant, but they
-may look ugly.
-
- The following list presents all the escape sequences used in 'awk'
-and what they represent. Unless noted otherwise, all these escape
-sequences apply to both string constants and regexp constants:
-
-'\\'
- A literal backslash, '\'.
-
-'\a'
- The "alert" character, 'Ctrl-g', ASCII code 7 (BEL). (This often
- makes some sort of audible noise.)
-
-'\b'
- Backspace, 'Ctrl-h', ASCII code 8 (BS).
-
-'\f'
- Formfeed, 'Ctrl-l', ASCII code 12 (FF).
-
-'\n'
- Newline, 'Ctrl-j', ASCII code 10 (LF).
-
-'\r'
- Carriage return, 'Ctrl-m', ASCII code 13 (CR).
-
-'\t'
- Horizontal TAB, 'Ctrl-i', ASCII code 9 (HT).
-
-'\v'
- Vertical TAB, 'Ctrl-k', ASCII code 11 (VT).
-
-'\NNN'
- The octal value NNN, where NNN stands for 1 to 3 digits between '0'
- and '7'. For example, the code for the ASCII ESC (escape)
- character is '\033'.
-
-'\xHH...'
- The hexadecimal value HH, where HH stands for a sequence of
- hexadecimal digits ('0'-'9', and either 'A'-'F' or 'a'-'f'). A
- maximum of two digts are allowed after the '\x'. Any further
- hexadecimal digits are treated as simple letters or numbers.
- (c.e.) (The '\x' escape sequence is not allowed in POSIX awk.)
-
- CAUTION: In ISO C, the escape sequence continues until the
- first nonhexadecimal digit is seen. For many years, 'gawk'
- would continue incorporating hexadecimal digits into the value
- until a non-hexadecimal digit or the end of the string was
- encountered. However, using more than two hexadecimal digits
- produced undefined results. As of version 4.2, only two
- digits are processed.
-
-'\/'
- A literal slash (necessary for regexp constants only). This
- sequence is used when you want to write a regexp constant that
- contains a slash (such as '/.*:\/home\/[[:alnum:]]+:.*/'; the
- '[[:alnum:]]' notation is discussed in *note Bracket
- Expressions::). Because the regexp is delimited by slashes, you
- need to escape any slash that is part of the pattern, in order to
- tell 'awk' to keep processing the rest of the regexp.
-
-'\"'
- A literal double quote (necessary for string constants only). This
- sequence is used when you want to write a string constant that
- contains a double quote (such as '"He said \"hi!\" to her."').
- Because the string is delimited by double quotes, you need to
- escape any quote that is part of the string, in order to tell 'awk'
- to keep processing the rest of the string.
-
- In 'gawk', a number of additional two-character sequences that begin
-with a backslash have special meaning in regexps. *Note GNU Regexp
-Operators::.
-
- In a regexp, a backslash before any character that is not in the
-previous list and not listed in *note GNU Regexp Operators:: means that
-the next character should be taken literally, even if it would normally
-be a regexp operator. For example, '/a\+b/' matches the three
-characters 'a+b'.
-
- For complete portability, do not use a backslash before any character
-not shown in the previous list or that is not an operator.
-
- Backslash Before Regular Characters
-
- If you place a backslash in a string constant before something that
-is not one of the characters previously listed, POSIX 'awk' purposely
-leaves what happens as undefined. There are two choices:
-
-Strip the backslash out
- This is what BWK 'awk' and 'gawk' both do. For example, '"a\qc"'
- is the same as '"aqc"'. (Because this is such an easy bug both to
- introduce and to miss, 'gawk' warns you about it.) Consider 'FS =
- "[ \t]+\|[ \t]+"' to use vertical bars surrounded by whitespace as
- the field separator. There should be two backslashes in the
- string: 'FS = "[ \t]+\\|[ \t]+"'.)
-
-Leave the backslash alone
- Some other 'awk' implementations do this. In such implementations,
- typing '"a\qc"' is the same as typing '"a\\qc"'.
-
- To summarize:
-
- * The escape sequences in the preceding list are always processed
- first, for both string constants and regexp constants. This
- happens very early, as soon as 'awk' reads your program.
-
- * 'gawk' processes both regexp constants and dynamic regexps (*note
- Computed Regexps::), for the special operators listed in *note GNU
- Regexp Operators::.
-
- * A backslash before any other character means to treat that
- character literally.
-
- Escape Sequences for Metacharacters
-
- Suppose you use an octal or hexadecimal escape to represent a regexp
-metacharacter. (See *note Regexp Operators::.) Does 'awk' treat the
-character as a literal character or as a regexp operator?
-
- Historically, such characters were taken literally. (d.c.) However,
-the POSIX standard indicates that they should be treated as real
-metacharacters, which is what 'gawk' does. In compatibility mode (*note
-Options::), 'gawk' treats the characters represented by octal and
-hexadecimal escape sequences literally when used in regexp constants.
-Thus, '/a\52b/' is equivalent to '/a\*b/'.
-
-
-File: gawk.info, Node: Regexp Operators, Next: Bracket Expressions, Prev: Escape Sequences, Up: Regexp
-
-3.3 Regular Expression Operators
-================================
-
-You can combine regular expressions with special characters, called
-"regular expression operators" or "metacharacters", to increase the
-power and versatility of regular expressions.
-
- The escape sequences described in *note Escape Sequences:: are valid
-inside a regexp. They are introduced by a '\' and are recognized and
-converted into corresponding real characters as the very first step in
-processing regexps.
-
- Here is a list of metacharacters. All characters that are not escape
-sequences and that are not listed here stand for themselves:
-
-'\'
- This suppresses the special meaning of a character when matching.
- For example, '\$' matches the character '$'.
-
-'^'
- This matches the beginning of a string. '^@chapter' matches
- '@chapter' at the beginning of a string, for example, and can be
- used to identify chapter beginnings in Texinfo source files. The
- '^' is known as an "anchor", because it anchors the pattern to
- match only at the beginning of the string.
-
- It is important to realize that '^' does not match the beginning of
- a line (the point right after a '\n' newline character) embedded in
- a string. The condition is not true in the following example:
-
- if ("line1\nLINE 2" ~ /^L/) ...
-
-'$'
- This is similar to '^', but it matches only at the end of a string.
- For example, 'p$' matches a record that ends with a 'p'. The '$'
- is an anchor and does not match the end of a line (the point right
- before a '\n' newline character) embedded in a string. The
- condition in the following example is not true:
-
- if ("line1\nLINE 2" ~ /1$/) ...
-
-'.' (period)
- This matches any single character, _including_ the newline
- character. For example, '.P' matches any single character followed
- by a 'P' in a string. Using concatenation, we can make a regular
- expression such as 'U.A', which matches any three-character
- sequence that begins with 'U' and ends with 'A'.
-
- In strict POSIX mode (*note Options::), '.' does not match the NUL
- character, which is a character with all bits equal to zero.
- Otherwise, NUL is just another character. Other versions of 'awk'
- may not be able to match the NUL character.
-
-'['...']'
- This is called a "bracket expression".(1) It matches any _one_ of
- the characters that are enclosed in the square brackets. For
- example, '[MVX]' matches any one of the characters 'M', 'V', or 'X'
- in a string. A full discussion of what can be inside the square
- brackets of a bracket expression is given in *note Bracket
- Expressions::.
-
-'[^'...']'
- This is a "complemented bracket expression". The first character
- after the '[' _must_ be a '^'. It matches any characters _except_
- those in the square brackets. For example, '[^awk]' matches any
- character that is not an 'a', 'w', or 'k'.
-
-'|'
- This is the "alternation operator" and it is used to specify
- alternatives. The '|' has the lowest precedence of all the regular
- expression operators. For example, '^P|[aeiouy]' matches any
- string that matches either '^P' or '[aeiouy]'. This means it
- matches any string that starts with 'P' or contains (anywhere
- within it) a lowercase English vowel.
-
- The alternation applies to the largest possible regexps on either
- side.
-
-'('...')'
- Parentheses are used for grouping in regular expressions, as in
- arithmetic. They can be used to concatenate regular expressions
- containing the alternation operator, '|'. For example,
- '@(samp|code)\{[^}]+\}' matches both '@code{foo}' and '@samp{bar}'.
- (These are Texinfo formatting control sequences. The '+' is
- explained further on in this list.)
-
-'*'
- This symbol means that the preceding regular expression should be
- repeated as many times as necessary to find a match. For example,
- 'ph*' applies the '*' symbol to the preceding 'h' and looks for
- matches of one 'p' followed by any number of 'h's. This also
- matches just 'p' if no 'h's are present.
-
- There are two subtle points to understand about how '*' works.
- First, the '*' applies only to the single preceding regular
- expression component (e.g., in 'ph*', it applies just to the 'h').
- To cause '*' to apply to a larger subexpression, use parentheses:
- '(ph)*' matches 'ph', 'phph', 'phphph', and so on.
-
- Second, '*' finds as many repetitions as possible. If the text to
- be matched is 'phhhhhhhhhhhhhhooey', 'ph*' matches all of the 'h's.
-
-'+'
- This symbol is similar to '*', except that the preceding expression
- must be matched at least once. This means that 'wh+y' would match
- 'why' and 'whhy', but not 'wy', whereas 'wh*y' would match all
- three.
-
-'?'
- This symbol is similar to '*', except that the preceding expression
- can be matched either once or not at all. For example, 'fe?d'
- matches 'fed' and 'fd', but nothing else.
-
-'{'N'}'
-'{'N',}'
-'{'N','M'}'
- One or two numbers inside braces denote an "interval expression".
- If there is one number in the braces, the preceding regexp is
- repeated N times. If there are two numbers separated by a comma,
- the preceding regexp is repeated N to M times. If there is one
- number followed by a comma, then the preceding regexp is repeated
- at least N times:
-
- 'wh{3}y'
- Matches 'whhhy', but not 'why' or 'whhhhy'.
-
- 'wh{3,5}y'
- Matches 'whhhy', 'whhhhy', or 'whhhhhy' only.
-
- 'wh{2,}y'
- Matches 'whhy', 'whhhy', and so on.
-
- Interval expressions were not traditionally available in 'awk'.
- They were added as part of the POSIX standard to make 'awk' and
- 'egrep' consistent with each other.
-
- Initially, because old programs may use '{' and '}' in regexp
- constants, 'gawk' did _not_ match interval expressions in regexps.
-
- However, beginning with version 4.0, 'gawk' does match interval
- expressions by default. This is because compatibility with POSIX
- has become more important to most 'gawk' users than compatibility
- with old programs.
-
- For programs that use '{' and '}' in regexp constants, it is good
- practice to always escape them with a backslash. Then the regexp
- constants are valid and work the way you want them to, using any
- version of 'awk'.(2)
-
- Finally, when '{' and '}' appear in regexp constants in a way that
- cannot be interpreted as an interval expression (such as '/q{a}/'),
- then they stand for themselves.
-
- In regular expressions, the '*', '+', and '?' operators, as well as
-the braces '{' and '}', have the highest precedence, followed by
-concatenation, and finally by '|'. As in arithmetic, parentheses can
-change how operators are grouped.
-
- In POSIX 'awk' and 'gawk', the '*', '+', and '?' operators stand for
-themselves when there is nothing in the regexp that precedes them. For
-example, '/+/' matches a literal plus sign. However, many other
-versions of 'awk' treat such a usage as a syntax error.
-
- If 'gawk' is in compatibility mode (*note Options::), interval
-expressions are not available in regular expressions.
-
- ---------- Footnotes ----------
-
- (1) In other literature, you may see a bracket expression referred to
-as either a "character set", a "character class", or a "character list".
-
- (2) Use two backslashes if you're using a string constant with a
-regexp operator or function.
-
-
-File: gawk.info, Node: Bracket Expressions, Next: Leftmost Longest, Prev: Regexp Operators, Up: Regexp
-
-3.4 Using Bracket Expressions
-=============================
-
-As mentioned earlier, a bracket expression matches any character among
-those listed between the opening and closing square brackets.
-
- Within a bracket expression, a "range expression" consists of two
-characters separated by a hyphen. It matches any single character that
-sorts between the two characters, based upon the system's native
-character set. For example, '[0-9]' is equivalent to '[0123456789]'.
-(See *note Ranges and Locales:: for an explanation of how the POSIX
-standard and 'gawk' have changed over time. This is mainly of
-historical interest.)
-
- With the increasing popularity of the Unicode character standard
-(http://www.unicode.org), there is an additional wrinkle to consider.
-Octal and hexadecimal escape sequences inside bracket expressions are
-taken to represent only single-byte characters (characters whose values
-fit within the range 0-256). To match a range of characters where the
-endpoints of the range are larger than 256, enter the multibyte
-encodings of the characters directly.
-
- To include one of the characters '\', ']', '-', or '^' in a bracket
-expression, put a '\' in front of it. For example:
-
- [d\]]
-
-matches either 'd' or ']'. Additionally, if you place ']' right after
-the opening '[', the closing bracket is treated as one of the characters
-to be matched.
-
- The treatment of '\' in bracket expressions is compatible with other
-'awk' implementations and is also mandated by POSIX. The regular
-expressions in 'awk' are a superset of the POSIX specification for
-Extended Regular Expressions (EREs). POSIX EREs are based on the
-regular expressions accepted by the traditional 'egrep' utility.
-
- "Character classes" are a feature introduced in the POSIX standard.
-A character class is a special notation for describing lists of
-characters that have a specific attribute, but the actual characters can
-vary from country to country and/or from character set to character set.
-For example, the notion of what is an alphabetic character differs
-between the United States and France.
-
- A character class is only valid in a regexp _inside_ the brackets of
-a bracket expression. Character classes consist of '[:', a keyword
-denoting the class, and ':]'. *note Table 3.1: table-char-classes.
-lists the character classes defined by the POSIX standard.
-
-Class Meaning
---------------------------------------------------------------------------
-'[:alnum:]' Alphanumeric characters
-'[:alpha:]' Alphabetic characters
-'[:blank:]' Space and TAB characters
-'[:cntrl:]' Control characters
-'[:digit:]' Numeric characters
-'[:graph:]' Characters that are both printable and visible (a space is
- printable but not visible, whereas an 'a' is both)
-'[:lower:]' Lowercase alphabetic characters
-'[:print:]' Printable characters (characters that are not control
- characters)
-'[:punct:]' Punctuation characters (characters that are not letters,
- digits, control characters, or space characters)
-'[:space:]' Space characters (such as space, TAB, and formfeed, to name
- a few)
-'[:upper:]' Uppercase alphabetic characters
-'[:xdigit:]'Characters that are hexadecimal digits
-
-Table 3.1: POSIX character classes
-
- For example, before the POSIX standard, you had to write
-'/[A-Za-z0-9]/' to match alphanumeric characters. If your character set
-had other alphabetic characters in it, this would not match them. With
-the POSIX character classes, you can write '/[[:alnum:]]/' to match the
-alphabetic and numeric characters in your character set.
-
- Some utilities that match regular expressions provide a nonstandard
-'[:ascii:]' character class; 'awk' does not. However, you can simulate
-such a construct using '[\x00-\x7F]'. This matches all values
-numerically between zero and 127, which is the defined range of the
-ASCII character set. Use a complemented character list ('[^\x00-\x7F]')
-to match any single-byte characters that are not in the ASCII range.
-
- Two additional special sequences can appear in bracket expressions.
-These apply to non-ASCII character sets, which can have single symbols
-(called "collating elements") that are represented with more than one
-character. They can also have several characters that are equivalent
-for "collating", or sorting, purposes. (For example, in French, a plain
-"e" and a grave-accented "e`" are equivalent.) These sequences are:
-
-Collating symbols
- Multicharacter collating elements enclosed between '[.' and '.]'.
- For example, if 'ch' is a collating element, then '[[.ch.]]' is a
- regexp that matches this collating element, whereas '[ch]' is a
- regexp that matches either 'c' or 'h'.
-
-Equivalence classes
- Locale-specific names for a list of characters that are equal. The
- name is enclosed between '[=' and '=]'. For example, the name 'e'
- might be used to represent all of "e," "e^," "e`," and "e'." In
- this case, '[[=e=]]' is a regexp that matches any of 'e', 'e^',
- 'e'', or 'e`'.
-
- These features are very valuable in non-English-speaking locales.
-
- CAUTION: The library functions that 'gawk' uses for regular
- expression matching currently recognize only POSIX character
- classes; they do not recognize collating symbols or equivalence
- classes.
-
- Inside a bracket expression, an opening bracket ('[') that does not
-start a character class, collating element or equivalence class is taken
-literally. This is also true of '.' and '*'.
-
-
-File: gawk.info, Node: Leftmost Longest, Next: Computed Regexps, Prev: Bracket Expressions, Up: Regexp
-
-3.5 How Much Text Matches?
-==========================
-
-Consider the following:
-
- echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }'
-
- This example uses the 'sub()' function to make a change to the input
-record. ('sub()' replaces the first instance of any text matched by the
-first argument with the string provided as the second argument; *note
-String Functions::.) Here, the regexp '/a+/' indicates "one or more 'a'
-characters," and the replacement text is '<A>'.
-
- The input contains four 'a' characters. 'awk' (and POSIX) regular
-expressions always match the leftmost, _longest_ sequence of input
-characters that can match. Thus, all four 'a' characters are replaced
-with '<A>' in this example:
-
- $ echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }'
- -| <A>bcd
-
- For simple match/no-match tests, this is not so important. But when
-doing text matching and substitutions with the 'match()', 'sub()',
-'gsub()', and 'gensub()' functions, it is very important. *Note String
-Functions::, for more information on these functions. Understanding
-this principle is also important for regexp-based record and field
-splitting (*note Records::, and also *note Field Separators::).
-
-
-File: gawk.info, Node: Computed Regexps, Next: GNU Regexp Operators, Prev: Leftmost Longest, Up: Regexp
-
-3.6 Using Dynamic Regexps
-=========================
-
-The righthand side of a '~' or '!~' operator need not be a regexp
-constant (i.e., a string of characters between slashes). It may be any
-expression. The expression is evaluated and converted to a string if
-necessary; the contents of the string are then used as the regexp. A
-regexp computed in this way is called a "dynamic regexp" or a "computed
-regexp":
-
- BEGIN { digits_regexp = "[[:digit:]]+" }
- $0 ~ digits_regexp { print }
-
-This sets 'digits_regexp' to a regexp that describes one or more digits,
-and tests whether the input record matches this regexp.
-
- NOTE: When using the '~' and '!~' operators, be aware that there is
- a difference between a regexp constant enclosed in slashes and a
- string constant enclosed in double quotes. If you are going to use
- a string constant, you have to understand that the string is, in
- essence, scanned _twice_: the first time when 'awk' reads your
- program, and the second time when it goes to match the string on
- the lefthand side of the operator with the pattern on the right.
- This is true of any string-valued expression (such as
- 'digits_regexp', shown in the previous example), not just string
- constants.
-
- What difference does it make if the string is scanned twice? The
-answer has to do with escape sequences, and particularly with
-backslashes. To get a backslash into a regular expression inside a
-string, you have to type two backslashes.
-
- For example, '/\*/' is a regexp constant for a literal '*'. Only one
-backslash is needed. To do the same thing with a string, you have to
-type '"\\*"'. The first backslash escapes the second one so that the
-string actually contains the two characters '\' and '*'.
-
- Given that you can use both regexp and string constants to describe
-regular expressions, which should you use? The answer is "regexp
-constants," for several reasons:
-
- * String constants are more complicated to write and more difficult
- to read. Using regexp constants makes your programs less
- error-prone. Not understanding the difference between the two
- kinds of constants is a common source of errors.
-
- * It is more efficient to use regexp constants. 'awk' can note that
- you have supplied a regexp and store it internally in a form that
- makes pattern matching more efficient. When using a string
- constant, 'awk' must first convert the string into this internal
- form and then perform the pattern matching.
-
- * Using regexp constants is better form; it shows clearly that you
- intend a regexp match.
-
- Using '\n' in Bracket Expressions of Dynamic Regexps
-
- Some older versions of 'awk' do not allow the newline character to be
-used inside a bracket expression for a dynamic regexp:
-
- $ awk '$0 ~ "[ \t\n]"'
- error-> awk: newline in character class [
- error-> ]...
- error-> source line number 1
- error-> context is
- error-> $0 ~ "[ >>> \t\n]" <<<
-
- But a newline in a regexp constant works with no problem:
-
- $ awk '$0 ~ /[ \t\n]/'
- here is a sample line
- -| here is a sample line
- Ctrl-d
-
- 'gawk' does not have this problem, and it isn't likely to occur often
-in practice, but it's worth noting for future reference.
-
-
-File: gawk.info, Node: GNU Regexp Operators, Next: Case-sensitivity, Prev: Computed Regexps, Up: Regexp
-
-3.7 'gawk'-Specific Regexp Operators
-====================================
-
-GNU software that deals with regular expressions provides a number of
-additional regexp operators. These operators are described in this
-minor node and are specific to 'gawk'; they are not available in other
-'awk' implementations. Most of the additional operators deal with word
-matching. For our purposes, a "word" is a sequence of one or more
-letters, digits, or underscores ('_'):
-
-'\s'
- Matches any whitespace character. Think of it as shorthand for
- '[[:space:]]'.
-
-'\S'
- Matches any character that is not whitespace. Think of it as
- shorthand for '[^[:space:]]'.
-
-'\w'
- Matches any word-constituent character--that is, it matches any
- letter, digit, or underscore. Think of it as shorthand for
- '[[:alnum:]_]'.
-
-'\W'
- Matches any character that is not word-constituent. Think of it as
- shorthand for '[^[:alnum:]_]'.
-
-'\<'
- Matches the empty string at the beginning of a word. For example,
- '/\<away/' matches 'away' but not 'stowaway'.
-
-'\>'
- Matches the empty string at the end of a word. For example,
- '/stow\>/' matches 'stow' but not 'stowaway'.
-
-'\y'
- Matches the empty string at either the beginning or the end of a
- word (i.e., the word boundar*y*). For example, '\yballs?\y'
- matches either 'ball' or 'balls', as a separate word.
-
-'\B'
- Matches the empty string that occurs between two word-constituent
- characters. For example, '/\Brat\B/' matches 'crate', but it does
- not match 'dirty rat'. '\B' is essentially the opposite of '\y'.
-
- There are two other operators that work on buffers. In Emacs, a
-"buffer" is, naturally, an Emacs buffer. Other GNU programs, including
-'gawk', consider the entire string to match as the buffer. The
-operators are:
-
-'\`'
- Matches the empty string at the beginning of a buffer (string)
-
-'\''
- Matches the empty string at the end of a buffer (string)
-
- Because '^' and '$' always work in terms of the beginning and end of
-strings, these operators don't add any new capabilities for 'awk'. They
-are provided for compatibility with other GNU software.
-
- In other GNU software, the word-boundary operator is '\b'. However,
-that conflicts with the 'awk' language's definition of '\b' as
-backspace, so 'gawk' uses a different letter. An alternative method
-would have been to require two backslashes in the GNU operators, but
-this was deemed too confusing. The current method of using '\y' for the
-GNU '\b' appears to be the lesser of two evils.
-
- The various command-line options (*note Options::) control how 'gawk'
-interprets characters in regexps:
-
-No options
- In the default case, 'gawk' provides all the facilities of POSIX
- regexps and the GNU regexp operators described in *note Regexp
- Operators::.
-
-'--posix'
- Match only POSIX regexps; the GNU operators are not special (e.g.,
- '\w' matches a literal 'w'). Interval expressions are allowed.
-
-'--traditional'
- Match traditional Unix 'awk' regexps. The GNU operators are not
- special, and interval expressions are not available. Because BWK
- 'awk' supports them, the POSIX character classes ('[[:alnum:]]',
- etc.) are available. Characters described by octal and
- hexadecimal escape sequences are treated literally, even if they
- represent regexp metacharacters.
-
-'--re-interval'
- Allow interval expressions in regexps, if '--traditional' has been
- provided. Otherwise, interval expressions are available by
- default.
-
-
-File: gawk.info, Node: Case-sensitivity, Next: Strong Regexp Constants, Prev: GNU Regexp Operators, Up: Regexp
-
-3.8 Case Sensitivity in Matching
-================================
-
-Case is normally significant in regular expressions, both when matching
-ordinary characters (i.e., not metacharacters) and inside bracket
-expressions. Thus, a 'w' in a regular expression matches only a
-lowercase 'w' and not an uppercase 'W'.
-
- The simplest way to do a case-independent match is to use a bracket
-expression--for example, '[Ww]'. However, this can be cumbersome if you
-need to use it often, and it can make the regular expressions harder to
-read. There are two alternatives that you might prefer.
-
- One way to perform a case-insensitive match at a particular point in
-the program is to convert the data to a single case, using the
-'tolower()' or 'toupper()' built-in string functions (which we haven't
-discussed yet; *note String Functions::). For example:
-
- tolower($1) ~ /foo/ { ... }
-
-converts the first field to lowercase before matching against it. This
-works in any POSIX-compliant 'awk'.
-
- Another method, specific to 'gawk', is to set the variable
-'IGNORECASE' to a nonzero value (*note Built-in Variables::). When
-'IGNORECASE' is not zero, _all_ regexp and string operations ignore
-case.
-
- Changing the value of 'IGNORECASE' dynamically controls the case
-sensitivity of the program as it runs. Case is significant by default
-because 'IGNORECASE' (like most variables) is initialized to zero:
-
- x = "aB"
- if (x ~ /ab/) ... # this test will fail
-
- IGNORECASE = 1
- if (x ~ /ab/) ... # now it will succeed
-
- In general, you cannot use 'IGNORECASE' to make certain rules case
-insensitive and other rules case sensitive, as there is no
-straightforward way to set 'IGNORECASE' just for the pattern of a
-particular rule.(1) To do this, use either bracket expressions or
-'tolower()'. However, one thing you can do with 'IGNORECASE' only is
-dynamically turn case sensitivity on or off for all the rules at once.
-
- 'IGNORECASE' can be set on the command line or in a 'BEGIN' rule
-(*note Other Arguments::; also *note Using BEGIN/END::). Setting
-'IGNORECASE' from the command line is a way to make a program case
-insensitive without having to edit it.
-
- In multibyte locales, the equivalences between upper- and lowercase
-characters are tested based on the wide-character values of the locale's
-character set. Otherwise, the characters are tested based on the
-ISO-8859-1 (ISO Latin-1) character set. This character set is a
-superset of the traditional 128 ASCII characters, which also provides a
-number of characters suitable for use with European languages.(2)
-
- The value of 'IGNORECASE' has no effect if 'gawk' is in compatibility
-mode (*note Options::). Case is always significant in compatibility
-mode.
-
- ---------- Footnotes ----------
-
- (1) Experienced C and C++ programmers will note that it is possible,
-using something like 'IGNORECASE = 1 && /foObAr/ { ... }' and
-'IGNORECASE = 0 || /foobar/ { ... }'. However, this is somewhat obscure
-and we don't recommend it.
-
- (2) If you don't understand this, don't worry about it; it just means
-that 'gawk' does the right thing.
-
-
-File: gawk.info, Node: Strong Regexp Constants, Next: Regexp Summary, Prev: Case-sensitivity, Up: Regexp
-
-3.9 Strongly Typed Regexp Constants
-===================================
-
-This minor node describes a 'gawk'-specific feature.
-
- Regexp constants ('/.../') hold a strange position in the 'awk'
-language. In most contexts, they act like an expression: '$0 ~ /.../'.
-In other contexts, they denote only a regexp to be matched. In no case
-are they really a "first class citizen" of the language. That is, you
-cannot define a scalar variable whose type is "regexp" in the same sense
-that you can define a variable to be a number or a string:
-
- num = 42 Numeric variable
- str = "hi" String variable
- re = /foo/ Wrong! re is the result of $0 ~ /foo/
-
-
-File: gawk.info, Node: Regexp Summary, Prev: Strong Regexp Constants, Up: Regexp
-
-3.10 Summary
-============
-
- * Regular expressions describe sets of strings to be matched. In
- 'awk', regular expression constants are written enclosed between
- slashes: '/'...'/'.
-
- * Regexp constants may be used standalone in patterns and in
- conditional expressions, or as part of matching expressions using
- the '~' and '!~' operators.
-
- * Escape sequences let you represent nonprintable characters and also
- let you represent regexp metacharacters as literal characters to be
- matched.
-
- * Regexp operators provide grouping, alternation, and repetition.
-
- * Bracket expressions give you a shorthand for specifying sets of
- characters that can match at a particular point in a regexp.
- Within bracket expressions, POSIX character classes let you specify
- certain groups of characters in a locale-independent fashion.
-
- * Regular expressions match the leftmost longest text in the string
- being matched. This matters for cases where you need to know the
- extent of the match, such as for text substitution and when the
- record separator is a regexp.
-
- * Matching expressions may use dynamic regexps (i.e., string values
- treated as regular expressions).
-
- * 'gawk''s 'IGNORECASE' variable lets you control the case
- sensitivity of regexp matching. In other 'awk' versions, use
- 'tolower()' or 'toupper()'.
-
-
-File: gawk.info, Node: Reading Files, Next: Printing, Prev: Regexp, Up: Top
-
-4 Reading Input Files
-*********************
-
-In the typical 'awk' program, 'awk' reads all input either from the
-standard input (by default, this is the keyboard, but often it is a pipe
-from another command) or from files whose names you specify on the 'awk'
-command line. If you specify input files, 'awk' reads them in order,
-processing all the data from one before going on to the next. The name
-of the current input file can be found in the predefined variable
-'FILENAME' (*note Built-in Variables::).
-
- The input is read in units called "records", and is processed by the
-rules of your program one record at a time. By default, each record is
-one line. Each record is automatically split into chunks called
-"fields". This makes it more convenient for programs to work on the
-parts of a record.
-
- On rare occasions, you may need to use the 'getline' command. The
-'getline' command is valuable both because it can do explicit input from
-any number of files, and because the files used with it do not have to
-be named on the 'awk' command line (*note Getline::).
-
-* Menu:
-
-* Records:: Controlling how data is split into records.
-* Fields:: An introduction to fields.
-* Nonconstant Fields:: Nonconstant Field Numbers.
-* Changing Fields:: Changing the Contents of a Field.
-* Field Separators:: The field separator and how to change it.
-* Constant Size:: Reading constant width data.
-* Splitting By Content:: Defining Fields By Content
-* Multiple Line:: Reading multiline records.
-* Getline:: Reading files under explicit program control
- using the 'getline' function.
-* Read Timeout:: Reading input with a timeout.
-* Retrying Input:: Retrying input after certain errors.
-* Command-line directories:: What happens if you put a directory on the
- command line.
-* Input Summary:: Input summary.
-* Input Exercises:: Exercises.
-
-
-File: gawk.info, Node: Records, Next: Fields, Up: Reading Files
-
-4.1 How Input Is Split into Records
-===================================
-
-'awk' divides the input for your program into records and fields. It
-keeps track of the number of records that have been read so far from the
-current input file. This value is stored in a predefined variable
-called 'FNR', which is reset to zero every time a new file is started.
-Another predefined variable, 'NR', records the total number of input
-records read so far from all data files. It starts at zero, but is
-never automatically reset to zero.
-
-* Menu:
-
-* awk split records:: How standard 'awk' splits records.
-* gawk split records:: How 'gawk' splits records.
-
-
-File: gawk.info, Node: awk split records, Next: gawk split records, Up: Records
-
-4.1.1 Record Splitting with Standard 'awk'
-------------------------------------------
-
-Records are separated by a character called the "record separator". By
-default, the record separator is the newline character. This is why
-records are, by default, single lines. To use a different character for
-the record separator, simply assign that character to the predefined
-variable 'RS'.
-
- Like any other variable, the value of 'RS' can be changed in the
-'awk' program with the assignment operator, '=' (*note Assignment
-Ops::). The new record-separator character should be enclosed in
-quotation marks, which indicate a string constant. Often, the right
-time to do this is at the beginning of execution, before any input is
-processed, so that the very first record is read with the proper
-separator. To do this, use the special 'BEGIN' pattern (*note
-BEGIN/END::). For example:
-
- awk 'BEGIN { RS = "u" }
- { print $0 }' mail-list
-
-changes the value of 'RS' to 'u', before reading any input. The new
-value is a string whose first character is the letter "u"; as a result,
-records are separated by the letter "u". Then the input file is read,
-and the second rule in the 'awk' program (the action with no pattern)
-prints each record. Because each 'print' statement adds a newline at
-the end of its output, this 'awk' program copies the input with each 'u'
-changed to a newline. Here are the results of running the program on
-'mail-list':
-
- $ awk 'BEGIN { RS = "u" }
- > { print $0 }' mail-list
- -| Amelia 555-5553 amelia.zodiac
- -| sq
- -| e@gmail.com F
- -| Anthony 555-3412 anthony.assert
- -| ro@hotmail.com A
- -| Becky 555-7685 becky.algebrar
- -| m@gmail.com A
- -| Bill 555-1675 bill.drowning@hotmail.com A
- -| Broderick 555-0542 broderick.aliq
- -| otiens@yahoo.com R
- -| Camilla 555-2912 camilla.inf
- -| sar
- -| m@skynet.be R
- -| Fabi
- -| s 555-1234 fabi
- -| s.
- -| ndevicesim
- -| s@
- -| cb.ed
- -| F
- -| J
- -| lie 555-6699 j
- -| lie.perscr
- -| tabor@skeeve.com F
- -| Martin 555-6480 martin.codicib
- -| s@hotmail.com A
- -| Sam
- -| el 555-3430 sam
- -| el.lanceolis@sh
- -| .ed
- -| A
- -| Jean-Pa
- -| l 555-2127 jeanpa
- -| l.campanor
- -| m@ny
- -| .ed
- -| R
- -|
-
-Note that the entry for the name 'Bill' is not split. In the original
-data file (*note Sample Data Files::), the line looks like this:
-
- Bill 555-1675 bill.drowning@hotmail.com A
-
-It contains no 'u', so there is no reason to split the record, unlike
-the others, which each have one or more occurrences of the 'u'. In
-fact, this record is treated as part of the previous record; the newline
-separating them in the output is the original newline in the data file,
-not the one added by 'awk' when it printed the record!
-
- Another way to change the record separator is on the command line,
-using the variable-assignment feature (*note Other Arguments::):
-
- awk '{ print $0 }' RS="u" mail-list
-
-This sets 'RS' to 'u' before processing 'mail-list'.
-
- Using an alphabetic character such as 'u' for the record separator is
-highly likely to produce strange results. Using an unusual character
-such as '/' is more likely to produce correct behavior in the majority
-of cases, but there are no guarantees. The moral is: Know Your Data.
-
- When using regular characters as the record separator, there is one
-unusual case that occurs when 'gawk' is being fully POSIX-compliant
-(*note Options::). Then, the following (extreme) pipeline prints a
-surprising '1':
-
- $ echo | gawk --posix 'BEGIN { RS = "a" } ; { print NF }'
- -| 1
-
- There is one field, consisting of a newline. The value of the
-built-in variable 'NF' is the number of fields in the current record.
-(In the normal case, 'gawk' treats the newline as whitespace, printing
-'0' as the result. Most other versions of 'awk' also act this way.)
-
- Reaching the end of an input file terminates the current input
-record, even if the last character in the file is not the character in
-'RS'. (d.c.)
-
- The empty string '""' (a string without any characters) has a special
-meaning as the value of 'RS'. It means that records are separated by
-one or more blank lines and nothing else. *Note Multiple Line:: for
-more details.
-
- If you change the value of 'RS' in the middle of an 'awk' run, the
-new value is used to delimit subsequent records, but the record
-currently being processed, as well as records already processed, are not
-affected.
-
- After the end of the record has been determined, 'gawk' sets the
-variable 'RT' to the text in the input that matched 'RS'.
-
-
-File: gawk.info, Node: gawk split records, Prev: awk split records, Up: Records
-
-4.1.2 Record Splitting with 'gawk'
-----------------------------------
-
-When using 'gawk', the value of 'RS' is not limited to a one-character
-string. It can be any regular expression (*note Regexp::). (c.e.) In
-general, each record ends at the next string that matches the regular
-expression; the next record starts at the end of the matching string.
-This general rule is actually at work in the usual case, where 'RS'
-contains just a newline: a record ends at the beginning of the next
-matching string (the next newline in the input), and the following
-record starts just after the end of this string (at the first character
-of the following line). The newline, because it matches 'RS', is not
-part of either record.
-
- When 'RS' is a single character, 'RT' contains the same single
-character. However, when 'RS' is a regular expression, 'RT' contains
-the actual input text that matched the regular expression.
-
- If the input file ends without any text matching 'RS', 'gawk' sets
-'RT' to the null string.
-
- The following example illustrates both of these features. It sets
-'RS' equal to a regular expression that matches either a newline or a
-series of one or more uppercase letters with optional leading and/or
-trailing whitespace:
-
- $ echo record 1 AAAA record 2 BBBB record 3 |
- > gawk 'BEGIN { RS = "\n|( *[[:upper:]]+ *)" }
- > { print "Record =", $0,"and RT = [" RT "]" }'
- -| Record = record 1 and RT = [ AAAA ]
- -| Record = record 2 and RT = [ BBBB ]
- -| Record = record 3 and RT = [
- -| ]
-
-The square brackets delineate the contents of 'RT', letting you see the
-leading and trailing whitespace. The final value of 'RT' is a newline.
-*Note Simple Sed:: for a more useful example of 'RS' as a regexp and
-'RT'.
-
- If you set 'RS' to a regular expression that allows optional trailing
-text, such as 'RS = "abc(XYZ)?"', it is possible, due to implementation
-constraints, that 'gawk' may match the leading part of the regular
-expression, but not the trailing part, particularly if the input text
-that could match the trailing part is fairly long. 'gawk' attempts to
-avoid this problem, but currently, there's no guarantee that this will
-never happen.
-
- NOTE: Remember that in 'awk', the '^' and '$' anchor metacharacters
- match the beginning and end of a _string_, and not the beginning
- and end of a _line_. As a result, something like 'RS =
- "^[[:upper:]]"' can only match at the beginning of a file. This is
- because 'gawk' views the input file as one long string that happens
- to contain newline characters. It is thus best to avoid anchor
- metacharacters in the value of 'RS'.
-
- The use of 'RS' as a regular expression and the 'RT' variable are
-'gawk' extensions; they are not available in compatibility mode (*note
-Options::). In compatibility mode, only the first character of the
-value of 'RS' determines the end of the record.
-
- 'RS = "\0"' Is Not Portable
-
- There are times when you might want to treat an entire data file as a
-single record. The only way to make this happen is to give 'RS' a value
-that you know doesn't occur in the input file. This is hard to do in a
-general way, such that a program always works for arbitrary input files.
-
- You might think that for text files, the NUL character, which
-consists of a character with all bits equal to zero, is a good value to
-use for 'RS' in this case:
-
- BEGIN { RS = "\0" } # whole file becomes one record?
-
- 'gawk' in fact accepts this, and uses the NUL character for the
-record separator. This works for certain special files, such as
-'/proc/environ' on GNU/Linux systems, where the NUL character is in fact
-the record separator. However, this usage is _not_ portable to most
-other 'awk' implementations.
-
- Almost all other 'awk' implementations(1) store strings internally as
-C-style strings. C strings use the NUL character as the string
-terminator. In effect, this means that 'RS = "\0"' is the same as 'RS =
-""'. (d.c.)
-
- It happens that recent versions of 'mawk' can use the NUL character
-as a record separator. However, this is a special case: 'mawk' does not
-allow embedded NUL characters in strings. (This may change in a future
-version of 'mawk'.)
-
- *Note Readfile Function:: for an interesting way to read whole files.
-If you are using 'gawk', see *note Extension Sample Readfile:: for
-another option.
-
- ---------- Footnotes ----------
-
- (1) At least that we know about.
-
-
-File: gawk.info, Node: Fields, Next: Nonconstant Fields, Prev: Records, Up: Reading Files
-
-4.2 Examining Fields
-====================
-
-When 'awk' reads an input record, the record is automatically "parsed"
-or separated by the 'awk' utility into chunks called "fields". By
-default, fields are separated by "whitespace", like words in a line.
-Whitespace in 'awk' means any string of one or more spaces, TABs, or
-newlines; other characters that are considered whitespace by other
-languages (such as formfeed, vertical tab, etc.) are _not_ considered
-whitespace by 'awk'.
-
- The purpose of fields is to make it more convenient for you to refer
-to these pieces of the record. You don't have to use them--you can
-operate on the whole record if you want--but fields are what make simple
-'awk' programs so powerful.
-
- You use a dollar sign ('$') to refer to a field in an 'awk' program,
-followed by the number of the field you want. Thus, '$1' refers to the
-first field, '$2' to the second, and so on. (Unlike in the Unix shells,
-the field numbers are not limited to single digits. '$127' is the 127th
-field in the record.) For example, suppose the following is a line of
-input:
-
- This seems like a pretty nice example.
-
-Here the first field, or '$1', is 'This', the second field, or '$2', is
-'seems', and so on. Note that the last field, '$7', is 'example.'.
-Because there is no space between the 'e' and the '.', the period is
-considered part of the seventh field.
-
- 'NF' is a predefined variable whose value is the number of fields in
-the current record. 'awk' automatically updates the value of 'NF' each
-time it reads a record. No matter how many fields there are, the last
-field in a record can be represented by '$NF'. So, '$NF' is the same as
-'$7', which is 'example.'. If you try to reference a field beyond the
-last one (such as '$8' when the record has only seven fields), you get
-the empty string. (If used in a numeric operation, you get zero.)
-
- The use of '$0', which looks like a reference to the "zeroth" field,
-is a special case: it represents the whole input record. Use it when
-you are not interested in specific fields. Here are some more examples:
-
- $ awk '$1 ~ /li/ { print $0 }' mail-list
- -| Amelia 555-5553 amelia.zodiacusque@gmail.com F
- -| Julie 555-6699 julie.perscrutabor@skeeve.com F
-
-This example prints each record in the file 'mail-list' whose first
-field contains the string 'li'.
-
- By contrast, the following example looks for 'li' in _the entire
-record_ and prints the first and last fields for each matching input
-record:
-
- $ awk '/li/ { print $1, $NF }' mail-list
- -| Amelia F
- -| Broderick R
- -| Julie F
- -| Samuel A
-
-
-File: gawk.info, Node: Nonconstant Fields, Next: Changing Fields, Prev: Fields, Up: Reading Files
-
-4.3 Nonconstant Field Numbers
-=============================
-
-A field number need not be a constant. Any expression in the 'awk'
-language can be used after a '$' to refer to a field. The value of the
-expression specifies the field number. If the value is a string, rather
-than a number, it is converted to a number. Consider this example:
-
- awk '{ print $NR }'
-
-Recall that 'NR' is the number of records read so far: one in the first
-record, two in the second, and so on. So this example prints the first
-field of the first record, the second field of the second record, and so
-on. For the twentieth record, field number 20 is printed; most likely,
-the record has fewer than 20 fields, so this prints a blank line. Here
-is another example of using expressions as field numbers:
-
- awk '{ print $(2*2) }' mail-list
-
- 'awk' evaluates the expression '(2*2)' and uses its value as the
-number of the field to print. The '*' represents multiplication, so the
-expression '2*2' evaluates to four. The parentheses are used so that
-the multiplication is done before the '$' operation; they are necessary
-whenever there is a binary operator(1) in the field-number expression.
-This example, then, prints the type of relationship (the fourth field)
-for every line of the file 'mail-list'. (All of the 'awk' operators are
-listed, in order of decreasing precedence, in *note Precedence::.)
-
- If the field number you compute is zero, you get the entire record.
-Thus, '$(2-2)' has the same value as '$0'. Negative field numbers are
-not allowed; trying to reference one usually terminates the program.
-(The POSIX standard does not define what happens when you reference a
-negative field number. 'gawk' notices this and terminates your program.
-Other 'awk' implementations may behave differently.)
-
- As mentioned in *note Fields::, 'awk' stores the current record's
-number of fields in the built-in variable 'NF' (also *note Built-in
-Variables::). Thus, the expression '$NF' is not a special feature--it
-is the direct consequence of evaluating 'NF' and using its value as a
-field number.
-
- ---------- Footnotes ----------
-
- (1) A "binary operator", such as '*' for multiplication, is one that
-takes two operands. The distinction is required because 'awk' also has
-unary (one-operand) and ternary (three-operand) operators.
-
-
-File: gawk.info, Node: Changing Fields, Next: Field Separators, Prev: Nonconstant Fields, Up: Reading Files
-
-4.4 Changing the Contents of a Field
-====================================
-
-The contents of a field, as seen by 'awk', can be changed within an
-'awk' program; this changes what 'awk' perceives as the current input
-record. (The actual input is untouched; 'awk' _never_ modifies the
-input file.) Consider the following example and its output:
-
- $ awk '{ nboxes = $3 ; $3 = $3 - 10
- > print nboxes, $3 }' inventory-shipped
- -| 25 15
- -| 32 22
- -| 24 14
- ...
-
-The program first saves the original value of field three in the
-variable 'nboxes'. The '-' sign represents subtraction, so this program
-reassigns field three, '$3', as the original value of field three minus
-ten: '$3 - 10'. (*Note Arithmetic Ops::.) Then it prints the original
-and new values for field three. (Someone in the warehouse made a
-consistent mistake while inventorying the red boxes.)
-
- For this to work, the text in '$3' must make sense as a number; the
-string of characters must be converted to a number for the computer to
-do arithmetic on it. The number resulting from the subtraction is
-converted back to a string of characters that then becomes field three.
-*Note Conversion::.
-
- When the value of a field is changed (as perceived by 'awk'), the
-text of the input record is recalculated to contain the new field where
-the old one was. In other words, '$0' changes to reflect the altered
-field. Thus, this program prints a copy of the input file, with 10
-subtracted from the second field of each line:
-
- $ awk '{ $2 = $2 - 10; print $0 }' inventory-shipped
- -| Jan 3 25 15 115
- -| Feb 5 32 24 226
- -| Mar 5 24 34 228
- ...
-
- It is also possible to assign contents to fields that are out of
-range. For example:
-
- $ awk '{ $6 = ($5 + $4 + $3 + $2)
- > print $6 }' inventory-shipped
- -| 168
- -| 297
- -| 301
- ...
-
-We've just created '$6', whose value is the sum of fields '$2', '$3',
-'$4', and '$5'. The '+' sign represents addition. For the file
-'inventory-shipped', '$6' represents the total number of parcels shipped
-for a particular month.
-
- Creating a new field changes 'awk''s internal copy of the current
-input record, which is the value of '$0'. Thus, if you do 'print $0'
-after adding a field, the record printed includes the new field, with
-the appropriate number of field separators between it and the previously
-existing fields.
-
- This recomputation affects and is affected by 'NF' (the number of
-fields; *note Fields::). For example, the value of 'NF' is set to the
-number of the highest field you create. The exact format of '$0' is
-also affected by a feature that has not been discussed yet: the "output
-field separator", 'OFS', used to separate the fields (*note Output
-Separators::).
-
- Note, however, that merely _referencing_ an out-of-range field does
-_not_ change the value of either '$0' or 'NF'. Referencing an
-out-of-range field only produces an empty string. For example:
-
- if ($(NF+1) != "")
- print "can't happen"
- else
- print "everything is normal"
-
-should print 'everything is normal', because 'NF+1' is certain to be out
-of range. (*Note If Statement:: for more information about 'awk''s
-'if-else' statements. *Note Typing and Comparison:: for more
-information about the '!=' operator.)
-
- It is important to note that making an assignment to an existing
-field changes the value of '$0' but does not change the value of 'NF',
-even when you assign the empty string to a field. For example:
-
- $ echo a b c d | awk '{ OFS = ":"; $2 = ""
- > print $0; print NF }'
- -| a::c:d
- -| 4
-
-The field is still there; it just has an empty value, delimited by the
-two colons between 'a' and 'c'. This example shows what happens if you
-create a new field:
-
- $ echo a b c d | awk '{ OFS = ":"; $2 = ""; $6 = "new"
- > print $0; print NF }'
- -| a::c:d::new
- -| 6
-
-The intervening field, '$5', is created with an empty value (indicated
-by the second pair of adjacent colons), and 'NF' is updated with the
-value six.
-
- Decrementing 'NF' throws away the values of the fields after the new
-value of 'NF' and recomputes '$0'. (d.c.) Here is an example:
-
- $ echo a b c d e f | awk '{ print "NF =", NF;
- > NF = 3; print $0 }'
- -| NF = 6
- -| a b c
-
- CAUTION: Some versions of 'awk' don't rebuild '$0' when 'NF' is
- decremented.
-
- Finally, there are times when it is convenient to force 'awk' to
-rebuild the entire record, using the current values of the fields and
-'OFS'. To do this, use the seemingly innocuous assignment:
-
- $1 = $1 # force record to be reconstituted
- print $0 # or whatever else with $0
-
-This forces 'awk' to rebuild the record. It does help to add a comment,
-as we've shown here.
-
- There is a flip side to the relationship between '$0' and the fields.
-Any assignment to '$0' causes the record to be reparsed into fields
-using the _current_ value of 'FS'. This also applies to any built-in
-function that updates '$0', such as 'sub()' and 'gsub()' (*note String
-Functions::).
-
- Understanding '$0'
-
- It is important to remember that '$0' is the _full_ record, exactly
-as it was read from the input. This includes any leading or trailing
-whitespace, and the exact whitespace (or other characters) that
-separates the fields.
-
- It is a common error to try to change the field separators in a
-record simply by setting 'FS' and 'OFS', and then expecting a plain
-'print' or 'print $0' to print the modified record.
-
- But this does not work, because nothing was done to change the record
-itself. Instead, you must force the record to be rebuilt, typically
-with a statement such as '$1 = $1', as described earlier.
-
-
-File: gawk.info, Node: Field Separators, Next: Constant Size, Prev: Changing Fields, Up: Reading Files
-
-4.5 Specifying How Fields Are Separated
-=======================================
-
-* Menu:
-
-* Default Field Splitting:: How fields are normally separated.
-* Regexp Field Splitting:: Using regexps as the field separator.
-* Single Character Fields:: Making each character a separate field.
-* Command Line Field Separator:: Setting 'FS' from the command line.
-* Full Line Fields:: Making the full line be a single field.
-* Field Splitting Summary:: Some final points and a summary table.
-
-The "field separator", which is either a single character or a regular
-expression, controls the way 'awk' splits an input record into fields.
-'awk' scans the input record for character sequences that match the
-separator; the fields themselves are the text between the matches.
-
- In the examples that follow, we use the bullet symbol (*) to
-represent spaces in the output. If the field separator is 'oo', then
-the following line:
-
- moo goo gai pan
-
-is split into three fields: 'm', '*g', and '*gai*pan'. Note the leading
-spaces in the values of the second and third fields.
-
- The field separator is represented by the predefined variable 'FS'.
-Shell programmers take note: 'awk' does _not_ use the name 'IFS' that is
-used by the POSIX-compliant shells (such as the Unix Bourne shell, 'sh',
-or Bash).
-
- The value of 'FS' can be changed in the 'awk' program with the
-assignment operator, '=' (*note Assignment Ops::). Often, the right
-time to do this is at the beginning of execution before any input has
-been processed, so that the very first record is read with the proper
-separator. To do this, use the special 'BEGIN' pattern (*note
-BEGIN/END::). For example, here we set the value of 'FS' to the string
-'","':
-
- awk 'BEGIN { FS = "," } ; { print $2 }'
-
-Given the input line:
-
- John Q. Smith, 29 Oak St., Walamazoo, MI 42139
-
-this 'awk' program extracts and prints the string '*29*Oak*St.'.
-
- Sometimes the input data contains separator characters that don't
-separate fields the way you thought they would. For instance, the
-person's name in the example we just used might have a title or suffix
-attached, such as:
-
- John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139
-
-The same program would extract '*LXIX' instead of '*29*Oak*St.'. If you
-were expecting the program to print the address, you would be surprised.
-The moral is to choose your data layout and separator characters
-carefully to prevent such problems. (If the data is not in a form that
-is easy to process, perhaps you can massage it first with a separate
-'awk' program.)
-
-
-File: gawk.info, Node: Default Field Splitting, Next: Regexp Field Splitting, Up: Field Separators
-
-4.5.1 Whitespace Normally Separates Fields
-------------------------------------------
-
-Fields are normally separated by whitespace sequences (spaces, TABs, and
-newlines), not by single spaces. Two spaces in a row do not delimit an
-empty field. The default value of the field separator 'FS' is a string
-containing a single space, '" "'. If 'awk' interpreted this value in
-the usual way, each space character would separate fields, so two spaces
-in a row would make an empty field between them. The reason this does
-not happen is that a single space as the value of 'FS' is a special
-case--it is taken to specify the default manner of delimiting fields.
-
- If 'FS' is any other single character, such as '","', then each
-occurrence of that character separates two fields. Two consecutive
-occurrences delimit an empty field. If the character occurs at the
-beginning or the end of the line, that too delimits an empty field. The
-space character is the only single character that does not follow these
-rules.
-
-
-File: gawk.info, Node: Regexp Field Splitting, Next: Single Character Fields, Prev: Default Field Splitting, Up: Field Separators
-
-4.5.2 Using Regular Expressions to Separate Fields
---------------------------------------------------
-
-The previous node discussed the use of single characters or simple
-strings as the value of 'FS'. More generally, the value of 'FS' may be
-a string containing any regular expression. In this case, each match in
-the record for the regular expression separates fields. For example,
-the assignment:
-
- FS = ", \t"
-
-makes every area of an input line that consists of a comma followed by a
-space and a TAB into a field separator. ('\t' is an "escape sequence"
-that stands for a TAB; *note Escape Sequences::, for the complete list
-of similar escape sequences.)
-
- For a less trivial example of a regular expression, try using single
-spaces to separate fields the way single commas are used. 'FS' can be
-set to '"[ ]"' (left bracket, space, right bracket). This regular
-expression matches a single space and nothing else (*note Regexp::).
-
- There is an important difference between the two cases of 'FS = " "'
-(a single space) and 'FS = "[ \t\n]+"' (a regular expression matching
-one or more spaces, TABs, or newlines). For both values of 'FS', fields
-are separated by "runs" (multiple adjacent occurrences) of spaces, TABs,
-and/or newlines. However, when the value of 'FS' is '" "', 'awk' first
-strips leading and trailing whitespace from the record and then decides
-where the fields are. For example, the following pipeline prints 'b':
-
- $ echo ' a b c d ' | awk '{ print $2 }'
- -| b
-
-However, this pipeline prints 'a' (note the extra spaces around each
-letter):
-
- $ echo ' a b c d ' | awk 'BEGIN { FS = "[ \t\n]+" }
- > { print $2 }'
- -| a
-
-In this case, the first field is null, or empty.
-
- The stripping of leading and trailing whitespace also comes into play
-whenever '$0' is recomputed. For instance, study this pipeline:
-
- $ echo ' a b c d' | awk '{ print; $2 = $2; print }'
- -| a b c d
- -| a b c d
-
-The first 'print' statement prints the record as it was read, with
-leading whitespace intact. The assignment to '$2' rebuilds '$0' by
-concatenating '$1' through '$NF' together, separated by the value of
-'OFS' (which is a space by default). Because the leading whitespace was
-ignored when finding '$1', it is not part of the new '$0'. Finally, the
-last 'print' statement prints the new '$0'.
-
- There is an additional subtlety to be aware of when using regular
-expressions for field splitting. It is not well specified in the POSIX
-standard, or anywhere else, what '^' means when splitting fields. Does
-the '^' match only at the beginning of the entire record? Or is each
-field separator a new string? It turns out that different 'awk'
-versions answer this question differently, and you should not rely on
-any specific behavior in your programs. (d.c.)
-
- As a point of information, BWK 'awk' allows '^' to match only at the
-beginning of the record. 'gawk' also works this way. For example:
-
- $ echo 'xxAA xxBxx C' |
- > gawk -F '(^x+)|( +)' '{ for (i = 1; i <= NF; i++)
- > printf "-->%s<--\n", $i }'
- -| --><--
- -| -->AA<--
- -| -->xxBxx<--
- -| -->C<--
-
-
-File: gawk.info, Node: Single Character Fields, Next: Command Line Field Separator, Prev: Regexp Field Splitting, Up: Field Separators
-
-4.5.3 Making Each Character a Separate Field
---------------------------------------------
-
-There are times when you may want to examine each character of a record
-separately. This can be done in 'gawk' by simply assigning the null
-string ('""') to 'FS'. (c.e.) In this case, each individual character
-in the record becomes a separate field. For example:
-
- $ echo a b | gawk 'BEGIN { FS = "" }
- > {
- > for (i = 1; i <= NF; i = i + 1)
- > print "Field", i, "is", $i
- > }'
- -| Field 1 is a
- -| Field 2 is
- -| Field 3 is b
-
- Traditionally, the behavior of 'FS' equal to '""' was not defined.
-In this case, most versions of Unix 'awk' simply treat the entire record
-as only having one field. (d.c.) In compatibility mode (*note
-Options::), if 'FS' is the null string, then 'gawk' also behaves this
-way.
-
-
-File: gawk.info, Node: Command Line Field Separator, Next: Full Line Fields, Prev: Single Character Fields, Up: Field Separators
-
-4.5.4 Setting 'FS' from the Command Line
-----------------------------------------
-
-'FS' can be set on the command line. Use the '-F' option to do so. For
-example:
-
- awk -F, 'PROGRAM' INPUT-FILES
-
-sets 'FS' to the ',' character. Notice that the option uses an
-uppercase 'F' instead of a lowercase 'f'. The latter option ('-f')
-specifies a file containing an 'awk' program.
-
- The value used for the argument to '-F' is processed in exactly the
-same way as assignments to the predefined variable 'FS'. Any special
-characters in the field separator must be escaped appropriately. For
-example, to use a '\' as the field separator on the command line, you
-would have to type:
-
- # same as FS = "\\"
- awk -F\\\\ '...' files ...
-
-Because '\' is used for quoting in the shell, 'awk' sees '-F\\'. Then
-'awk' processes the '\\' for escape characters (*note Escape
-Sequences::), finally yielding a single '\' to use for the field
-separator.
-
- As a special case, in compatibility mode (*note Options::), if the
-argument to '-F' is 't', then 'FS' is set to the TAB character. If you
-type '-F\t' at the shell, without any quotes, the '\' gets deleted, so
-'awk' figures that you really want your fields to be separated with TABs
-and not 't's. Use '-v FS="t"' or '-F"[t]"' on the command line if you
-really do want to separate your fields with 't's. Use '-F '\t'' when
-not in compatibility mode to specify that TABs separate fields.
-
- As an example, let's use an 'awk' program file called 'edu.awk' that
-contains the pattern '/edu/' and the action 'print $1':
-
- /edu/ { print $1 }
-
- Let's also set 'FS' to be the '-' character and run the program on
-the file 'mail-list'. The following command prints a list of the names
-of the people that work at or attend a university, and the first three
-digits of their phone numbers:
-
- $ awk -F- -f edu.awk mail-list
- -| Fabius 555
- -| Samuel 555
- -| Jean
-
-Note the third line of output. The third line in the original file
-looked like this:
-
- Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R
-
- The '-' as part of the person's name was used as the field separator,
-instead of the '-' in the phone number that was originally intended.
-This demonstrates why you have to be careful in choosing your field and
-record separators.
-
- Perhaps the most common use of a single character as the field
-separator occurs when processing the Unix system password file. On many
-Unix systems, each user has a separate entry in the system password
-file, with one line per user. The information in these lines is
-separated by colons. The first field is the user's login name and the
-second is the user's encrypted or shadow password. (A shadow password
-is indicated by the presence of a single 'x' in the second field.) A
-password file entry might look like this:
-
- arnold:x:2076:10:Arnold Robbins:/home/arnold:/bin/bash
-
- The following program searches the system password file and prints
-the entries for users whose full name is not indicated:
-
- awk -F: '$5 == ""' /etc/passwd
-
-
-File: gawk.info, Node: Full Line Fields, Next: Field Splitting Summary, Prev: Command Line Field Separator, Up: Field Separators
-
-4.5.5 Making the Full Line Be a Single Field
---------------------------------------------
-
-Occasionally, it's useful to treat the whole input line as a single
-field. This can be done easily and portably simply by setting 'FS' to
-'"\n"' (a newline):(1)
-
- awk -F'\n' 'PROGRAM' FILES ...
-
-When you do this, '$1' is the same as '$0'.
-
- Changing 'FS' Does Not Affect the Fields
-
- According to the POSIX standard, 'awk' is supposed to behave as if
-each record is split into fields at the time it is read. In particular,
-this means that if you change the value of 'FS' after a record is read,
-the values of the fields (i.e., how they were split) should reflect the
-old value of 'FS', not the new one.
-
- However, many older implementations of 'awk' do not work this way.
-Instead, they defer splitting the fields until a field is actually
-referenced. The fields are split using the _current_ value of 'FS'!
-(d.c.) This behavior can be difficult to diagnose. The following
-example illustrates the difference between the two methods:
-
- sed 1q /etc/passwd | awk '{ FS = ":" ; print $1 }'
-
-which usually prints:
-
- root
-
-on an incorrect implementation of 'awk', while 'gawk' prints the full
-first line of the file, something like:
-
- root:x:0:0:Root:/:
-
- (The 'sed'(2) command prints just the first line of '/etc/passwd'.)
-
- ---------- Footnotes ----------
-
- (1) Thanks to Andrew Schorr for this tip.
-
- (2) The 'sed' utility is a "stream editor." Its behavior is also
-defined by the POSIX standard.
-
-
-File: gawk.info, Node: Field Splitting Summary, Prev: Full Line Fields, Up: Field Separators
-
-4.5.6 Field-Splitting Summary
------------------------------
-
-It is important to remember that when you assign a string constant as
-the value of 'FS', it undergoes normal 'awk' string processing. For
-example, with Unix 'awk' and 'gawk', the assignment 'FS = "\.."' assigns
-the character string '".."' to 'FS' (the backslash is stripped). This
-creates a regexp meaning "fields are separated by occurrences of any two
-characters." If instead you want fields to be separated by a literal
-period followed by any single character, use 'FS = "\\.."'.
-
- The following list summarizes how fields are split, based on the
-value of 'FS' ('==' means "is equal to"):
-
-'FS == " "'
- Fields are separated by runs of whitespace. Leading and trailing
- whitespace are ignored. This is the default.
-
-'FS == ANY OTHER SINGLE CHARACTER'
- Fields are separated by each occurrence of the character. Multiple
- successive occurrences delimit empty fields, as do leading and
- trailing occurrences. The character can even be a regexp
- metacharacter; it does not need to be escaped.
-
-'FS == REGEXP'
- Fields are separated by occurrences of characters that match
- REGEXP. Leading and trailing matches of REGEXP delimit empty
- fields.
-
-'FS == ""'
- Each individual character in the record becomes a separate field.
- (This is a common extension; it is not specified by the POSIX
- standard.)
-
- 'FS' and 'IGNORECASE'
-
- The 'IGNORECASE' variable (*note User-modified::) affects field
-splitting _only_ when the value of 'FS' is a regexp. It has no effect
-when 'FS' is a single character, even if that character is a letter.
-Thus, in the following code:
-
- FS = "c"
- IGNORECASE = 1
- $0 = "aCa"
- print $1
-
-The output is 'aCa'. If you really want to split fields on an
-alphabetic character while ignoring case, use a regexp that will do it
-for you (e.g., 'FS = "[c]"'). In this case, 'IGNORECASE' will take
-effect.
-
-
-File: gawk.info, Node: Constant Size, Next: Splitting By Content, Prev: Field Separators, Up: Reading Files
-
-4.6 Reading Fixed-Width Data
-============================
-
-This minor node discusses an advanced feature of 'gawk'. If you are a
-novice 'awk' user, you might want to skip it on the first reading.
-
- 'gawk' provides a facility for dealing with fixed-width fields with
-no distinctive field separator. For example, data of this nature arises
-in the input for old Fortran programs where numbers are run together, or
-in the output of programs that did not anticipate the use of their
-output as input for other programs.
-
- An example of the latter is a table where all the columns are lined
-up by the use of a variable number of spaces and _empty fields are just
-spaces_. Clearly, 'awk''s normal field splitting based on 'FS' does not
-work well in this case. Although a portable 'awk' program can use a
-series of 'substr()' calls on '$0' (*note String Functions::), this is
-awkward and inefficient for a large number of fields.
-
- The splitting of an input record into fixed-width fields is specified
-by assigning a string containing space-separated numbers to the built-in
-variable 'FIELDWIDTHS'. Each number specifies the width of the field,
-_including_ columns between fields. If you want to ignore the columns
-between fields, you can specify the width as a separate field that is
-subsequently ignored. It is a fatal error to supply a field width that
-has a negative value. The following data is the output of the Unix 'w'
-utility. It is useful to illustrate the use of 'FIELDWIDTHS':
-
- 10:06pm up 21 days, 14:04, 23 users
- User tty login idle JCPU PCPU what
- hzuo ttyV0 8:58pm 9 5 vi p24.tex
- hzang ttyV3 6:37pm 50 -csh
- eklye ttyV5 9:53pm 7 1 em thes.tex
- dportein ttyV6 8:17pm 1:47 -csh
- gierd ttyD3 10:00pm 1 elm
- dave ttyD4 9:47pm 4 4 w
- brent ttyp0 26Jun91 4:46 26:46 4:41 bash
- dave ttyq4 26Jun9115days 46 46 wnewmail
-
- The following program takes this input, converts the idle time to
-number of seconds, and prints out the first two fields and the
-calculated idle time:
-
- BEGIN { FIELDWIDTHS = "9 6 10 6 7 7 35" }
- NR > 2 {
- idle = $4
- sub(/^ +/, "", idle) # strip leading spaces
- if (idle == "")
- idle = 0
- if (idle ~ /:/) {
- split(idle, t, ":")
- idle = t[1] * 60 + t[2]
- }
- if (idle ~ /days/)
- idle *= 24 * 60 * 60
-
- print $1, $2, idle
- }
-
- NOTE: The preceding program uses a number of 'awk' features that
- haven't been introduced yet.
-
- Running the program on the data produces the following results:
-
- hzuo ttyV0 0
- hzang ttyV3 50
- eklye ttyV5 0
- dportein ttyV6 107
- gierd ttyD3 1
- dave ttyD4 0
- brent ttyp0 286
- dave ttyq4 1296000
-
- Another (possibly more practical) example of fixed-width input data
-is the input from a deck of balloting cards. In some parts of the
-United States, voters mark their choices by punching holes in computer
-cards. These cards are then processed to count the votes for any
-particular candidate or on any particular issue. Because a voter may
-choose not to vote on some issue, any column on the card may be empty.
-An 'awk' program for processing such data could use the 'FIELDWIDTHS'
-feature to simplify reading the data. (Of course, getting 'gawk' to run
-on a system with card readers is another story!)
-
- Assigning a value to 'FS' causes 'gawk' to use 'FS' for field
-splitting again. Use 'FS = FS' to make this happen, without having to
-know the current value of 'FS'. In order to tell which kind of field
-splitting is in effect, use 'PROCINFO["FS"]' (*note Auto-set::). The
-value is '"FS"' if regular field splitting is being used, or
-'"FIELDWIDTHS"' if fixed-width field splitting is being used:
-
- if (PROCINFO["FS"] == "FS")
- REGULAR FIELD SPLITTING ...
- else if (PROCINFO["FS"] == "FIELDWIDTHS")
- FIXED-WIDTH FIELD SPLITTING ...
- else
- CONTENT-BASED FIELD SPLITTING ... (see next minor node)
-
- This information is useful when writing a function that needs to
-temporarily change 'FS' or 'FIELDWIDTHS', read some records, and then
-restore the original settings (*note Passwd Functions:: for an example
-of such a function).
-
-
-File: gawk.info, Node: Splitting By Content, Next: Multiple Line, Prev: Constant Size, Up: Reading Files
-
-4.7 Defining Fields by Content
-==============================
-
-This minor node discusses an advanced feature of 'gawk'. If you are a
-novice 'awk' user, you might want to skip it on the first reading.
-
- Normally, when using 'FS', 'gawk' defines the fields as the parts of
-the record that occur in between each field separator. In other words,
-'FS' defines what a field _is not_, instead of what a field _is_.
-However, there are times when you really want to define the fields by
-what they are, and not by what they are not.
-
- The most notorious such case is so-called "comma-separated values"
-(CSV) data. Many spreadsheet programs, for example, can export their
-data into text files, where each record is terminated with a newline,
-and fields are separated by commas. If commas only separated the data,
-there wouldn't be an issue. The problem comes when one of the fields
-contains an _embedded_ comma. In such cases, most programs embed the
-field in double quotes.(1) So, we might have data like this:
-
- Robbins,Arnold,"1234 A Pretty Street, NE",MyTown,MyState,12345-6789,USA
-
- The 'FPAT' variable offers a solution for cases like this. The value
-of 'FPAT' should be a string that provides a regular expression. This
-regular expression describes the contents of each field.
-
- In the case of CSV data as presented here, each field is either
-"anything that is not a comma," or "a double quote, anything that is not
-a double quote, and a closing double quote." If written as a regular
-expression constant (*note Regexp::), we would have
-'/([^,]+)|("[^"]+")/'. Writing this as a string requires us to escape
-the double quotes, leading to:
-
- FPAT = "([^,]+)|(\"[^\"]+\")"
-
- Putting this to use, here is a simple program to parse the data:
-
- BEGIN {
- FPAT = "([^,]+)|(\"[^\"]+\")"
- }
-
- {
- print "NF = ", NF
- for (i = 1; i <= NF; i++) {
- printf("$%d = <%s>\n", i, $i)
- }
- }
-
- When run, we get the following:
-
- $ gawk -f simple-csv.awk addresses.csv
- NF = 7
- $1 = <Robbins>
- $2 = <Arnold>
- $3 = <"1234 A Pretty Street, NE">
- $4 = <MyTown>
- $5 = <MyState>
- $6 = <12345-6789>
- $7 = <USA>
-
- Note the embedded comma in the value of '$3'.
-
- A straightforward improvement when processing CSV data of this sort
-would be to remove the quotes when they occur, with something like this:
-
- if (substr($i, 1, 1) == "\"") {
- len = length($i)
- $i = substr($i, 2, len - 2) # Get text within the two quotes
- }
-
- As with 'FS', the 'IGNORECASE' variable (*note User-modified::)
-affects field splitting with 'FPAT'.
-
- Assigning a value to 'FPAT' overrides field splitting with 'FS' and
-with 'FIELDWIDTHS'. Similar to 'FIELDWIDTHS', the value of
-'PROCINFO["FS"]' will be '"FPAT"' if content-based field splitting is
-being used.
-
- NOTE: Some programs export CSV data that contains embedded newlines
- between the double quotes. 'gawk' provides no way to deal with
- this. Even though a formal specification for CSV data exists,
- there isn't much more to be done; the 'FPAT' mechanism provides an
- elegant solution for the majority of cases, and the 'gawk'
- developers are satisfied with that.
-
- As written, the regexp used for 'FPAT' requires that each field
-contain at least one character. A straightforward modification
-(changing the first '+' to '*') allows fields to be empty:
-
- FPAT = "([^,]*)|(\"[^\"]+\")"
-
- Finally, the 'patsplit()' function makes the same functionality
-available for splitting regular strings (*note String Functions::).
-
- To recap, 'gawk' provides three independent methods to split input
-records into fields. The mechanism used is based on which of the three
-variables--'FS', 'FIELDWIDTHS', or 'FPAT'--was last assigned to.
-
- ---------- Footnotes ----------
-
- (1) The CSV format lacked a formal standard definition for many
-years. RFC 4180 (http://www.ietf.org/rfc/rfc4180.txt) standardizes the
-most common practices.
-
-
-File: gawk.info, Node: Multiple Line, Next: Getline, Prev: Splitting By Content, Up: Reading Files
-
-4.8 Multiple-Line Records
-=========================
-
-In some databases, a single line cannot conveniently hold all the
-information in one entry. In such cases, you can use multiline records.
-The first step in doing this is to choose your data format.
-
- One technique is to use an unusual character or string to separate
-records. For example, you could use the formfeed character (written
-'\f' in 'awk', as in C) to separate them, making each record a page of
-the file. To do this, just set the variable 'RS' to '"\f"' (a string
-containing the formfeed character). Any other character could equally
-well be used, as long as it won't be part of the data in a record.
-
- Another technique is to have blank lines separate records. By a
-special dispensation, an empty string as the value of 'RS' indicates
-that records are separated by one or more blank lines. When 'RS' is set
-to the empty string, each record always ends at the first blank line
-encountered. The next record doesn't start until the first nonblank
-line that follows. No matter how many blank lines appear in a row, they
-all act as one record separator. (Blank lines must be completely empty;
-lines that contain only whitespace do not count.)
-
- You can achieve the same effect as 'RS = ""' by assigning the string
-'"\n\n+"' to 'RS'. This regexp matches the newline at the end of the
-record and one or more blank lines after the record. In addition, a
-regular expression always matches the longest possible sequence when
-there is a choice (*note Leftmost Longest::). So, the next record
-doesn't start until the first nonblank line that follows--no matter how
-many blank lines appear in a row, they are considered one record
-separator.
-
- However, there is an important difference between 'RS = ""' and 'RS =
-"\n\n+"'. In the first case, leading newlines in the input data file
-are ignored, and if a file ends without extra blank lines after the last
-record, the final newline is removed from the record. In the second
-case, this special processing is not done. (d.c.)
-
- Now that the input is separated into records, the second step is to
-separate the fields in the records. One way to do this is to divide
-each of the lines into fields in the normal manner. This happens by
-default as the result of a special feature. When 'RS' is set to the
-empty string _and_ 'FS' is set to a single character, the newline
-character _always_ acts as a field separator. This is in addition to
-whatever field separations result from 'FS'.(1)
-
- The original motivation for this special exception was probably to
-provide useful behavior in the default case (i.e., 'FS' is equal to
-'" "'). This feature can be a problem if you really don't want the
-newline character to separate fields, because there is no way to prevent
-it. However, you can work around this by using the 'split()' function
-to break up the record manually (*note String Functions::). If you have
-a single-character field separator, you can work around the special
-feature in a different way, by making 'FS' into a regexp for that single
-character. For example, if the field separator is a percent character,
-instead of 'FS = "%"', use 'FS = "[%]"'.
-
- Another way to separate fields is to put each field on a separate
-line: to do this, just set the variable 'FS' to the string '"\n"'.
-(This single-character separator matches a single newline.) A practical
-example of a data file organized this way might be a mailing list, where
-blank lines separate the entries. Consider a mailing list in a file
-named 'addresses', which looks like this:
-
- Jane Doe
- 123 Main Street
- Anywhere, SE 12345-6789
-
- John Smith
- 456 Tree-lined Avenue
- Smallville, MW 98765-4321
- ...
-
-A simple program to process this file is as follows:
-
- # addrs.awk --- simple mailing list program
-
- # Records are separated by blank lines.
- # Each line is one field.
- BEGIN { RS = "" ; FS = "\n" }
-
- {
- print "Name is:", $1
- print "Address is:", $2
- print "City and State are:", $3
- print ""
- }
-
- Running the program produces the following output:
-
- $ awk -f addrs.awk addresses
- -| Name is: Jane Doe
- -| Address is: 123 Main Street
- -| City and State are: Anywhere, SE 12345-6789
- -|
- -| Name is: John Smith
- -| Address is: 456 Tree-lined Avenue
- -| City and State are: Smallville, MW 98765-4321
- -|
- ...
-
- *Note Labels Program:: for a more realistic program dealing with
-address lists. The following list summarizes how records are split,
-based on the value of 'RS'. ('==' means "is equal to.")
-
-'RS == "\n"'
- Records are separated by the newline character ('\n'). In effect,
- every line in the data file is a separate record, including blank
- lines. This is the default.
-
-'RS == ANY SINGLE CHARACTER'
- Records are separated by each occurrence of the character.
- Multiple successive occurrences delimit empty records.
-
-'RS == ""'
- Records are separated by runs of blank lines. When 'FS' is a
- single character, then the newline character always serves as a
- field separator, in addition to whatever value 'FS' may have.
- Leading and trailing newlines in a file are ignored.
-
-'RS == REGEXP'
- Records are separated by occurrences of characters that match
- REGEXP. Leading and trailing matches of REGEXP delimit empty
- records. (This is a 'gawk' extension; it is not specified by the
- POSIX standard.)
-
- If not in compatibility mode (*note Options::), 'gawk' sets 'RT' to
-the input text that matched the value specified by 'RS'. But if the
-input file ended without any text that matches 'RS', then 'gawk' sets
-'RT' to the null string.
-
- ---------- Footnotes ----------
-
- (1) When 'FS' is the null string ('""') or a regexp, this special
-feature of 'RS' does not apply. It does apply to the default field
-separator of a single space: 'FS = " "'.
-
-
-File: gawk.info, Node: Getline, Next: Read Timeout, Prev: Multiple Line, Up: Reading Files
-
-4.9 Explicit Input with 'getline'
-=================================
-
-So far we have been getting our input data from 'awk''s main input
-stream--either the standard input (usually your keyboard, sometimes the
-output from another program) or the files specified on the command line.
-The 'awk' language has a special built-in command called 'getline' that
-can be used to read input under your explicit control.
-
- The 'getline' command is used in several different ways and should
-_not_ be used by beginners. The examples that follow the explanation of
-the 'getline' command include material that has not been covered yet.
-Therefore, come back and study the 'getline' command _after_ you have
-reviewed the rest of this Info file and have a good knowledge of how
-'awk' works.
-
- The 'getline' command returns 1 if it finds a record and 0 if it
-encounters the end of the file. If there is some error in getting a
-record, such as a file that cannot be opened, then 'getline' returns -1.
-In this case, 'gawk' sets the variable 'ERRNO' to a string describing
-the error that occurred.
-
- If 'ERRNO' indicates that the I/O operation may be retried, and
-'PROCINFO["INPUT", "RETRY"]' is set, then 'getline' returns -2 instead
-of -1, and further calls to 'getline' may be attempted. *Note Retrying
-Input:: for further information about this feature.
-
- In the following examples, COMMAND stands for a string value that
-represents a shell command.
-
- NOTE: When '--sandbox' is specified (*note Options::), reading
- lines from files, pipes, and coprocesses is disabled.
-
-* Menu:
-
-* Plain Getline:: Using 'getline' with no arguments.
-* Getline/Variable:: Using 'getline' into a variable.
-* Getline/File:: Using 'getline' from a file.
-* Getline/Variable/File:: Using 'getline' into a variable from a
- file.
-* Getline/Pipe:: Using 'getline' from a pipe.
-* Getline/Variable/Pipe:: Using 'getline' into a variable from a
- pipe.
-* Getline/Coprocess:: Using 'getline' from a coprocess.
-* Getline/Variable/Coprocess:: Using 'getline' into a variable from a
- coprocess.
-* Getline Notes:: Important things to know about 'getline'.
-* Getline Summary:: Summary of 'getline' Variants.
-
-
-File: gawk.info, Node: Plain Getline, Next: Getline/Variable, Up: Getline
-
-4.9.1 Using 'getline' with No Arguments
----------------------------------------
-
-The 'getline' command can be used without arguments to read input from
-the current input file. All it does in this case is read the next input
-record and split it up into fields. This is useful if you've finished
-processing the current record, but want to do some special processing on
-the next record _right now_. For example:
-
- # Remove text between /* and */, inclusive
- {
- if ((i = index($0, "/*")) != 0) {
- out = substr($0, 1, i - 1) # leading part of the string
- rest = substr($0, i + 2) # ... */ ...
- j = index(rest, "*/") # is */ in trailing part?
- if (j > 0) {
- rest = substr(rest, j + 2) # remove comment
- } else {
- while (j == 0) {
- # get more text
- if (getline <= 0) {
- print("unexpected EOF or error:", ERRNO) > "/dev/stderr"
- exit
- }
- # build up the line using string concatenation
- rest = rest $0
- j = index(rest, "*/") # is */ in trailing part?
- if (j != 0) {
- rest = substr(rest, j + 2)
- break
- }
- }
- }
- # build up the output line using string concatenation
- $0 = out rest
- }
- print $0
- }
-
- This 'awk' program deletes C-style comments ('/* ... */') from the
-input. It uses a number of features we haven't covered yet, including
-string concatenation (*note Concatenation::) and the 'index()' and
-'substr()' built-in functions (*note String Functions::). By replacing
-the 'print $0' with other statements, you could perform more complicated
-processing on the decommented input, such as searching for matches of a
-regular expression. (This program has a subtle problem--it does not
-work if one comment ends and another begins on the same line.)
-
- This form of the 'getline' command sets 'NF', 'NR', 'FNR', 'RT', and
-the value of '$0'.
-
- NOTE: The new value of '$0' is used to test the patterns of any
- subsequent rules. The original value of '$0' that triggered the
- rule that executed 'getline' is lost. By contrast, the 'next'
- statement reads a new record but immediately begins processing it
- normally, starting with the first rule in the program. *Note Next
- Statement::.
-
-
-File: gawk.info, Node: Getline/Variable, Next: Getline/File, Prev: Plain Getline, Up: Getline
-
-4.9.2 Using 'getline' into a Variable
--------------------------------------
-
-You can use 'getline VAR' to read the next record from 'awk''s input
-into the variable VAR. No other processing is done. For example,
-suppose the next line is a comment or a special string, and you want to
-read it without triggering any rules. This form of 'getline' allows you
-to read that line and store it in a variable so that the main
-read-a-line-and-check-each-rule loop of 'awk' never sees it. The
-following example swaps every two lines of input:
-
- {
- if ((getline tmp) > 0) {
- print tmp
- print $0
- } else
- print $0
- }
-
-It takes the following list:
-
- wan
- tew
- free
- phore
-
-and produces these results:
-
- tew
- wan
- phore
- free
-
- The 'getline' command used in this way sets only the variables 'NR',
-'FNR', and 'RT' (and, of course, VAR). The record is not split into
-fields, so the values of the fields (including '$0') and the value of
-'NF' do not change.
-
-
-File: gawk.info, Node: Getline/File, Next: Getline/Variable/File, Prev: Getline/Variable, Up: Getline
-
-4.9.3 Using 'getline' from a File
----------------------------------
-
-Use 'getline < FILE' to read the next record from FILE. Here, FILE is a
-string-valued expression that specifies the file name. '< FILE' is
-called a "redirection" because it directs input to come from a different
-place. For example, the following program reads its input record from
-the file 'secondary.input' when it encounters a first field with a value
-equal to 10 in the current input file:
-
- {
- if ($1 == 10) {
- getline < "secondary.input"
- print
- } else
- print
- }
-
- Because the main input stream is not used, the values of 'NR' and
-'FNR' are not changed. However, the record it reads is split into
-fields in the normal manner, so the values of '$0' and the other fields
-are changed, resulting in a new value of 'NF'. 'RT' is also set.
-
- According to POSIX, 'getline < EXPRESSION' is ambiguous if EXPRESSION
-contains unparenthesized operators other than '$'; for example, 'getline
-< dir "/" file' is ambiguous because the concatenation operator (not
-discussed yet; *note Concatenation::) is not parenthesized. You should
-write it as 'getline < (dir "/" file)' if you want your program to be
-portable to all 'awk' implementations.
-
-
-File: gawk.info, Node: Getline/Variable/File, Next: Getline/Pipe, Prev: Getline/File, Up: Getline
-
-4.9.4 Using 'getline' into a Variable from a File
--------------------------------------------------
-
-Use 'getline VAR < FILE' to read input from the file FILE, and put it in
-the variable VAR. As earlier, FILE is a string-valued expression that
-specifies the file from which to read.
-
- In this version of 'getline', none of the predefined variables are
-changed and the record is not split into fields. The only variable
-changed is VAR.(1) For example, the following program copies all the
-input files to the output, except for records that say
-'@include FILENAME'. Such a record is replaced by the contents of the
-file FILENAME:
-
- {
- if (NF == 2 && $1 == "@include") {
- while ((getline line < $2) > 0)
- print line
- close($2)
- } else
- print
- }
-
- Note here how the name of the extra input file is not built into the
-program; it is taken directly from the data, specifically from the
-second field on the '@include' line.
-
- The 'close()' function is called to ensure that if two identical
-'@include' lines appear in the input, the entire specified file is
-included twice. *Note Close Files And Pipes::.
-
- One deficiency of this program is that it does not process nested
-'@include' statements (i.e., '@include' statements in included files)
-the way a true macro preprocessor would. *Note Igawk Program:: for a
-program that does handle nested '@include' statements.
-
- ---------- Footnotes ----------
-
- (1) This is not quite true. 'RT' could be changed if 'RS' is a
-regular expression.
-
-
-File: gawk.info, Node: Getline/Pipe, Next: Getline/Variable/Pipe, Prev: Getline/Variable/File, Up: Getline
-
-4.9.5 Using 'getline' from a Pipe
----------------------------------
-
- Omniscience has much to recommend it. Failing that, attention to
- details would be useful.
- -- _Brian Kernighan_
-
- The output of a command can also be piped into 'getline', using
-'COMMAND | getline'. In this case, the string COMMAND is run as a shell
-command and its output is piped into 'awk' to be used as input. This
-form of 'getline' reads one record at a time from the pipe. For
-example, the following program copies its input to its output, except
-for lines that begin with '@execute', which are replaced by the output
-produced by running the rest of the line as a shell command:
-
- {
- if ($1 == "@execute") {
- tmp = substr($0, 10) # Remove "@execute"
- while ((tmp | getline) > 0)
- print
- close(tmp)
- } else
- print
- }
-
-The 'close()' function is called to ensure that if two identical
-'@execute' lines appear in the input, the command is run for each one.
-*Note Close Files And Pipes::. Given the input:
-
- foo
- bar
- baz
- @execute who
- bletch
-
-the program might produce:
-
- foo
- bar
- baz
- arnold ttyv0 Jul 13 14:22
- miriam ttyp0 Jul 13 14:23 (murphy:0)
- bill ttyp1 Jul 13 14:23 (murphy:0)
- bletch
-
-Notice that this program ran the command 'who' and printed the result.
-(If you try this program yourself, you will of course get different
-results, depending upon who is logged in on your system.)
-
- This variation of 'getline' splits the record into fields, sets the
-value of 'NF', and recomputes the value of '$0'. The values of 'NR' and
-'FNR' are not changed. 'RT' is set.
-
- According to POSIX, 'EXPRESSION | getline' is ambiguous if EXPRESSION
-contains unparenthesized operators other than '$'--for example, '"echo "
-"date" | getline' is ambiguous because the concatenation operator is not
-parenthesized. You should write it as '("echo " "date") | getline' if
-you want your program to be portable to all 'awk' implementations.
-
- NOTE: Unfortunately, 'gawk' has not been consistent in its
- treatment of a construct like '"echo " "date" | getline'. Most
- versions, including the current version, treat it at as '("echo "
- "date") | getline'. (This is also how BWK 'awk' behaves.) Some
- versions instead treat it as '"echo " ("date" | getline)'. (This
- is how 'mawk' behaves.) In short, _always_ use explicit
- parentheses, and then you won't have to worry.
-
-
-File: gawk.info, Node: Getline/Variable/Pipe, Next: Getline/Coprocess, Prev: Getline/Pipe, Up: Getline
-
-4.9.6 Using 'getline' into a Variable from a Pipe
--------------------------------------------------
-
-When you use 'COMMAND | getline VAR', the output of COMMAND is sent
-through a pipe to 'getline' and into the variable VAR. For example, the
-following program reads the current date and time into the variable
-'current_time', using the 'date' utility, and then prints it:
-
- BEGIN {
- "date" | getline current_time
- close("date")
- print "Report printed on " current_time
- }
-
- In this version of 'getline', none of the predefined variables are
-changed and the record is not split into fields. However, 'RT' is set.
-
- According to POSIX, 'EXPRESSION | getline VAR' is ambiguous if
-EXPRESSION contains unparenthesized operators other than '$'; for
-example, '"echo " "date" | getline VAR' is ambiguous because the
-concatenation operator is not parenthesized. You should write it as
-'("echo " "date") | getline VAR' if you want your program to be portable
-to other 'awk' implementations.
-
-
-File: gawk.info, Node: Getline/Coprocess, Next: Getline/Variable/Coprocess, Prev: Getline/Variable/Pipe, Up: Getline
-
-4.9.7 Using 'getline' from a Coprocess
---------------------------------------
-
-Reading input into 'getline' from a pipe is a one-way operation. The
-command that is started with 'COMMAND | getline' only sends data _to_
-your 'awk' program.
-
- On occasion, you might want to send data to another program for
-processing and then read the results back. 'gawk' allows you to start a
-"coprocess", with which two-way communications are possible. This is
-done with the '|&' operator. Typically, you write data to the coprocess
-first and then read the results back, as shown in the following:
-
- print "SOME QUERY" |& "db_server"
- "db_server" |& getline
-
-which sends a query to 'db_server' and then reads the results.
-
- The values of 'NR' and 'FNR' are not changed, because the main input
-stream is not used. However, the record is split into fields in the
-normal manner, thus changing the values of '$0', of the other fields,
-and of 'NF' and 'RT'.
-
- Coprocesses are an advanced feature. They are discussed here only
-because this is the minor node on 'getline'. *Note Two-way I/O::, where
-coprocesses are discussed in more detail.
-
-
-File: gawk.info, Node: Getline/Variable/Coprocess, Next: Getline Notes, Prev: Getline/Coprocess, Up: Getline
-
-4.9.8 Using 'getline' into a Variable from a Coprocess
-------------------------------------------------------
-
-When you use 'COMMAND |& getline VAR', the output from the coprocess
-COMMAND is sent through a two-way pipe to 'getline' and into the
-variable VAR.
-
- In this version of 'getline', none of the predefined variables are
-changed and the record is not split into fields. The only variable
-changed is VAR. However, 'RT' is set.
-
- Coprocesses are an advanced feature. They are discussed here only
-because this is the minor node on 'getline'. *Note Two-way I/O::, where
-coprocesses are discussed in more detail.
-
-
-File: gawk.info, Node: Getline Notes, Next: Getline Summary, Prev: Getline/Variable/Coprocess, Up: Getline
-
-4.9.9 Points to Remember About 'getline'
-----------------------------------------
-
-Here are some miscellaneous points about 'getline' that you should bear
-in mind:
-
- * When 'getline' changes the value of '$0' and 'NF', 'awk' does _not_
- automatically jump to the start of the program and start testing
- the new record against every pattern. However, the new record is
- tested against any subsequent rules.
-
- * Some very old 'awk' implementations limit the number of pipelines
- that an 'awk' program may have open to just one. In 'gawk', there
- is no such limit. You can open as many pipelines (and coprocesses)
- as the underlying operating system permits.
-
- * An interesting side effect occurs if you use 'getline' without a
- redirection inside a 'BEGIN' rule. Because an unredirected
- 'getline' reads from the command-line data files, the first
- 'getline' command causes 'awk' to set the value of 'FILENAME'.
- Normally, 'FILENAME' does not have a value inside 'BEGIN' rules,
- because you have not yet started to process the command-line data
- files. (d.c.) (See *note BEGIN/END::; also *note Auto-set::.)
-
- * Using 'FILENAME' with 'getline' ('getline < FILENAME') is likely to
- be a source of confusion. 'awk' opens a separate input stream from
- the current input file. However, by not using a variable, '$0' and
- 'NF' are still updated. If you're doing this, it's probably by
- accident, and you should reconsider what it is you're trying to
- accomplish.
-
- * *note Getline Summary::, presents a table summarizing the 'getline'
- variants and which variables they can affect. It is worth noting
- that those variants that do not use redirection can cause
- 'FILENAME' to be updated if they cause 'awk' to start reading a new
- input file.
-
- * If the variable being assigned is an expression with side effects,
- different versions of 'awk' behave differently upon encountering
- end-of-file. Some versions don't evaluate the expression; many
- versions (including 'gawk') do. Here is an example, courtesy of
- Duncan Moore:
-
- BEGIN {
- system("echo 1 > f")
- while ((getline a[++c] < "f") > 0) { }
- print c
- }
-
- Here, the side effect is the '++c'. Is 'c' incremented if
- end-of-file is encountered before the element in 'a' is assigned?
-
- 'gawk' treats 'getline' like a function call, and evaluates the
- expression 'a[++c]' before attempting to read from 'f'. However,
- some versions of 'awk' only evaluate the expression once they know
- that there is a string value to be assigned.
-
-
-File: gawk.info, Node: Getline Summary, Prev: Getline Notes, Up: Getline
-
-4.9.10 Summary of 'getline' Variants
-------------------------------------
-
-*note Table 4.1: table-getline-variants. summarizes the eight variants
-of 'getline', listing which predefined variables are set by each one,
-and whether the variant is standard or a 'gawk' extension. Note: for
-each variant, 'gawk' sets the 'RT' predefined variable.
-
-Variant Effect 'awk' / 'gawk'
--------------------------------------------------------------------------
-'getline' Sets '$0', 'NF', 'FNR', 'awk'
- 'NR', and 'RT'
-'getline' VAR Sets VAR, 'FNR', 'NR', 'awk'
- and 'RT'
-'getline <' FILE Sets '$0', 'NF', and 'RT' 'awk'
-'getline VAR < FILE' Sets VAR and 'RT' 'awk'
-COMMAND '| getline' Sets '$0', 'NF', and 'RT' 'awk'
-COMMAND '| getline' Sets VAR and 'RT' 'awk'
-VAR
-COMMAND '|& getline' Sets '$0', 'NF', and 'RT' 'gawk'
-COMMAND '|& getline' Sets VAR and 'RT' 'gawk'
-VAR
-
-Table 4.1: 'getline' variants and what they set
-
-
-File: gawk.info, Node: Read Timeout, Next: Retrying Input, Prev: Getline, Up: Reading Files
-
-4.10 Reading Input with a Timeout
-=================================
-
-This minor node describes a feature that is specific to 'gawk'.
-
- You may specify a timeout in milliseconds for reading input from the
-keyboard, a pipe, or two-way communication, including TCP/IP sockets.
-This can be done on a per-input, per-command, or per-connection basis,
-by setting a special element in the 'PROCINFO' array (*note Auto-set::):
-
- PROCINFO["input_name", "READ_TIMEOUT"] = TIMEOUT IN MILLISECONDS
-
- When set, this causes 'gawk' to time out and return failure if no
-data is available to read within the specified timeout period. For
-example, a TCP client can decide to give up on receiving any response
-from the server after a certain amount of time:
-
- Service = "/inet/tcp/0/localhost/daytime"
- PROCINFO[Service, "READ_TIMEOUT"] = 100
- if ((Service |& getline) > 0)
- print $0
- else if (ERRNO != "")
- print ERRNO
-
- Here is how to read interactively from the user(1) without waiting
-for more than five seconds:
-
- PROCINFO["/dev/stdin", "READ_TIMEOUT"] = 5000
- while ((getline < "/dev/stdin") > 0)
- print $0
-
- 'gawk' terminates the read operation if input does not arrive after
-waiting for the timeout period, returns failure, and sets 'ERRNO' to an
-appropriate string value. A negative or zero value for the timeout is
-the same as specifying no timeout at all.
-
- A timeout can also be set for reading from the keyboard in the
-implicit loop that reads input records and matches them against
-patterns, like so:
-
- $ gawk 'BEGIN { PROCINFO["-", "READ_TIMEOUT"] = 5000 }
- > { print "You entered: " $0 }'
- gawk
- -| You entered: gawk
-
- In this case, failure to respond within five seconds results in the
-following error message:
-
- error-> gawk: cmd. line:2: (FILENAME=- FNR=1) fatal: error reading input file `-': Connection timed out
-
- The timeout can be set or changed at any time, and will take effect
-on the next attempt to read from the input device. In the following
-example, we start with a timeout value of one second, and progressively
-reduce it by one-tenth of a second until we wait indefinitely for the
-input to arrive:
-
- PROCINFO[Service, "READ_TIMEOUT"] = 1000
- while ((Service |& getline) > 0) {
- print $0
- PROCINFO[Service, "READ_TIMEOUT"] -= 100
- }
-
- NOTE: You should not assume that the read operation will block
- exactly after the tenth record has been printed. It is possible
- that 'gawk' will read and buffer more than one record's worth of
- data the first time. Because of this, changing the value of
- timeout like in the preceding example is not very useful.
-
- If the 'PROCINFO' element is not present and the 'GAWK_READ_TIMEOUT'
-environment variable exists, 'gawk' uses its value to initialize the
-timeout value. The exclusive use of the environment variable to specify
-timeout has the disadvantage of not being able to control it on a
-per-command or per-connection basis.
-
- 'gawk' considers a timeout event to be an error even though the
-attempt to read from the underlying device may succeed in a later
-attempt. This is a limitation, and it also means that you cannot use
-this to multiplex input from two or more sources. *Note Retrying
-Input:: for a way to enable later I/O attempts to succeed.
-
- Assigning a timeout value prevents read operations from blocking
-indefinitely. But bear in mind that there are other ways 'gawk' can
-stall waiting for an input device to be ready. A network client can
-sometimes take a long time to establish a connection before it can start
-reading any data, or the attempt to open a FIFO special file for reading
-can block indefinitely until some other process opens it for writing.
-
- ---------- Footnotes ----------
-
- (1) This assumes that standard input is the keyboard.
-
-
-File: gawk.info, Node: Retrying Input, Next: Command-line directories, Prev: Read Timeout, Up: Reading Files
-
-4.11 Retrying Reads After Certain Input Errors
-==============================================
-
-This minor node describes a feature that is specific to 'gawk'.
-
- When 'gawk' encounters an error while reading input, by default
-'getline' returns -1, and subsequent attempts to read from that file
-result in an end-of-file indication. However, you may optionally
-instruct 'gawk' to allow I/O to be retried when certain errors are
-encountered by setting a special element in the 'PROCINFO' array (*note
-Auto-set::):
-
- PROCINFO["INPUT_NAME", "RETRY"] = 1
-
- When this element exists, 'gawk' checks the value of the system (C
-language) 'errno' variable when an I/O error occurs. If 'errno'
-indicates a subsequent I/O attempt may succeed, 'getline' instead
-returns -2 and further calls to 'getline' may succeed. This applies to
-the 'errno' values 'EAGAIN', 'EWOULDBLOCK', 'EINTR', or 'ETIMEDOUT'.
-
- This feature is useful in conjunction with 'PROCINFO["INPUT_NAME",
-"READ_TIMEOUT"]' or situations where a file descriptor has been
-configured to behave in a non-blocking fashion.
-
-
-File: gawk.info, Node: Command-line directories, Next: Input Summary, Prev: Retrying Input, Up: Reading Files
-
-4.12 Directories on the Command Line
-====================================
-
-According to the POSIX standard, files named on the 'awk' command line
-must be text files; it is a fatal error if they are not. Most versions
-of 'awk' treat a directory on the command line as a fatal error.
-
- By default, 'gawk' produces a warning for a directory on the command
-line, but otherwise ignores it. This makes it easier to use shell
-wildcards with your 'awk' program:
-
- $ gawk -f whizprog.awk * Directories could kill this program
-
- If either of the '--posix' or '--traditional' options is given, then
-'gawk' reverts to treating a directory on the command line as a fatal
-error.
-
- *Note Extension Sample Readdir:: for a way to treat directories as
-usable data from an 'awk' program.
-
-
-File: gawk.info, Node: Input Summary, Next: Input Exercises, Prev: Command-line directories, Up: Reading Files
-
-4.13 Summary
-============
-
- * Input is split into records based on the value of 'RS'. The
- possibilities are as follows:
-
- Value of 'RS' Records are split on 'awk' / 'gawk'
- ...
- ---------------------------------------------------------------------------
- Any single That character 'awk'
- character
- The empty string Runs of two or more 'awk'
- ('""') newlines
- A regexp Text that matches the 'gawk'
- regexp
-
- * 'FNR' indicates how many records have been read from the current
- input file; 'NR' indicates how many records have been read in
- total.
-
- * 'gawk' sets 'RT' to the text matched by 'RS'.
-
- * After splitting the input into records, 'awk' further splits the
- records into individual fields, named '$1', '$2', and so on. '$0'
- is the whole record, and 'NF' indicates how many fields there are.
- The default way to split fields is between whitespace characters.
-
- * Fields may be referenced using a variable, as in '$NF'. Fields may
- also be assigned values, which causes the value of '$0' to be
- recomputed when it is later referenced. Assigning to a field with
- a number greater than 'NF' creates the field and rebuilds the
- record, using 'OFS' to separate the fields. Incrementing 'NF' does
- the same thing. Decrementing 'NF' throws away fields and rebuilds
- the record.
-
- * Field splitting is more complicated than record splitting:
-
- Field separator value Fields are split ... 'awk' /
- 'gawk'
- ---------------------------------------------------------------------------
- 'FS == " "' On runs of whitespace 'awk'
- 'FS == ANY SINGLE On that character 'awk'
- CHARACTER'
- 'FS == REGEXP' On text matching the regexp 'awk'
- 'FS == ""' Such that each individual 'gawk'
- character is a separate
- field
- 'FIELDWIDTHS == LIST OF Based on character position 'gawk'
- COLUMNS'
- 'FPAT == REGEXP' On the text surrounding 'gawk'
- text matching the regexp
-
- * Using 'FS = "\n"' causes the entire record to be a single field
- (assuming that newlines separate records).
-
- * 'FS' may be set from the command line using the '-F' option. This
- can also be done using command-line variable assignment.
-
- * Use 'PROCINFO["FS"]' to see how fields are being split.
-
- * Use 'getline' in its various forms to read additional records from
- the default input stream, from a file, or from a pipe or coprocess.
-
- * Use 'PROCINFO[FILE, "READ_TIMEOUT"]' to cause reads to time out for
- FILE.
-
- * Directories on the command line are fatal for standard 'awk';
- 'gawk' ignores them if not in POSIX mode.
-
-
-File: gawk.info, Node: Input Exercises, Prev: Input Summary, Up: Reading Files
-
-4.14 Exercises
-==============
-
- 1. Using the 'FIELDWIDTHS' variable (*note Constant Size::), write a
- program to read election data, where each record represents one
- voter's votes. Come up with a way to define which columns are
- associated with each ballot item, and print the total votes,
- including abstentions, for each item.
-
- 2. *note Plain Getline::, presented a program to remove C-style
- comments ('/* ... */') from the input. That program does not work
- if one comment ends on one line and another one starts later on the
- same line. That can be fixed by making one simple change. What is
- it?
-
-
-File: gawk.info, Node: Printing, Next: Expressions, Prev: Reading Files, Up: Top
-
-5 Printing Output
-*****************
-
-One of the most common programming actions is to "print", or output,
-some or all of the input. Use the 'print' statement for simple output,
-and the 'printf' statement for fancier formatting. The 'print'
-statement is not limited when computing _which_ values to print.
-However, with two exceptions, you cannot specify _how_ to print
-them--how many columns, whether to use exponential notation or not, and
-so on. (For the exceptions, *note Output Separators:: and *note
-OFMT::.) For printing with specifications, you need the 'printf'
-statement (*note Printf::).
-
- Besides basic and formatted printing, this major node also covers I/O
-redirections to files and pipes, introduces the special file names that
-'gawk' processes internally, and discusses the 'close()' built-in
-function.
-
-* Menu:
-
-* Print:: The 'print' statement.
-* Print Examples:: Simple examples of 'print' statements.
-* Output Separators:: The output separators and how to change them.
-* OFMT:: Controlling Numeric Output With 'print'.
-* Printf:: The 'printf' statement.
-* Redirection:: How to redirect output to multiple files and
- pipes.
-* Special FD:: Special files for I/O.
-* Special Files:: File name interpretation in 'gawk'.
- 'gawk' allows access to inherited file
- descriptors.
-* Close Files And Pipes:: Closing Input and Output Files and Pipes.
-* Nonfatal:: Enabling Nonfatal Output.
-* Output Summary:: Output summary.
-* Output Exercises:: Exercises.
-
-
-File: gawk.info, Node: Print, Next: Print Examples, Up: Printing
-
-5.1 The 'print' Statement
-=========================
-
-Use the 'print' statement to produce output with simple, standardized
-formatting. You specify only the strings or numbers to print, in a list
-separated by commas. They are output, separated by single spaces,
-followed by a newline. The statement looks like this:
-
- print ITEM1, ITEM2, ...
-
-The entire list of items may be optionally enclosed in parentheses. The
-parentheses are necessary if any of the item expressions uses the '>'
-relational operator; otherwise it could be confused with an output
-redirection (*note Redirection::).
-
- The items to print can be constant strings or numbers, fields of the
-current record (such as '$1'), variables, or any 'awk' expression.
-Numeric values are converted to strings and then printed.
-
- The simple statement 'print' with no items is equivalent to 'print
-$0': it prints the entire current record. To print a blank line, use
-'print ""'. To print a fixed piece of text, use a string constant, such
-as '"Don't Panic"', as one item. If you forget to use the double-quote
-characters, your text is taken as an 'awk' expression, and you will
-probably get an error. Keep in mind that a space is printed between any
-two items.
-
- Note that the 'print' statement is a statement and not an
-expression--you can't use it in the pattern part of a pattern-action
-statement, for example.
-
-
-File: gawk.info, Node: Print Examples, Next: Output Separators, Prev: Print, Up: Printing
-
-5.2 'print' Statement Examples
-==============================
-
-Each 'print' statement makes at least one line of output. However, it
-isn't limited to only one line. If an item value is a string containing
-a newline, the newline is output along with the rest of the string. A
-single 'print' statement can make any number of lines this way.
-
- The following is an example of printing a string that contains
-embedded newlines (the '\n' is an escape sequence, used to represent the
-newline character; *note Escape Sequences::):
-
- $ awk 'BEGIN { print "line one\nline two\nline three" }'
- -| line one
- -| line two
- -| line three
-
- The next example, which is run on the 'inventory-shipped' file,
-prints the first two fields of each input record, with a space between
-them:
-
- $ awk '{ print $1, $2 }' inventory-shipped
- -| Jan 13
- -| Feb 15
- -| Mar 15
- ...
-
- A common mistake in using the 'print' statement is to omit the comma
-between two items. This often has the effect of making the items run
-together in the output, with no space. The reason for this is that
-juxtaposing two string expressions in 'awk' means to concatenate them.
-Here is the same program, without the comma:
-
- $ awk '{ print $1 $2 }' inventory-shipped
- -| Jan13
- -| Feb15
- -| Mar15
- ...
-
- To someone unfamiliar with the 'inventory-shipped' file, neither
-example's output makes much sense. A heading line at the beginning
-would make it clearer. Let's add some headings to our table of months
-('$1') and green crates shipped ('$2'). We do this using a 'BEGIN' rule
-(*note BEGIN/END::) so that the headings are only printed once:
-
- awk 'BEGIN { print "Month Crates"
- print "----- ------" }
- { print $1, $2 }' inventory-shipped
-
-When run, the program prints the following:
-
- Month Crates
- ----- ------
- Jan 13
- Feb 15
- Mar 15
- ...
-
-The only problem, however, is that the headings and the table data don't
-line up! We can fix this by printing some spaces between the two
-fields:
-
- awk 'BEGIN { print "Month Crates"
- print "----- ------" }
- { print $1, " ", $2 }' inventory-shipped
-
- Lining up columns this way can get pretty complicated when there are
-many columns to fix. Counting spaces for two or three columns is
-simple, but any more than this can take up a lot of time. This is why
-the 'printf' statement was created (*note Printf::); one of its
-specialties is lining up columns of data.
-
- NOTE: You can continue either a 'print' or 'printf' statement
- simply by putting a newline after any comma (*note
- Statements/Lines::).
-
-
-File: gawk.info, Node: Output Separators, Next: OFMT, Prev: Print Examples, Up: Printing
-
-5.3 Output Separators
-=====================
-
-As mentioned previously, a 'print' statement contains a list of items
-separated by commas. In the output, the items are normally separated by
-single spaces. However, this doesn't need to be the case; a single
-space is simply the default. Any string of characters may be used as
-the "output field separator" by setting the predefined variable 'OFS'.
-The initial value of this variable is the string '" "' (i.e., a single
-space).
-
- The output from an entire 'print' statement is called an "output
-record". Each 'print' statement outputs one output record, and then
-outputs a string called the "output record separator" (or 'ORS'). The
-initial value of 'ORS' is the string '"\n"' (i.e., a newline character).
-Thus, each 'print' statement normally makes a separate line.
-
- In order to change how output fields and records are separated,
-assign new values to the variables 'OFS' and 'ORS'. The usual place to
-do this is in the 'BEGIN' rule (*note BEGIN/END::), so that it happens
-before any input is processed. It can also be done with assignments on
-the command line, before the names of the input files, or using the '-v'
-command-line option (*note Options::). The following example prints the
-first and second fields of each input record, separated by a semicolon,
-with a blank line added after each newline:
-
- $ awk 'BEGIN { OFS = ";"; ORS = "\n\n" }
- > { print $1, $2 }' mail-list
- -| Amelia;555-5553
- -|
- -| Anthony;555-3412
- -|
- -| Becky;555-7685
- -|
- -| Bill;555-1675
- -|
- -| Broderick;555-0542
- -|
- -| Camilla;555-2912
- -|
- -| Fabius;555-1234
- -|
- -| Julie;555-6699
- -|
- -| Martin;555-6480
- -|
- -| Samuel;555-3430
- -|
- -| Jean-Paul;555-2127
- -|
-
- If the value of 'ORS' does not contain a newline, the program's
-output runs together on a single line.
-
-
-File: gawk.info, Node: OFMT, Next: Printf, Prev: Output Separators, Up: Printing
-
-5.4 Controlling Numeric Output with 'print'
-===========================================
-
-When printing numeric values with the 'print' statement, 'awk'
-internally converts each number to a string of characters and prints
-that string. 'awk' uses the 'sprintf()' function to do this conversion
-(*note String Functions::). For now, it suffices to say that the
-'sprintf()' function accepts a "format specification" that tells it how
-to format numbers (or strings), and that there are a number of different
-ways in which numbers can be formatted. The different format
-specifications are discussed more fully in *note Control Letters::.
-
- The predefined variable 'OFMT' contains the format specification that
-'print' uses with 'sprintf()' when it wants to convert a number to a
-string for printing. The default value of 'OFMT' is '"%.6g"'. The way
-'print' prints numbers can be changed by supplying a different format
-specification for the value of 'OFMT', as shown in the following
-example:
-
- $ awk 'BEGIN {
- > OFMT = "%.0f" # print numbers as integers (rounds)
- > print 17.23, 17.54 }'
- -| 17 18
-
-According to the POSIX standard, 'awk''s behavior is undefined if 'OFMT'
-contains anything but a floating-point conversion specification. (d.c.)
-
-
-File: gawk.info, Node: Printf, Next: Redirection, Prev: OFMT, Up: Printing
-
-5.5 Using 'printf' Statements for Fancier Printing
-==================================================
-
-For more precise control over the output format than what is provided by
-'print', use 'printf'. With 'printf' you can specify the width to use
-for each item, as well as various formatting choices for numbers (such
-as what output base to use, whether to print an exponent, whether to
-print a sign, and how many digits to print after the decimal point).
-
-* Menu:
-
-* Basic Printf:: Syntax of the 'printf' statement.
-* Control Letters:: Format-control letters.
-* Format Modifiers:: Format-specification modifiers.
-* Printf Examples:: Several examples.
-
-
-File: gawk.info, Node: Basic Printf, Next: Control Letters, Up: Printf
-
-5.5.1 Introduction to the 'printf' Statement
---------------------------------------------
-
-A simple 'printf' statement looks like this:
-
- printf FORMAT, ITEM1, ITEM2, ...
-
-As for 'print', the entire list of arguments may optionally be enclosed
-in parentheses. Here too, the parentheses are necessary if any of the
-item expressions uses the '>' relational operator; otherwise, it can be
-confused with an output redirection (*note Redirection::).
-
- The difference between 'printf' and 'print' is the FORMAT argument.
-This is an expression whose value is taken as a string; it specifies how
-to output each of the other arguments. It is called the "format
-string".
-
- The format string is very similar to that in the ISO C library
-function 'printf()'. Most of FORMAT is text to output verbatim.
-Scattered among this text are "format specifiers"--one per item. Each
-format specifier says to output the next item in the argument list at
-that place in the format.
-
- The 'printf' statement does not automatically append a newline to its
-output. It outputs only what the format string specifies. So if a
-newline is needed, you must include one in the format string. The
-output separator variables 'OFS' and 'ORS' have no effect on 'printf'
-statements. For example:
-
- $ awk 'BEGIN {
- > ORS = "\nOUCH!\n"; OFS = "+"
- > msg = "Don\47t Panic!"
- > printf "%s\n", msg
- > }'
- -| Don't Panic!
-
-Here, neither the '+' nor the 'OUCH!' appears in the output message.
-
-
-File: gawk.info, Node: Control Letters, Next: Format Modifiers, Prev: Basic Printf, Up: Printf
-
-5.5.2 Format-Control Letters
-----------------------------
-
-A format specifier starts with the character '%' and ends with a
-"format-control letter"--it tells the 'printf' statement how to output
-one item. The format-control letter specifies what _kind_ of value to
-print. The rest of the format specifier is made up of optional
-"modifiers" that control _how_ to print the value, such as the field
-width. Here is a list of the format-control letters:
-
-'%c'
- Print a number as a character; thus, 'printf "%c", 65' outputs the
- letter 'A'. The output for a string value is the first character
- of the string.
-
- NOTE: The POSIX standard says the first character of a string
- is printed. In locales with multibyte characters, 'gawk'
- attempts to convert the leading bytes of the string into a
- valid wide character and then to print the multibyte encoding
- of that character. Similarly, when printing a numeric value,
- 'gawk' allows the value to be within the numeric range of
- values that can be held in a wide character. If the
- conversion to multibyte encoding fails, 'gawk' uses the low
- eight bits of the value as the character to print.
-
- Other 'awk' versions generally restrict themselves to printing
- the first byte of a string or to numeric values within the
- range of a single byte (0-255).
-
-'%d', '%i'
- Print a decimal integer. The two control letters are equivalent.
- (The '%i' specification is for compatibility with ISO C.)
-
-'%e', '%E'
- Print a number in scientific (exponential) notation. For example:
-
- printf "%4.3e\n", 1950
-
- prints '1.950e+03', with a total of four significant figures, three
- of which follow the decimal point. (The '4.3' represents two
- modifiers, discussed in the next node.) '%E' uses 'E' instead of
- 'e' in the output.
-
-'%f'
- Print a number in floating-point notation. For example:
-
- printf "%4.3f", 1950
-
- prints '1950.000', with a total of four significant figures, three
- of which follow the decimal point. (The '4.3' represents two
- modifiers, discussed in the next node.)
-
- On systems supporting IEEE 754 floating-point format, values
- representing negative infinity are formatted as '-inf' or
- '-infinity', and positive infinity as 'inf' or 'infinity'. The
- special "not a number" value formats as '-nan' or 'nan' (*note Math
- Definitions::).
-
-'%F'
- Like '%f', but the infinity and "not a number" values are spelled
- using uppercase letters.
-
- The '%F' format is a POSIX extension to ISO C; not all systems
- support it. On those that don't, 'gawk' uses '%f' instead.
-
-'%g', '%G'
- Print a number in either scientific notation or in floating-point
- notation, whichever uses fewer characters; if the result is printed
- in scientific notation, '%G' uses 'E' instead of 'e'.
-
-'%o'
- Print an unsigned octal integer (*note Nondecimal-numbers::).
-
-'%s'
- Print a string.
-
-'%u'
- Print an unsigned decimal integer. (This format is of marginal
- use, because all numbers in 'awk' are floating point; it is
- provided primarily for compatibility with C.)
-
-'%x', '%X'
- Print an unsigned hexadecimal integer; '%X' uses the letters 'A'
- through 'F' instead of 'a' through 'f' (*note
- Nondecimal-numbers::).
-
-'%%'
- Print a single '%'. This does not consume an argument and it
- ignores any modifiers.
-
- NOTE: When using the integer format-control letters for values that
- are outside the range of the widest C integer type, 'gawk' switches
- to the '%g' format specifier. If '--lint' is provided on the
- command line (*note Options::), 'gawk' warns about this. Other
- versions of 'awk' may print invalid values or do something else
- entirely. (d.c.)
-
-
-File: gawk.info, Node: Format Modifiers, Next: Printf Examples, Prev: Control Letters, Up: Printf
-
-5.5.3 Modifiers for 'printf' Formats
-------------------------------------
-
-A format specification can also include "modifiers" that can control how
-much of the item's value is printed, as well as how much space it gets.
-The modifiers come between the '%' and the format-control letter. We
-use the bullet symbol "*" in the following examples to represent spaces
-in the output. Here are the possible modifiers, in the order in which
-they may appear:
-
-'N$'
- An integer constant followed by a '$' is a "positional specifier".
- Normally, format specifications are applied to arguments in the
- order given in the format string. With a positional specifier, the
- format specification is applied to a specific argument, instead of
- what would be the next argument in the list. Positional specifiers
- begin counting with one. Thus:
-
- printf "%s %s\n", "don't", "panic"
- printf "%2$s %1$s\n", "panic", "don't"
-
- prints the famous friendly message twice.
-
- At first glance, this feature doesn't seem to be of much use. It
- is in fact a 'gawk' extension, intended for use in translating
- messages at runtime. *Note Printf Ordering::, which describes how
- and why to use positional specifiers. For now, we ignore them.
-
-'-' (Minus)
- The minus sign, used before the width modifier (see later on in
- this list), says to left-justify the argument within its specified
- width. Normally, the argument is printed right-justified in the
- specified width. Thus:
-
- printf "%-4s", "foo"
-
- prints 'foo*'.
-
-SPACE
- For numeric conversions, prefix positive values with a space and
- negative values with a minus sign.
-
-'+'
- The plus sign, used before the width modifier (see later on in this
- list), says to always supply a sign for numeric conversions, even
- if the data to format is positive. The '+' overrides the space
- modifier.
-
-'#'
- Use an "alternative form" for certain control letters. For '%o',
- supply a leading zero. For '%x' and '%X', supply a leading '0x' or
- '0X' for a nonzero result. For '%e', '%E', '%f', and '%F', the
- result always contains a decimal point. For '%g' and '%G',
- trailing zeros are not removed from the result.
-
-'0'
- A leading '0' (zero) acts as a flag indicating that output should
- be padded with zeros instead of spaces. This applies only to the
- numeric output formats. This flag only has an effect when the
- field width is wider than the value to print.
-
-'''
- A single quote or apostrophe character is a POSIX extension to ISO
- C. It indicates that the integer part of a floating-point value, or
- the entire part of an integer decimal value, should have a
- thousands-separator character in it. This only works in locales
- that support such characters. For example:
-
- $ cat thousands.awk Show source program
- -| BEGIN { printf "%'d\n", 1234567 }
- $ LC_ALL=C gawk -f thousands.awk
- -| 1234567 Results in "C" locale
- $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk
- -| 1,234,567 Results in US English UTF locale
-
- For more information about locales and internationalization issues,
- see *note Locales::.
-
- NOTE: The ''' flag is a nice feature, but its use complicates
- things: it becomes difficult to use it in command-line
- programs. For information on appropriate quoting tricks, see
- *note Quoting::.
-
-WIDTH
- This is a number specifying the desired minimum width of a field.
- Inserting any number between the '%' sign and the format-control
- character forces the field to expand to this width. The default
- way to do this is to pad with spaces on the left. For example:
-
- printf "%4s", "foo"
-
- prints '*foo'.
-
- The value of WIDTH is a minimum width, not a maximum. If the item
- value requires more than WIDTH characters, it can be as wide as
- necessary. Thus, the following:
-
- printf "%4s", "foobar"
-
- prints 'foobar'.
-
- Preceding the WIDTH with a minus sign causes the output to be
- padded with spaces on the right, instead of on the left.
-
-'.PREC'
- A period followed by an integer constant specifies the precision to
- use when printing. The meaning of the precision varies by control
- letter:
-
- '%d', '%i', '%o', '%u', '%x', '%X'
- Minimum number of digits to print.
-
- '%e', '%E', '%f', '%F'
- Number of digits to the right of the decimal point.
-
- '%g', '%G'
- Maximum number of significant digits.
-
- '%s'
- Maximum number of characters from the string that should
- print.
-
- Thus, the following:
-
- printf "%.4s", "foobar"
-
- prints 'foob'.
-
- The C library 'printf''s dynamic WIDTH and PREC capability (e.g.,
-'"%*.*s"') is supported. Instead of supplying explicit WIDTH and/or
-PREC values in the format string, they are passed in the argument list.
-For example:
-
- w = 5
- p = 3
- s = "abcdefg"
- printf "%*.*s\n", w, p, s
-
-is exactly equivalent to:
-
- s = "abcdefg"
- printf "%5.3s\n", s
-
-Both programs output '**abc'. Earlier versions of 'awk' did not support
-this capability. If you must use such a version, you may simulate this
-feature by using concatenation to build up the format string, like so:
-
- w = 5
- p = 3
- s = "abcdefg"
- printf "%" w "." p "s\n", s
-
-This is not particularly easy to read, but it does work.
-
- C programmers may be used to supplying additional modifiers ('h',
-'j', 'l', 'L', 't', and 'z') in 'printf' format strings. These are not
-valid in 'awk'. Most 'awk' implementations silently ignore them. If
-'--lint' is provided on the command line (*note Options::), 'gawk' warns
-about their use. If '--posix' is supplied, their use is a fatal error.
-
-
-File: gawk.info, Node: Printf Examples, Prev: Format Modifiers, Up: Printf
-
-5.5.4 Examples Using 'printf'
------------------------------
-
-The following simple example shows how to use 'printf' to make an
-aligned table:
-
- awk '{ printf "%-10s %s\n", $1, $2 }' mail-list
-
-This command prints the names of the people ('$1') in the file
-'mail-list' as a string of 10 characters that are left-justified. It
-also prints the phone numbers ('$2') next on the line. This produces an
-aligned two-column table of names and phone numbers, as shown here:
-
- $ awk '{ printf "%-10s %s\n", $1, $2 }' mail-list
- -| Amelia 555-5553
- -| Anthony 555-3412
- -| Becky 555-7685
- -| Bill 555-1675
- -| Broderick 555-0542
- -| Camilla 555-2912
- -| Fabius 555-1234
- -| Julie 555-6699
- -| Martin 555-6480
- -| Samuel 555-3430
- -| Jean-Paul 555-2127
-
- In this case, the phone numbers had to be printed as strings because
-the numbers are separated by dashes. Printing the phone numbers as
-numbers would have produced just the first three digits: '555'. This
-would have been pretty confusing.
-
- It wasn't necessary to specify a width for the phone numbers because
-they are last on their lines. They don't need to have spaces after
-them.
-
- The table could be made to look even nicer by adding headings to the
-tops of the columns. This is done using a 'BEGIN' rule (*note
-BEGIN/END::) so that the headers are only printed once, at the beginning
-of the 'awk' program:
-
- awk 'BEGIN { print "Name Number"
- print "---- ------" }
- { printf "%-10s %s\n", $1, $2 }' mail-list
-
- The preceding example mixes 'print' and 'printf' statements in the
-same program. Using just 'printf' statements can produce the same
-results:
-
- awk 'BEGIN { printf "%-10s %s\n", "Name", "Number"
- printf "%-10s %s\n", "----", "------" }
- { printf "%-10s %s\n", $1, $2 }' mail-list
-
-Printing each column heading with the same format specification used for
-the column elements ensures that the headings are aligned just like the
-columns.
-
- The fact that the same format specification is used three times can
-be emphasized by storing it in a variable, like this:
-
- awk 'BEGIN { format = "%-10s %s\n"
- printf format, "Name", "Number"
- printf format, "----", "------" }
- { printf format, $1, $2 }' mail-list
-
-
-File: gawk.info, Node: Redirection, Next: Special FD, Prev: Printf, Up: Printing
-
-5.6 Redirecting Output of 'print' and 'printf'
-==============================================
-
-So far, the output from 'print' and 'printf' has gone to the standard
-output, usually the screen. Both 'print' and 'printf' can also send
-their output to other places. This is called "redirection".
-
- NOTE: When '--sandbox' is specified (*note Options::), redirecting
- output to files, pipes, and coprocesses is disabled.
-
- A redirection appears after the 'print' or 'printf' statement.
-Redirections in 'awk' are written just like redirections in shell
-commands, except that they are written inside the 'awk' program.
-
- There are four forms of output redirection: output to a file, output
-appended to a file, output through a pipe to another command, and output
-to a coprocess. We show them all for the 'print' statement, but they
-work identically for 'printf':
-
-'print ITEMS > OUTPUT-FILE'
- This redirection prints the items into the output file named
- OUTPUT-FILE. The file name OUTPUT-FILE can be any expression. Its
- value is changed to a string and then used as a file name (*note
- Expressions::).
-
- When this type of redirection is used, the OUTPUT-FILE is erased
- before the first output is written to it. Subsequent writes to the
- same OUTPUT-FILE do not erase OUTPUT-FILE, but append to it. (This
- is different from how you use redirections in shell scripts.) If
- OUTPUT-FILE does not exist, it is created. For example, here is
- how an 'awk' program can write a list of peoples' names to one file
- named 'name-list', and a list of phone numbers to another file
- named 'phone-list':
-
- $ awk '{ print $2 > "phone-list"
- > print $1 > "name-list" }' mail-list
- $ cat phone-list
- -| 555-5553
- -| 555-3412
- ...
- $ cat name-list
- -| Amelia
- -| Anthony
- ...
-
- Each output file contains one name or number per line.
-
-'print ITEMS >> OUTPUT-FILE'
- This redirection prints the items into the preexisting output file
- named OUTPUT-FILE. The difference between this and the single-'>'
- redirection is that the old contents (if any) of OUTPUT-FILE are
- not erased. Instead, the 'awk' output is appended to the file. If
- OUTPUT-FILE does not exist, then it is created.
-
-'print ITEMS | COMMAND'
- It is possible to send output to another program through a pipe
- instead of into a file. This redirection opens a pipe to COMMAND,
- and writes the values of ITEMS through this pipe to another process
- created to execute COMMAND.
-
- The redirection argument COMMAND is actually an 'awk' expression.
- Its value is converted to a string whose contents give the shell
- command to be run. For example, the following produces two files,
- one unsorted list of peoples' names, and one list sorted in reverse
- alphabetical order:
-
- awk '{ print $1 > "names.unsorted"
- command = "sort -r > names.sorted"
- print $1 | command }' mail-list
-
- The unsorted list is written with an ordinary redirection, while
- the sorted list is written by piping through the 'sort' utility.
-
- The next example uses redirection to mail a message to the mailing
- list 'bug-system'. This might be useful when trouble is
- encountered in an 'awk' script run periodically for system
- maintenance:
-
- report = "mail bug-system"
- print("Awk script failed:", $0) | report
- print("at record number", FNR, "of", FILENAME) | report
- close(report)
-
- The 'close()' function is called here because it's a good idea to
- close the pipe as soon as all the intended output has been sent to
- it. *Note Close Files And Pipes:: for more information.
-
- This example also illustrates the use of a variable to represent a
- FILE or COMMAND--it is not necessary to always use a string
- constant. Using a variable is generally a good idea, because (if
- you mean to refer to that same file or command) 'awk' requires that
- the string value be written identically every time.
-
-'print ITEMS |& COMMAND'
- This redirection prints the items to the input of COMMAND. The
- difference between this and the single-'|' redirection is that the
- output from COMMAND can be read with 'getline'. Thus, COMMAND is a
- "coprocess", which works together with but is subsidiary to the
- 'awk' program.
-
- This feature is a 'gawk' extension, and is not available in POSIX
- 'awk'. *Note Getline/Coprocess::, for a brief discussion. *Note
- Two-way I/O::, for a more complete discussion.
-
- Redirecting output using '>', '>>', '|', or '|&' asks the system to
-open a file, pipe, or coprocess only if the particular FILE or COMMAND
-you specify has not already been written to by your program or if it has
-been closed since it was last written to.
-
- It is a common error to use '>' redirection for the first 'print' to
-a file, and then to use '>>' for subsequent output:
-
- # clear the file
- print "Don't panic" > "guide.txt"
- ...
- # append
- print "Avoid improbability generators" >> "guide.txt"
-
-This is indeed how redirections must be used from the shell. But in
-'awk', it isn't necessary. In this kind of case, a program should use
-'>' for all the 'print' statements, because the output file is only
-opened once. (It happens that if you mix '>' and '>>' output is
-produced in the expected order. However, mixing the operators for the
-same file is definitely poor style, and is confusing to readers of your
-program.)
-
- Many older 'awk' implementations limit the number of pipelines that
-an 'awk' program may have open to just one! In 'gawk', there is no such
-limit. 'gawk' allows a program to open as many pipelines as the
-underlying operating system permits.
-
- Piping into 'sh'
-
- A particularly powerful way to use redirection is to build command
-lines and pipe them into the shell, 'sh'. For example, suppose you have
-a list of files brought over from a system where all the file names are
-stored in uppercase, and you wish to rename them to have names in all
-lowercase. The following program is both simple and efficient:
-
- { printf("mv %s %s\n", $0, tolower($0)) | "sh" }
-
- END { close("sh") }
-
- The 'tolower()' function returns its argument string with all
-uppercase characters converted to lowercase (*note String Functions::).
-The program builds up a list of command lines, using the 'mv' utility to
-rename the files. It then sends the list to the shell for execution.
-
- *Note Shell Quoting:: for a function that can help in generating
-command lines to be fed to the shell.
-
-
-File: gawk.info, Node: Special FD, Next: Special Files, Prev: Redirection, Up: Printing
-
-5.7 Special Files for Standard Preopened Data Streams
-=====================================================
-
-Running programs conventionally have three input and output streams
-already available to them for reading and writing. These are known as
-the "standard input", "standard output", and "standard error output".
-These open streams (and any other open files or pipes) are often
-referred to by the technical term "file descriptors".
-
- These streams are, by default, connected to your keyboard and screen,
-but they are often redirected with the shell, via the '<', '<<', '>',
-'>>', '>&', and '|' operators. Standard error is typically used for
-writing error messages; the reason there are two separate streams,
-standard output and standard error, is so that they can be redirected
-separately.
-
- In traditional implementations of 'awk', the only way to write an
-error message to standard error in an 'awk' program is as follows:
-
- print "Serious error detected!" | "cat 1>&2"
-
-This works by opening a pipeline to a shell command that can access the
-standard error stream that it inherits from the 'awk' process. This is
-far from elegant, and it also requires a separate process. So people
-writing 'awk' programs often don't do this. Instead, they send the
-error messages to the screen, like this:
-
- print "Serious error detected!" > "/dev/tty"
-
-('/dev/tty' is a special file supplied by the operating system that is
-connected to your keyboard and screen. It represents the "terminal,"(1)
-which on modern systems is a keyboard and screen, not a serial console.)
-This generally has the same effect, but not always: although the
-standard error stream is usually the screen, it can be redirected; when
-that happens, writing to the screen is not correct. In fact, if 'awk'
-is run from a background job, it may not have a terminal at all. Then
-opening '/dev/tty' fails.
-
- 'gawk', BWK 'awk', and 'mawk' provide special file names for
-accessing the three standard streams. If the file name matches one of
-these special names when 'gawk' (or one of the others) redirects input
-or output, then it directly uses the descriptor that the file name
-stands for. These special file names work for all operating systems
-that 'gawk' has been ported to, not just those that are POSIX-compliant:
-
-'/dev/stdin'
- The standard input (file descriptor 0).
-
-'/dev/stdout'
- The standard output (file descriptor 1).
-
-'/dev/stderr'
- The standard error output (file descriptor 2).
-
- With these facilities, the proper way to write an error message then
-becomes:
-
- print "Serious error detected!" > "/dev/stderr"
-
- Note the use of quotes around the file name. Like with any other
-redirection, the value must be a string. It is a common error to omit
-the quotes, which leads to confusing results.
-
- 'gawk' does not treat these file names as special when in
-POSIX-compatibility mode. However, because BWK 'awk' supports them,
-'gawk' does support them even when invoked with the '--traditional'
-option (*note Options::).
-
- ---------- Footnotes ----------
-
- (1) The "tty" in '/dev/tty' stands for "Teletype," a serial terminal.
-
-
-File: gawk.info, Node: Special Files, Next: Close Files And Pipes, Prev: Special FD, Up: Printing
-
-5.8 Special File names in 'gawk'
-================================
-
-Besides access to standard input, standard output, and standard error,
-'gawk' provides access to any open file descriptor. Additionally, there
-are special file names reserved for TCP/IP networking.
-
-* Menu:
-
-* Other Inherited Files:: Accessing other open files with
- 'gawk'.
-* Special Network:: Special files for network communications.
-* Special Caveats:: Things to watch out for.
-
-
-File: gawk.info, Node: Other Inherited Files, Next: Special Network, Up: Special Files
-
-5.8.1 Accessing Other Open Files with 'gawk'
---------------------------------------------
-
-Besides the '/dev/stdin', '/dev/stdout', and '/dev/stderr' special file
-names mentioned earlier, 'gawk' provides syntax for accessing any other
-inherited open file:
-
-'/dev/fd/N'
- The file associated with file descriptor N. Such a file must be
- opened by the program initiating the 'awk' execution (typically the
- shell). Unless special pains are taken in the shell from which
- 'gawk' is invoked, only descriptors 0, 1, and 2 are available.
-
- The file names '/dev/stdin', '/dev/stdout', and '/dev/stderr' are
-essentially aliases for '/dev/fd/0', '/dev/fd/1', and '/dev/fd/2',
-respectively. However, those names are more self-explanatory.
-
- Note that using 'close()' on a file name of the form '"/dev/fd/N"',
-for file descriptor numbers above two, does actually close the given
-file descriptor.
-
-
-File: gawk.info, Node: Special Network, Next: Special Caveats, Prev: Other Inherited Files, Up: Special Files
-
-5.8.2 Special Files for Network Communications
-----------------------------------------------
-
-'gawk' programs can open a two-way TCP/IP connection, acting as either a
-client or a server. This is done using a special file name of the form:
-
- /NET-TYPE/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT
-
- The NET-TYPE is one of 'inet', 'inet4', or 'inet6'. The PROTOCOL is
-one of 'tcp' or 'udp', and the other fields represent the other
-essential pieces of information for making a networking connection.
-These file names are used with the '|&' operator for communicating with
-a coprocess (*note Two-way I/O::). This is an advanced feature,
-mentioned here only for completeness. Full discussion is delayed until
-*note TCP/IP Networking::.
-
-
-File: gawk.info, Node: Special Caveats, Prev: Special Network, Up: Special Files
-
-5.8.3 Special File name Caveats
--------------------------------
-
-Here are some things to bear in mind when using the special file names
-that 'gawk' provides:
-
- * Recognition of the file names for the three standard preopened
- files is disabled only in POSIX mode.
-
- * Recognition of the other special file names is disabled if 'gawk'
- is in compatibility mode (either '--traditional' or '--posix';
- *note Options::).
-
- * 'gawk' _always_ interprets these special file names. For example,
- using '/dev/fd/4' for output actually writes on file descriptor 4,
- and not on a new file descriptor that is 'dup()'ed from file
- descriptor 4. Most of the time this does not matter; however, it
- is important to _not_ close any of the files related to file
- descriptors 0, 1, and 2. Doing so results in unpredictable
- behavior.
-
-
-File: gawk.info, Node: Close Files And Pipes, Next: Nonfatal, Prev: Special Files, Up: Printing
-
-5.9 Closing Input and Output Redirections
-=========================================
-
-If the same file name or the same shell command is used with 'getline'
-more than once during the execution of an 'awk' program (*note
-Getline::), the file is opened (or the command is executed) the first
-time only. At that time, the first record of input is read from that
-file or command. The next time the same file or command is used with
-'getline', another record is read from it, and so on.
-
- Similarly, when a file or pipe is opened for output, 'awk' remembers
-the file name or command associated with it, and subsequent writes to
-the same file or command are appended to the previous writes. The file
-or pipe stays open until 'awk' exits.
-
- This implies that special steps are necessary in order to read the
-same file again from the beginning, or to rerun a shell command (rather
-than reading more output from the same command). The 'close()' function
-makes these things possible:
-
- close(FILENAME)
-
-or:
-
- close(COMMAND)
-
- The argument FILENAME or COMMAND can be any expression. Its value
-must _exactly_ match the string that was used to open the file or start
-the command (spaces and other "irrelevant" characters included). For
-example, if you open a pipe with this:
-
- "sort -r names" | getline foo
-
-then you must close it with this:
-
- close("sort -r names")
-
- Once this function call is executed, the next 'getline' from that
-file or command, or the next 'print' or 'printf' to that file or
-command, reopens the file or reruns the command. Because the expression
-that you use to close a file or pipeline must exactly match the
-expression used to open the file or run the command, it is good practice
-to use a variable to store the file name or command. The previous
-example becomes the following:
-
- sortcom = "sort -r names"
- sortcom | getline foo
- ...
- close(sortcom)
-
-This helps avoid hard-to-find typographical errors in your 'awk'
-programs. Here are some of the reasons for closing an output file:
-
- * To write a file and read it back later on in the same 'awk'
- program. Close the file after writing it, then begin reading it
- with 'getline'.
-
- * To write numerous files, successively, in the same 'awk' program.
- If the files aren't closed, eventually 'awk' may exceed a system
- limit on the number of open files in one process. It is best to
- close each one when the program has finished writing it.
-
- * To make a command finish. When output is redirected through a
- pipe, the command reading the pipe normally continues to try to
- read input as long as the pipe is open. Often this means the
- command cannot really do its work until the pipe is closed. For
- example, if output is redirected to the 'mail' program, the message
- is not actually sent until the pipe is closed.
-
- * To run the same program a second time, with the same arguments.
- This is not the same thing as giving more input to the first run!
-
- For example, suppose a program pipes output to the 'mail' program.
- If it outputs several lines redirected to this pipe without closing
- it, they make a single message of several lines. By contrast, if
- the program closes the pipe after each line of output, then each
- line makes a separate message.
-
- If you use more files than the system allows you to have open, 'gawk'
-attempts to multiplex the available open files among your data files.
-'gawk''s ability to do this depends upon the facilities of your
-operating system, so it may not always work. It is therefore both good
-practice and good portability advice to always use 'close()' on your
-files when you are done with them. In fact, if you are using a lot of
-pipes, it is essential that you close commands when done. For example,
-consider something like this:
-
- {
- ...
- command = ("grep " $1 " /some/file | my_prog -q " $3)
- while ((command | getline) > 0) {
- PROCESS OUTPUT OF command
- }
- # need close(command) here
- }
-
- This example creates a new pipeline based on data in _each_ record.
-Without the call to 'close()' indicated in the comment, 'awk' creates
-child processes to run the commands, until it eventually runs out of
-file descriptors for more pipelines.
-
- Even though each command has finished (as indicated by the
-end-of-file return status from 'getline'), the child process is not
-terminated;(1) more importantly, the file descriptor for the pipe is not
-closed and released until 'close()' is called or 'awk' exits.
-
- 'close()' silently does nothing if given an argument that does not
-represent a file, pipe, or coprocess that was opened with a redirection.
-In such a case, it returns a negative value, indicating an error. In
-addition, 'gawk' sets 'ERRNO' to a string indicating the error.
-
- Note also that 'close(FILENAME)' has no "magic" effects on the
-implicit loop that reads through the files named on the command line.
-It is, more likely, a close of a file that was never opened with a
-redirection, so 'awk' silently does nothing, except return a negative
-value.
-
- When using the '|&' operator to communicate with a coprocess, it is
-occasionally useful to be able to close one end of the two-way pipe
-without closing the other. This is done by supplying a second argument
-to 'close()'. As in any other call to 'close()', the first argument is
-the name of the command or special file used to start the coprocess.
-The second argument should be a string, with either of the values '"to"'
-or '"from"'. Case does not matter. As this is an advanced feature,
-discussion is delayed until *note Two-way I/O::, which describes it in
-more detail and gives an example.
-
- Using 'close()''s Return Value
-
- In many older versions of Unix 'awk', the 'close()' function is
-actually a statement. (d.c.) It is a syntax error to try and use the
-return value from 'close()':
-
- command = "..."
- command | getline info
- retval = close(command) # syntax error in many Unix awks
-
- 'gawk' treats 'close()' as a function. The return value is -1 if the
-argument names something that was never opened with a redirection, or if
-there is a system problem closing the file or process. In these cases,
-'gawk' sets the predefined variable 'ERRNO' to a string describing the
-problem.
-
- In 'gawk', starting with version 4.2, when closing a pipe or
-coprocess (input or output), the return value is the exit status of the
-command, as described in *note Table 5.1:
-table-close-pipe-return-values.(2) Otherwise, it is the return value
-from the system's 'close()' or 'fclose()' C functions when closing input
-or output files, respectively. This value is zero if the close
-succeeds, or -1 if it fails.
-
-Situation Return value from 'close()'
---------------------------------------------------------------------------
-Normal exit of command Command's exit status
-Death by signal of command 256 + number of murderous signal
-Death by signal of command 512 + number of murderous signal
-with core dump
-Some kind of error -1
-
-Table 5.1: Return values from 'close()' of a pipe
-
- The POSIX standard is very vague; it says that 'close()' returns zero
-on success and a nonzero value otherwise. In general, different
-implementations vary in what they report when closing pipes; thus, the
-return value cannot be used portably. (d.c.) In POSIX mode (*note
-Options::), 'gawk' just returns zero when closing a pipe.
-
- ---------- Footnotes ----------
-
- (1) The technical terminology is rather morbid. The finished child
-is called a "zombie," and cleaning up after it is referred to as
-"reaping."
-
- (2) Prior to version 4.2, the return value from closing a pipe or
-co-process was the full 16-bit exit value as defined by the 'wait()'
-system call.
-
-
-File: gawk.info, Node: Nonfatal, Next: Output Summary, Prev: Close Files And Pipes, Up: Printing
-
-5.10 Enabling Nonfatal Output
-=============================
-
-This minor node describes a 'gawk'-specific feature.
-
- In standard 'awk', output with 'print' or 'printf' to a nonexistent
-file, or some other I/O error (such as filling up the disk) is a fatal
-error.
-
- $ gawk 'BEGIN { print "hi" > "/no/such/file" }'
- error-> gawk: cmd. line:1: fatal: can't redirect to `/no/such/file' (No such file or directory)
-
- 'gawk' makes it possible to detect that an error has occurred,
-allowing you to possibly recover from the error, or at least print an
-error message of your choosing before exiting. You can do this in one
-of two ways:
-
- * For all output files, by assigning any value to
- 'PROCINFO["NONFATAL"]'.
-
- * On a per-file basis, by assigning any value to 'PROCINFO[FILENAME,
- "NONFATAL"]'. Here, FILENAME is the name of the file to which you
- wish output to be nonfatal.
-
- Once you have enabled nonfatal output, you must check 'ERRNO' after
-every relevant 'print' or 'printf' statement to see if something went
-wrong. It is also a good idea to initialize 'ERRNO' to zero before
-attempting the output. For example:
-
- $ gawk '
- > BEGIN {
- > PROCINFO["NONFATAL"] = 1
- > ERRNO = 0
- > print "hi" > "/no/such/file"
- > if (ERRNO) {
- > print("Output failed:", ERRNO) > "/dev/stderr"
- > exit 1
- > }
- > }'
- error-> Output failed: No such file or directory
-
- Here, 'gawk' did not produce a fatal error; instead it let the 'awk'
-program code detect the problem and handle it.
-
- This mechanism works also for standard output and standard error.
-For standard output, you may use 'PROCINFO["-", "NONFATAL"]' or
-'PROCINFO["/dev/stdout", "NONFATAL"]'. For standard error, use
-'PROCINFO["/dev/stderr", "NONFATAL"]'.
-
- When attempting to open a TCP/IP socket (*note TCP/IP Networking::),
-'gawk' tries multiple times. The 'GAWK_SOCK_RETRIES' environment
-variable (*note Other Environment Variables::) allows you to override
-'gawk''s builtin default number of attempts. However, once nonfatal I/O
-is enabled for a given socket, 'gawk' only retries once, relying on
-'awk'-level code to notice that there was a problem.
-
-
-File: gawk.info, Node: Output Summary, Next: Output Exercises, Prev: Nonfatal, Up: Printing
-
-5.11 Summary
-============
-
- * The 'print' statement prints comma-separated expressions. Each
- expression is separated by the value of 'OFS' and terminated by the
- value of 'ORS'. 'OFMT' provides the conversion format for numeric
- values for the 'print' statement.
-
- * The 'printf' statement provides finer-grained control over output,
- with format-control letters for different data types and various
- flags that modify the behavior of the format-control letters.
-
- * Output from both 'print' and 'printf' may be redirected to files,
- pipes, and coprocesses.
-
- * 'gawk' provides special file names for access to standard input,
- output, and error, and for network communications.
-
- * Use 'close()' to close open file, pipe, and coprocess redirections.
- For coprocesses, it is possible to close only one direction of the
- communications.
-
- * Normally errors with 'print' or 'printf' are fatal. 'gawk' lets
- you make output errors be nonfatal either for all files or on a
- per-file basis. You must then check for errors after every
- relevant output statement.
-
-
-File: gawk.info, Node: Output Exercises, Prev: Output Summary, Up: Printing
-
-5.12 Exercises
-==============
-
- 1. Rewrite the program:
-
- awk 'BEGIN { print "Month Crates"
- print "----- ------" }
- { print $1, " ", $2 }' inventory-shipped
-
- from *note Output Separators::, by using a new value of 'OFS'.
-
- 2. Use the 'printf' statement to line up the headings and table data
- for the 'inventory-shipped' example that was covered in *note
- Print::.
-
- 3. What happens if you forget the double quotes when redirecting
- output, as follows:
-
- BEGIN { print "Serious error detected!" > /dev/stderr }
-
-
-File: gawk.info, Node: Expressions, Next: Patterns and Actions, Prev: Printing, Up: Top
-
-6 Expressions
-*************
-
-Expressions are the basic building blocks of 'awk' patterns and actions.
-An expression evaluates to a value that you can print, test, or pass to
-a function. Additionally, an expression can assign a new value to a
-variable or a field by using an assignment operator.
-
- An expression can serve as a pattern or action statement on its own.
-Most other kinds of statements contain one or more expressions that
-specify the data on which to operate. As in other languages,
-expressions in 'awk' can include variables, array references, constants,
-and function calls, as well as combinations of these with various
-operators.
-
-* Menu:
-
-* Values:: Constants, Variables, and Regular Expressions.
-* All Operators:: 'gawk''s operators.
-* Truth Values and Conditions:: Testing for true and false.
-* Function Calls:: A function call is an expression.
-* Precedence:: How various operators nest.
-* Locales:: How the locale affects things.
-* Expressions Summary:: Expressions summary.
-
-
-File: gawk.info, Node: Values, Next: All Operators, Up: Expressions
-
-6.1 Constants, Variables, and Conversions
-=========================================
-
-Expressions are built up from values and the operations performed upon
-them. This minor node describes the elementary objects that provide the
-values used in expressions.
-
-* Menu:
-
-* Constants:: String, numeric and regexp constants.
-* Using Constant Regexps:: When and how to use a regexp constant.
-* Variables:: Variables give names to values for later use.
-* Conversion:: The conversion of strings to numbers and vice
- versa.
-
-
-File: gawk.info, Node: Constants, Next: Using Constant Regexps, Up: Values
-
-6.1.1 Constant Expressions
---------------------------
-
-The simplest type of expression is the "constant", which always has the
-same value. There are three types of constants: numeric, string, and
-regular expression.
-
- Each is used in the appropriate context when you need a data value
-that isn't going to change. Numeric constants can have different forms,
-but are internally stored in an identical manner.
-
-* Menu:
-
-* Scalar Constants:: Numeric and string constants.
-* Nondecimal-numbers:: What are octal and hex numbers.
-* Regexp Constants:: Regular Expression constants.
-
-
-File: gawk.info, Node: Scalar Constants, Next: Nondecimal-numbers, Up: Constants
-
-6.1.1.1 Numeric and String Constants
-....................................
-
-A "numeric constant" stands for a number. This number can be an
-integer, a decimal fraction, or a number in scientific (exponential)
-notation.(1) Here are some examples of numeric constants that all have
-the same value:
-
- 105
- 1.05e+2
- 1050e-1
-
- A "string constant" consists of a sequence of characters enclosed in
-double quotation marks. For example:
-
- "parrot"
-
-represents the string whose contents are 'parrot'. Strings in 'gawk'
-can be of any length, and they can contain any of the possible eight-bit
-ASCII characters, including ASCII NUL (character code zero). Other
-'awk' implementations may have difficulty with some character codes.
-
- ---------- Footnotes ----------
-
- (1) The internal representation of all numbers, including integers,
-uses double-precision floating-point numbers. On most modern systems,
-these are in IEEE 754 standard format. *Note Arbitrary Precision
-Arithmetic::, for much more information.
-
-
-File: gawk.info, Node: Nondecimal-numbers, Next: Regexp Constants, Prev: Scalar Constants, Up: Constants
-
-6.1.1.2 Octal and Hexadecimal Numbers
-.....................................
-
-In 'awk', all numbers are in decimal (i.e., base 10). Many other
-programming languages allow you to specify numbers in other bases, often
-octal (base 8) and hexadecimal (base 16). In octal, the numbers go 0,
-1, 2, 3, 4, 5, 6, 7, 10, 11, 12, and so on. Just as '11' in decimal is
-1 times 10 plus 1, so '11' in octal is 1 times 8 plus 1. This equals 9
-in decimal. In hexadecimal, there are 16 digits. Because the everyday
-decimal number system only has ten digits ('0'-'9'), the letters 'a'
-through 'f' are used to represent the rest. (Case in the letters is
-usually irrelevant; hexadecimal 'a' and 'A' have the same value.) Thus,
-'11' in hexadecimal is 1 times 16 plus 1, which equals 17 in decimal.
-
- Just by looking at plain '11', you can't tell what base it's in. So,
-in C, C++, and other languages derived from C, there is a special
-notation to signify the base. Octal numbers start with a leading '0',
-and hexadecimal numbers start with a leading '0x' or '0X':
-
-'11'
- Decimal value 11
-
-'011'
- Octal 11, decimal value 9
-
-'0x11'
- Hexadecimal 11, decimal value 17
-
- This example shows the difference:
-
- $ gawk 'BEGIN { printf "%d, %d, %d\n", 011, 11, 0x11 }'
- -| 9, 11, 17
-
- Being able to use octal and hexadecimal constants in your programs is
-most useful when working with data that cannot be represented
-conveniently as characters or as regular numbers, such as binary data of
-various sorts.
-
- 'gawk' allows the use of octal and hexadecimal constants in your
-program text. However, such numbers in the input data are not treated
-differently; doing so by default would break old programs. (If you
-really need to do this, use the '--non-decimal-data' command-line
-option; *note Nondecimal Data::.) If you have octal or hexadecimal
-data, you can use the 'strtonum()' function (*note String Functions::)
-to convert the data into a number. Most of the time, you will want to
-use octal or hexadecimal constants when working with the built-in
-bit-manipulation functions; see *note Bitwise Functions:: for more
-information.
-
- Unlike in some early C implementations, '8' and '9' are not valid in
-octal constants. For example, 'gawk' treats '018' as decimal 18:
-
- $ gawk 'BEGIN { print "021 is", 021 ; print 018 }'
- -| 021 is 17
- -| 18
-
- Octal and hexadecimal source code constants are a 'gawk' extension.
-If 'gawk' is in compatibility mode (*note Options::), they are not
-available.
-
- A Constant's Base Does Not Affect Its Value
-
- Once a numeric constant has been converted internally into a number,
-'gawk' no longer remembers what the original form of the constant was;
-the internal value is always used. This has particular consequences for
-conversion of numbers to strings:
-
- $ gawk 'BEGIN { printf "0x11 is <%s>\n", 0x11 }'
- -| 0x11 is <17>
-
-
-File: gawk.info, Node: Regexp Constants, Prev: Nondecimal-numbers, Up: Constants
-
-6.1.1.3 Regular Expression Constants
-....................................
-
-A "regexp constant" is a regular expression description enclosed in
-slashes, such as '/^beginning and end$/'. Most regexps used in 'awk'
-programs are constant, but the '~' and '!~' matching operators can also
-match computed or dynamic regexps (which are typically just ordinary
-strings or variables that contain a regexp, but could be more complex
-expressions).
-
-
-File: gawk.info, Node: Using Constant Regexps, Next: Variables, Prev: Constants, Up: Values
-
-6.1.2 Using Regular Expression Constants
-----------------------------------------
-
-When used on the righthand side of the '~' or '!~' operators, a regexp
-constant merely stands for the regexp that is to be matched. However,
-regexp constants (such as '/foo/') may be used like simple expressions.
-When a regexp constant appears by itself, it has the same meaning as if
-it appeared in a pattern (i.e., '($0 ~ /foo/)'). (d.c.) *Note
-Expression Patterns::. This means that the following two code segments:
-
- if ($0 ~ /barfly/ || $0 ~ /camelot/)
- print "found"
-
-and:
-
- if (/barfly/ || /camelot/)
- print "found"
-
-are exactly equivalent. One rather bizarre consequence of this rule is
-that the following Boolean expression is valid, but does not do what its
-author probably intended:
-
- # Note that /foo/ is on the left of the ~
- if (/foo/ ~ $1) print "found foo"
-
-This code is "obviously" testing '$1' for a match against the regexp
-'/foo/'. But in fact, the expression '/foo/ ~ $1' really means '($0 ~
-/foo/) ~ $1'. In other words, first match the input record against the
-regexp '/foo/'. The result is either zero or one, depending upon the
-success or failure of the match. That result is then matched against
-the first field in the record. Because it is unlikely that you would
-ever really want to make this kind of test, 'gawk' issues a warning when
-it sees this construct in a program. Another consequence of this rule
-is that the assignment statement:
-
- matches = /foo/
-
-assigns either zero or one to the variable 'matches', depending upon the
-contents of the current input record.
-
- Constant regular expressions are also used as the first argument for
-the 'gensub()', 'sub()', and 'gsub()' functions, as the second argument
-of the 'match()' function, and as the third argument of the 'split()'
-and 'patsplit()' functions (*note String Functions::). Modern
-implementations of 'awk', including 'gawk', allow the third argument of
-'split()' to be a regexp constant, but some older implementations do
-not. (d.c.) Because some built-in functions accept regexp constants as
-arguments, confusion can arise when attempting to use regexp constants
-as arguments to user-defined functions (*note User-defined::). For
-example:
-
- function mysub(pat, repl, str, global)
- {
- if (global)
- gsub(pat, repl, str)
- else
- sub(pat, repl, str)
- return str
- }
-
- {
- ...
- text = "hi! hi yourself!"
- mysub(/hi/, "howdy", text, 1)
- ...
- }
-
- In this example, the programmer wants to pass a regexp constant to
-the user-defined function 'mysub()', which in turn passes it on to
-either 'sub()' or 'gsub()'. However, what really happens is that the
-'pat' parameter is assigned a value of either one or zero, depending
-upon whether or not '$0' matches '/hi/'. 'gawk' issues a warning when
-it sees a regexp constant used as a parameter to a user-defined
-function, because passing a truth value in this way is probably not what
-was intended.
-
-
-File: gawk.info, Node: Variables, Next: Conversion, Prev: Using Constant Regexps, Up: Values
-
-6.1.3 Variables
----------------
-
-"Variables" are ways of storing values at one point in your program for
-use later in another part of your program. They can be manipulated
-entirely within the program text, and they can also be assigned values
-on the 'awk' command line.
-
-* Menu:
-
-* Using Variables:: Using variables in your programs.
-* Assignment Options:: Setting variables on the command line and a
- summary of command-line syntax. This is an
- advanced method of input.
-
-
-File: gawk.info, Node: Using Variables, Next: Assignment Options, Up: Variables
-
-6.1.3.1 Using Variables in a Program
-....................................
-
-Variables let you give names to values and refer to them later.
-Variables have already been used in many of the examples. The name of a
-variable must be a sequence of letters, digits, or underscores, and it
-may not begin with a digit. Here, a "letter" is any one of the 52
-upper- and lowercase English letters. Other characters that may be
-defined as letters in non-English locales are not valid in variable
-names. Case is significant in variable names; 'a' and 'A' are distinct
-variables.
-
- A variable name is a valid expression by itself; it represents the
-variable's current value. Variables are given new values with
-"assignment operators", "increment operators", and "decrement operators"
-(*note Assignment Ops::). In addition, the 'sub()' and 'gsub()'
-functions can change a variable's value, and the 'match()', 'split()',
-and 'patsplit()' functions can change the contents of their array
-parameters (*note String Functions::).
-
- A few variables have special built-in meanings, such as 'FS' (the
-field separator) and 'NF' (the number of fields in the current input
-record). *Note Built-in Variables:: for a list of the predefined
-variables. These predefined variables can be used and assigned just
-like all other variables, but their values are also used or changed
-automatically by 'awk'. All predefined variables' names are entirely
-uppercase.
-
- Variables in 'awk' can be assigned either numeric or string values.
-The kind of value a variable holds can change over the life of a
-program. By default, variables are initialized to the empty string,
-which is zero if converted to a number. There is no need to explicitly
-initialize a variable in 'awk', which is what you would do in C and in
-most other traditional languages.
-
-
-File: gawk.info, Node: Assignment Options, Prev: Using Variables, Up: Variables
-
-6.1.3.2 Assigning Variables on the Command Line
-...............................................
-
-Any 'awk' variable can be set by including a "variable assignment" among
-the arguments on the command line when 'awk' is invoked (*note Other
-Arguments::). Such an assignment has the following form:
-
- VARIABLE=TEXT
-
-With it, a variable is set either at the beginning of the 'awk' run or
-in between input files. When the assignment is preceded with the '-v'
-option, as in the following:
-
- -v VARIABLE=TEXT
-
-the variable is set at the very beginning, even before the 'BEGIN' rules
-execute. The '-v' option and its assignment must precede all the file
-name arguments, as well as the program text. (*Note Options:: for more
-information about the '-v' option.) Otherwise, the variable assignment
-is performed at a time determined by its position among the input file
-arguments--after the processing of the preceding input file argument.
-For example:
-
- awk '{ print $n }' n=4 inventory-shipped n=2 mail-list
-
-prints the value of field number 'n' for all input records. Before the
-first file is read, the command line sets the variable 'n' equal to
-four. This causes the fourth field to be printed in lines from
-'inventory-shipped'. After the first file has finished, but before the
-second file is started, 'n' is set to two, so that the second field is
-printed in lines from 'mail-list':
-
- $ awk '{ print $n }' n=4 inventory-shipped n=2 mail-list
- -| 15
- -| 24
- ...
- -| 555-5553
- -| 555-3412
- ...
-
- Command-line arguments are made available for explicit examination by
-the 'awk' program in the 'ARGV' array (*note ARGC and ARGV::). 'awk'
-processes the values of command-line assignments for escape sequences
-(*note Escape Sequences::). (d.c.)
-
-
-File: gawk.info, Node: Conversion, Prev: Variables, Up: Values
-
-6.1.4 Conversion of Strings and Numbers
----------------------------------------
-
-Number-to-string and string-to-number conversion are generally
-straightforward. There can be subtleties to be aware of; this minor
-node discusses this important facet of 'awk'.
-
-* Menu:
-
-* Strings And Numbers:: How 'awk' Converts Between Strings And
- Numbers.
-* Locale influences conversions:: How the locale may affect conversions.
-
-
-File: gawk.info, Node: Strings And Numbers, Next: Locale influences conversions, Up: Conversion
-
-6.1.4.1 How 'awk' Converts Between Strings and Numbers
-......................................................
-
-Strings are converted to numbers and numbers are converted to strings,
-if the context of the 'awk' program demands it. For example, if the
-value of either 'foo' or 'bar' in the expression 'foo + bar' happens to
-be a string, it is converted to a number before the addition is
-performed. If numeric values appear in string concatenation, they are
-converted to strings. Consider the following:
-
- two = 2; three = 3
- print (two three) + 4
-
-This prints the (numeric) value 27. The numeric values of the variables
-'two' and 'three' are converted to strings and concatenated together.
-The resulting string is converted back to the number 23, to which 4 is
-then added.
-
- If, for some reason, you need to force a number to be converted to a
-string, concatenate that number with the empty string, '""'. To force a
-string to be converted to a number, add zero to that string. A string
-is converted to a number by interpreting any numeric prefix of the
-string as numerals: '"2.5"' converts to 2.5, '"1e3"' converts to 1,000,
-and '"25fix"' has a numeric value of 25. Strings that can't be
-interpreted as valid numbers convert to zero.
-
- The exact manner in which numbers are converted into strings is
-controlled by the 'awk' predefined variable 'CONVFMT' (*note Built-in
-Variables::). Numbers are converted using the 'sprintf()' function with
-'CONVFMT' as the format specifier (*note String Functions::).
-
- 'CONVFMT''s default value is '"%.6g"', which creates a value with at
-most six significant digits. For some applications, you might want to
-change it to specify more precision. On most modern machines, 17 digits
-is usually enough to capture a floating-point number's value exactly.(1)
-
- Strange results can occur if you set 'CONVFMT' to a string that
-doesn't tell 'sprintf()' how to format floating-point numbers in a
-useful way. For example, if you forget the '%' in the format, 'awk'
-converts all numbers to the same constant string.
-
- As a special case, if a number is an integer, then the result of
-converting it to a string is _always_ an integer, no matter what the
-value of 'CONVFMT' may be. Given the following code fragment:
-
- CONVFMT = "%2.2f"
- a = 12
- b = a ""
-
-'b' has the value '"12"', not '"12.00"'. (d.c.)
-
- Pre-POSIX 'awk' Used 'OFMT' for String Conversion
-
- Prior to the POSIX standard, 'awk' used the value of 'OFMT' for
-converting numbers to strings. 'OFMT' specifies the output format to
-use when printing numbers with 'print'. 'CONVFMT' was introduced in
-order to separate the semantics of conversion from the semantics of
-printing. Both 'CONVFMT' and 'OFMT' have the same default value:
-'"%.6g"'. In the vast majority of cases, old 'awk' programs do not
-change their behavior. *Note Print:: for more information on the
-'print' statement.
-
- ---------- Footnotes ----------
-
- (1) Pathological cases can require up to 752 digits (!), but we doubt
-that you need to worry about this.
-
-
-File: gawk.info, Node: Locale influences conversions, Prev: Strings And Numbers, Up: Conversion
-
-6.1.4.2 Locales Can Influence Conversion
-........................................
-
-Where you are can matter when it comes to converting between numbers and
-strings. The local character set and language--the "locale"--can affect
-numeric formats. In particular, for 'awk' programs, it affects the
-decimal point character and the thousands-separator character. The
-'"C"' locale, and most English-language locales, use the period
-character ('.') as the decimal point and don't have a thousands
-separator. However, many (if not most) European and non-English locales
-use the comma (',') as the decimal point character. European locales
-often use either a space or a period as the thousands separator, if they
-have one.
-
- The POSIX standard says that 'awk' always uses the period as the
-decimal point when reading the 'awk' program source code, and for
-command-line variable assignments (*note Other Arguments::). However,
-when interpreting input data, for 'print' and 'printf' output, and for
-number-to-string conversion, the local decimal point character is used.
-(d.c.) In all cases, numbers in source code and in input data cannot
-have a thousands separator. Here are some examples indicating the
-difference in behavior, on a GNU/Linux system:
-
- $ export POSIXLY_CORRECT=1 Force POSIX behavior
- $ gawk 'BEGIN { printf "%g\n", 3.1415927 }'
- -| 3.14159
- $ LC_ALL=en_DK.utf-8 gawk 'BEGIN { printf "%g\n", 3.1415927 }'
- -| 3,14159
- $ echo 4,321 | gawk '{ print $1 + 1 }'
- -| 5
- $ echo 4,321 | LC_ALL=en_DK.utf-8 gawk '{ print $1 + 1 }'
- -| 5,321
-
-The 'en_DK.utf-8' locale is for English in Denmark, where the comma acts
-as the decimal point separator. In the normal '"C"' locale, 'gawk'
-treats '4,321' as 4, while in the Danish locale, it's treated as the
-full number including the fractional part, 4.321.
-
- Some earlier versions of 'gawk' fully complied with this aspect of
-the standard. However, many users in non-English locales complained
-about this behavior, because their data used a period as the decimal
-point, so the default behavior was restored to use a period as the
-decimal point character. You can use the '--use-lc-numeric' option
-(*note Options::) to force 'gawk' to use the locale's decimal point
-character. ('gawk' also uses the locale's decimal point character when
-in POSIX mode, either via '--posix' or the 'POSIXLY_CORRECT' environment
-variable, as shown previously.)
-
- *note Table 6.1: table-locale-affects. describes the cases in which
-the locale's decimal point character is used and when a period is used.
-Some of these features have not been described yet.
-
-Feature Default '--posix' or
- '--use-lc-numeric'
-------------------------------------------------------------
-'%'g' Use locale Use locale
-'%g' Use period Use locale
-Input Use period Use locale
-'strtonum()'Use period Use locale
-
-Table 6.1: Locale decimal point versus a period
-
- Finally, modern-day formal standards and the IEEE standard
-floating-point representation can have an unusual but important effect
-on the way 'gawk' converts some special string values to numbers. The
-details are presented in *note POSIX Floating Point Problems::.
-
-
-File: gawk.info, Node: All Operators, Next: Truth Values and Conditions, Prev: Values, Up: Expressions
-
-6.2 Operators: Doing Something with Values
-==========================================
-
-This minor node introduces the "operators" that make use of the values
-provided by constants and variables.
-
-* Menu:
-
-* Arithmetic Ops:: Arithmetic operations ('+', '-',
- etc.)
-* Concatenation:: Concatenating strings.
-* Assignment Ops:: Changing the value of a variable or a field.
-* Increment Ops:: Incrementing the numeric value of a variable.
-
-
-File: gawk.info, Node: Arithmetic Ops, Next: Concatenation, Up: All Operators
-
-6.2.1 Arithmetic Operators
---------------------------
-
-The 'awk' language uses the common arithmetic operators when evaluating
-expressions. All of these arithmetic operators follow normal precedence
-rules and work as you would expect them to.
-
- The following example uses a file named 'grades', which contains a
-list of student names as well as three test scores per student (it's a
-small class):
-
- Pat 100 97 58
- Sandy 84 72 93
- Chris 72 92 89
-
-This program takes the file 'grades' and prints the average of the
-scores:
-
- $ awk '{ sum = $2 + $3 + $4 ; avg = sum / 3
- > print $1, avg }' grades
- -| Pat 85
- -| Sandy 83
- -| Chris 84.3333
-
- The following list provides the arithmetic operators in 'awk', in
-order from the highest precedence to the lowest:
-
-'X ^ Y'
-'X ** Y'
- Exponentiation; X raised to the Y power. '2 ^ 3' has the value
- eight; the character sequence '**' is equivalent to '^'. (c.e.)
-
-'- X'
- Negation.
-
-'+ X'
- Unary plus; the expression is converted to a number.
-
-'X * Y'
- Multiplication.
-
-'X / Y'
- Division; because all numbers in 'awk' are floating-point numbers,
- the result is _not_ rounded to an integer--'3 / 4' has the value
- 0.75. (It is a common mistake, especially for C programmers, to
- forget that _all_ numbers in 'awk' are floating point, and that
- division of integer-looking constants produces a real number, not
- an integer.)
-
-'X % Y'
- Remainder; further discussion is provided in the text, just after
- this list.
-
-'X + Y'
- Addition.
-
-'X - Y'
- Subtraction.
-
- Unary plus and minus have the same precedence, the multiplication
-operators all have the same precedence, and addition and subtraction
-have the same precedence.
-
- When computing the remainder of 'X % Y', the quotient is rounded
-toward zero to an integer and multiplied by Y. This result is
-subtracted from X; this operation is sometimes known as "trunc-mod."
-The following relation always holds:
-
- b * int(a / b) + (a % b) == a
-
- One possibly undesirable effect of this definition of remainder is
-that 'X % Y' is negative if X is negative. Thus:
-
- -17 % 8 = -1
-
- In other 'awk' implementations, the signedness of the remainder may
-be machine-dependent.
-
- NOTE: The POSIX standard only specifies the use of '^' for
- exponentiation. For maximum portability, do not use the '**'
- operator.
-
-
-File: gawk.info, Node: Concatenation, Next: Assignment Ops, Prev: Arithmetic Ops, Up: All Operators
-
-6.2.2 String Concatenation
---------------------------
-
- It seemed like a good idea at the time.
- -- _Brian Kernighan_
-
- There is only one string operation: concatenation. It does not have
-a specific operator to represent it. Instead, concatenation is
-performed by writing expressions next to one another, with no operator.
-For example:
-
- $ awk '{ print "Field number one: " $1 }' mail-list
- -| Field number one: Amelia
- -| Field number one: Anthony
- ...
-
- Without the space in the string constant after the ':', the line runs
-together. For example:
-
- $ awk '{ print "Field number one:" $1 }' mail-list
- -| Field number one:Amelia
- -| Field number one:Anthony
- ...
-
- Because string concatenation does not have an explicit operator, it
-is often necessary to ensure that it happens at the right time by using
-parentheses to enclose the items to concatenate. For example, you might
-expect that the following code fragment concatenates 'file' and 'name':
-
- file = "file"
- name = "name"
- print "something meaningful" > file name
-
-This produces a syntax error with some versions of Unix 'awk'.(1) It is
-necessary to use the following:
-
- print "something meaningful" > (file name)
-
- Parentheses should be used around concatenation in all but the most
-common contexts, such as on the righthand side of '='. Be careful about
-the kinds of expressions used in string concatenation. In particular,
-the order of evaluation of expressions used for concatenation is
-undefined in the 'awk' language. Consider this example:
-
- BEGIN {
- a = "don't"
- print (a " " (a = "panic"))
- }
-
-It is not defined whether the second assignment to 'a' happens before or
-after the value of 'a' is retrieved for producing the concatenated
-value. The result could be either 'don't panic', or 'panic panic'.
-
- The precedence of concatenation, when mixed with other operators, is
-often counter-intuitive. Consider this example:
-
- $ awk 'BEGIN { print -12 " " -24 }'
- -| -12-24
-
- This "obviously" is concatenating -12, a space, and -24. But where
-did the space disappear to? The answer lies in the combination of
-operator precedences and 'awk''s automatic conversion rules. To get the
-desired result, write the program this way:
-
- $ awk 'BEGIN { print -12 " " (-24) }'
- -| -12 -24
-
- This forces 'awk' to treat the '-' on the '-24' as unary. Otherwise,
-it's parsed as follows:
-
- -12 ('" "' - 24)
- => -12 (0 - 24)
- => -12 (-24)
- => -12-24
-
- As mentioned earlier, when mixing concatenation with other operators,
-_parenthesize_. Otherwise, you're never quite sure what you'll get.
-
- ---------- Footnotes ----------
-
- (1) It happens that BWK 'awk', 'gawk', and 'mawk' all "get it right,"
-but you should not rely on this.
-
-
-File: gawk.info, Node: Assignment Ops, Next: Increment Ops, Prev: Concatenation, Up: All Operators
-
-6.2.3 Assignment Expressions
-----------------------------
-
-An "assignment" is an expression that stores a (usually different) value
-into a variable. For example, let's assign the value one to the
-variable 'z':
-
- z = 1
-
- After this expression is executed, the variable 'z' has the value
-one. Whatever old value 'z' had before the assignment is forgotten.
-
- Assignments can also store string values. For example, the following
-stores the value '"this food is good"' in the variable 'message':
-
- thing = "food"
- predicate = "good"
- message = "this " thing " is " predicate
-
-This also illustrates string concatenation. The '=' sign is called an
-"assignment operator". It is the simplest assignment operator because
-the value of the righthand operand is stored unchanged. Most operators
-(addition, concatenation, and so on) have no effect except to compute a
-value. If the value isn't used, there's no reason to use the operator.
-An assignment operator is different; it does produce a value, but even
-if you ignore it, the assignment still makes itself felt through the
-alteration of the variable. We call this a "side effect".
-
- The lefthand operand of an assignment need not be a variable (*note
-Variables::); it can also be a field (*note Changing Fields::) or an
-array element (*note Arrays::). These are all called "lvalues", which
-means they can appear on the lefthand side of an assignment operator.
-The righthand operand may be any expression; it produces the new value
-that the assignment stores in the specified variable, field, or array
-element. (Such values are called "rvalues".)
-
- It is important to note that variables do _not_ have permanent types.
-A variable's type is simply the type of whatever value was last assigned
-to it. In the following program fragment, the variable 'foo' has a
-numeric value at first, and a string value later on:
-
- foo = 1
- print foo
- foo = "bar"
- print foo
-
-When the second assignment gives 'foo' a string value, the fact that it
-previously had a numeric value is forgotten.
-
- String values that do not begin with a digit have a numeric value of
-zero. After executing the following code, the value of 'foo' is five:
-
- foo = "a string"
- foo = foo + 5
-
- NOTE: Using a variable as a number and then later as a string can
- be confusing and is poor programming style. The previous two
- examples illustrate how 'awk' works, _not_ how you should write
- your programs!
-
- An assignment is an expression, so it has a value--the same value
-that is assigned. Thus, 'z = 1' is an expression with the value one.
-One consequence of this is that you can write multiple assignments
-together, such as:
-
- x = y = z = 5
-
-This example stores the value five in all three variables ('x', 'y', and
-'z'). It does so because the value of 'z = 5', which is five, is stored
-into 'y' and then the value of 'y = z = 5', which is five, is stored
-into 'x'.
-
- Assignments may be used anywhere an expression is called for. For
-example, it is valid to write 'x != (y = 1)' to set 'y' to one, and then
-test whether 'x' equals one. But this style tends to make programs hard
-to read; such nesting of assignments should be avoided, except perhaps
-in a one-shot program.
-
- Aside from '=', there are several other assignment operators that do
-arithmetic with the old value of the variable. For example, the
-operator '+=' computes a new value by adding the righthand value to the
-old value of the variable. Thus, the following assignment adds five to
-the value of 'foo':
-
- foo += 5
-
-This is equivalent to the following:
-
- foo = foo + 5
-
-Use whichever makes the meaning of your program clearer.
-
- There are situations where using '+=' (or any assignment operator) is
-_not_ the same as simply repeating the lefthand operand in the righthand
-expression. For example:
-
- # Thanks to Pat Rankin for this example
- BEGIN {
- foo[rand()] += 5
- for (x in foo)
- print x, foo[x]
-
- bar[rand()] = bar[rand()] + 5
- for (x in bar)
- print x, bar[x]
- }
-
-The indices of 'bar' are practically guaranteed to be different, because
-'rand()' returns different values each time it is called. (Arrays and
-the 'rand()' function haven't been covered yet. *Note Arrays::, and
-*note Numeric Functions:: for more information.) This example
-illustrates an important fact about assignment operators: the lefthand
-expression is only evaluated _once_.
-
- It is up to the implementation as to which expression is evaluated
-first, the lefthand or the righthand. Consider this example:
-
- i = 1
- a[i += 2] = i + 1
-
-The value of 'a[3]' could be either two or four.
-
- *note Table 6.2: table-assign-ops. lists the arithmetic assignment
-operators. In each case, the righthand operand is an expression whose
-value is converted to a number.
-
-Operator Effect
---------------------------------------------------------------------------
-LVALUE '+=' Add INCREMENT to the value of LVALUE.
-INCREMENT
-LVALUE '-=' Subtract DECREMENT from the value of LVALUE.
-DECREMENT
-LVALUE '*=' Multiply the value of LVALUE by COEFFICIENT.
-COEFFICIENT
-LVALUE '/=' DIVISOR Divide the value of LVALUE by DIVISOR.
-LVALUE '%=' MODULUS Set LVALUE to its remainder by MODULUS.
-LVALUE '^=' POWER Raise LVALUE to the power POWER.
-LVALUE '**=' POWER Raise LVALUE to the power POWER. (c.e.)
-
-Table 6.2: Arithmetic assignment operators
-
- NOTE: Only the '^=' operator is specified by POSIX. For maximum
- portability, do not use the '**=' operator.
-
- Syntactic Ambiguities Between '/=' and Regular Expressions
-
- There is a syntactic ambiguity between the '/=' assignment operator
-and regexp constants whose first character is an '='. (d.c.) This is
-most notable in some commercial 'awk' versions. For example:
-
- $ awk /==/ /dev/null
- error-> awk: syntax error at source line 1
- error-> context is
- error-> >>> /= <<<
- error-> awk: bailing out at source line 1
-
-A workaround is:
-
- awk '/[=]=/' /dev/null
-
- 'gawk' does not have this problem; BWK 'awk' and 'mawk' also do not.
-
-
-File: gawk.info, Node: Increment Ops, Prev: Assignment Ops, Up: All Operators
-
-6.2.4 Increment and Decrement Operators
----------------------------------------
-
-"Increment" and "decrement operators" increase or decrease the value of
-a variable by one. An assignment operator can do the same thing, so the
-increment operators add no power to the 'awk' language; however, they
-are convenient abbreviations for very common operations.
-
- The operator used for adding one is written '++'. It can be used to
-increment a variable either before or after taking its value. To
-"pre-increment" a variable 'v', write '++v'. This adds one to the value
-of 'v'--that new value is also the value of the expression. (The
-assignment expression 'v += 1' is completely equivalent.) Writing the
-'++' after the variable specifies "post-increment". This increments the
-variable value just the same; the difference is that the value of the
-increment expression itself is the variable's _old_ value. Thus, if
-'foo' has the value four, then the expression 'foo++' has the value
-four, but it changes the value of 'foo' to five. In other words, the
-operator returns the old value of the variable, but with the side effect
-of incrementing it.
-
- The post-increment 'foo++' is nearly the same as writing '(foo += 1)
-- 1'. It is not perfectly equivalent because all numbers in 'awk' are
-floating point--in floating point, 'foo + 1 - 1' does not necessarily
-equal 'foo'. But the difference is minute as long as you stick to
-numbers that are fairly small (less than 10e12).
-
- Fields and array elements are incremented just like variables. (Use
-'$(i++)' when you want to do a field reference and a variable increment
-at the same time. The parentheses are necessary because of the
-precedence of the field reference operator '$'.)
-
- The decrement operator '--' works just like '++', except that it
-subtracts one instead of adding it. As with '++', it can be used before
-the lvalue to pre-decrement or after it to post-decrement. Following is
-a summary of increment and decrement expressions:
-
-'++LVALUE'
- Increment LVALUE, returning the new value as the value of the
- expression.
-
-'LVALUE++'
- Increment LVALUE, returning the _old_ value of LVALUE as the value
- of the expression.
-
-'--LVALUE'
- Decrement LVALUE, returning the new value as the value of the
- expression. (This expression is like '++LVALUE', but instead of
- adding, it subtracts.)
-
-'LVALUE--'
- Decrement LVALUE, returning the _old_ value of LVALUE as the value
- of the expression. (This expression is like 'LVALUE++', but
- instead of adding, it subtracts.)
-
- Operator Evaluation Order
-
- Doctor, it hurts when I do this!
- Then don't do that!
- -- _Groucho Marx_
-
-What happens for something like the following?
-
- b = 6
- print b += b++
-
-Or something even stranger?
-
- b = 6
- b += ++b + b++
- print b
-
- In other words, when do the various side effects prescribed by the
-postfix operators ('b++') take effect? When side effects happen is
-"implementation-defined". In other words, it is up to the particular
-version of 'awk'. The result for the first example may be 12 or 13, and
-for the second, it may be 22 or 23.
-
- In short, doing things like this is not recommended and definitely
-not anything that you can rely upon for portability. You should avoid
-such things in your own programs.
-
-
-File: gawk.info, Node: Truth Values and Conditions, Next: Function Calls, Prev: All Operators, Up: Expressions
-
-6.3 Truth Values and Conditions
-===============================
-
-In certain contexts, expression values also serve as "truth values";
-i.e., they determine what should happen next as the program runs. This
-minor node describes how 'awk' defines "true" and "false" and how values
-are compared.
-
-* Menu:
-
-* Truth Values:: What is "true" and what is "false".
-* Typing and Comparison:: How variables acquire types and how this
- affects comparison of numbers and strings with
- '<', etc.
-* Boolean Ops:: Combining comparison expressions using boolean
- operators '||' ("or"), '&&'
- ("and") and '!' ("not").
-* Conditional Exp:: Conditional expressions select between two
- subexpressions under control of a third
- subexpression.
-
-
-File: gawk.info, Node: Truth Values, Next: Typing and Comparison, Up: Truth Values and Conditions
-
-6.3.1 True and False in 'awk'
------------------------------
-
-Many programming languages have a special representation for the
-concepts of "true" and "false." Such languages usually use the special
-constants 'true' and 'false', or perhaps their uppercase equivalents.
-However, 'awk' is different. It borrows a very simple concept of true
-and false from C. In 'awk', any nonzero numeric value _or_ any nonempty
-string value is true. Any other value (zero or the null string, '""')
-is false. The following program prints 'A strange truth value' three
-times:
-
- BEGIN {
- if (3.1415927)
- print "A strange truth value"
- if ("Four Score And Seven Years Ago")
- print "A strange truth value"
- if (j = 57)
- print "A strange truth value"
- }
-
- There is a surprising consequence of the "nonzero or non-null" rule:
-the string constant '"0"' is actually true, because it is non-null.
-(d.c.)
-
-
-File: gawk.info, Node: Typing and Comparison, Next: Boolean Ops, Prev: Truth Values, Up: Truth Values and Conditions
-
-6.3.2 Variable Typing and Comparison Expressions
-------------------------------------------------
-
- The Guide is definitive. Reality is frequently inaccurate.
- -- _Douglas Adams, 'The Hitchhiker's Guide to the Galaxy'_
-
- Unlike in other programming languages, in 'awk' variables do not have
-a fixed type. Instead, they can be either a number or a string,
-depending upon the value that is assigned to them. We look now at how
-variables are typed, and how 'awk' compares variables.
-
-* Menu:
-
-* Variable Typing:: String type versus numeric type.
-* Comparison Operators:: The comparison operators.
-* POSIX String Comparison:: String comparison with POSIX rules.
-
-
-File: gawk.info, Node: Variable Typing, Next: Comparison Operators, Up: Typing and Comparison
-
-6.3.2.1 String Type versus Numeric Type
-.......................................
-
-The POSIX standard introduced the concept of a "numeric string", which
-is simply a string that looks like a number--for example, '" +2"'. This
-concept is used for determining the type of a variable. The type of the
-variable is important because the types of two variables determine how
-they are compared. Variable typing follows these rules:
-
- * A numeric constant or the result of a numeric operation has the
- "numeric" attribute.
-
- * A string constant or the result of a string operation has the
- "string" attribute.
-
- * Fields, 'getline' input, 'FILENAME', 'ARGV' elements, 'ENVIRON'
- elements, and the elements of an array created by 'match()',
- 'split()', and 'patsplit()' that are numeric strings have the
- "strnum" attribute. Otherwise, they have the "string" attribute.
- Uninitialized variables also have the "strnum" attribute.
-
- * Attributes propagate across assignments but are not changed by any
- use.
-
- The last rule is particularly important. In the following program,
-'a' has numeric type, even though it is later used in a string
-operation:
-
- BEGIN {
- a = 12.345
- b = a " is a cute number"
- print b
- }
-
- When two operands are compared, either string comparison or numeric
-comparison may be used. This depends upon the attributes of the
-operands, according to the following symmetric matrix:
-
- +-------------------------------
- | STRING NUMERIC STRNUM
- -----+-------------------------------
- |
- STRING | string string string
- |
- NUMERIC | string numeric numeric
- |
- STRNUM | string numeric numeric
- -----+-------------------------------
-
- The basic idea is that user input that looks numeric--and _only_ user
-input--should be treated as numeric, even though it is actually made of
-characters and is therefore also a string. Thus, for example, the
-string constant '" +3.14"', when it appears in program source code, is a
-string--even though it looks numeric--and is _never_ treated as a number
-for comparison purposes.
-
- In short, when one operand is a "pure" string, such as a string
-constant, then a string comparison is performed. Otherwise, a numeric
-comparison is performed.
-
- This point bears additional emphasis: All user input is made of
-characters, and so is first and foremost of string type; input strings
-that look numeric are additionally given the strnum attribute. Thus,
-the six-character input string ' +3.14' receives the strnum attribute.
-In contrast, the eight characters '" +3.14"' appearing in program text
-comprise a string constant. The following examples print '1' when the
-comparison between the two different constants is true, and '0'
-otherwise:
-
- $ echo ' +3.14' | awk '{ print($0 == " +3.14") }' True
- -| 1
- $ echo ' +3.14' | awk '{ print($0 == "+3.14") }' False
- -| 0
- $ echo ' +3.14' | awk '{ print($0 == "3.14") }' False
- -| 0
- $ echo ' +3.14' | awk '{ print($0 == 3.14) }' True
- -| 1
- $ echo ' +3.14' | awk '{ print($1 == " +3.14") }' False
- -| 0
- $ echo ' +3.14' | awk '{ print($1 == "+3.14") }' True
- -| 1
- $ echo ' +3.14' | awk '{ print($1 == "3.14") }' False
- -| 0
- $ echo ' +3.14' | awk '{ print($1 == 3.14) }' True
- -| 1
-
-
-File: gawk.info, Node: Comparison Operators, Next: POSIX String Comparison, Prev: Variable Typing, Up: Typing and Comparison
-
-6.3.2.2 Comparison Operators
-............................
-
-"Comparison expressions" compare strings or numbers for relationships
-such as equality. They are written using "relational operators", which
-are a superset of those in C. *note Table 6.3: table-relational-ops.
-describes them.
-
-Expression Result
---------------------------------------------------------------------------
-X '<' Y True if X is less than Y
-X '<=' Y True if X is less than or equal to Y
-X '>' Y True if X is greater than Y
-X '>=' Y True if X is greater than or equal to Y
-X '==' Y True if X is equal to Y
-X '!=' Y True if X is not equal to Y
-X '~' Y True if the string X matches the regexp denoted by Y
-X '!~' Y True if the string X does not match the regexp
- denoted by Y
-SUBSCRIPT 'in' True if the array ARRAY has an element with the
-ARRAY subscript SUBSCRIPT
-
-Table 6.3: Relational operators
-
- Comparison expressions have the value one if true and zero if false.
-When comparing operands of mixed types, numeric operands are converted
-to strings using the value of 'CONVFMT' (*note Conversion::).
-
- Strings are compared by comparing the first character of each, then
-the second character of each, and so on. Thus, '"10"' is less than
-'"9"'. If there are two strings where one is a prefix of the other, the
-shorter string is less than the longer one. Thus, '"abc"' is less than
-'"abcd"'.
-
- It is very easy to accidentally mistype the '==' operator and leave
-off one of the '=' characters. The result is still valid 'awk' code,
-but the program does not do what is intended:
-
- if (a = b) # oops! should be a == b
- ...
- else
- ...
-
-Unless 'b' happens to be zero or the null string, the 'if' part of the
-test always succeeds. Because the operators are so similar, this kind
-of error is very difficult to spot when scanning the source code.
-
- The following list of expressions illustrates the kinds of
-comparisons 'awk' performs, as well as what the result of each
-comparison is:
-
-'1.5 <= 2.0'
- Numeric comparison (true)
-
-'"abc" >= "xyz"'
- String comparison (false)
-
-'1.5 != " +2"'
- String comparison (true)
-
-'"1e2" < "3"'
- String comparison (true)
-
-'a = 2; b = "2"'
-'a == b'
- String comparison (true)
-
-'a = 2; b = " +2"'
-'a == b'
- String comparison (false)
-
- In this example:
-
- $ echo 1e2 3 | awk '{ print ($1 < $2) ? "true" : "false" }'
- -| false
-
-the result is 'false' because both '$1' and '$2' are user input. They
-are numeric strings--therefore both have the strnum attribute, dictating
-a numeric comparison. The purpose of the comparison rules and the use
-of numeric strings is to attempt to produce the behavior that is "least
-surprising," while still "doing the right thing."
-
- String comparisons and regular expression comparisons are very
-different. For example:
-
- x == "foo"
-
-has the value one, or is true if the variable 'x' is precisely 'foo'.
-By contrast:
-
- x ~ /foo/
-
-has the value one if 'x' contains 'foo', such as '"Oh, what a fool am
-I!"'.
-
- The righthand operand of the '~' and '!~' operators may be either a
-regexp constant ('/'...'/') or an ordinary expression. In the latter
-case, the value of the expression as a string is used as a dynamic
-regexp (*note Regexp Usage::; also *note Computed Regexps::).
-
- A constant regular expression in slashes by itself is also an
-expression. '/REGEXP/' is an abbreviation for the following comparison
-expression:
-
- $0 ~ /REGEXP/
-
- One special place where '/foo/' is _not_ an abbreviation for '$0 ~
-/foo/' is when it is the righthand operand of '~' or '!~'. *Note Using
-Constant Regexps::, where this is discussed in more detail.
-
-
-File: gawk.info, Node: POSIX String Comparison, Prev: Comparison Operators, Up: Typing and Comparison
-
-6.3.2.3 String Comparison Based on Locale Collating Order
-.........................................................
-
-The POSIX standard used to say that all string comparisons are performed
-based on the locale's "collating order". This is the order in which
-characters sort, as defined by the locale (for more discussion, *note
-Locales::). This order is usually very different from the results
-obtained when doing straight byte-by-byte comparison.(1)
-
- Because this behavior differs considerably from existing practice,
-'gawk' only implemented it when in POSIX mode (*note Options::). Here
-is an example to illustrate the difference, in an 'en_US.UTF-8' locale:
-
- $ gawk 'BEGIN { printf("ABC < abc = %s\n",
- > ("ABC" < "abc" ? "TRUE" : "FALSE")) }'
- -| ABC < abc = TRUE
- $ gawk --posix 'BEGIN { printf("ABC < abc = %s\n",
- > ("ABC" < "abc" ? "TRUE" : "FALSE")) }'
- -| ABC < abc = FALSE
-
- Fortunately, as of August 2016, comparison based on locale collating
-order is no longer required for the '==' and '!=' operators.(2)
-However, comparison based on locales is still required for '<', '<=',
-'>', and '>='. POSIX thus recommends as follows:
-
- Since the '==' operator checks whether strings are identical, not
- whether they collate equally, applications needing to check whether
- strings collate equally can use:
-
- a <= b && a >= b
-
- As of version 4.2, 'gawk' continues to use locale collating order for
-'<', '<=', '>', and '>=' only in POSIX mode.
-
- ---------- Footnotes ----------
-
- (1) Technically, string comparison is supposed to behave the same way
-as if the strings were compared with the C 'strcoll()' function.
-
- (2) See the Austin Group website
-(http://austingroupbugs.net/view.php?id=1070).
-
-
-File: gawk.info, Node: Boolean Ops, Next: Conditional Exp, Prev: Typing and Comparison, Up: Truth Values and Conditions
-
-6.3.3 Boolean Expressions
--------------------------
-
-A "Boolean expression" is a combination of comparison expressions or
-matching expressions, using the Boolean operators "or" ('||'), "and"
-('&&'), and "not" ('!'), along with parentheses to control nesting. The
-truth value of the Boolean expression is computed by combining the truth
-values of the component expressions. Boolean expressions are also
-referred to as "logical expressions". The terms are equivalent.
-
- Boolean expressions can be used wherever comparison and matching
-expressions can be used. They can be used in 'if', 'while', 'do', and
-'for' statements (*note Statements::). They have numeric values (one if
-true, zero if false) that come into play if the result of the Boolean
-expression is stored in a variable or used in arithmetic.
-
- In addition, every Boolean expression is also a valid pattern, so you
-can use one as a pattern to control the execution of rules. The Boolean
-operators are:
-
-'BOOLEAN1 && BOOLEAN2'
- True if both BOOLEAN1 and BOOLEAN2 are true. For example, the
- following statement prints the current input record if it contains
- both 'edu' and 'li':
-
- if ($0 ~ /edu/ && $0 ~ /li/) print
-
- The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is true.
- This can make a difference when BOOLEAN2 contains expressions that
- have side effects. In the case of '$0 ~ /foo/ && ($2 == bar++)',
- the variable 'bar' is not incremented if there is no substring
- 'foo' in the record.
-
-'BOOLEAN1 || BOOLEAN2'
- True if at least one of BOOLEAN1 or BOOLEAN2 is true. For example,
- the following statement prints all records in the input that
- contain _either_ 'edu' or 'li':
-
- if ($0 ~ /edu/ || $0 ~ /li/) print
-
- The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is false.
- This can make a difference when BOOLEAN2 contains expressions that
- have side effects. (Thus, this test never really distinguishes
- records that contain both 'edu' and 'li'--as soon as 'edu' is
- matched, the full test succeeds.)
-
-'! BOOLEAN'
- True if BOOLEAN is false. For example, the following program
- prints 'no home!' in the unusual event that the 'HOME' environment
- variable is not defined:
-
- BEGIN { if (! ("HOME" in ENVIRON))
- print "no home!" }
-
- (The 'in' operator is described in *note Reference to Elements::.)
-
- The '&&' and '||' operators are called "short-circuit" operators
-because of the way they work. Evaluation of the full expression is
-"short-circuited" if the result can be determined partway through its
-evaluation.
-
- Statements that end with '&&' or '||' can be continued simply by
-putting a newline after them. But you cannot put a newline in front of
-either of these operators without using backslash continuation (*note
-Statements/Lines::).
-
- The actual value of an expression using the '!' operator is either
-one or zero, depending upon the truth value of the expression it is
-applied to. The '!' operator is often useful for changing the sense of
-a flag variable from false to true and back again. For example, the
-following program is one way to print lines in between special
-bracketing lines:
-
- $1 == "START" { interested = ! interested; next }
- interested { print }
- $1 == "END" { interested = ! interested; next }
-
-The variable 'interested', as with all 'awk' variables, starts out
-initialized to zero, which is also false. When a line is seen whose
-first field is 'START', the value of 'interested' is toggled to true,
-using '!'. The next rule prints lines as long as 'interested' is true.
-When a line is seen whose first field is 'END', 'interested' is toggled
-back to false.(1)
-
- Most commonly, the '!' operator is used in the conditions of 'if' and
-'while' statements, where it often makes more sense to phrase the logic
-in the negative:
-
- if (! SOME CONDITION || SOME OTHER CONDITION) {
- ... DO WHATEVER PROCESSING ...
- }
-
- NOTE: The 'next' statement is discussed in *note Next Statement::.
- 'next' tells 'awk' to skip the rest of the rules, get the next
- record, and start processing the rules over again at the top. The
- reason it's there is to avoid printing the bracketing 'START' and
- 'END' lines.
-
- ---------- Footnotes ----------
-
- (1) This program has a bug; it prints lines starting with 'END'. How
-would you fix it?
-
-
-File: gawk.info, Node: Conditional Exp, Prev: Boolean Ops, Up: Truth Values and Conditions
-
-6.3.4 Conditional Expressions
------------------------------
-
-A "conditional expression" is a special kind of expression that has
-three operands. It allows you to use one expression's value to select
-one of two other expressions. The conditional expression in 'awk' is
-the same as in the C language, as shown here:
-
- SELECTOR ? IF-TRUE-EXP : IF-FALSE-EXP
-
-There are three subexpressions. The first, SELECTOR, is always computed
-first. If it is "true" (not zero or not null), then IF-TRUE-EXP is
-computed next, and its value becomes the value of the whole expression.
-Otherwise, IF-FALSE-EXP is computed next, and its value becomes the
-value of the whole expression. For example, the following expression
-produces the absolute value of 'x':
-
- x >= 0 ? x : -x
-
- Each time the conditional expression is computed, only one of
-IF-TRUE-EXP and IF-FALSE-EXP is used; the other is ignored. This is
-important when the expressions have side effects. For example, this
-conditional expression examines element 'i' of either array 'a' or array
-'b', and increments 'i':
-
- x == y ? a[i++] : b[i++]
-
-This is guaranteed to increment 'i' exactly once, because each time only
-one of the two increment expressions is executed and the other is not.
-*Note Arrays::, for more information about arrays.
-
- As a minor 'gawk' extension, a statement that uses '?:' can be
-continued simply by putting a newline after either character. However,
-putting a newline in front of either character does not work without
-using backslash continuation (*note Statements/Lines::). If '--posix'
-is specified (*note Options::), this extension is disabled.
-
-
-File: gawk.info, Node: Function Calls, Next: Precedence, Prev: Truth Values and Conditions, Up: Expressions
-
-6.4 Function Calls
-==================
-
-A "function" is a name for a particular calculation. This enables you
-to ask for it by name at any point in the program. For example, the
-function 'sqrt()' computes the square root of a number.
-
- A fixed set of functions are "built in", which means they are
-available in every 'awk' program. The 'sqrt()' function is one of
-these. *Note Built-in:: for a list of built-in functions and their
-descriptions. In addition, you can define functions for use in your
-program. *Note User-defined:: for instructions on how to do this.
-Finally, 'gawk' lets you write functions in C or C++ that may be called
-from your program (*note Dynamic Extensions::).
-
- The way to use a function is with a "function call" expression, which
-consists of the function name followed immediately by a list of
-"arguments" in parentheses. The arguments are expressions that provide
-the raw materials for the function's calculations. When there is more
-than one argument, they are separated by commas. If there are no
-arguments, just write '()' after the function name. The following
-examples show function calls with and without arguments:
-
- sqrt(x^2 + y^2) one argument
- atan2(y, x) two arguments
- rand() no arguments
-
- CAUTION: Do not put any space between the function name and the
- opening parenthesis! A user-defined function name looks just like
- the name of a variable--a space would make the expression look like
- concatenation of a variable with an expression inside parentheses.
- With built-in functions, space before the parenthesis is harmless,
- but it is best not to get into the habit of using space to avoid
- mistakes with user-defined functions.
-
- Each function expects a particular number of arguments. For example,
-the 'sqrt()' function must be called with a single argument, the number
-of which to take the square root:
-
- sqrt(ARGUMENT)
-
- Some of the built-in functions have one or more optional arguments.
-If those arguments are not supplied, the functions use a reasonable
-default value. *Note Built-in:: for full details. If arguments are
-omitted in calls to user-defined functions, then those arguments are
-treated as local variables. Such local variables act like the empty
-string if referenced where a string value is required, and like zero if
-referenced where a numeric value is required (*note User-defined::).
-
- As an advanced feature, 'gawk' provides indirect function calls,
-which is a way to choose the function to call at runtime, instead of
-when you write the source code to your program. We defer discussion of
-this feature until later; see *note Indirect Calls::.
-
- Like every other expression, the function call has a value, often
-called the "return value", which is computed by the function based on
-the arguments you give it. In this example, the return value of
-'sqrt(ARGUMENT)' is the square root of ARGUMENT. The following program
-reads numbers, one number per line, and prints the square root of each
-one:
-
- $ awk '{ print "The square root of", $1, "is", sqrt($1) }'
- 1
- -| The square root of 1 is 1
- 3
- -| The square root of 3 is 1.73205
- 5
- -| The square root of 5 is 2.23607
- Ctrl-d
-
- A function can also have side effects, such as assigning values to
-certain variables or doing I/O. This program shows how the 'match()'
-function (*note String Functions::) changes the variables 'RSTART' and
-'RLENGTH':
-
- {
- if (match($1, $2))
- print RSTART, RLENGTH
- else
- print "no match"
- }
-
-Here is a sample run:
-
- $ awk -f matchit.awk
- aaccdd c+
- -| 3 2
- foo bar
- -| no match
- abcdefg e
- -| 5 1
-
-
-File: gawk.info, Node: Precedence, Next: Locales, Prev: Function Calls, Up: Expressions
-
-6.5 Operator Precedence (How Operators Nest)
-============================================
-
-"Operator precedence" determines how operators are grouped when
-different operators appear close by in one expression. For example, '*'
-has higher precedence than '+'; thus, 'a + b * c' means to multiply 'b'
-and 'c', and then add 'a' to the product (i.e., 'a + (b * c)').
-
- The normal precedence of the operators can be overruled by using
-parentheses. Think of the precedence rules as saying where the
-parentheses are assumed to be. In fact, it is wise to always use
-parentheses whenever there is an unusual combination of operators,
-because other people who read the program may not remember what the
-precedence is in this case. Even experienced programmers occasionally
-forget the exact rules, which leads to mistakes. Explicit parentheses
-help prevent any such mistakes.
-
- When operators of equal precedence are used together, the leftmost
-operator groups first, except for the assignment, conditional, and
-exponentiation operators, which group in the opposite order. Thus, 'a -
-b + c' groups as '(a - b) + c' and 'a = b = c' groups as 'a = (b = c)'.
-
- Normally the precedence of prefix unary operators does not matter,
-because there is only one way to interpret them: innermost first. Thus,
-'$++i' means '$(++i)' and '++$x' means '++($x)'. However, when another
-operator follows the operand, then the precedence of the unary operators
-can matter. '$x^2' means '($x)^2', but '-x^2' means '-(x^2)', because
-'-' has lower precedence than '^', whereas '$' has higher precedence.
-Also, operators cannot be combined in a way that violates the precedence
-rules; for example, '$$0++--' is not a valid expression because the
-first '$' has higher precedence than the '++'; to avoid the problem the
-expression can be rewritten as '$($0++)--'.
-
- This list presents 'awk''s operators, in order of highest to lowest
-precedence:
-
-'('...')'
- Grouping.
-
-'$'
- Field reference.
-
-'++ --'
- Increment, decrement.
-
-'^ **'
- Exponentiation. These operators group right to left.
-
-'+ - !'
- Unary plus, minus, logical "not."
-
-'* / %'
- Multiplication, division, remainder.
-
-'+ -'
- Addition, subtraction.
-
-String concatenation
- There is no special symbol for concatenation. The operands are
- simply written side by side (*note Concatenation::).
-
-'< <= == != > >= >> | |&'
- Relational and redirection. The relational operators and the
- redirections have the same precedence level. Characters such as
- '>' serve both as relationals and as redirections; the context
- distinguishes between the two meanings.
-
- Note that the I/O redirection operators in 'print' and 'printf'
- statements belong to the statement level, not to expressions. The
- redirection does not produce an expression that could be the
- operand of another operator. As a result, it does not make sense
- to use a redirection operator near another operator of lower
- precedence without parentheses. Such combinations (e.g., 'print
- foo > a ? b : c') result in syntax errors. The correct way to
- write this statement is 'print foo > (a ? b : c)'.
-
-'~ !~'
- Matching, nonmatching.
-
-'in'
- Array membership.
-
-'&&'
- Logical "and."
-
-'||'
- Logical "or."
-
-'?:'
- Conditional. This operator groups right to left.
-
-'= += -= *= /= %= ^= **='
- Assignment. These operators group right to left.
-
- NOTE: The '|&', '**', and '**=' operators are not specified by
- POSIX. For maximum portability, do not use them.
-
-
-File: gawk.info, Node: Locales, Next: Expressions Summary, Prev: Precedence, Up: Expressions
-
-6.6 Where You Are Makes a Difference
-====================================
-
-Modern systems support the notion of "locales": a way to tell the system
-about the local character set and language. The ISO C standard defines
-a default '"C"' locale, which is an environment that is typical of what
-many C programmers are used to.
-
- Once upon a time, the locale setting used to affect regexp matching,
-but this is no longer true (*note Ranges and Locales::).
-
- Locales can affect record splitting. For the normal case of 'RS =
-"\n"', the locale is largely irrelevant. For other single-character
-record separators, setting 'LC_ALL=C' in the environment will give you
-much better performance when reading records. Otherwise, 'gawk' has to
-make several function calls, _per input character_, to find the record
-terminator.
-
- Locales can affect how dates and times are formatted (*note Time
-Functions::). For example, a common way to abbreviate the date
-September 4, 2015, in the United States is "9/4/15." In many countries
-in Europe, however, it is abbreviated "4.9.15." Thus, the '%x'
-specification in a '"US"' locale might produce '9/4/15', while in a
-'"EUROPE"' locale, it might produce '4.9.15'.
-
- According to POSIX, string comparison is also affected by locales
-(similar to regular expressions). The details are presented in *note
-POSIX String Comparison::.
-
- Finally, the locale affects the value of the decimal point character
-used when 'gawk' parses input data. This is discussed in detail in
-*note Conversion::.
-
-
-File: gawk.info, Node: Expressions Summary, Prev: Locales, Up: Expressions
-
-6.7 Summary
-===========
-
- * Expressions are the basic elements of computation in programs.
- They are built from constants, variables, function calls, and
- combinations of the various kinds of values with operators.
-
- * 'awk' supplies three kinds of constants: numeric, string, and
- regexp. 'gawk' lets you specify numeric constants in octal and
- hexadecimal (bases 8 and 16) as well as decimal (base 10). In
- certain contexts, a standalone regexp constant such as '/foo/' has
- the same meaning as '$0 ~ /foo/'.
-
- * Variables hold values between uses in computations. A number of
- built-in variables provide information to your 'awk' program, and a
- number of others let you control how 'awk' behaves.
-
- * Numbers are automatically converted to strings, and strings to
- numbers, as needed by 'awk'. Numeric values are converted as if
- they were formatted with 'sprintf()' using the format in 'CONVFMT'.
- Locales can influence the conversions.
-
- * 'awk' provides the usual arithmetic operators (addition,
- subtraction, multiplication, division, modulus), and unary plus and
- minus. It also provides comparison operators, Boolean operators,
- an array membership testing operator, and regexp matching
- operators. String concatenation is accomplished by placing two
- expressions next to each other; there is no explicit operator. The
- three-operand '?:' operator provides an "if-else" test within
- expressions.
-
- * Assignment operators provide convenient shorthands for common
- arithmetic operations.
-
- * In 'awk', a value is considered to be true if it is nonzero _or_
- non-null. Otherwise, the value is false.
-
- * A variable's type is set upon each assignment and may change over
- its lifetime. The type determines how it behaves in comparisons
- (string or numeric).
-
- * Function calls return a value that may be used as part of a larger
- expression. Expressions used to pass parameter values are fully
- evaluated before the function is called. 'awk' provides built-in
- and user-defined functions; this is described in *note Functions::.
-
- * Operator precedence specifies the order in which operations are
- performed, unless explicitly overridden by parentheses. 'awk''s
- operator precedence is compatible with that of C.
-
- * Locales can affect the format of data as output by an 'awk'
- program, and occasionally the format for data read as input.
-
-
-File: gawk.info, Node: Patterns and Actions, Next: Arrays, Prev: Expressions, Up: Top
-
-7 Patterns, Actions, and Variables
-**********************************
-
-As you have already seen, each 'awk' statement consists of a pattern
-with an associated action. This major node describes how you build
-patterns and actions, what kinds of things you can do within actions,
-and 'awk''s predefined variables.
-
- The pattern-action rules and the statements available for use within
-actions form the core of 'awk' programming. In a sense, everything
-covered up to here has been the foundation that programs are built on
-top of. Now it's time to start building something useful.
-
-* Menu:
-
-* Pattern Overview:: What goes into a pattern.
-* Using Shell Variables:: How to use shell variables with 'awk'.
-* Action Overview:: What goes into an action.
-* Statements:: Describes the various control statements in
- detail.
-* Built-in Variables:: Summarizes the predefined variables.
-* Pattern Action Summary:: Patterns and Actions summary.
-
-
-File: gawk.info, Node: Pattern Overview, Next: Using Shell Variables, Up: Patterns and Actions
-
-7.1 Pattern Elements
-====================
-
-* Menu:
-
-* Regexp Patterns:: Using regexps as patterns.
-* Expression Patterns:: Any expression can be used as a pattern.
-* Ranges:: Pairs of patterns specify record ranges.
-* BEGIN/END:: Specifying initialization and cleanup rules.
-* BEGINFILE/ENDFILE:: Two special patterns for advanced control.
-* Empty:: The empty pattern, which matches every record.
-
-Patterns in 'awk' control the execution of rules--a rule is executed
-when its pattern matches the current input record. The following is a
-summary of the types of 'awk' patterns:
-
-'/REGULAR EXPRESSION/'
- A regular expression. It matches when the text of the input record
- fits the regular expression. (*Note Regexp::.)
-
-'EXPRESSION'
- A single expression. It matches when its value is nonzero (if a
- number) or non-null (if a string). (*Note Expression Patterns::.)
-
-'BEGPAT, ENDPAT'
- A pair of patterns separated by a comma, specifying a "range" of
- records. The range includes both the initial record that matches
- BEGPAT and the final record that matches ENDPAT. (*Note Ranges::.)
-
-'BEGIN'
-'END'
- Special patterns for you to supply startup or cleanup actions for
- your 'awk' program. (*Note BEGIN/END::.)
-
-'BEGINFILE'
-'ENDFILE'
- Special patterns for you to supply startup or cleanup actions to be
- done on a per-file basis. (*Note BEGINFILE/ENDFILE::.)
-
-'EMPTY'
- The empty pattern matches every input record. (*Note Empty::.)
-
-
-File: gawk.info, Node: Regexp Patterns, Next: Expression Patterns, Up: Pattern Overview
-
-7.1.1 Regular Expressions as Patterns
--------------------------------------
-
-Regular expressions are one of the first kinds of patterns presented in
-this book. This kind of pattern is simply a regexp constant in the
-pattern part of a rule. Its meaning is '$0 ~ /PATTERN/'. The pattern
-matches when the input record matches the regexp. For example:
-
- /foo|bar|baz/ { buzzwords++ }
- END { print buzzwords, "buzzwords seen" }
-
-
-File: gawk.info, Node: Expression Patterns, Next: Ranges, Prev: Regexp Patterns, Up: Pattern Overview
-
-7.1.2 Expressions as Patterns
------------------------------
-
-Any 'awk' expression is valid as an 'awk' pattern. The pattern matches
-if the expression's value is nonzero (if a number) or non-null (if a
-string). The expression is reevaluated each time the rule is tested
-against a new input record. If the expression uses fields such as '$1',
-the value depends directly on the new input record's text; otherwise, it
-depends on only what has happened so far in the execution of the 'awk'
-program.
-
- Comparison expressions, using the comparison operators described in
-*note Typing and Comparison::, are a very common kind of pattern.
-Regexp matching and nonmatching are also very common expressions. The
-left operand of the '~' and '!~' operators is a string. The right
-operand is either a constant regular expression enclosed in slashes
-('/REGEXP/'), or any expression whose string value is used as a dynamic
-regular expression (*note Computed Regexps::). The following example
-prints the second field of each input record whose first field is
-precisely 'li':
-
- $ awk '$1 == "li" { print $2 }' mail-list
-
-(There is no output, because there is no person with the exact name
-'li'.) Contrast this with the following regular expression match, which
-accepts any record with a first field that contains 'li':
-
- $ awk '$1 ~ /li/ { print $2 }' mail-list
- -| 555-5553
- -| 555-6699
-
- A regexp constant as a pattern is also a special case of an
-expression pattern. The expression '/li/' has the value one if 'li'
-appears in the current input record. Thus, as a pattern, '/li/' matches
-any record containing 'li'.
-
- Boolean expressions are also commonly used as patterns. Whether the
-pattern matches an input record depends on whether its subexpressions
-match. For example, the following command prints all the records in
-'mail-list' that contain both 'edu' and 'li':
-
- $ awk '/edu/ && /li/' mail-list
- -| Samuel 555-3430 samuel.lanceolis@shu.edu A
-
- The following command prints all records in 'mail-list' that contain
-_either_ 'edu' or 'li' (or both, of course):
-
- $ awk '/edu/ || /li/' mail-list
- -| Amelia 555-5553 amelia.zodiacusque@gmail.com F
- -| Broderick 555-0542 broderick.aliquotiens@yahoo.com R
- -| Fabius 555-1234 fabius.undevicesimus@ucb.edu F
- -| Julie 555-6699 julie.perscrutabor@skeeve.com F
- -| Samuel 555-3430 samuel.lanceolis@shu.edu A
- -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R
-
- The following command prints all records in 'mail-list' that do _not_
-contain the string 'li':
-
- $ awk '! /li/' mail-list
- -| Anthony 555-3412 anthony.asserturo@hotmail.com A
- -| Becky 555-7685 becky.algebrarum@gmail.com A
- -| Bill 555-1675 bill.drowning@hotmail.com A
- -| Camilla 555-2912 camilla.infusarum@skynet.be R
- -| Fabius 555-1234 fabius.undevicesimus@ucb.edu F
- -| Martin 555-6480 martin.codicibus@hotmail.com A
- -| Jean-Paul 555-2127 jeanpaul.campanorum@nyu.edu R
-
- The subexpressions of a Boolean operator in a pattern can be constant
-regular expressions, comparisons, or any other 'awk' expressions. Range
-patterns are not expressions, so they cannot appear inside Boolean
-patterns. Likewise, the special patterns 'BEGIN', 'END', 'BEGINFILE',
-and 'ENDFILE', which never match any input record, are not expressions
-and cannot appear inside Boolean patterns.
-
- The precedence of the different operators that can appear in patterns
-is described in *note Precedence::.
-
-
-File: gawk.info, Node: Ranges, Next: BEGIN/END, Prev: Expression Patterns, Up: Pattern Overview
-
-7.1.3 Specifying Record Ranges with Patterns
---------------------------------------------
-
-A "range pattern" is made of two patterns separated by a comma, in the
-form 'BEGPAT, ENDPAT'. It is used to match ranges of consecutive input
-records. The first pattern, BEGPAT, controls where the range begins,
-while ENDPAT controls where the pattern ends. For example, the
-following:
-
- awk '$1 == "on", $1 == "off"' myfile
-
-prints every record in 'myfile' between 'on'/'off' pairs, inclusive.
-
- A range pattern starts out by matching BEGPAT against every input
-record. When a record matches BEGPAT, the range pattern is "turned on",
-and the range pattern matches this record as well. As long as the range
-pattern stays turned on, it automatically matches every input record
-read. The range pattern also matches ENDPAT against every input record;
-when this succeeds, the range pattern is "turned off" again for the
-following record. Then the range pattern goes back to checking BEGPAT
-against each record.
-
- The record that turns on the range pattern and the one that turns it
-off both match the range pattern. If you don't want to operate on these
-records, you can write 'if' statements in the rule's action to
-distinguish them from the records you are interested in.
-
- It is possible for a pattern to be turned on and off by the same
-record. If the record satisfies both conditions, then the action is
-executed for just that record. For example, suppose there is text
-between two identical markers (e.g., the '%' symbol), each on its own
-line, that should be ignored. A first attempt would be to combine a
-range pattern that describes the delimited text with the 'next'
-statement (not discussed yet, *note Next Statement::). This causes
-'awk' to skip any further processing of the current record and start
-over again with the next input record. Such a program looks like this:
-
- /^%$/,/^%$/ { next }
- { print }
-
-This program fails because the range pattern is both turned on and
-turned off by the first line, which just has a '%' on it. To accomplish
-this task, write the program in the following manner, using a flag:
-
- /^%$/ { skip = ! skip; next }
- skip == 1 { next } # skip lines with `skip' set
-
- In a range pattern, the comma (',') has the lowest precedence of all
-the operators (i.e., it is evaluated last). Thus, the following program
-attempts to combine a range pattern with another, simpler test:
-
- echo Yes | awk '/1/,/2/ || /Yes/'
-
- The intent of this program is '(/1/,/2/) || /Yes/'. However, 'awk'
-interprets this as '/1/, (/2/ || /Yes/)'. This cannot be changed or
-worked around; range patterns do not combine with other patterns:
-
- $ echo Yes | gawk '(/1/,/2/) || /Yes/'
- error-> gawk: cmd. line:1: (/1/,/2/) || /Yes/
- error-> gawk: cmd. line:1: ^ syntax error
-
- As a minor point of interest, although it is poor style, POSIX allows
-you to put a newline after the comma in a range pattern. (d.c.)
-
-
-File: gawk.info, Node: BEGIN/END, Next: BEGINFILE/ENDFILE, Prev: Ranges, Up: Pattern Overview
-
-7.1.4 The 'BEGIN' and 'END' Special Patterns
---------------------------------------------
-
-All the patterns described so far are for matching input records. The
-'BEGIN' and 'END' special patterns are different. They supply startup
-and cleanup actions for 'awk' programs. 'BEGIN' and 'END' rules must
-have actions; there is no default action for these rules because there
-is no current record when they run. 'BEGIN' and 'END' rules are often
-referred to as "'BEGIN' and 'END' blocks" by longtime 'awk' programmers.
-
-* Menu:
-
-* Using BEGIN/END:: How and why to use BEGIN/END rules.
-* I/O And BEGIN/END:: I/O issues in BEGIN/END rules.
-
-
-File: gawk.info, Node: Using BEGIN/END, Next: I/O And BEGIN/END, Up: BEGIN/END
-
-7.1.4.1 Startup and Cleanup Actions
-...................................
-
-A 'BEGIN' rule is executed once only, before the first input record is
-read. Likewise, an 'END' rule is executed once only, after all the
-input is read. For example:
-
- $ awk '
- > BEGIN { print "Analysis of \"li\"" }
- > /li/ { ++n }
- > END { print "\"li\" appears in", n, "records." }' mail-list
- -| Analysis of "li"
- -| "li" appears in 4 records.
-
- This program finds the number of records in the input file
-'mail-list' that contain the string 'li'. The 'BEGIN' rule prints a
-title for the report. There is no need to use the 'BEGIN' rule to
-initialize the counter 'n' to zero, as 'awk' does this automatically
-(*note Variables::). The second rule increments the variable 'n' every
-time a record containing the pattern 'li' is read. The 'END' rule
-prints the value of 'n' at the end of the run.
-
- The special patterns 'BEGIN' and 'END' cannot be used in ranges or
-with Boolean operators (indeed, they cannot be used with any operators).
-An 'awk' program may have multiple 'BEGIN' and/or 'END' rules. They are
-executed in the order in which they appear: all the 'BEGIN' rules at
-startup and all the 'END' rules at termination. 'BEGIN' and 'END' rules
-may be intermixed with other rules. This feature was added in the 1987
-version of 'awk' and is included in the POSIX standard. The original
-(1978) version of 'awk' required the 'BEGIN' rule to be placed at the
-beginning of the program, the 'END' rule to be placed at the end, and
-only allowed one of each. This is no longer required, but it is a good
-idea to follow this template in terms of program organization and
-readability.
-
- Multiple 'BEGIN' and 'END' rules are useful for writing library
-functions, because each library file can have its own 'BEGIN' and/or
-'END' rule to do its own initialization and/or cleanup. The order in
-which library functions are named on the command line controls the order
-in which their 'BEGIN' and 'END' rules are executed. Therefore, you
-have to be careful when writing such rules in library files so that the
-order in which they are executed doesn't matter. *Note Options:: for
-more information on using library functions. *Note Library Functions::,
-for a number of useful library functions.
-
- If an 'awk' program has only 'BEGIN' rules and no other rules, then
-the program exits after the 'BEGIN' rules are run.(1) However, if an
-'END' rule exists, then the input is read, even if there are no other
-rules in the program. This is necessary in case the 'END' rule checks
-the 'FNR' and 'NR' variables.
-
- ---------- Footnotes ----------
-
- (1) The original version of 'awk' kept reading and ignoring input
-until the end of the file was seen.
-
-
-File: gawk.info, Node: I/O And BEGIN/END, Prev: Using BEGIN/END, Up: BEGIN/END
-
-7.1.4.2 Input/Output from 'BEGIN' and 'END' Rules
-.................................................
-
-There are several (sometimes subtle) points to be aware of when doing
-I/O from a 'BEGIN' or 'END' rule. The first has to do with the value of
-'$0' in a 'BEGIN' rule. Because 'BEGIN' rules are executed before any
-input is read, there simply is no input record, and therefore no fields,
-when executing 'BEGIN' rules. References to '$0' and the fields yield a
-null string or zero, depending upon the context. One way to give '$0' a
-real value is to execute a 'getline' command without a variable (*note
-Getline::). Another way is simply to assign a value to '$0'.
-
- The second point is similar to the first, but from the other
-direction. Traditionally, due largely to implementation issues, '$0'
-and 'NF' were _undefined_ inside an 'END' rule. The POSIX standard
-specifies that 'NF' is available in an 'END' rule. It contains the
-number of fields from the last input record. Most probably due to an
-oversight, the standard does not say that '$0' is also preserved,
-although logically one would think that it should be. In fact, all of
-BWK 'awk', 'mawk', and 'gawk' preserve the value of '$0' for use in
-'END' rules. Be aware, however, that some other implementations and
-many older versions of Unix 'awk' do not.
-
- The third point follows from the first two. The meaning of 'print'
-inside a 'BEGIN' or 'END' rule is the same as always: 'print $0'. If
-'$0' is the null string, then this prints an empty record. Many
-longtime 'awk' programmers use an unadorned 'print' in 'BEGIN' and 'END'
-rules, to mean 'print ""', relying on '$0' being null. Although one
-might generally get away with this in 'BEGIN' rules, it is a very bad
-idea in 'END' rules, at least in 'gawk'. It is also poor style, because
-if an empty line is needed in the output, the program should print one
-explicitly.
-
- Finally, the 'next' and 'nextfile' statements are not allowed in a
-'BEGIN' rule, because the implicit
-read-a-record-and-match-against-the-rules loop has not started yet.
-Similarly, those statements are not valid in an 'END' rule, because all
-the input has been read. (*Note Next Statement:: and *note Nextfile
-Statement::.)
-
-
-File: gawk.info, Node: BEGINFILE/ENDFILE, Next: Empty, Prev: BEGIN/END, Up: Pattern Overview
-
-7.1.5 The 'BEGINFILE' and 'ENDFILE' Special Patterns
-----------------------------------------------------
-
-This minor node describes a 'gawk'-specific feature.
-
- Two special kinds of rule, 'BEGINFILE' and 'ENDFILE', give you
-"hooks" into 'gawk''s command-line file processing loop. As with the
-'BEGIN' and 'END' rules (*note BEGIN/END::), all 'BEGINFILE' rules in a
-program are merged, in the order they are read by 'gawk', and all
-'ENDFILE' rules are merged as well.
-
- The body of the 'BEGINFILE' rules is executed just before 'gawk'
-reads the first record from a file. 'FILENAME' is set to the name of
-the current file, and 'FNR' is set to zero.
-
- The 'BEGINFILE' rule provides you the opportunity to accomplish two
-tasks that would otherwise be difficult or impossible to perform:
-
- * You can test if the file is readable. Normally, it is a fatal
- error if a file named on the command line cannot be opened for
- reading. However, you can bypass the fatal error and move on to
- the next file on the command line.
-
- You do this by checking if the 'ERRNO' variable is not the empty
- string; if so, then 'gawk' was not able to open the file. In this
- case, your program can execute the 'nextfile' statement (*note
- Nextfile Statement::). This causes 'gawk' to skip the file
- entirely. Otherwise, 'gawk' exits with the usual fatal error.
-
- * If you have written extensions that modify the record handling (by
- inserting an "input parser"; *note Input Parsers::), you can invoke
- them at this point, before 'gawk' has started processing the file.
- (This is a _very_ advanced feature, currently used only by the
- 'gawkextlib' project (http://sourceforge.net/projects/gawkextlib).)
-
- The 'ENDFILE' rule is called when 'gawk' has finished processing the
-last record in an input file. For the last input file, it will be
-called before any 'END' rules. The 'ENDFILE' rule is executed even for
-empty input files.
-
- Normally, when an error occurs when reading input in the normal
-input-processing loop, the error is fatal. However, if an 'ENDFILE'
-rule is present, the error becomes non-fatal, and instead 'ERRNO' is
-set. This makes it possible to catch and process I/O errors at the
-level of the 'awk' program.
-
- The 'next' statement (*note Next Statement::) is not allowed inside
-either a 'BEGINFILE' or an 'ENDFILE' rule. The 'nextfile' statement is
-allowed only inside a 'BEGINFILE' rule, not inside an 'ENDFILE' rule.
-
- The 'getline' statement (*note Getline::) is restricted inside both
-'BEGINFILE' and 'ENDFILE': only redirected forms of 'getline' are
-allowed.
-
- 'BEGINFILE' and 'ENDFILE' are 'gawk' extensions. In most other 'awk'
-implementations, or if 'gawk' is in compatibility mode (*note
-Options::), they are not special.
-
-
-File: gawk.info, Node: Empty, Prev: BEGINFILE/ENDFILE, Up: Pattern Overview
-
-7.1.6 The Empty Pattern
------------------------
-
-An empty (i.e., nonexistent) pattern is considered to match _every_
-input record. For example, the program:
-
- awk '{ print $1 }' mail-list
-
-prints the first field of every record.
-
-
-File: gawk.info, Node: Using Shell Variables, Next: Action Overview, Prev: Pattern Overview, Up: Patterns and Actions
-
-7.2 Using Shell Variables in Programs
-=====================================
-
-'awk' programs are often used as components in larger programs written
-in shell. For example, it is very common to use a shell variable to
-hold a pattern that the 'awk' program searches for. There are two ways
-to get the value of the shell variable into the body of the 'awk'
-program.
-
- A common method is to use shell quoting to substitute the variable's
-value into the program inside the script. For example, consider the
-following program:
-
- printf "Enter search pattern: "
- read pattern
- awk "/$pattern/ "'{ nmatches++ }
- END { print nmatches, "found" }' /path/to/data
-
-The 'awk' program consists of two pieces of quoted text that are
-concatenated together to form the program. The first part is
-double-quoted, which allows substitution of the 'pattern' shell variable
-inside the quotes. The second part is single-quoted.
-
- Variable substitution via quoting works, but can potentially be
-messy. It requires a good understanding of the shell's quoting rules
-(*note Quoting::), and it's often difficult to correctly match up the
-quotes when reading the program.
-
- A better method is to use 'awk''s variable assignment feature (*note
-Assignment Options::) to assign the shell variable's value to an 'awk'
-variable. Then use dynamic regexps to match the pattern (*note Computed
-Regexps::). The following shows how to redo the previous example using
-this technique:
-
- printf "Enter search pattern: "
- read pattern
- awk -v pat="$pattern" '$0 ~ pat { nmatches++ }
- END { print nmatches, "found" }' /path/to/data
-
-Now, the 'awk' program is just one single-quoted string. The assignment
-'-v pat="$pattern"' still requires double quotes, in case there is
-whitespace in the value of '$pattern'. The 'awk' variable 'pat' could
-be named 'pattern' too, but that would be more confusing. Using a
-variable also provides more flexibility, as the variable can be used
-anywhere inside the program--for printing, as an array subscript, or for
-any other use--without requiring the quoting tricks at every point in
-the program.
-
-
-File: gawk.info, Node: Action Overview, Next: Statements, Prev: Using Shell Variables, Up: Patterns and Actions
-
-7.3 Actions
-===========
-
-An 'awk' program or script consists of a series of rules and function
-definitions interspersed. (Functions are described later. *Note
-User-defined::.) A rule contains a pattern and an action, either of
-which (but not both) may be omitted. The purpose of the "action" is to
-tell 'awk' what to do once a match for the pattern is found. Thus, in
-outline, an 'awk' program generally looks like this:
-
- [PATTERN] '{ ACTION }'
- PATTERN ['{ ACTION }']
- ...
- 'function NAME(ARGS) { ... }'
- ...
-
- An action consists of one or more 'awk' "statements", enclosed in
-braces ('{...}'). Each statement specifies one thing to do. The
-statements are separated by newlines or semicolons. The braces around
-an action must be used even if the action contains only one statement,
-or if it contains no statements at all. However, if you omit the action
-entirely, omit the braces as well. An omitted action is equivalent to
-'{ print $0 }':
-
- /foo/ { } match 'foo', do nothing -- empty action
- /foo/ match 'foo', print the record -- omitted action
-
- The following types of statements are supported in 'awk':
-
-Expressions
- Call functions or assign values to variables (*note Expressions::).
- Executing this kind of statement simply computes the value of the
- expression. This is useful when the expression has side effects
- (*note Assignment Ops::).
-
-Control statements
- Specify the control flow of 'awk' programs. The 'awk' language
- gives you C-like constructs ('if', 'for', 'while', and 'do') as
- well as a few special ones (*note Statements::).
-
-Compound statements
- Enclose one or more statements in braces. A compound statement is
- used in order to put several statements together in the body of an
- 'if', 'while', 'do', or 'for' statement.
-
-Input statements
- Use the 'getline' command (*note Getline::). Also supplied in
- 'awk' are the 'next' statement (*note Next Statement::) and the
- 'nextfile' statement (*note Nextfile Statement::).
-
-Output statements
- Such as 'print' and 'printf'. *Note Printing::.
-
-Deletion statements
- For deleting array elements. *Note Delete::.
-
-
-File: gawk.info, Node: Statements, Next: Built-in Variables, Prev: Action Overview, Up: Patterns and Actions
-
-7.4 Control Statements in Actions
-=================================
-
-"Control statements", such as 'if', 'while', and so on, control the flow
-of execution in 'awk' programs. Most of 'awk''s control statements are
-patterned after similar statements in C.
-
- All the control statements start with special keywords, such as 'if'
-and 'while', to distinguish them from simple expressions. Many control
-statements contain other statements. For example, the 'if' statement
-contains another statement that may or may not be executed. The
-contained statement is called the "body". To include more than one
-statement in the body, group them into a single "compound statement"
-with braces, separating them with newlines or semicolons.
-
-* Menu:
-
-* If Statement:: Conditionally execute some 'awk'
- statements.
-* While Statement:: Loop until some condition is satisfied.
-* Do Statement:: Do specified action while looping until some
- condition is satisfied.
-* For Statement:: Another looping statement, that provides
- initialization and increment clauses.
-* Switch Statement:: Switch/case evaluation for conditional
- execution of statements based on a value.
-* Break Statement:: Immediately exit the innermost enclosing loop.
-* Continue Statement:: Skip to the end of the innermost enclosing
- loop.
-* Next Statement:: Stop processing the current input record.
-* Nextfile Statement:: Stop processing the current file.
-* Exit Statement:: Stop execution of 'awk'.
-
-
-File: gawk.info, Node: If Statement, Next: While Statement, Up: Statements
-
-7.4.1 The 'if'-'else' Statement
--------------------------------
-
-The 'if'-'else' statement is 'awk''s decision-making statement. It
-looks like this:
-
- 'if (CONDITION) THEN-BODY' ['else ELSE-BODY']
-
-The CONDITION is an expression that controls what the rest of the
-statement does. If the CONDITION is true, THEN-BODY is executed;
-otherwise, ELSE-BODY is executed. The 'else' part of the statement is
-optional. The condition is considered false if its value is zero or the
-null string; otherwise, the condition is true. Refer to the following:
-
- if (x % 2 == 0)
- print "x is even"
- else
- print "x is odd"
-
- In this example, if the expression 'x % 2 == 0' is true (i.e., if the
-value of 'x' is evenly divisible by two), then the first 'print'
-statement is executed; otherwise, the second 'print' statement is
-executed. If the 'else' keyword appears on the same line as THEN-BODY
-and THEN-BODY is not a compound statement (i.e., not surrounded by
-braces), then a semicolon must separate THEN-BODY from the 'else'. To
-illustrate this, the previous example can be rewritten as:
-
- if (x % 2 == 0) print "x is even"; else
- print "x is odd"
-
-If the ';' is left out, 'awk' can't interpret the statement and it
-produces a syntax error. Don't actually write programs this way,
-because a human reader might fail to see the 'else' if it is not the
-first thing on its line.
-
-
-File: gawk.info, Node: While Statement, Next: Do Statement, Prev: If Statement, Up: Statements
-
-7.4.2 The 'while' Statement
----------------------------
-
-In programming, a "loop" is a part of a program that can be executed two
-or more times in succession. The 'while' statement is the simplest
-looping statement in 'awk'. It repeatedly executes a statement as long
-as a condition is true. For example:
-
- while (CONDITION)
- BODY
-
-BODY is a statement called the "body" of the loop, and CONDITION is an
-expression that controls how long the loop keeps running. The first
-thing the 'while' statement does is test the CONDITION. If the
-CONDITION is true, it executes the statement BODY. (The CONDITION is
-true when the value is not zero and not a null string.) After BODY has
-been executed, CONDITION is tested again, and if it is still true, BODY
-executes again. This process repeats until the CONDITION is no longer
-true. If the CONDITION is initially false, the body of the loop never
-executes and 'awk' continues with the statement following the loop.
-This example prints the first three fields of each record, one per line:
-
- awk '
- {
- i = 1
- while (i <= 3) {
- print $i
- i++
- }
- }' inventory-shipped
-
-The body of this loop is a compound statement enclosed in braces,
-containing two statements. The loop works in the following manner:
-first, the value of 'i' is set to one. Then, the 'while' statement
-tests whether 'i' is less than or equal to three. This is true when 'i'
-equals one, so the 'i'th field is printed. Then the 'i++' increments
-the value of 'i' and the loop repeats. The loop terminates when 'i'
-reaches four.
-
- A newline is not required between the condition and the body;
-however, using one makes the program clearer unless the body is a
-compound statement or else is very simple. The newline after the open
-brace that begins the compound statement is not required either, but the
-program is harder to read without it.
-
-
-File: gawk.info, Node: Do Statement, Next: For Statement, Prev: While Statement, Up: Statements
-
-7.4.3 The 'do'-'while' Statement
---------------------------------
-
-The 'do' loop is a variation of the 'while' looping statement. The 'do'
-loop executes the BODY once and then repeats the BODY as long as the
-CONDITION is true. It looks like this:
-
- do
- BODY
- while (CONDITION)
-
- Even if the CONDITION is false at the start, the BODY executes at
-least once (and only once, unless executing BODY makes CONDITION true).
-Contrast this with the corresponding 'while' statement:
-
- while (CONDITION)
- BODY
-
-This statement does not execute the BODY even once if the CONDITION is
-false to begin with. The following is an example of a 'do' statement:
-
- {
- i = 1
- do {
- print $0
- i++
- } while (i <= 10)
- }
-
-This program prints each input record 10 times. However, it isn't a
-very realistic example, because in this case an ordinary 'while' would
-do just as well. This situation reflects actual experience; only
-occasionally is there a real use for a 'do' statement.
-
-
-File: gawk.info, Node: For Statement, Next: Switch Statement, Prev: Do Statement, Up: Statements
-
-7.4.4 The 'for' Statement
--------------------------
-
-The 'for' statement makes it more convenient to count iterations of a
-loop. The general form of the 'for' statement looks like this:
-
- for (INITIALIZATION; CONDITION; INCREMENT)
- BODY
-
-The INITIALIZATION, CONDITION, and INCREMENT parts are arbitrary 'awk'
-expressions, and BODY stands for any 'awk' statement.
-
- The 'for' statement starts by executing INITIALIZATION. Then, as
-long as the CONDITION is true, it repeatedly executes BODY and then
-INCREMENT. Typically, INITIALIZATION sets a variable to either zero or
-one, INCREMENT adds one to it, and CONDITION compares it against the
-desired number of iterations. For example:
-
- awk '
- {
- for (i = 1; i <= 3; i++)
- print $i
- }' inventory-shipped
-
-This prints the first three fields of each input record, with one field
-per line.
-
- It isn't possible to set more than one variable in the INITIALIZATION
-part without using a multiple assignment statement such as 'x = y = 0'.
-This makes sense only if all the initial values are equal. (But it is
-possible to initialize additional variables by writing their assignments
-as separate statements preceding the 'for' loop.)
-
- The same is true of the INCREMENT part. Incrementing additional
-variables requires separate statements at the end of the loop. The C
-compound expression, using C's comma operator, is useful in this
-context, but it is not supported in 'awk'.
-
- Most often, INCREMENT is an increment expression, as in the previous
-example. But this is not required; it can be any expression whatsoever.
-For example, the following statement prints all the powers of two
-between 1 and 100:
-
- for (i = 1; i <= 100; i *= 2)
- print i
-
- If there is nothing to be done, any of the three expressions in the
-parentheses following the 'for' keyword may be omitted. Thus,
-'for (; x > 0;)' is equivalent to 'while (x > 0)'. If the CONDITION is
-omitted, it is treated as true, effectively yielding an "infinite loop"
-(i.e., a loop that never terminates).
-
- In most cases, a 'for' loop is an abbreviation for a 'while' loop, as
-shown here:
-
- INITIALIZATION
- while (CONDITION) {
- BODY
- INCREMENT
- }
-
-The only exception is when the 'continue' statement (*note Continue
-Statement::) is used inside the loop. Changing a 'for' statement to a
-'while' statement in this way can change the effect of the 'continue'
-statement inside the loop.
-
- The 'awk' language has a 'for' statement in addition to a 'while'
-statement because a 'for' loop is often both less work to type and more
-natural to think of. Counting the number of iterations is very common
-in loops. It can be easier to think of this counting as part of looping
-rather than as something to do inside the loop.
-
- There is an alternative version of the 'for' loop, for iterating over
-all the indices of an array:
-
- for (i in array)
- DO SOMETHING WITH array[i]
-
-*Note Scanning an Array:: for more information on this version of the
-'for' loop.
-
-
-File: gawk.info, Node: Switch Statement, Next: Break Statement, Prev: For Statement, Up: Statements
-
-7.4.5 The 'switch' Statement
-----------------------------
-
-This minor node describes a 'gawk'-specific feature. If 'gawk' is in
-compatibility mode (*note Options::), it is not available.
-
- The 'switch' statement allows the evaluation of an expression and the
-execution of statements based on a 'case' match. Case statements are
-checked for a match in the order they are defined. If no suitable
-'case' is found, the 'default' section is executed, if supplied.
-
- Each 'case' contains a single constant, be it numeric, string, or
-regexp. The 'switch' expression is evaluated, and then each 'case''s
-constant is compared against the result in turn. The type of constant
-determines the comparison: numeric or string do the usual comparisons.
-A regexp constant does a regular expression match against the string
-value of the original expression. The general form of the 'switch'
-statement looks like this:
-
- switch (EXPRESSION) {
- case VALUE OR REGULAR EXPRESSION:
- CASE-BODY
- default:
- DEFAULT-BODY
- }
-
- Control flow in the 'switch' statement works as it does in C. Once a
-match to a given case is made, the case statement bodies execute until a
-'break', 'continue', 'next', 'nextfile', or 'exit' is encountered, or
-the end of the 'switch' statement itself. For example:
-
- while ((c = getopt(ARGC, ARGV, "aksx")) != -1) {
- switch (c) {
- case "a":
- # report size of all files
- all_files = TRUE;
- break
- case "k":
- BLOCK_SIZE = 1024 # 1K block size
- break
- case "s":
- # do sums only
- sum_only = TRUE
- break
- case "x":
- # don't cross filesystems
- fts_flags = or(fts_flags, FTS_XDEV)
- break
- case "?":
- default:
- usage()
- break
- }
- }
-
- Note that if none of the statements specified here halt execution of
-a matched 'case' statement, execution falls through to the next 'case'
-until execution halts. In this example, the 'case' for '"?"' falls
-through to the 'default' case, which is to call a function named
-'usage()'. (The 'getopt()' function being called here is described in
-*note Getopt Function::.)
-
-
-File: gawk.info, Node: Break Statement, Next: Continue Statement, Prev: Switch Statement, Up: Statements
-
-7.4.6 The 'break' Statement
----------------------------
-
-The 'break' statement jumps out of the innermost 'for', 'while', or 'do'
-loop that encloses it. The following example finds the smallest divisor
-of any integer, and also identifies prime numbers:
-
- # find smallest divisor of num
- {
- num = $1
- for (divisor = 2; divisor * divisor <= num; divisor++) {
- if (num % divisor == 0)
- break
- }
- if (num % divisor == 0)
- printf "Smallest divisor of %d is %d\n", num, divisor
- else
- printf "%d is prime\n", num
- }
-
- When the remainder is zero in the first 'if' statement, 'awk'
-immediately "breaks out" of the containing 'for' loop. This means that
-'awk' proceeds immediately to the statement following the loop and
-continues processing. (This is very different from the 'exit'
-statement, which stops the entire 'awk' program. *Note Exit
-Statement::.)
-
- The following program illustrates how the CONDITION of a 'for' or
-'while' statement could be replaced with a 'break' inside an 'if':
-
- # find smallest divisor of num
- {
- num = $1
- for (divisor = 2; ; divisor++) {
- if (num % divisor == 0) {
- printf "Smallest divisor of %d is %d\n", num, divisor
- break
- }
- if (divisor * divisor > num) {
- printf "%d is prime\n", num
- break
- }
- }
- }
-
- The 'break' statement is also used to break out of the 'switch'
-statement. This is discussed in *note Switch Statement::.
-
- The 'break' statement has no meaning when used outside the body of a
-loop or 'switch'. However, although it was never documented, historical
-implementations of 'awk' treated the 'break' statement outside of a loop
-as if it were a 'next' statement (*note Next Statement::). (d.c.)
-Recent versions of BWK 'awk' no longer allow this usage, nor does
-'gawk'.
-
-
-File: gawk.info, Node: Continue Statement, Next: Next Statement, Prev: Break Statement, Up: Statements
-
-7.4.7 The 'continue' Statement
-------------------------------
-
-Similar to 'break', the 'continue' statement is used only inside 'for',
-'while', and 'do' loops. It skips over the rest of the loop body,
-causing the next cycle around the loop to begin immediately. Contrast
-this with 'break', which jumps out of the loop altogether.
-
- The 'continue' statement in a 'for' loop directs 'awk' to skip the
-rest of the body of the loop and resume execution with the
-increment-expression of the 'for' statement. The following program
-illustrates this fact:
-
- BEGIN {
- for (x = 0; x <= 20; x++) {
- if (x == 5)
- continue
- printf "%d ", x
- }
- print ""
- }
-
-This program prints all the numbers from 0 to 20--except for 5, for
-which the 'printf' is skipped. Because the increment 'x++' is not
-skipped, 'x' does not remain stuck at 5. Contrast the 'for' loop from
-the previous example with the following 'while' loop:
-
- BEGIN {
- x = 0
- while (x <= 20) {
- if (x == 5)
- continue
- printf "%d ", x
- x++
- }
- print ""
- }
-
-This program loops forever once 'x' reaches 5, because the increment
-('x++') is never reached.
-
- The 'continue' statement has no special meaning with respect to the
-'switch' statement, nor does it have any meaning when used outside the
-body of a loop. Historical versions of 'awk' treated a 'continue'
-statement outside a loop the same way they treated a 'break' statement
-outside a loop: as if it were a 'next' statement (*note Next
-Statement::). (d.c.) Recent versions of BWK 'awk' no longer work this
-way, nor does 'gawk'.
-
-
-File: gawk.info, Node: Next Statement, Next: Nextfile Statement, Prev: Continue Statement, Up: Statements
-
-7.4.8 The 'next' Statement
---------------------------
-
-The 'next' statement forces 'awk' to immediately stop processing the
-current record and go on to the next record. This means that no further
-rules are executed for the current record, and the rest of the current
-rule's action isn't executed.
-
- Contrast this with the effect of the 'getline' function (*note
-Getline::). That also causes 'awk' to read the next record immediately,
-but it does not alter the flow of control in any way (i.e., the rest of
-the current action executes with a new input record).
-
- At the highest level, 'awk' program execution is a loop that reads an
-input record and then tests each rule's pattern against it. If you
-think of this loop as a 'for' statement whose body contains the rules,
-then the 'next' statement is analogous to a 'continue' statement. It
-skips to the end of the body of this implicit loop and executes the
-increment (which reads another record).
-
- For example, suppose an 'awk' program works only on records with four
-fields, and it shouldn't fail when given bad input. To avoid
-complicating the rest of the program, write a "weed out" rule near the
-beginning, in the following manner:
-
- NF != 4 {
- printf("%s:%d: skipped: NF != 4\n", FILENAME, FNR) > "/dev/stderr"
- next
- }
-
-Because of the 'next' statement, the program's subsequent rules won't
-see the bad record. The error message is redirected to the standard
-error output stream, as error messages should be. For more detail, see
-*note Special Files::.
-
- If the 'next' statement causes the end of the input to be reached,
-then the code in any 'END' rules is executed. *Note BEGIN/END::.
-
- The 'next' statement is not allowed inside 'BEGINFILE' and 'ENDFILE'
-rules. *Note BEGINFILE/ENDFILE::.
-
- According to the POSIX standard, the behavior is undefined if the
-'next' statement is used in a 'BEGIN' or 'END' rule. 'gawk' treats it
-as a syntax error. Although POSIX does not disallow it, most other
-'awk' implementations don't allow the 'next' statement inside function
-bodies (*note User-defined::). Just as with any other 'next' statement,
-a 'next' statement inside a function body reads the next record and
-starts processing it with the first rule in the program.
-
-
-File: gawk.info, Node: Nextfile Statement, Next: Exit Statement, Prev: Next Statement, Up: Statements
-
-7.4.9 The 'nextfile' Statement
-------------------------------
-
-The 'nextfile' statement is similar to the 'next' statement. However,
-instead of abandoning processing of the current record, the 'nextfile'
-statement instructs 'awk' to stop processing the current data file.
-
- Upon execution of the 'nextfile' statement, 'FILENAME' is updated to
-the name of the next data file listed on the command line, 'FNR' is
-reset to one, and processing starts over with the first rule in the
-program. If the 'nextfile' statement causes the end of the input to be
-reached, then the code in any 'END' rules is executed. An exception to
-this is when 'nextfile' is invoked during execution of any statement in
-an 'END' rule; in this case, it causes the program to stop immediately.
-*Note BEGIN/END::.
-
- The 'nextfile' statement is useful when there are many data files to
-process but it isn't necessary to process every record in every file.
-Without 'nextfile', in order to move on to the next data file, a program
-would have to continue scanning the unwanted records. The 'nextfile'
-statement accomplishes this much more efficiently.
-
- In 'gawk', execution of 'nextfile' causes additional things to
-happen: any 'ENDFILE' rules are executed if 'gawk' is not currently in
-an 'END' or 'BEGINFILE' rule, 'ARGIND' is incremented, and any
-'BEGINFILE' rules are executed. ('ARGIND' hasn't been introduced yet.
-*Note Built-in Variables::.)
-
- With 'gawk', 'nextfile' is useful inside a 'BEGINFILE' rule to skip
-over a file that would otherwise cause 'gawk' to exit with a fatal
-error. In this case, 'ENDFILE' rules are not executed. *Note
-BEGINFILE/ENDFILE::.
-
- Although it might seem that 'close(FILENAME)' would accomplish the
-same as 'nextfile', this isn't true. 'close()' is reserved for closing
-files, pipes, and coprocesses that are opened with redirections. It is
-not related to the main processing that 'awk' does with the files listed
-in 'ARGV'.
-
- NOTE: For many years, 'nextfile' was a common extension. In
- September 2012, it was accepted for inclusion into the POSIX
- standard. See the Austin Group website
- (http://austingroupbugs.net/view.php?id=607).
-
- The current version of BWK 'awk' and 'mawk' also support 'nextfile'.
-However, they don't allow the 'nextfile' statement inside function
-bodies (*note User-defined::). 'gawk' does; a 'nextfile' inside a
-function body reads the first record from the next file and starts
-processing it with the first rule in the program, just as any other
-'nextfile' statement.
-
-
-File: gawk.info, Node: Exit Statement, Prev: Nextfile Statement, Up: Statements
-
-7.4.10 The 'exit' Statement
----------------------------
-
-The 'exit' statement causes 'awk' to immediately stop executing the
-current rule and to stop processing input; any remaining input is
-ignored. The 'exit' statement is written as follows:
-
- 'exit' [RETURN CODE]
-
- When an 'exit' statement is executed from a 'BEGIN' rule, the program
-stops processing everything immediately. No input records are read.
-However, if an 'END' rule is present, as part of executing the 'exit'
-statement, the 'END' rule is executed (*note BEGIN/END::). If 'exit' is
-used in the body of an 'END' rule, it causes the program to stop
-immediately.
-
- An 'exit' statement that is not part of a 'BEGIN' or 'END' rule stops
-the execution of any further automatic rules for the current record,
-skips reading any remaining input records, and executes the 'END' rule
-if there is one. 'gawk' also skips any 'ENDFILE' rules; they do not
-execute.
-
- In such a case, if you don't want the 'END' rule to do its job, set a
-variable to a nonzero value before the 'exit' statement and check that
-variable in the 'END' rule. *Note Assert Function:: for an example that
-does this.
-
- If an argument is supplied to 'exit', its value is used as the exit
-status code for the 'awk' process. If no argument is supplied, 'exit'
-causes 'awk' to return a "success" status. In the case where an
-argument is supplied to a first 'exit' statement, and then 'exit' is
-called a second time from an 'END' rule with no argument, 'awk' uses the
-previously supplied exit value. (d.c.) *Note Exit Status:: for more
-information.
-
- For example, suppose an error condition occurs that is difficult or
-impossible to handle. Conventionally, programs report this by exiting
-with a nonzero status. An 'awk' program can do this using an 'exit'
-statement with a nonzero argument, as shown in the following example:
-
- BEGIN {
- if (("date" | getline date_now) <= 0) {
- print "Can't get system date" > "/dev/stderr"
- exit 1
- }
- print "current date is", date_now
- close("date")
- }
-
- NOTE: For full portability, exit values should be between zero and
- 126, inclusive. Negative values, and values of 127 or greater, may
- not produce consistent results across different operating systems.
-
-
-File: gawk.info, Node: Built-in Variables, Next: Pattern Action Summary, Prev: Statements, Up: Patterns and Actions
-
-7.5 Predefined Variables
-========================
-
-Most 'awk' variables are available to use for your own purposes; they
-never change unless your program assigns values to them, and they never
-affect anything unless your program examines them. However, a few
-variables in 'awk' have special built-in meanings. 'awk' examines some
-of these automatically, so that they enable you to tell 'awk' how to do
-certain things. Others are set automatically by 'awk', so that they
-carry information from the internal workings of 'awk' to your program.
-
- This minor node documents all of 'gawk''s predefined variables, most
-of which are also documented in the major nodes describing their areas
-of activity.
-
-* Menu:
-
-* User-modified:: Built-in variables that you change to control
- 'awk'.
-* Auto-set:: Built-in variables where 'awk' gives
- you information.
-* ARGC and ARGV:: Ways to use 'ARGC' and 'ARGV'.
-
-
-File: gawk.info, Node: User-modified, Next: Auto-set, Up: Built-in Variables
-
-7.5.1 Built-in Variables That Control 'awk'
--------------------------------------------
-
-The following is an alphabetical list of variables that you can change
-to control how 'awk' does certain things.
-
- The variables that are specific to 'gawk' are marked with a pound
-sign ('#'). These variables are 'gawk' extensions. In other 'awk'
-implementations or if 'gawk' is in compatibility mode (*note Options::),
-they are not special. (Any exceptions are noted in the description of
-each variable.)
-
-'BINMODE #'
- On non-POSIX systems, this variable specifies use of binary mode
- for all I/O. Numeric values of one, two, or three specify that
- input files, output files, or all files, respectively, should use
- binary I/O. A numeric value less than zero is treated as zero, and
- a numeric value greater than three is treated as three.
- Alternatively, string values of '"r"' or '"w"' specify that input
- files and output files, respectively, should use binary I/O. A
- string value of '"rw"' or '"wr"' indicates that all files should
- use binary I/O. Any other string value is treated the same as
- '"rw"', but causes 'gawk' to generate a warning message. 'BINMODE'
- is described in more detail in *note PC Using::. 'mawk' (*note
- Other Versions::) also supports this variable, but only using
- numeric values.
-
-'CONVFMT'
- A string that controls the conversion of numbers to strings (*note
- Conversion::). It works by being passed, in effect, as the first
- argument to the 'sprintf()' function (*note String Functions::).
- Its default value is '"%.6g"'. 'CONVFMT' was introduced by the
- POSIX standard.
-
-'FIELDWIDTHS #'
- A space-separated list of columns that tells 'gawk' how to split
- input with fixed columnar boundaries. Assigning a value to
- 'FIELDWIDTHS' overrides the use of 'FS' and 'FPAT' for field
- splitting. *Note Constant Size:: for more information.
-
-'FPAT #'
- A regular expression (as a string) that tells 'gawk' to create the
- fields based on text that matches the regular expression.
- Assigning a value to 'FPAT' overrides the use of 'FS' and
- 'FIELDWIDTHS' for field splitting. *Note Splitting By Content::
- for more information.
-
-'FS'
- The input field separator (*note Field Separators::). The value is
- a single-character string or a multicharacter regular expression
- that matches the separations between fields in an input record. If
- the value is the null string ('""'), then each character in the
- record becomes a separate field. (This behavior is a 'gawk'
- extension. POSIX 'awk' does not specify the behavior when 'FS' is
- the null string. Nonetheless, some other versions of 'awk' also
- treat '""' specially.)
-
- The default value is '" "', a string consisting of a single space.
- As a special exception, this value means that any sequence of
- spaces, TABs, and/or newlines is a single separator. It also
- causes spaces, TABs, and newlines at the beginning and end of a
- record to be ignored.
-
- You can set the value of 'FS' on the command line using the '-F'
- option:
-
- awk -F, 'PROGRAM' INPUT-FILES
-
- If 'gawk' is using 'FIELDWIDTHS' or 'FPAT' for field splitting,
- assigning a value to 'FS' causes 'gawk' to return to the normal,
- 'FS'-based field splitting. An easy way to do this is to simply
- say 'FS = FS', perhaps with an explanatory comment.
-
-'IGNORECASE #'
- If 'IGNORECASE' is nonzero or non-null, then all string comparisons
- and all regular expression matching are case-independent. This
- applies to regexp matching with '~' and '!~', the 'gensub()',
- 'gsub()', 'index()', 'match()', 'patsplit()', 'split()', and
- 'sub()' functions, record termination with 'RS', and field
- splitting with 'FS' and 'FPAT'. However, the value of 'IGNORECASE'
- does _not_ affect array subscripting and it does not affect field
- splitting when using a single-character field separator. *Note
- Case-sensitivity::.
-
-'LINT #'
- When this variable is true (nonzero or non-null), 'gawk' behaves as
- if the '--lint' command-line option is in effect (*note Options::).
- With a value of '"fatal"', lint warnings become fatal errors. With
- a value of '"invalid"', only warnings about things that are
- actually invalid are issued. (This is not fully implemented yet.)
- Any other true value prints nonfatal warnings. Assigning a false
- value to 'LINT' turns off the lint warnings.
-
- This variable is a 'gawk' extension. It is not special in other
- 'awk' implementations. Unlike with the other special variables,
- changing 'LINT' does affect the production of lint warnings, even
- if 'gawk' is in compatibility mode. Much as the '--lint' and
- '--traditional' options independently control different aspects of
- 'gawk''s behavior, the control of lint warnings during program
- execution is independent of the flavor of 'awk' being executed.
-
-'OFMT'
- A string that controls conversion of numbers to strings (*note
- Conversion::) for printing with the 'print' statement. It works by
- being passed as the first argument to the 'sprintf()' function
- (*note String Functions::). Its default value is '"%.6g"'.
- Earlier versions of 'awk' used 'OFMT' to specify the format for
- converting numbers to strings in general expressions; this is now
- done by 'CONVFMT'.
-
-'OFS'
- The output field separator (*note Output Separators::). It is
- output between the fields printed by a 'print' statement. Its
- default value is '" "', a string consisting of a single space.
-
-'ORS'
- The output record separator. It is output at the end of every
- 'print' statement. Its default value is '"\n"', the newline
- character. (*Note Output Separators::.)
-
-'PREC #'
- The working precision of arbitrary-precision floating-point
- numbers, 53 bits by default (*note Setting precision::).
-
-'ROUNDMODE #'
- The rounding mode to use for arbitrary-precision arithmetic on
- numbers, by default '"N"' ('roundTiesToEven' in the IEEE 754
- standard; *note Setting the rounding mode::).
-
-'RS'
- The input record separator. Its default value is a string
- containing a single newline character, which means that an input
- record consists of a single line of text. It can also be the null
- string, in which case records are separated by runs of blank lines.
- If it is a regexp, records are separated by matches of the regexp
- in the input text. (*Note Records::.)
-
- The ability for 'RS' to be a regular expression is a 'gawk'
- extension. In most other 'awk' implementations, or if 'gawk' is in
- compatibility mode (*note Options::), just the first character of
- 'RS''s value is used.
-
-'SUBSEP'
- The subscript separator. It has the default value of '"\034"' and
- is used to separate the parts of the indices of a multidimensional
- array. Thus, the expression 'foo["A", "B"]' really accesses
- 'foo["A\034B"]' (*note Multidimensional::).
-
-'TEXTDOMAIN #'
- Used for internationalization of programs at the 'awk' level. It
- sets the default text domain for specially marked string constants
- in the source text, as well as for the 'dcgettext()',
- 'dcngettext()', and 'bindtextdomain()' functions (*note
- Internationalization::). The default value of 'TEXTDOMAIN' is
- '"messages"'.
-
-
-File: gawk.info, Node: Auto-set, Next: ARGC and ARGV, Prev: User-modified, Up: Built-in Variables
-
-7.5.2 Built-in Variables That Convey Information
-------------------------------------------------
-
-The following is an alphabetical list of variables that 'awk' sets
-automatically on certain occasions in order to provide information to
-your program.
-
- The variables that are specific to 'gawk' are marked with a pound
-sign ('#'). These variables are 'gawk' extensions. In other 'awk'
-implementations or if 'gawk' is in compatibility mode (*note Options::),
-they are not special:
-
-'ARGC', 'ARGV'
- The command-line arguments available to 'awk' programs are stored
- in an array called 'ARGV'. 'ARGC' is the number of command-line
- arguments present. *Note Other Arguments::. Unlike most 'awk'
- arrays, 'ARGV' is indexed from 0 to 'ARGC' - 1. In the following
- example:
-
- $ awk 'BEGIN {
- > for (i = 0; i < ARGC; i++)
- > print ARGV[i]
- > }' inventory-shipped mail-list
- -| awk
- -| inventory-shipped
- -| mail-list
-
- 'ARGV[0]' contains 'awk', 'ARGV[1]' contains 'inventory-shipped',
- and 'ARGV[2]' contains 'mail-list'. The value of 'ARGC' is three,
- one more than the index of the last element in 'ARGV', because the
- elements are numbered from zero.
-
- The names 'ARGC' and 'ARGV', as well as the convention of indexing
- the array from 0 to 'ARGC' - 1, are derived from the C language's
- method of accessing command-line arguments.
-
- The value of 'ARGV[0]' can vary from system to system. Also, you
- should note that the program text is _not_ included in 'ARGV', nor
- are any of 'awk''s command-line options. *Note ARGC and ARGV:: for
- information about how 'awk' uses these variables. (d.c.)
-
-'ARGIND #'
- The index in 'ARGV' of the current file being processed. Every
- time 'gawk' opens a new data file for processing, it sets 'ARGIND'
- to the index in 'ARGV' of the file name. When 'gawk' is processing
- the input files, 'FILENAME == ARGV[ARGIND]' is always true.
-
- This variable is useful in file processing; it allows you to tell
- how far along you are in the list of data files as well as to
- distinguish between successive instances of the same file name on
- the command line.
-
- While you can change the value of 'ARGIND' within your 'awk'
- program, 'gawk' automatically sets it to a new value when it opens
- the next file.
-
-'ENVIRON'
- An associative array containing the values of the environment. The
- array indices are the environment variable names; the elements are
- the values of the particular environment variables. For example,
- 'ENVIRON["HOME"]' might be '/home/arnold'.
-
- For POSIX 'awk', changing this array does not affect the
- environment passed on to any programs that 'awk' may spawn via
- redirection or the 'system()' function.
-
- However, beginning with version 4.2, if not in POSIX compatibility
- mode, 'gawk' does update its own environment when 'ENVIRON' is
- changed, thus changing the environment seen by programs that it
- creates. You should therefore be especially careful if you modify
- 'ENVIRON["PATH"]', which is the search path for finding executable
- programs.
-
- This can also affect the running 'gawk' program, since some of the
- built-in functions may pay attention to certain environment
- variables. The most notable instance of this is 'mktime()' (*note
- Time Functions::), which pays attention the value of the 'TZ'
- environment variable on many systems.
-
- Some operating systems may not have environment variables. On such
- systems, the 'ENVIRON' array is empty (except for
- 'ENVIRON["AWKPATH"]' and 'ENVIRON["AWKLIBPATH"]'; *note AWKPATH
- Variable:: and *note AWKLIBPATH Variable::).
-
-'ERRNO #'
- If a system error occurs during a redirection for 'getline', during
- a read for 'getline', or during a 'close()' operation, then 'ERRNO'
- contains a string describing the error.
-
- In addition, 'gawk' clears 'ERRNO' before opening each command-line
- input file. This enables checking if the file is readable inside a
- 'BEGINFILE' pattern (*note BEGINFILE/ENDFILE::).
-
- Otherwise, 'ERRNO' works similarly to the C variable 'errno'.
- Except for the case just mentioned, 'gawk' _never_ clears it (sets
- it to zero or '""'). Thus, you should only expect its value to be
- meaningful when an I/O operation returns a failure value, such as
- 'getline' returning -1. You are, of course, free to clear it
- yourself before doing an I/O operation.
-
- If the value of 'ERRNO' corresponds to a system error in the C
- 'errno' variable, then 'PROCINFO["errno"]' will be set to the value
- of 'errno'. For non-system errors, 'PROCINFO["errno"]' will be
- zero.
-
-'FILENAME'
- The name of the current input file. When no data files are listed
- on the command line, 'awk' reads from the standard input and
- 'FILENAME' is set to '"-"'. 'FILENAME' changes each time a new
- file is read (*note Reading Files::). Inside a 'BEGIN' rule, the
- value of 'FILENAME' is '""', because there are no input files being
- processed yet.(1) (d.c.) Note, though, that using 'getline'
- (*note Getline::) inside a 'BEGIN' rule can give 'FILENAME' a
- value.
-
-'FNR'
- The current record number in the current file. 'awk' increments
- 'FNR' each time it reads a new record (*note Records::). 'awk'
- resets 'FNR' to zero each time it starts a new input file.
-
-'NF'
- The number of fields in the current input record. 'NF' is set each
- time a new record is read, when a new field is created, or when
- '$0' changes (*note Fields::).
-
- Unlike most of the variables described in this node, assigning a
- value to 'NF' has the potential to affect 'awk''s internal
- workings. In particular, assignments to 'NF' can be used to create
- fields in or remove fields from the current record. *Note Changing
- Fields::.
-
-'FUNCTAB #'
- An array whose indices and corresponding values are the names of
- all the built-in, user-defined, and extension functions in the
- program.
-
- NOTE: Attempting to use the 'delete' statement with the
- 'FUNCTAB' array causes a fatal error. Any attempt to assign
- to an element of 'FUNCTAB' also causes a fatal error.
-
-'NR'
- The number of input records 'awk' has processed since the beginning
- of the program's execution (*note Records::). 'awk' increments
- 'NR' each time it reads a new record.
-
-'PROCINFO #'
- The elements of this array provide access to information about the
- running 'awk' program. The following elements (listed
- alphabetically) are guaranteed to be available:
-
- 'PROCINFO["egid"]'
- The value of the 'getegid()' system call.
-
- 'PROCINFO["errno"]'
- The value of the C 'errno' variable when 'ERRNO' is set to the
- associated error message.
-
- 'PROCINFO["euid"]'
- The value of the 'geteuid()' system call.
-
- 'PROCINFO["FS"]'
- This is '"FS"' if field splitting with 'FS' is in effect,
- '"FIELDWIDTHS"' if field splitting with 'FIELDWIDTHS' is in
- effect, or '"FPAT"' if field matching with 'FPAT' is in
- effect.
-
- 'PROCINFO["gid"]'
- The value of the 'getgid()' system call.
-
- 'PROCINFO["identifiers"]'
- A subarray, indexed by the names of all identifiers used in
- the text of the 'awk' program. An "identifier" is simply the
- name of a variable (be it scalar or array), built-in function,
- user-defined function, or extension function. For each
- identifier, the value of the element is one of the following:
-
- '"array"'
- The identifier is an array.
-
- '"builtin"'
- The identifier is a built-in function.
-
- '"extension"'
- The identifier is an extension function loaded via
- '@load' or '-l'.
-
- '"scalar"'
- The identifier is a scalar.
-
- '"untyped"'
- The identifier is untyped (could be used as a scalar or
- an array; 'gawk' doesn't know yet).
-
- '"user"'
- The identifier is a user-defined function.
-
- The values indicate what 'gawk' knows about the identifiers
- after it has finished parsing the program; they are _not_
- updated while the program runs.
-
- 'PROCINFO["pgrpid"]'
- The process group ID of the current process.
-
- 'PROCINFO["pid"]'
- The process ID of the current process.
-
- 'PROCINFO["ppid"]'
- The parent process ID of the current process.
-
- 'PROCINFO["strftime"]'
- The default time format string for 'strftime()'. Assigning a
- new value to this element changes the default. *Note Time
- Functions::.
-
- 'PROCINFO["uid"]'
- The value of the 'getuid()' system call.
-
- 'PROCINFO["version"]'
- The version of 'gawk'.
-
- The following additional elements in the array are available to
- provide information about the MPFR and GMP libraries if your
- version of 'gawk' supports arbitrary-precision arithmetic (*note
- Arbitrary Precision Arithmetic::):
-
- 'PROCINFO["gmp_version"]'
- The version of the GNU MP library.
-
- 'PROCINFO["mpfr_version"]'
- The version of the GNU MPFR library.
-
- 'PROCINFO["prec_max"]'
- The maximum precision supported by MPFR.
-
- 'PROCINFO["prec_min"]'
- The minimum precision required by MPFR.
-
- The following additional elements in the array are available to
- provide information about the version of the extension API, if your
- version of 'gawk' supports dynamic loading of extension functions
- (*note Dynamic Extensions::):
-
- 'PROCINFO["api_major"]'
- The major version of the extension API.
-
- 'PROCINFO["api_minor"]'
- The minor version of the extension API.
-
- On some systems, there may be elements in the array, '"group1"'
- through '"groupN"' for some N. N is the number of supplementary
- groups that the process has. Use the 'in' operator to test for
- these elements (*note Reference to Elements::).
-
- The following elements allow you to change 'gawk''s behavior:
-
- 'PROCINFO["NONFATAL"]'
- If this element exists, then I/O errors for all output
- redirections become nonfatal. *Note Nonfatal::.
-
- 'PROCINFO["OUTPUT_NAME", "NONFATAL"]'
- Make output errors for OUTPUT_NAME be nonfatal. *Note
- Nonfatal::.
-
- 'PROCINFO["COMMAND", "pty"]'
- For two-way communication to COMMAND, use a pseudo-tty instead
- of setting up a two-way pipe. *Note Two-way I/O:: for more
- information.
-
- 'PROCINFO["INPUT_NAME", "READ_TIMEOUT"]'
- Set a timeout for reading from input redirection INPUT_NAME.
- *Note Read Timeout:: for more information.
-
- 'PROCINFO["sorted_in"]'
- If this element exists in 'PROCINFO', its value controls the
- order in which array indices will be processed by 'for (INDX
- in ARRAY)' loops. This is an advanced feature, so we defer
- the full description until later; see *note Scanning an
- Array::.
-
-'RLENGTH'
- The length of the substring matched by the 'match()' function
- (*note String Functions::). 'RLENGTH' is set by invoking the
- 'match()' function. Its value is the length of the matched string,
- or -1 if no match is found.
-
-'RSTART'
- The start index in characters of the substring that is matched by
- the 'match()' function (*note String Functions::). 'RSTART' is set
- by invoking the 'match()' function. Its value is the position of
- the string where the matched substring starts, or zero if no match
- was found.
-
-'RT #'
- The input text that matched the text denoted by 'RS', the record
- separator. It is set every time a record is read.
-
-'SYMTAB #'
- An array whose indices are the names of all defined global
- variables and arrays in the program. 'SYMTAB' makes 'gawk''s
- symbol table visible to the 'awk' programmer. It is built as
- 'gawk' parses the program and is complete before the program starts
- to run.
-
- The array may be used for indirect access to read or write the
- value of a variable:
-
- foo = 5
- SYMTAB["foo"] = 4
- print foo # prints 4
-
- The 'isarray()' function (*note Type Functions::) may be used to
- test if an element in 'SYMTAB' is an array. Also, you may not use
- the 'delete' statement with the 'SYMTAB' array.
-
- You may use an index for 'SYMTAB' that is not a predefined
- identifier:
-
- SYMTAB["xxx"] = 5
- print SYMTAB["xxx"]
-
- This works as expected: in this case 'SYMTAB' acts just like a
- regular array. The only difference is that you can't then delete
- 'SYMTAB["xxx"]'.
-
- The 'SYMTAB' array is more interesting than it looks. Andrew
- Schorr points out that it effectively gives 'awk' data pointers.
- Consider his example:
-
- # Indirect multiply of any variable by amount, return result
-
- function multiply(variable, amount)
- {
- return SYMTAB[variable] *= amount
- }
-
- You would use it like this:
-
- BEGIN {
- answer = 10.5
- multiply("answer", 4)
- print "The answer is", answer
- }
-
- When run, this produces:
-
- $ gawk -f answer.awk
- -| The answer is 42
-
- NOTE: In order to avoid severe time-travel paradoxes,(2)
- neither 'FUNCTAB' nor 'SYMTAB' is available as an element
- within the 'SYMTAB' array.
-
- Changing 'NR' and 'FNR'
-
- 'awk' increments 'NR' and 'FNR' each time it reads a record, instead
-of setting them to the absolute value of the number of records read.
-This means that a program can change these variables and their new
-values are incremented for each record. (d.c.) The following example
-shows this:
-
- $ echo '1
- > 2
- > 3
- > 4' | awk 'NR == 2 { NR = 17 }
- > { print NR }'
- -| 1
- -| 17
- -| 18
- -| 19
-
-Before 'FNR' was added to the 'awk' language (*note V7/SVR3.1::), many
-'awk' programs used this feature to track the number of records in a
-file by resetting 'NR' to zero when 'FILENAME' changed.
-
- ---------- Footnotes ----------
-
- (1) Some early implementations of Unix 'awk' initialized 'FILENAME'
-to '"-"', even if there were data files to be processed. This behavior
-was incorrect and should not be relied upon in your programs.
-
- (2) Not to mention difficult implementation issues.
-
-
-File: gawk.info, Node: ARGC and ARGV, Prev: Auto-set, Up: Built-in Variables
-
-7.5.3 Using 'ARGC' and 'ARGV'
------------------------------
-
-*note Auto-set:: presented the following program describing the
-information contained in 'ARGC' and 'ARGV':
-
- $ awk 'BEGIN {
- > for (i = 0; i < ARGC; i++)
- > print ARGV[i]
- > }' inventory-shipped mail-list
- -| awk
- -| inventory-shipped
- -| mail-list
-
-In this example, 'ARGV[0]' contains 'awk', 'ARGV[1]' contains
-'inventory-shipped', and 'ARGV[2]' contains 'mail-list'. Notice that
-the 'awk' program is not entered in 'ARGV'. The other command-line
-options, with their arguments, are also not entered. This includes
-variable assignments done with the '-v' option (*note Options::).
-Normal variable assignments on the command line _are_ treated as
-arguments and do show up in the 'ARGV' array. Given the following
-program in a file named 'showargs.awk':
-
- BEGIN {
- printf "A=%d, B=%d\n", A, B
- for (i = 0; i < ARGC; i++)
- printf "\tARGV[%d] = %s\n", i, ARGV[i]
- }
- END { printf "A=%d, B=%d\n", A, B }
-
-Running it produces the following:
-
- $ awk -v A=1 -f showargs.awk B=2 /dev/null
- -| A=1, B=0
- -| ARGV[0] = awk
- -| ARGV[1] = B=2
- -| ARGV[2] = /dev/null
- -| A=1, B=2
-
- A program can alter 'ARGC' and the elements of 'ARGV'. Each time
-'awk' reaches the end of an input file, it uses the next element of
-'ARGV' as the name of the next input file. By storing a different
-string there, a program can change which files are read. Use '"-"' to
-represent the standard input. Storing additional elements and
-incrementing 'ARGC' causes additional files to be read.
-
- If the value of 'ARGC' is decreased, that eliminates input files from
-the end of the list. By recording the old value of 'ARGC' elsewhere, a
-program can treat the eliminated arguments as something other than file
-names.
-
- To eliminate a file from the middle of the list, store the null
-string ('""') into 'ARGV' in place of the file's name. As a special
-feature, 'awk' ignores file names that have been replaced with the null
-string. Another option is to use the 'delete' statement to remove
-elements from 'ARGV' (*note Delete::).
-
- All of these actions are typically done in the 'BEGIN' rule, before
-actual processing of the input begins. *Note Split Program:: and *note
-Tee Program:: for examples of each way of removing elements from 'ARGV'.
-
- To actually get options into an 'awk' program, end the 'awk' options
-with '--' and then supply the 'awk' program's options, in the following
-manner:
-
- awk -f myprog.awk -- -v -q file1 file2 ...
-
- The following fragment processes 'ARGV' in order to examine, and then
-remove, the previously mentioned command-line options:
-
- BEGIN {
- for (i = 1; i < ARGC; i++) {
- if (ARGV[i] == "-v")
- verbose = 1
- else if (ARGV[i] == "-q")
- debug = 1
- else if (ARGV[i] ~ /^-./) {
- e = sprintf("%s: unrecognized option -- %c",
- ARGV[0], substr(ARGV[i], 2, 1))
- print e > "/dev/stderr"
- } else
- break
- delete ARGV[i]
- }
- }
-
- Ending the 'awk' options with '--' isn't necessary in 'gawk'. Unless
-'--posix' has been specified, 'gawk' silently puts any unrecognized
-options into 'ARGV' for the 'awk' program to deal with. As soon as it
-sees an unknown option, 'gawk' stops looking for other options that it
-might otherwise recognize. The previous command line with 'gawk' would
-be:
-
- gawk -f myprog.awk -q -v file1 file2 ...
-
-Because '-q' is not a valid 'gawk' option, it and the following '-v' are
-passed on to the 'awk' program. (*Note Getopt Function:: for an 'awk'
-library function that parses command-line options.)
-
- When designing your program, you should choose options that don't
-conflict with 'gawk''s, because it will process any options that it
-accepts before passing the rest of the command line on to your program.
-Using '#!' with the '-E' option may help (*note Executable Scripts:: and
-*note Options::).
-
-
-File: gawk.info, Node: Pattern Action Summary, Prev: Built-in Variables, Up: Patterns and Actions
-
-7.6 Summary
-===========
-
- * Pattern-action pairs make up the basic elements of an 'awk'
- program. Patterns are either normal expressions, range
- expressions, or regexp constants; one of the special keywords
- 'BEGIN', 'END', 'BEGINFILE', or 'ENDFILE'; or empty. The action
- executes if the current record matches the pattern. Empty
- (missing) patterns match all records.
-
- * I/O from 'BEGIN' and 'END' rules has certain constraints. This is
- also true, only more so, for 'BEGINFILE' and 'ENDFILE' rules. The
- latter two give you "hooks" into 'gawk''s file processing, allowing
- you to recover from a file that otherwise would cause a fatal error
- (such as a file that cannot be opened).
-
- * Shell variables can be used in 'awk' programs by careful use of
- shell quoting. It is easier to pass a shell variable into 'awk' by
- using the '-v' option and an 'awk' variable.
-
- * Actions consist of statements enclosed in curly braces. Statements
- are built up from expressions, control statements, compound
- statements, input and output statements, and deletion statements.
-
- * The control statements in 'awk' are 'if'-'else', 'while', 'for',
- and 'do'-'while'. 'gawk' adds the 'switch' statement. There are
- two flavors of 'for' statement: one for performing general looping,
- and the other for iterating through an array.
-
- * 'break' and 'continue' let you exit early or start the next
- iteration of a loop (or get out of a 'switch').
-
- * 'next' and 'nextfile' let you read the next record and start over
- at the top of your program or skip to the next input file and start
- over, respectively.
-
- * The 'exit' statement terminates your program. When executed from
- an action (or function body), it transfers control to the 'END'
- statements. From an 'END' statement body, it exits immediately.
- You may pass an optional numeric value to be used as 'awk''s exit
- status.
-
- * Some predefined variables provide control over 'awk', mainly for
- I/O. Other variables convey information from 'awk' to your program.
-
- * 'ARGC' and 'ARGV' make the command-line arguments available to your
- program. Manipulating them from a 'BEGIN' rule lets you control
- how 'awk' will process the provided data files.
-
-
-File: gawk.info, Node: Arrays, Next: Functions, Prev: Patterns and Actions, Up: Top
-
-8 Arrays in 'awk'
-*****************
-
-An "array" is a table of values called "elements". The elements of an
-array are distinguished by their "indices". Indices may be either
-numbers or strings.
-
- This major node describes how arrays work in 'awk', how to use array
-elements, how to scan through every element in an array, and how to
-remove array elements. It also describes how 'awk' simulates
-multidimensional arrays, as well as some of the less obvious points
-about array usage. The major node moves on to discuss 'gawk''s facility
-for sorting arrays, and ends with a brief description of 'gawk''s
-ability to support true arrays of arrays.
-
-* Menu:
-
-* Array Basics:: The basics of arrays.
-* Numeric Array Subscripts:: How to use numbers as subscripts in
- 'awk'.
-* Uninitialized Subscripts:: Using Uninitialized variables as subscripts.
-* Delete:: The 'delete' statement removes an element
- from an array.
-* Multidimensional:: Emulating multidimensional arrays in
- 'awk'.
-* Arrays of Arrays:: True multidimensional arrays.
-* Arrays Summary:: Summary of arrays.
-
-
-File: gawk.info, Node: Array Basics, Next: Numeric Array Subscripts, Up: Arrays
-
-8.1 The Basics of Arrays
-========================
-
-This minor node presents the basics: working with elements in arrays one
-at a time, and traversing all of the elements in an array.
-
-* Menu:
-
-* Array Intro:: Introduction to Arrays
-* Reference to Elements:: How to examine one element of an array.
-* Assigning Elements:: How to change an element of an array.
-* Array Example:: Basic Example of an Array
-* Scanning an Array:: A variation of the 'for' statement. It
- loops through the indices of an array's
- existing elements.
-* Controlling Scanning:: Controlling the order in which arrays are
- scanned.
-
-
-File: gawk.info, Node: Array Intro, Next: Reference to Elements, Up: Array Basics
-
-8.1.1 Introduction to Arrays
-----------------------------
-
- Doing linear scans over an associative array is like trying to club
- someone to death with a loaded Uzi.
- -- _Larry Wall_
-
- The 'awk' language provides one-dimensional arrays for storing groups
-of related strings or numbers. Every 'awk' array must have a name.
-Array names have the same syntax as variable names; any valid variable
-name would also be a valid array name. But one name cannot be used in
-both ways (as an array and as a variable) in the same 'awk' program.
-
- Arrays in 'awk' superficially resemble arrays in other programming
-languages, but there are fundamental differences. In 'awk', it isn't
-necessary to specify the size of an array before starting to use it.
-Additionally, any number or string, not just consecutive integers, may
-be used as an array index.
-
- In most other languages, arrays must be "declared" before use,
-including a specification of how many elements or components they
-contain. In such languages, the declaration causes a contiguous block
-of memory to be allocated for that many elements. Usually, an index in
-the array must be a nonnegative integer. For example, the index zero
-specifies the first element in the array, which is actually stored at
-the beginning of the block of memory. Index one specifies the second
-element, which is stored in memory right after the first element, and so
-on. It is impossible to add more elements to the array, because it has
-room only for as many elements as given in the declaration. (Some
-languages allow arbitrary starting and ending indices--e.g., '15 ..
-27'--but the size of the array is still fixed when the array is
-declared.)
-
- A contiguous array of four elements might look like *note Figure 8.1:
-figure-array-elements, conceptually, if the element values are eight,
-'"foo"', '""', and 30.
-
-
-| 8 | \"foo\" | \"\" | 30 | Value
-+---------+---------+--------+---------+
- 0 1 2 3 Index"
-
-Figure 8.1: A contiguous array
-
-Only the values are stored; the indices are implicit from the order of
-the values. Here, eight is the value at index zero, because eight
-appears in the position with zero elements before it.
-
- Arrays in 'awk' are different--they are "associative". This means
-that each array is a collection of pairs--an index and its corresponding
-array element value:
-
- Index Value
-------------------------
- '3' '30'
- '1' '"foo"'
- '0' '8'
- '2' '""'
-
-The pairs are shown in jumbled order because their order is
-irrelevant.(1)
-
- One advantage of associative arrays is that new pairs can be added at
-any time. For example, suppose a tenth element is added to the array
-whose value is '"number ten"'. The result is:
-
- Index Value
--------------------------------
- '10' '"number
- ten"'
- '3' '30'
- '1' '"foo"'
- '0' '8'
- '2' '""'
-
-Now the array is "sparse", which just means some indices are missing.
-It has elements 0-3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or
-9.
-
- Another consequence of associative arrays is that the indices don't
-have to be nonnegative integers. Any number, or even a string, can be
-an index. For example, the following is an array that translates words
-from English to French:
-
- Index Value
-------------------------
- '"dog"' '"chien"'
- '"cat"' '"chat"'
- '"one"' '"un"'
- '1' '"un"'
-
-Here we decided to translate the number one in both spelled-out and
-numeric form--thus illustrating that a single array can have both
-numbers and strings as indices. (In fact, array subscripts are always
-strings. There are some subtleties to how numbers work when used as
-array subscripts; this is discussed in more detail in *note Numeric
-Array Subscripts::.) Here, the number '1' isn't double-quoted, because
-'awk' automatically converts it to a string.
-
- The value of 'IGNORECASE' has no effect upon array subscripting. The
-identical string value used to store an array element must be used to
-retrieve it. When 'awk' creates an array (e.g., with the 'split()'
-built-in function), that array's indices are consecutive integers
-starting at one. (*Note String Functions::.)
-
- 'awk''s arrays are efficient--the time to access an element is
-independent of the number of elements in the array.
-
- ---------- Footnotes ----------
-
- (1) The ordering will vary among 'awk' implementations, which
-typically use hash tables to store array elements and values.
-
-
-File: gawk.info, Node: Reference to Elements, Next: Assigning Elements, Prev: Array Intro, Up: Array Basics
-
-8.1.2 Referring to an Array Element
------------------------------------
-
-The principal way to use an array is to refer to one of its elements.
-An "array reference" is an expression as follows:
-
- ARRAY[INDEX-EXPRESSION]
-
-Here, ARRAY is the name of an array. The expression INDEX-EXPRESSION is
-the index of the desired element of the array.
-
- The value of the array reference is the current value of that array
-element. For example, 'foo[4.3]' is an expression referencing the
-element of array 'foo' at index '4.3'.
-
- A reference to an array element that has no recorded value yields a
-value of '""', the null string. This includes elements that have not
-been assigned any value as well as elements that have been deleted
-(*note Delete::).
-
- NOTE: A reference to an element that does not exist _automatically_
- creates that array element, with the null string as its value. (In
- some cases, this is unfortunate, because it might waste memory
- inside 'awk'.)
-
- Novice 'awk' programmers often make the mistake of checking if an
- element exists by checking if the value is empty:
-
- # Check if "foo" exists in a: Incorrect!
- if (a["foo"] != "") ...
-
- This is incorrect for two reasons. First, it _creates_ 'a["foo"]'
- if it didn't exist before! Second, it is valid (if a bit unusual)
- to set an array element equal to the empty string.
-
- To determine whether an element exists in an array at a certain
-index, use the following expression:
-
- INDX in ARRAY
-
-This expression tests whether the particular index INDX exists, without
-the side effect of creating that element if it is not present. The
-expression has the value one (true) if 'ARRAY[INDX]' exists and zero
-(false) if it does not exist. (We use INDX here, because 'index' is the
-name of a built-in function.) For example, this statement tests whether
-the array 'frequencies' contains the index '2':
-
- if (2 in frequencies)
- print "Subscript 2 is present."
-
- Note that this is _not_ a test of whether the array 'frequencies'
-contains an element whose _value_ is two. There is no way to do that
-except to scan all the elements. Also, this _does not_ create
-'frequencies[2]', while the following (incorrect) alternative does:
-
- if (frequencies[2] != "")
- print "Subscript 2 is present."
-
-
-File: gawk.info, Node: Assigning Elements, Next: Array Example, Prev: Reference to Elements, Up: Array Basics
-
-8.1.3 Assigning Array Elements
-------------------------------
-
-Array elements can be assigned values just like 'awk' variables:
-
- ARRAY[INDEX-EXPRESSION] = VALUE
-
-ARRAY is the name of an array. The expression INDEX-EXPRESSION is the
-index of the element of the array that is assigned a value. The
-expression VALUE is the value to assign to that element of the array.
-
-
-File: gawk.info, Node: Array Example, Next: Scanning an Array, Prev: Assigning Elements, Up: Array Basics
-
-8.1.4 Basic Array Example
--------------------------
-
-The following program takes a list of lines, each beginning with a line
-number, and prints them out in order of line number. The line numbers
-are not in order when they are first read--instead, they are scrambled.
-This program sorts the lines by making an array using the line numbers
-as subscripts. The program then prints out the lines in sorted order of
-their numbers. It is a very simple program and gets confused upon
-encountering repeated numbers, gaps, or lines that don't begin with a
-number:
-
- {
- if ($1 > max)
- max = $1
- arr[$1] = $0
- }
-
- END {
- for (x = 1; x <= max; x++)
- print arr[x]
- }
-
- The first rule keeps track of the largest line number seen so far; it
-also stores each line into the array 'arr', at an index that is the
-line's number. The second rule runs after all the input has been read,
-to print out all the lines. When this program is run with the following
-input:
-
- 5 I am the Five man
- 2 Who are you? The new number two!
- 4 . . . And four on the floor
- 1 Who is number one?
- 3 I three you.
-
-Its output is:
-
- 1 Who is number one?
- 2 Who are you? The new number two!
- 3 I three you.
- 4 . . . And four on the floor
- 5 I am the Five man
-
- If a line number is repeated, the last line with a given number
-overrides the others. Gaps in the line numbers can be handled with an
-easy improvement to the program's 'END' rule, as follows:
-
- END {
- for (x = 1; x <= max; x++)
- if (x in arr)
- print arr[x]
- }
-
-
-File: gawk.info, Node: Scanning an Array, Next: Controlling Scanning, Prev: Array Example, Up: Array Basics
-
-8.1.5 Scanning All Elements of an Array
----------------------------------------
-
-In programs that use arrays, it is often necessary to use a loop that
-executes once for each element of an array. In other languages, where
-arrays are contiguous and indices are limited to nonnegative integers,
-this is easy: all the valid indices can be found by counting from the
-lowest index up to the highest. This technique won't do the job in
-'awk', because any number or string can be an array index. So 'awk' has
-a special kind of 'for' statement for scanning an array:
-
- for (VAR in ARRAY)
- BODY
-
-This loop executes BODY once for each index in ARRAY that the program
-has previously used, with the variable VAR set to that index.
-
- The following program uses this form of the 'for' statement. The
-first rule scans the input records and notes which words appear (at
-least once) in the input, by storing a one into the array 'used' with
-the word as the index. The second rule scans the elements of 'used' to
-find all the distinct words that appear in the input. It prints each
-word that is more than 10 characters long and also prints the number of
-such words. *Note String Functions:: for more information on the
-built-in function 'length()'.
-
- # Record a 1 for each word that is used at least once
- {
- for (i = 1; i <= NF; i++)
- used[$i] = 1
- }
-
- # Find number of distinct words more than 10 characters long
- END {
- for (x in used) {
- if (length(x) > 10) {
- ++num_long_words
- print x
- }
- }
- print num_long_words, "words longer than 10 characters"
- }
-
-*Note Word Sorting:: for a more detailed example of this type.
-
- The order in which elements of the array are accessed by this
-statement is determined by the internal arrangement of the array
-elements within 'awk' and in standard 'awk' cannot be controlled or
-changed. This can lead to problems if new elements are added to ARRAY
-by statements in the loop body; it is not predictable whether the 'for'
-loop will reach them. Similarly, changing VAR inside the loop may
-produce strange results. It is best to avoid such things.
-
- As a point of information, 'gawk' sets up the list of elements to be
-iterated over before the loop starts, and does not change it. But not
-all 'awk' versions do so. Consider this program, named 'loopcheck.awk':
-
- BEGIN {
- a["here"] = "here"
- a["is"] = "is"
- a["a"] = "a"
- a["loop"] = "loop"
- for (i in a) {
- j++
- a[j] = j
- print i
- }
- }
-
- Here is what happens when run with 'gawk' (and 'mawk'):
-
- $ gawk -f loopcheck.awk
- -| here
- -| loop
- -| a
- -| is
-
- Contrast this to BWK 'awk':
-
- $ nawk -f loopcheck.awk
- -| loop
- -| here
- -| is
- -| a
- -| 1
-
-
-File: gawk.info, Node: Controlling Scanning, Prev: Scanning an Array, Up: Array Basics
-
-8.1.6 Using Predefined Array Scanning Orders with 'gawk'
---------------------------------------------------------
-
-This node describes a feature that is specific to 'gawk'.
-
- By default, when a 'for' loop traverses an array, the order is
-undefined, meaning that the 'awk' implementation determines the order in
-which the array is traversed. This order is usually based on the
-internal implementation of arrays and will vary from one version of
-'awk' to the next.
-
- Often, though, you may wish to do something simple, such as "traverse
-the array by comparing the indices in ascending order," or "traverse the
-array by comparing the values in descending order." 'gawk' provides two
-mechanisms that give you this control:
-
- * Set 'PROCINFO["sorted_in"]' to one of a set of predefined values.
- We describe this now.
-
- * Set 'PROCINFO["sorted_in"]' to the name of a user-defined function
- to use for comparison of array elements. This advanced feature is
- described later in *note Array Sorting::.
-
- The following special values for 'PROCINFO["sorted_in"]' are
-available:
-
-'"@unsorted"'
- Array elements are processed in arbitrary order, which is the
- default 'awk' behavior.
-
-'"@ind_str_asc"'
- Order by indices in ascending order compared as strings; this is
- the most basic sort. (Internally, array indices are always
- strings, so with 'a[2*5] = 1' the index is '"10"' rather than
- numeric 10.)
-
-'"@ind_num_asc"'
- Order by indices in ascending order but force them to be treated as
- numbers in the process. Any index with a non-numeric value will
- end up positioned as if it were zero.
-
-'"@val_type_asc"'
- Order by element values in ascending order (rather than by
- indices). Ordering is by the type assigned to the element (*note
- Typing and Comparison::). All numeric values come before all
- string values, which in turn come before all subarrays. (Subarrays
- have not been described yet; *note Arrays of Arrays::.)
-
-'"@val_str_asc"'
- Order by element values in ascending order (rather than by
- indices). Scalar values are compared as strings. Subarrays, if
- present, come out last.
-
-'"@val_num_asc"'
- Order by element values in ascending order (rather than by
- indices). Scalar values are compared as numbers. Subarrays, if
- present, come out last. When numeric values are equal, the string
- values are used to provide an ordering: this guarantees consistent
- results across different versions of the C 'qsort()' function,(1)
- which 'gawk' uses internally to perform the sorting.
-
-'"@ind_str_desc"'
- Like '"@ind_str_asc"', but the string indices are ordered from high
- to low.
-
-'"@ind_num_desc"'
- Like '"@ind_num_asc"', but the numeric indices are ordered from
- high to low.
-
-'"@val_type_desc"'
- Like '"@val_type_asc"', but the element values, based on type, are
- ordered from high to low. Subarrays, if present, come out first.
-
-'"@val_str_desc"'
- Like '"@val_str_asc"', but the element values, treated as strings,
- are ordered from high to low. Subarrays, if present, come out
- first.
-
-'"@val_num_desc"'
- Like '"@val_num_asc"', but the element values, treated as numbers,
- are ordered from high to low. Subarrays, if present, come out
- first.
-
- The array traversal order is determined before the 'for' loop starts
-to run. Changing 'PROCINFO["sorted_in"]' in the loop body does not
-affect the loop. For example:
-
- $ gawk '
- > BEGIN {
- > a[4] = 4
- > a[3] = 3
- > for (i in a)
- > print i, a[i]
- > }'
- -| 4 4
- -| 3 3
- $ gawk '
- > BEGIN {
- > PROCINFO["sorted_in"] = "@ind_str_asc"
- > a[4] = 4
- > a[3] = 3
- > for (i in a)
- > print i, a[i]
- > }'
- -| 3 3
- -| 4 4
-
- When sorting an array by element values, if a value happens to be a
-subarray then it is considered to be greater than any string or numeric
-value, regardless of what the subarray itself contains, and all
-subarrays are treated as being equal to each other. Their order
-relative to each other is determined by their index strings.
-
- Here are some additional things to bear in mind about sorted array
-traversal:
-
- * The value of 'PROCINFO["sorted_in"]' is global. That is, it
- affects all array traversal 'for' loops. If you need to change it
- within your own code, you should see if it's defined and save and
- restore the value:
-
- ...
- if ("sorted_in" in PROCINFO) {
- save_sorted = PROCINFO["sorted_in"]
- PROCINFO["sorted_in"] = "@val_str_desc" # or whatever
- }
- ...
- if (save_sorted)
- PROCINFO["sorted_in"] = save_sorted
-
- * As already mentioned, the default array traversal order is
- represented by '"@unsorted"'. You can also get the default
- behavior by assigning the null string to 'PROCINFO["sorted_in"]' or
- by just deleting the '"sorted_in"' element from the 'PROCINFO'
- array with the 'delete' statement. (The 'delete' statement hasn't
- been described yet; *note Delete::.)
-
- In addition, 'gawk' provides built-in functions for sorting arrays;
-see *note Array Sorting Functions::.
-
- ---------- Footnotes ----------
-
- (1) When two elements compare as equal, the C 'qsort()' function does
-not guarantee that they will maintain their original relative order
-after sorting. Using the string value to provide a unique ordering when
-the numeric values are equal ensures that 'gawk' behaves consistently
-across different environments.
-
-
-File: gawk.info, Node: Numeric Array Subscripts, Next: Uninitialized Subscripts, Prev: Array Basics, Up: Arrays
-
-8.2 Using Numbers to Subscript Arrays
-=====================================
-
-An important aspect to remember about arrays is that _array subscripts
-are always strings_. When a numeric value is used as a subscript, it is
-converted to a string value before being used for subscripting (*note
-Conversion::). This means that the value of the predefined variable
-'CONVFMT' can affect how your program accesses elements of an array.
-For example:
-
- xyz = 12.153
- data[xyz] = 1
- CONVFMT = "%2.2f"
- if (xyz in data)
- printf "%s is in data\n", xyz
- else
- printf "%s is not in data\n", xyz
-
-This prints '12.15 is not in data'. The first statement gives 'xyz' a
-numeric value. Assigning to 'data[xyz]' subscripts 'data' with the
-string value '"12.153"' (using the default conversion value of
-'CONVFMT', '"%.6g"'). Thus, the array element 'data["12.153"]' is
-assigned the value one. The program then changes the value of
-'CONVFMT'. The test '(xyz in data)' generates a new string value from
-'xyz'--this time '"12.15"'--because the value of 'CONVFMT' only allows
-two significant digits. This test fails, because '"12.15"' is different
-from '"12.153"'.
-
- According to the rules for conversions (*note Conversion::), integer
-values always convert to strings as integers, no matter what the value
-of 'CONVFMT' may happen to be. So the usual case of the following
-works:
-
- for (i = 1; i <= maxsub; i++)
- do something with array[i]
-
- The "integer values always convert to strings as integers" rule has
-an additional consequence for array indexing. Octal and hexadecimal
-constants (*note Nondecimal-numbers::) are converted internally into
-numbers, and their original form is forgotten. This means, for example,
-that 'array[17]', 'array[021]', and 'array[0x11]' all refer to the same
-element!
-
- As with many things in 'awk', the majority of the time things work as
-you would expect them to. But it is useful to have a precise knowledge
-of the actual rules, as they can sometimes have a subtle effect on your
-programs.
-
-
-File: gawk.info, Node: Uninitialized Subscripts, Next: Delete, Prev: Numeric Array Subscripts, Up: Arrays
-
-8.3 Using Uninitialized Variables as Subscripts
-===============================================
-
-Suppose it's necessary to write a program to print the input data in
-reverse order. A reasonable attempt to do so (with some test data)
-might look like this:
-
- $ echo 'line 1
- > line 2
- > line 3' | awk '{ l[lines] = $0; ++lines }
- > END {
- > for (i = lines - 1; i >= 0; i--)
- > print l[i]
- > }'
- -| line 3
- -| line 2
-
- Unfortunately, the very first line of input data did not appear in
-the output!
-
- Upon first glance, we would think that this program should have
-worked. The variable 'lines' is uninitialized, and uninitialized
-variables have the numeric value zero. So, 'awk' should have printed
-the value of 'l[0]'.
-
- The issue here is that subscripts for 'awk' arrays are _always_
-strings. Uninitialized variables, when used as strings, have the value
-'""', not zero. Thus, 'line 1' ends up stored in 'l[""]'. The
-following version of the program works correctly:
-
- { l[lines++] = $0 }
- END {
- for (i = lines - 1; i >= 0; i--)
- print l[i]
- }
-
- Here, the '++' forces 'lines' to be numeric, thus making the "old
-value" numeric zero. This is then converted to '"0"' as the array
-subscript.
-
- Even though it is somewhat unusual, the null string ('""') is a valid
-array subscript. (d.c.) 'gawk' warns about the use of the null string
-as a subscript if '--lint' is provided on the command line (*note
-Options::).
-
-
-File: gawk.info, Node: Delete, Next: Multidimensional, Prev: Uninitialized Subscripts, Up: Arrays
-
-8.4 The 'delete' Statement
-==========================
-
-To remove an individual element of an array, use the 'delete' statement:
-
- delete ARRAY[INDEX-EXPRESSION]
-
- Once an array element has been deleted, any value the element once
-had is no longer available. It is as if the element had never been
-referred to or been given a value. The following is an example of
-deleting elements in an array:
-
- for (i in frequencies)
- delete frequencies[i]
-
-This example removes all the elements from the array 'frequencies'.
-Once an element is deleted, a subsequent 'for' statement to scan the
-array does not report that element and using the 'in' operator to check
-for the presence of that element returns zero (i.e., false):
-
- delete foo[4]
- if (4 in foo)
- print "This will never be printed"
-
- It is important to note that deleting an element is _not_ the same as
-assigning it a null value (the empty string, '""'). For example:
-
- foo[4] = ""
- if (4 in foo)
- print "This is printed, even though foo[4] is empty"
-
- It is not an error to delete an element that does not exist.
-However, if '--lint' is provided on the command line (*note Options::),
-'gawk' issues a warning message when an element that is not in the array
-is deleted.
-
- All the elements of an array may be deleted with a single statement
-by leaving off the subscript in the 'delete' statement, as follows:
-
- delete ARRAY
-
- Using this version of the 'delete' statement is about three times
-more efficient than the equivalent loop that deletes each element one at
-a time.
-
- This form of the 'delete' statement is also supported by BWK 'awk'
-and 'mawk', as well as by a number of other implementations.
-
- NOTE: For many years, using 'delete' without a subscript was a
- common extension. In September 2012, it was accepted for inclusion
- into the POSIX standard. See the Austin Group website
- (http://austingroupbugs.net/view.php?id=544).
-
- The following statement provides a portable but nonobvious way to
-clear out an array:(1)
-
- split("", array)
-
- The 'split()' function (*note String Functions::) clears out the
-target array first. This call asks it to split apart the null string.
-Because there is no data to split out, the function simply clears the
-array and then returns.
-
- CAUTION: Deleting all the elements from an array does not change
- its type; you cannot clear an array and then use the array's name
- as a scalar (i.e., a regular variable). For example, the following
- does not work:
-
- a[1] = 3
- delete a
- a = 3
-
- ---------- Footnotes ----------
-
- (1) Thanks to Michael Brennan for pointing this out.
-
-
-File: gawk.info, Node: Multidimensional, Next: Arrays of Arrays, Prev: Delete, Up: Arrays
-
-8.5 Multidimensional Arrays
-===========================
-
-* Menu:
-
-* Multiscanning:: Scanning multidimensional arrays.
-
-A "multidimensional array" is an array in which an element is identified
-by a sequence of indices instead of a single index. For example, a
-two-dimensional array requires two indices. The usual way (in many
-languages, including 'awk') to refer to an element of a two-dimensional
-array named 'grid' is with 'grid[X,Y]'.
-
- Multidimensional arrays are supported in 'awk' through concatenation
-of indices into one string. 'awk' converts the indices into strings
-(*note Conversion::) and concatenates them together, with a separator
-between them. This creates a single string that describes the values of
-the separate indices. The combined string is used as a single index
-into an ordinary, one-dimensional array. The separator used is the
-value of the built-in variable 'SUBSEP'.
-
- For example, suppose we evaluate the expression 'foo[5,12] = "value"'
-when the value of 'SUBSEP' is '"@"'. The numbers 5 and 12 are converted
-to strings and concatenated with an '@' between them, yielding '"5@12"';
-thus, the array element 'foo["5@12"]' is set to '"value"'.
-
- Once the element's value is stored, 'awk' has no record of whether it
-was stored with a single index or a sequence of indices. The two
-expressions 'foo[5,12]' and 'foo[5 SUBSEP 12]' are always equivalent.
-
- The default value of 'SUBSEP' is the string '"\034"', which contains
-a nonprinting character that is unlikely to appear in an 'awk' program
-or in most input data. The usefulness of choosing an unlikely character
-comes from the fact that index values that contain a string matching
-'SUBSEP' can lead to combined strings that are ambiguous. Suppose that
-'SUBSEP' is '"@"'; then 'foo["a@b", "c"]' and 'foo["a", "b@c"]' are
-indistinguishable because both are actually stored as 'foo["a@b@c"]'.
-
- To test whether a particular index sequence exists in a
-multidimensional array, use the same operator ('in') that is used for
-single-dimensional arrays. Write the whole sequence of indices in
-parentheses, separated by commas, as the left operand:
-
- if ((SUBSCRIPT1, SUBSCRIPT2, ...) in ARRAY)
- ...
-
- Here is an example that treats its input as a two-dimensional array
-of fields; it rotates this array 90 degrees clockwise and prints the
-result. It assumes that all lines have the same number of elements:
-
- {
- if (max_nf < NF)
- max_nf = NF
- max_nr = NR
- for (x = 1; x <= NF; x++)
- vector[x, NR] = $x
- }
-
- END {
- for (x = 1; x <= max_nf; x++) {
- for (y = max_nr; y >= 1; --y)
- printf("%s ", vector[x, y])
- printf("\n")
- }
- }
-
-When given the input:
-
- 1 2 3 4 5 6
- 2 3 4 5 6 1
- 3 4 5 6 1 2
- 4 5 6 1 2 3
-
-the program produces the following output:
-
- 4 3 2 1
- 5 4 3 2
- 6 5 4 3
- 1 6 5 4
- 2 1 6 5
- 3 2 1 6
-
-
-File: gawk.info, Node: Multiscanning, Up: Multidimensional
-
-8.5.1 Scanning Multidimensional Arrays
---------------------------------------
-
-There is no special 'for' statement for scanning a "multidimensional"
-array. There cannot be one, because, in truth, 'awk' does not have
-multidimensional arrays or elements--there is only a multidimensional
-_way of accessing_ an array.
-
- However, if your program has an array that is always accessed as
-multidimensional, you can get the effect of scanning it by combining the
-scanning 'for' statement (*note Scanning an Array::) with the built-in
-'split()' function (*note String Functions::). It works in the
-following manner:
-
- for (combined in array) {
- split(combined, separate, SUBSEP)
- ...
- }
-
-This sets the variable 'combined' to each concatenated combined index in
-the array, and splits it into the individual indices by breaking it
-apart where the value of 'SUBSEP' appears. The individual indices then
-become the elements of the array 'separate'.
-
- Thus, if a value is previously stored in 'array[1, "foo"]', then an
-element with index '"1\034foo"' exists in 'array'. (Recall that the
-default value of 'SUBSEP' is the character with code 034.) Sooner or
-later, the 'for' statement finds that index and does an iteration with
-the variable 'combined' set to '"1\034foo"'. Then the 'split()'
-function is called as follows:
-
- split("1\034foo", separate, "\034")
-
-The result is to set 'separate[1]' to '"1"' and 'separate[2]' to
-'"foo"'. Presto! The original sequence of separate indices is
-recovered.
-
-
-File: gawk.info, Node: Arrays of Arrays, Next: Arrays Summary, Prev: Multidimensional, Up: Arrays
-
-8.6 Arrays of Arrays
-====================
-
-'gawk' goes beyond standard 'awk''s multidimensional array access and
-provides true arrays of arrays. Elements of a subarray are referred to
-by their own indices enclosed in square brackets, just like the elements
-of the main array. For example, the following creates a two-element
-subarray at index '1' of the main array 'a':
-
- a[1][1] = 1
- a[1][2] = 2
-
- This simulates a true two-dimensional array. Each subarray element
-can contain another subarray as a value, which in turn can hold other
-arrays as well. In this way, you can create arrays of three or more
-dimensions. The indices can be any 'awk' expressions, including scalars
-separated by commas (i.e., a regular 'awk' simulated multidimensional
-subscript). So the following is valid in 'gawk':
-
- a[1][3][1, "name"] = "barney"
-
- Each subarray and the main array can be of different length. In
-fact, the elements of an array or its subarray do not all have to have
-the same type. This means that the main array and any of its subarrays
-can be nonrectangular, or jagged in structure. You can assign a scalar
-value to the index '4' of the main array 'a', even though 'a[1]' is
-itself an array and not a scalar:
-
- a[4] = "An element in a jagged array"
-
- The terms "dimension", "row", and "column" are meaningless when
-applied to such an array, but we will use "dimension" henceforth to
-imply the maximum number of indices needed to refer to an existing
-element. The type of any element that has already been assigned cannot
-be changed by assigning a value of a different type. You have to first
-delete the current element, which effectively makes 'gawk' forget about
-the element at that index:
-
- delete a[4]
- a[4][5][6][7] = "An element in a four-dimensional array"
-
-This removes the scalar value from index '4' and then inserts a
-three-level nested subarray containing a scalar. You can also delete an
-entire subarray or subarray of subarrays:
-
- delete a[4][5]
- a[4][5] = "An element in subarray a[4]"
-
- But recall that you can not delete the main array 'a' and then use it
-as a scalar.
-
- The built-in functions that take array arguments can also be used
-with subarrays. For example, the following code fragment uses
-'length()' (*note String Functions::) to determine the number of
-elements in the main array 'a' and its subarrays:
-
- print length(a), length(a[1]), length(a[1][3])
-
-This results in the following output for our main array 'a':
-
- 2, 3, 1
-
-The 'SUBSCRIPT in ARRAY' expression (*note Reference to Elements::)
-works similarly for both regular 'awk'-style arrays and arrays of
-arrays. For example, the tests '1 in a', '3 in a[1]', and '(1, "name")
-in a[1][3]' all evaluate to one (true) for our array 'a'.
-
- The 'for (item in array)' statement (*note Scanning an Array::) can
-be nested to scan all the elements of an array of arrays if it is
-rectangular in structure. In order to print the contents (scalar
-values) of a two-dimensional array of arrays (i.e., in which each
-first-level element is itself an array, not necessarily of the same
-length), you could use the following code:
-
- for (i in array)
- for (j in array[i])
- print array[i][j]
-
- The 'isarray()' function (*note Type Functions::) lets you test if an
-array element is itself an array:
-
- for (i in array) {
- if (isarray(array[i]) {
- for (j in array[i]) {
- print array[i][j]
- }
- }
- else
- print array[i]
- }
-
- If the structure of a jagged array of arrays is known in advance, you
-can often devise workarounds using control statements. For example, the
-following code prints the elements of our main array 'a':
-
- for (i in a) {
- for (j in a[i]) {
- if (j == 3) {
- for (k in a[i][j])
- print a[i][j][k]
- } else
- print a[i][j]
- }
- }
-
-*Note Walking Arrays:: for a user-defined function that "walks" an
-arbitrarily dimensioned array of arrays.
-
- Recall that a reference to an uninitialized array element yields a
-value of '""', the null string. This has one important implication when
-you intend to use a subarray as an argument to a function, as
-illustrated by the following example:
-
- $ gawk 'BEGIN { split("a b c d", b[1]); print b[1][1] }'
- error-> gawk: cmd. line:1: fatal: split: second argument is not an array
-
- The way to work around this is to first force 'b[1]' to be an array
-by creating an arbitrary index:
-
- $ gawk 'BEGIN { b[1][1] = ""; split("a b c d", b[1]); print b[1][1] }'
- -| a
-
-
-File: gawk.info, Node: Arrays Summary, Prev: Arrays of Arrays, Up: Arrays
-
-8.7 Summary
-===========
-
- * Standard 'awk' provides one-dimensional associative arrays (arrays
- indexed by string values). All arrays are associative; numeric
- indices are converted automatically to strings.
-
- * Array elements are referenced as 'ARRAY[INDX]'. Referencing an
- element creates it if it did not exist previously.
-
- * The proper way to see if an array has an element with a given index
- is to use the 'in' operator: 'INDX in ARRAY'.
-
- * Use 'for (INDX in ARRAY) ...' to scan through all the individual
- elements of an array. In the body of the loop, INDX takes on the
- value of each element's index in turn.
-
- * The order in which a 'for (INDX in ARRAY)' loop traverses an array
- is undefined in POSIX 'awk' and varies among implementations.
- 'gawk' lets you control the order by assigning special predefined
- values to 'PROCINFO["sorted_in"]'.
-
- * Use 'delete ARRAY[INDX]' to delete an individual element. To
- delete all of the elements in an array, use 'delete ARRAY'. This
- latter feature has been a common extension for many years and is
- now standard, but may not be supported by all commercial versions
- of 'awk'.
-
- * Standard 'awk' simulates multidimensional arrays by separating
- subscript values with commas. The values are concatenated into a
- single string, separated by the value of 'SUBSEP'. The fact that
- such a subscript was created in this way is not retained; thus,
- changing 'SUBSEP' may have unexpected consequences. You can use
- '(SUB1, SUB2, ...) in ARRAY' to see if such a multidimensional
- subscript exists in ARRAY.
-
- * 'gawk' provides true arrays of arrays. You use a separate set of
- square brackets for each dimension in such an array:
- 'data[row][col]', for example. Array elements may thus be either
- scalar values (number or string) or other arrays.
-
- * Use the 'isarray()' built-in function to determine if an array
- element is itself a subarray.
-
-
-File: gawk.info, Node: Functions, Next: Library Functions, Prev: Arrays, Up: Top
-
-9 Functions
-***********
-
-This major node describes 'awk''s built-in functions, which fall into
-three categories: numeric, string, and I/O. 'gawk' provides additional
-groups of functions to work with values that represent time, do bit
-manipulation, sort arrays, provide type information, and
-internationalize and localize programs.
-
- Besides the built-in functions, 'awk' has provisions for writing new
-functions that the rest of a program can use. The second half of this
-major node describes these "user-defined" functions. Finally, we
-explore indirect function calls, a 'gawk'-specific extension that lets
-you determine at runtime what function is to be called.
-
-* Menu:
-
-* Built-in:: Summarizes the built-in functions.
-* User-defined:: Describes User-defined functions in detail.
-* Indirect Calls:: Choosing the function to call at runtime.
-* Functions Summary:: Summary of functions.
-
-
-File: gawk.info, Node: Built-in, Next: User-defined, Up: Functions
-
-9.1 Built-in Functions
-======================
-
-"Built-in" functions are always available for your 'awk' program to
-call. This minor node defines all the built-in functions in 'awk'; some
-of these are mentioned in other minor nodes but are summarized here for
-your convenience.
-
-* Menu:
-
-* Calling Built-in:: How to call built-in functions.
-* Numeric Functions:: Functions that work with numbers, including
- 'int()', 'sin()' and 'rand()'.
-* String Functions:: Functions for string manipulation, such as
- 'split()', 'match()' and
- 'sprintf()'.
-* I/O Functions:: Functions for files and shell commands.
-* Time Functions:: Functions for dealing with timestamps.
-* Bitwise Functions:: Functions for bitwise operations.
-* Type Functions:: Functions for type information.
-* I18N Functions:: Functions for string translation.
-
-
-File: gawk.info, Node: Calling Built-in, Next: Numeric Functions, Up: Built-in
-
-9.1.1 Calling Built-in Functions
---------------------------------
-
-To call one of 'awk''s built-in functions, write the name of the
-function followed by arguments in parentheses. For example, 'atan2(y +
-z, 1)' is a call to the function 'atan2()' and has two arguments.
-
- Whitespace is ignored between the built-in function name and the
-opening parenthesis, but nonetheless it is good practice to avoid using
-whitespace there. User-defined functions do not permit whitespace in
-this way, and it is easier to avoid mistakes by following a simple
-convention that always works--no whitespace after a function name.
-
- Each built-in function accepts a certain number of arguments. In
-some cases, arguments can be omitted. The defaults for omitted
-arguments vary from function to function and are described under the
-individual functions. In some 'awk' implementations, extra arguments
-given to built-in functions are ignored. However, in 'gawk', it is a
-fatal error to give extra arguments to a built-in function.
-
- When a function is called, expressions that create the function's
-actual parameters are evaluated completely before the call is performed.
-For example, in the following code fragment:
-
- i = 4
- j = sqrt(i++)
-
-the variable 'i' is incremented to the value five before 'sqrt()' is
-called with a value of four for its actual parameter. The order of
-evaluation of the expressions used for the function's parameters is
-undefined. Thus, avoid writing programs that assume that parameters are
-evaluated from left to right or from right to left. For example:
-
- i = 5
- j = atan2(++i, i *= 2)
-
- If the order of evaluation is left to right, then 'i' first becomes
-six, and then 12, and 'atan2()' is called with the two arguments six and
-12. But if the order of evaluation is right to left, 'i' first becomes
-10, then 11, and 'atan2()' is called with the two arguments 11 and 10.
-
-
-File: gawk.info, Node: Numeric Functions, Next: String Functions, Prev: Calling Built-in, Up: Built-in
-
-9.1.2 Numeric Functions
------------------------
-
-The following list describes all of the built-in functions that work
-with numbers. Optional parameters are enclosed in square
-brackets ([ ]):
-
-'atan2(Y, X)'
- Return the arctangent of 'Y / X' in radians. You can use 'pi =
- atan2(0, -1)' to retrieve the value of pi.
-
-'cos(X)'
- Return the cosine of X, with X in radians.
-
-'exp(X)'
- Return the exponential of X ('e ^ X') or report an error if X is
- out of range. The range of values X can have depends on your
- machine's floating-point representation.
-
-'int(X)'
- Return the nearest integer to X, located between X and zero and
- truncated toward zero. For example, 'int(3)' is 3, 'int(3.9)' is
- 3, 'int(-3.9)' is -3, and 'int(-3)' is -3 as well.
-
-'intdiv(NUMERATOR, DENOMINATOR, RESULT)'
- Perform integer division, similar to the standard C function of the
- same name. First, truncate 'numerator' and 'denominator' towards
- zero, creating integer values. Clear the 'result' array, and then
- set 'result["quotient"]' to the result of 'numerator /
- denominator', truncated towards zero to an integer, and set
- 'result["remainder"]' to the result of 'numerator % denominator',
- truncated towards zero to an integer. This function is primarily
- intended for use with arbitrary length integers; it avoids creating
- MPFR arbitrary precision floating-point values (*note Arbitrary
- Precision Integers::).
-
- This function is a 'gawk' extension. It is not available in
- compatibility mode (*note Options::).
-
-'log(X)'
- Return the natural logarithm of X, if X is positive; otherwise,
- return 'NaN' ("not a number") on IEEE 754 systems. Additionally,
- 'gawk' prints a warning message when 'x' is negative.
-
-'rand()'
- Return a random number. The values of 'rand()' are uniformly
- distributed between zero and one. The value could be zero but is
- never one.(1)
-
- Often random integers are needed instead. Following is a
- user-defined function that can be used to obtain a random
- nonnegative integer less than N:
-
- function randint(n)
- {
- return int(n * rand())
- }
-
- The multiplication produces a random number greater than or equal
- to zero and less than 'n'. Using 'int()', this result is made into
- an integer between zero and 'n' - 1, inclusive.
-
- The following example uses a similar function to produce random
- integers between one and N. This program prints a new random
- number for each input record:
-
- # Function to roll a simulated die.
- function roll(n) { return 1 + int(rand() * n) }
-
- # Roll 3 six-sided dice and
- # print total number of points.
- {
- printf("%d points\n", roll(6) + roll(6) + roll(6))
- }
-
- CAUTION: In most 'awk' implementations, including 'gawk',
- 'rand()' starts generating numbers from the same starting
- number, or "seed", each time you run 'awk'.(2) Thus, a
- program generates the same results each time you run it. The
- numbers are random within one 'awk' run but predictable from
- run to run. This is convenient for debugging, but if you want
- a program to do different things each time it is used, you
- must change the seed to a value that is different in each run.
- To do this, use 'srand()'.
-
-'sin(X)'
- Return the sine of X, with X in radians.
-
-'sqrt(X)'
- Return the positive square root of X. 'gawk' prints a warning
- message if X is negative. Thus, 'sqrt(4)' is 2.
-
-'srand('[X]')'
- Set the starting point, or seed, for generating random numbers to
- the value X.
-
- Each seed value leads to a particular sequence of random
- numbers.(3) Thus, if the seed is set to the same value a second
- time, the same sequence of random numbers is produced again.
-
- CAUTION: Different 'awk' implementations use different
- random-number generators internally. Don't expect the same
- 'awk' program to produce the same series of random numbers
- when executed by different versions of 'awk'.
-
- If the argument X is omitted, as in 'srand()', then the current
- date and time of day are used for a seed. This is the way to get
- random numbers that are truly unpredictable.
-
- The return value of 'srand()' is the previous seed. This makes it
- easy to keep track of the seeds in case you need to consistently
- reproduce sequences of random numbers.
-
- POSIX does not specify the initial seed; it differs among 'awk'
- implementations.
-
- ---------- Footnotes ----------
-
- (1) The C version of 'rand()' on many Unix systems is known to
-produce fairly poor sequences of random numbers. However, nothing
-requires that an 'awk' implementation use the C 'rand()' to implement
-the 'awk' version of 'rand()'. In fact, 'gawk' uses the BSD 'random()'
-function, which is considerably better than 'rand()', to produce random
-numbers.
-
- (2) 'mawk' uses a different seed each time.
-
- (3) Computer-generated random numbers really are not truly random.
-They are technically known as "pseudorandom". This means that although
-the numbers in a sequence appear to be random, you can in fact generate
-the same sequence of random numbers over and over again.
-
-
-File: gawk.info, Node: String Functions, Next: I/O Functions, Prev: Numeric Functions, Up: Built-in
-
-9.1.3 String-Manipulation Functions
------------------------------------
-
-The functions in this minor node look at or change the text of one or
-more strings.
-
- 'gawk' understands locales (*note Locales::) and does all string
-processing in terms of _characters_, not _bytes_. This distinction is
-particularly important to understand for locales where one character may
-be represented by multiple bytes. Thus, for example, 'length()' returns
-the number of characters in a string, and not the number of bytes used
-to represent those characters. Similarly, 'index()' works with
-character indices, and not byte indices.
-
- CAUTION: A number of functions deal with indices into strings. For
- these functions, the first character of a string is at position
- (index) one. This is different from C and the languages descended
- from it, where the first character is at position zero. You need
- to remember this when doing index calculations, particularly if you
- are used to C.
-
- In the following list, optional parameters are enclosed in square
-brackets ([ ]). Several functions perform string substitution; the full
-discussion is provided in the description of the 'sub()' function, which
-comes toward the end, because the list is presented alphabetically.
-
- Those functions that are specific to 'gawk' are marked with a pound
-sign ('#'). They are not available in compatibility mode (*note
-Options::):
-
-* Menu:
-
-* Gory Details:: More than you want to know about '\' and
- '&' with 'sub()', 'gsub()', and
- 'gensub()'.
-
-'asort('SOURCE [',' DEST [',' HOW ] ]') #'
-'asorti('SOURCE [',' DEST [',' HOW ] ]') #'
- These two functions are similar in behavior, so they are described
- together.
-
- NOTE: The following description ignores the third argument,
- HOW, as it requires understanding features that we have not
- discussed yet. Thus, the discussion here is a deliberate
- simplification. (We do provide all the details later on; see
- *note Array Sorting Functions:: for the full story.)
-
- Both functions return the number of elements in the array SOURCE.
- For 'asort()', 'gawk' sorts the values of SOURCE and replaces the
- indices of the sorted values of SOURCE with sequential integers
- starting with one. If the optional array DEST is specified, then
- SOURCE is duplicated into DEST. DEST is then sorted, leaving the
- indices of SOURCE unchanged.
-
- When comparing strings, 'IGNORECASE' affects the sorting (*note
- Array Sorting Functions::). If the SOURCE array contains subarrays
- as values (*note Arrays of Arrays::), they will come last, after
- all scalar values. Subarrays are _not_ recursively sorted.
-
- For example, if the contents of 'a' are as follows:
-
- a["last"] = "de"
- a["first"] = "sac"
- a["middle"] = "cul"
-
- A call to 'asort()':
-
- asort(a)
-
- results in the following contents of 'a':
-
- a[1] = "cul"
- a[2] = "de"
- a[3] = "sac"
-
- The 'asorti()' function works similarly to 'asort()'; however, the
- _indices_ are sorted, instead of the values. Thus, in the previous
- example, starting with the same initial set of indices and values
- in 'a', calling 'asorti(a)' would yield:
-
- a[1] = "first"
- a[2] = "last"
- a[3] = "middle"
-
-'gensub(REGEXP, REPLACEMENT, HOW' [', TARGET']') #'
- Search the target string TARGET for matches of the regular
- expression REGEXP. If HOW is a string beginning with 'g' or 'G'
- (short for "global"), then replace all matches of REGEXP with
- REPLACEMENT. Otherwise, HOW is treated as a number indicating
- which match of REGEXP to replace. If no TARGET is supplied, use
- '$0'. It returns the modified string as the result of the function
- and the original target string is _not_ changed.
-
- 'gensub()' is a general substitution function. Its purpose is to
- provide more features than the standard 'sub()' and 'gsub()'
- functions.
-
- 'gensub()' provides an additional feature that is not available in
- 'sub()' or 'gsub()': the ability to specify components of a regexp
- in the replacement text. This is done by using parentheses in the
- regexp to mark the components and then specifying '\N' in the
- replacement text, where N is a digit from 1 to 9. For example:
-
- $ gawk '
- > BEGIN {
- > a = "abc def"
- > b = gensub(/(.+) (.+)/, "\\2 \\1", "g", a)
- > print b
- > }'
- -| def abc
-
- As with 'sub()', you must type two backslashes in order to get one
- into the string. In the replacement text, the sequence '\0'
- represents the entire matched text, as does the character '&'.
-
- The following example shows how you can use the third argument to
- control which match of the regexp should be changed:
-
- $ echo a b c a b c |
- > gawk '{ print gensub(/a/, "AA", 2) }'
- -| a b c AA b c
-
- In this case, '$0' is the default target string. 'gensub()'
- returns the new string as its result, which is passed directly to
- 'print' for printing.
-
- If the HOW argument is a string that does not begin with 'g' or
- 'G', or if it is a number that is less than or equal to zero, only
- one substitution is performed. If HOW is zero, 'gawk' issues a
- warning message.
-
- If REGEXP does not match TARGET, 'gensub()''s return value is the
- original unchanged value of TARGET.
-
-'gsub(REGEXP, REPLACEMENT' [', TARGET']')'
- Search TARGET for _all_ of the longest, leftmost, _nonoverlapping_
- matching substrings it can find and replace them with REPLACEMENT.
- The 'g' in 'gsub()' stands for "global," which means replace
- everywhere. For example:
-
- { gsub(/Britain/, "United Kingdom"); print }
-
- replaces all occurrences of the string 'Britain' with 'United
- Kingdom' for all input records.
-
- The 'gsub()' function returns the number of substitutions made. If
- the variable to search and alter (TARGET) is omitted, then the
- entire input record ('$0') is used. As in 'sub()', the characters
- '&' and '\' are special, and the third argument must be assignable.
-
-'index(IN, FIND)'
- Search the string IN for the first occurrence of the string FIND,
- and return the position in characters where that occurrence begins
- in the string IN. Consider the following example:
-
- $ awk 'BEGIN { print index("peanut", "an") }'
- -| 3
-
- If FIND is not found, 'index()' returns zero.
-
- With BWK 'awk' and 'gawk', it is a fatal error to use a regexp
- constant for FIND. Other implementations allow it, simply treating
- the regexp constant as an expression meaning '$0 ~ /regexp/'.
- (d.c.)
-
-'length('[STRING]')'
- Return the number of characters in STRING. If STRING is a number,
- the length of the digit string representing that number is
- returned. For example, 'length("abcde")' is five. By contrast,
- 'length(15 * 35)' works out to three. In this example, 15 * 35 =
- 525, and 525 is then converted to the string '"525"', which has
- three characters.
-
- If no argument is supplied, 'length()' returns the length of '$0'.
-
- NOTE: In older versions of 'awk', the 'length()' function
- could be called without any parentheses. Doing so is
- considered poor practice, although the 2008 POSIX standard
- explicitly allows it, to support historical practice. For
- programs to be maximally portable, always supply the
- parentheses.
-
- If 'length()' is called with a variable that has not been used,
- 'gawk' forces the variable to be a scalar. Other implementations
- of 'awk' leave the variable without a type. (d.c.) Consider:
-
- $ gawk 'BEGIN { print length(x) ; x[1] = 1 }'
- -| 0
- error-> gawk: fatal: attempt to use scalar `x' as array
-
- $ nawk 'BEGIN { print length(x) ; x[1] = 1 }'
- -| 0
-
- If '--lint' has been specified on the command line, 'gawk' issues a
- warning about this.
-
- With 'gawk' and several other 'awk' implementations, when given an
- array argument, the 'length()' function returns the number of
- elements in the array. (c.e.) This is less useful than it might
- seem at first, as the array is not guaranteed to be indexed from
- one to the number of elements in it. If '--lint' is provided on
- the command line (*note Options::), 'gawk' warns that passing an
- array argument is not portable. If '--posix' is supplied, using an
- array argument is a fatal error (*note Arrays::).
-
-'match(STRING, REGEXP' [', ARRAY']')'
- Search STRING for the longest, leftmost substring matched by the
- regular expression REGEXP and return the character position (index)
- at which that substring begins (one, if it starts at the beginning
- of STRING). If no match is found, return zero.
-
- The REGEXP argument may be either a regexp constant ('/'...'/') or
- a string constant ('"'...'"'). In the latter case, the string is
- treated as a regexp to be matched. *Note Computed Regexps:: for a
- discussion of the difference between the two forms, and the
- implications for writing your program correctly.
-
- The order of the first two arguments is the opposite of most other
- string functions that work with regular expressions, such as
- 'sub()' and 'gsub()'. It might help to remember that for
- 'match()', the order is the same as for the '~' operator: 'STRING ~
- REGEXP'.
-
- The 'match()' function sets the predefined variable 'RSTART' to the
- index. It also sets the predefined variable 'RLENGTH' to the
- length in characters of the matched substring. If no match is
- found, 'RSTART' is set to zero, and 'RLENGTH' to -1.
-
- For example:
-
- {
- if ($1 == "FIND")
- regex = $2
- else {
- where = match($0, regex)
- if (where != 0)
- print "Match of", regex, "found at", where, "in", $0
- }
- }
-
- This program looks for lines that match the regular expression
- stored in the variable 'regex'. This regular expression can be
- changed. If the first word on a line is 'FIND', 'regex' is changed
- to be the second word on that line. Therefore, if given:
-
- FIND ru+n
- My program runs
- but not very quickly
- FIND Melvin
- JF+KM
- This line is property of Reality Engineering Co.
- Melvin was here.
-
- 'awk' prints:
-
- Match of ru+n found at 12 in My program runs
- Match of Melvin found at 1 in Melvin was here.
-
- If ARRAY is present, it is cleared, and then the zeroth element of
- ARRAY is set to the entire portion of STRING matched by REGEXP. If
- REGEXP contains parentheses, the integer-indexed elements of ARRAY
- are set to contain the portion of STRING matching the corresponding
- parenthesized subexpression. For example:
-
- $ echo foooobazbarrrrr |
- > gawk '{ match($0, /(fo+).+(bar*)/, arr)
- > print arr[1], arr[2] }'
- -| foooo barrrrr
-
- In addition, multidimensional subscripts are available providing
- the start index and length of each matched subexpression:
-
- $ echo foooobazbarrrrr |
- > gawk '{ match($0, /(fo+).+(bar*)/, arr)
- > print arr[1], arr[2]
- > print arr[1, "start"], arr[1, "length"]
- > print arr[2, "start"], arr[2, "length"]
- > }'
- -| foooo barrrrr
- -| 1 5
- -| 9 7
-
- There may not be subscripts for the start and index for every
- parenthesized subexpression, because they may not all have matched
- text; thus, they should be tested for with the 'in' operator (*note
- Reference to Elements::).
-
- The ARRAY argument to 'match()' is a 'gawk' extension. In
- compatibility mode (*note Options::), using a third argument is a
- fatal error.
-
-'patsplit(STRING, ARRAY' [', FIELDPAT' [', SEPS' ] ]') #'
- Divide STRING into pieces defined by FIELDPAT and store the pieces
- in ARRAY and the separator strings in the SEPS array. The first
- piece is stored in 'ARRAY[1]', the second piece in 'ARRAY[2]', and
- so forth. The third argument, FIELDPAT, is a regexp describing the
- fields in STRING (just as 'FPAT' is a regexp describing the fields
- in input records). It may be either a regexp constant or a string.
- If FIELDPAT is omitted, the value of 'FPAT' is used. 'patsplit()'
- returns the number of elements created. 'SEPS[I]' is the separator
- string between 'ARRAY[I]' and 'ARRAY[I+1]'. Any leading separator
- will be in 'SEPS[0]'.
-
- The 'patsplit()' function splits strings into pieces in a manner
- similar to the way input lines are split into fields using 'FPAT'
- (*note Splitting By Content::).
-
- Before splitting the string, 'patsplit()' deletes any previously
- existing elements in the arrays ARRAY and SEPS.
-
-'split(STRING, ARRAY' [', FIELDSEP' [', SEPS' ] ]')'
- Divide STRING into pieces separated by FIELDSEP and store the
- pieces in ARRAY and the separator strings in the SEPS array. The
- first piece is stored in 'ARRAY[1]', the second piece in
- 'ARRAY[2]', and so forth. The string value of the third argument,
- FIELDSEP, is a regexp describing where to split STRING (much as
- 'FS' can be a regexp describing where to split input records). If
- FIELDSEP is omitted, the value of 'FS' is used. 'split()' returns
- the number of elements created. SEPS is a 'gawk' extension, with
- 'SEPS[I]' being the separator string between 'ARRAY[I]' and
- 'ARRAY[I+1]'. If FIELDSEP is a single space, then any leading
- whitespace goes into 'SEPS[0]' and any trailing whitespace goes
- into 'SEPS[N]', where N is the return value of 'split()' (i.e., the
- number of elements in ARRAY).
-
- The 'split()' function splits strings into pieces in a manner
- similar to the way input lines are split into fields. For example:
-
- split("cul-de-sac", a, "-", seps)
-
- splits the string '"cul-de-sac"' into three fields using '-' as the
- separator. It sets the contents of the array 'a' as follows:
-
- a[1] = "cul"
- a[2] = "de"
- a[3] = "sac"
-
- and sets the contents of the array 'seps' as follows:
-
- seps[1] = "-"
- seps[2] = "-"
-
- The value returned by this call to 'split()' is three.
-
- As with input field-splitting, when the value of FIELDSEP is '" "',
- leading and trailing whitespace is ignored in values assigned to
- the elements of ARRAY but not in SEPS, and the elements are
- separated by runs of whitespace. Also, as with input field
- splitting, if FIELDSEP is the null string, each individual
- character in the string is split into its own array element.
- (c.e.)
-
- Note, however, that 'RS' has no effect on the way 'split()' works.
- Even though 'RS = ""' causes the newline character to also be an
- input field separator, this does not affect how 'split()' splits
- strings.
-
- Modern implementations of 'awk', including 'gawk', allow the third
- argument to be a regexp constant ('/'...'/') as well as a string.
- (d.c.) The POSIX standard allows this as well. *Note Computed
- Regexps:: for a discussion of the difference between using a string
- constant or a regexp constant, and the implications for writing
- your program correctly.
-
- Before splitting the string, 'split()' deletes any previously
- existing elements in the arrays ARRAY and SEPS.
-
- If STRING is null, the array has no elements. (So this is a
- portable way to delete an entire array with one statement. *Note
- Delete::.)
-
- If STRING does not match FIELDSEP at all (but is not null), ARRAY
- has one element only. The value of that element is the original
- STRING.
-
- In POSIX mode (*note Options::), the fourth argument is not
- allowed.
-
-'sprintf(FORMAT, EXPRESSION1, ...)'
- Return (without printing) the string that 'printf' would have
- printed out with the same arguments (*note Printf::). For example:
-
- pival = sprintf("pi = %.2f (approx.)", 22/7)
-
- assigns the string 'pi = 3.14 (approx.)' to the variable 'pival'.
-
-'strtonum(STR) #'
- Examine STR and return its numeric value. If STR begins with a
- leading '0', 'strtonum()' assumes that STR is an octal number. If
- STR begins with a leading '0x' or '0X', 'strtonum()' assumes that
- STR is a hexadecimal number. For example:
-
- $ echo 0x11 |
- > gawk '{ printf "%d\n", strtonum($1) }'
- -| 17
-
- Using the 'strtonum()' function is _not_ the same as adding zero to
- a string value; the automatic coercion of strings to numbers works
- only for decimal data, not for octal or hexadecimal.(1)
-
- Note also that 'strtonum()' uses the current locale's decimal point
- for recognizing numbers (*note Locales::).
-
-'sub(REGEXP, REPLACEMENT' [', TARGET']')'
- Search TARGET, which is treated as a string, for the leftmost,
- longest substring matched by the regular expression REGEXP. Modify
- the entire string by replacing the matched text with REPLACEMENT.
- The modified string becomes the new value of TARGET. Return the
- number of substitutions made (zero or one).
-
- The REGEXP argument may be either a regexp constant ('/'...'/') or
- a string constant ('"'...'"'). In the latter case, the string is
- treated as a regexp to be matched. *Note Computed Regexps:: for a
- discussion of the difference between the two forms, and the
- implications for writing your program correctly.
-
- This function is peculiar because TARGET is not simply used to
- compute a value, and not just any expression will do--it must be a
- variable, field, or array element so that 'sub()' can store a
- modified value there. If this argument is omitted, then the
- default is to use and alter '$0'.(2) For example:
-
- str = "water, water, everywhere"
- sub(/at/, "ith", str)
-
- sets 'str' to 'wither, water, everywhere', by replacing the
- leftmost longest occurrence of 'at' with 'ith'.
-
- If the special character '&' appears in REPLACEMENT, it stands for
- the precise substring that was matched by REGEXP. (If the regexp
- can match more than one string, then this precise substring may
- vary.) For example:
-
- { sub(/candidate/, "& and his wife"); print }
-
- changes the first occurrence of 'candidate' to 'candidate and his
- wife' on each input line. Here is another example:
-
- $ awk 'BEGIN {
- > str = "daabaaa"
- > sub(/a+/, "C&C", str)
- > print str
- > }'
- -| dCaaCbaaa
-
- This shows how '&' can represent a nonconstant string and also
- illustrates the "leftmost, longest" rule in regexp matching (*note
- Leftmost Longest::).
-
- The effect of this special character ('&') can be turned off by
- putting a backslash before it in the string. As usual, to insert
- one backslash in the string, you must write two backslashes.
- Therefore, write '\\&' in a string constant to include a literal
- '&' in the replacement. For example, the following shows how to
- replace the first '|' on each line with an '&':
-
- { sub(/\|/, "\\&"); print }
-
- As mentioned, the third argument to 'sub()' must be a variable,
- field, or array element. Some versions of 'awk' allow the third
- argument to be an expression that is not an lvalue. In such a
- case, 'sub()' still searches for the pattern and returns zero or
- one, but the result of the substitution (if any) is thrown away
- because there is no place to put it. Such versions of 'awk' accept
- expressions like the following:
-
- sub(/USA/, "United States", "the USA and Canada")
-
- For historical compatibility, 'gawk' accepts such erroneous code.
- However, using any other nonchangeable object as the third
- parameter causes a fatal error and your program will not run.
-
- Finally, if the REGEXP is not a regexp constant, it is converted
- into a string, and then the value of that string is treated as the
- regexp to match.
-
-'substr(STRING, START' [', LENGTH' ]')'
- Return a LENGTH-character-long substring of STRING, starting at
- character number START. The first character of a string is
- character number one.(3) For example, 'substr("washington", 5, 3)'
- returns '"ing"'.
-
- If LENGTH is not present, 'substr()' returns the whole suffix of
- STRING that begins at character number START. For example,
- 'substr("washington", 5)' returns '"ington"'. The whole suffix is
- also returned if LENGTH is greater than the number of characters
- remaining in the string, counting from character START.
-
- If START is less than one, 'substr()' treats it as if it was one.
- (POSIX doesn't specify what to do in this case: BWK 'awk' acts this
- way, and therefore 'gawk' does too.) If START is greater than the
- number of characters in the string, 'substr()' returns the null
- string. Similarly, if LENGTH is present but less than or equal to
- zero, the null string is returned.
-
- The string returned by 'substr()' _cannot_ be assigned. Thus, it
- is a mistake to attempt to change a portion of a string, as shown
- in the following example:
-
- string = "abcdef"
- # try to get "abCDEf", won't work
- substr(string, 3, 3) = "CDE"
-
- It is also a mistake to use 'substr()' as the third argument of
- 'sub()' or 'gsub()':
-
- gsub(/xyz/, "pdq", substr($0, 5, 20)) # WRONG
-
- (Some commercial versions of 'awk' treat 'substr()' as assignable,
- but doing so is not portable.)
-
- If you need to replace bits and pieces of a string, combine
- 'substr()' with string concatenation, in the following manner:
-
- string = "abcdef"
- ...
- string = substr(string, 1, 2) "CDE" substr(string, 6)
-
-'tolower(STRING)'
- Return a copy of STRING, with each uppercase character in the
- string replaced with its corresponding lowercase character.
- Nonalphabetic characters are left unchanged. For example,
- 'tolower("MiXeD cAsE 123")' returns '"mixed case 123"'.
-
-'toupper(STRING)'
- Return a copy of STRING, with each lowercase character in the
- string replaced with its corresponding uppercase character.
- Nonalphabetic characters are left unchanged. For example,
- 'toupper("MiXeD cAsE 123")' returns '"MIXED CASE 123"'.
-
- Matching the Null String
-
- In 'awk', the '*' operator can match the null string. This is
-particularly important for the 'sub()', 'gsub()', and 'gensub()'
-functions. For example:
-
- $ echo abc | awk '{ gsub(/m*/, "X"); print }'
- -| XaXbXcX
-
-Although this makes a certain amount of sense, it can be surprising.
-
- ---------- Footnotes ----------
-
- (1) Unless you use the '--non-decimal-data' option, which isn't
-recommended. *Note Nondecimal Data:: for more information.
-
- (2) Note that this means that the record will first be regenerated
-using the value of 'OFS' if any fields have been changed, and that the
-fields will be updated after the substitution, even if the operation is
-a "no-op" such as 'sub(/^/, "")'.
-
- (3) This is different from C and C++, in which the first character is
-number zero.
-
-
-File: gawk.info, Node: Gory Details, Up: String Functions
-
-9.1.3.1 More about '\' and '&' with 'sub()', 'gsub()', and 'gensub()'
-.....................................................................
-
- CAUTION: This subsubsection has been reported to cause headaches.
- You might want to skip it upon first reading.
-
- When using 'sub()', 'gsub()', or 'gensub()', and trying to get
-literal backslashes and ampersands into the replacement text, you need
-to remember that there are several levels of "escape processing" going
-on.
-
- First, there is the "lexical" level, which is when 'awk' reads your
-program and builds an internal copy of it to execute. Then there is the
-runtime level, which is when 'awk' actually scans the replacement string
-to determine what to generate.
-
- At both levels, 'awk' looks for a defined set of characters that can
-come after a backslash. At the lexical level, it looks for the escape
-sequences listed in *note Escape Sequences::. Thus, for every '\' that
-'awk' processes at the runtime level, you must type two backslashes at
-the lexical level. When a character that is not valid for an escape
-sequence follows the '\', BWK 'awk' and 'gawk' both simply remove the
-initial '\' and put the next character into the string. Thus, for
-example, '"a\qb"' is treated as '"aqb"'.
-
- At the runtime level, the various functions handle sequences of '\'
-and '&' differently. The situation is (sadly) somewhat complex.
-Historically, the 'sub()' and 'gsub()' functions treated the
-two-character sequence '\&' specially; this sequence was replaced in the
-generated text with a single '&'. Any other '\' within the REPLACEMENT
-string that did not precede an '&' was passed through unchanged. This
-is illustrated in *note Table 9.1: table-sub-escapes.
-
- You type 'sub()' sees 'sub()' generates
- ----- ------- ----------
- '\&' '&' The matched text
- '\\&' '\&' A literal '&'
- '\\\&' '\&' A literal '&'
- '\\\\&' '\\&' A literal '\&'
- '\\\\\&' '\\&' A literal '\&'
- '\\\\\\&' '\\\&' A literal '\\&'
- '\\q' '\q' A literal '\q'
-
-Table 9.1: Historical escape sequence processing for 'sub()' and
-'gsub()'
-
-This table shows the lexical-level processing, where an odd number of
-backslashes becomes an even number at the runtime level, as well as the
-runtime processing done by 'sub()'. (For the sake of simplicity, the
-rest of the following tables only show the case of even numbers of
-backslashes entered at the lexical level.)
-
- The problem with the historical approach is that there is no way to
-get a literal '\' followed by the matched text.
-
- Several editions of the POSIX standard attempted to fix this problem
-but weren't successful. The details are irrelevant at this point in
-time.
-
- At one point, the 'gawk' maintainer submitted proposed text for a
-revised standard that reverts to rules that correspond more closely to
-the original existing practice. The proposed rules have special cases
-that make it possible to produce a '\' preceding the matched text. This
-is shown in *note Table 9.2: table-sub-proposed.
-
- You type 'sub()' sees 'sub()' generates
- ----- ------- ----------
- '\\\\\\&' '\\\&' A literal '\&'
- '\\\\&' '\\&' A literal '\', followed by the matched text
- '\\&' '\&' A literal '&'
- '\\q' '\q' A literal '\q'
- '\\\\' '\\' '\\'
-
-Table 9.2: 'gawk' rules for 'sub()' and backslash
-
- In a nutshell, at the runtime level, there are now three special
-sequences of characters ('\\\&', '\\&', and '\&') whereas historically
-there was only one. However, as in the historical case, any '\' that is
-not part of one of these three sequences is not special and appears in
-the output literally.
-
- 'gawk' 3.0 and 3.1 follow these rules for 'sub()' and 'gsub()'. The
-POSIX standard took much longer to be revised than was expected. In
-addition, the 'gawk' maintainer's proposal was lost during the
-standardization process. The final rules are somewhat simpler. The
-results are similar except for one case.
-
- The POSIX rules state that '\&' in the replacement string produces a
-literal '&', '\\' produces a literal '\', and '\' followed by anything
-else is not special; the '\' is placed straight into the output. These
-rules are presented in *note Table 9.3: table-posix-sub.
-
- You type 'sub()' sees 'sub()' generates
- ----- ------- ----------
- '\\\\\\&' '\\\&' A literal '\&'
- '\\\\&' '\\&' A literal '\', followed by the matched text
- '\\&' '\&' A literal '&'
- '\\q' '\q' A literal '\q'
- '\\\\' '\\' '\'
-
-Table 9.3: POSIX rules for 'sub()' and 'gsub()'
-
- The only case where the difference is noticeable is the last one:
-'\\\\' is seen as '\\' and produces '\' instead of '\\'.
-
- Starting with version 3.1.4, 'gawk' followed the POSIX rules when
-'--posix' was specified (*note Options::). Otherwise, it continued to
-follow the proposed rules, as that had been its behavior for many years.
-
- When version 4.0.0 was released, the 'gawk' maintainer made the POSIX
-rules the default, breaking well over a decade's worth of backward
-compatibility.(1) Needless to say, this was a bad idea, and as of
-version 4.0.1, 'gawk' resumed its historical behavior, and only follows
-the POSIX rules when '--posix' is given.
-
- The rules for 'gensub()' are considerably simpler. At the runtime
-level, whenever 'gawk' sees a '\', if the following character is a
-digit, then the text that matched the corresponding parenthesized
-subexpression is placed in the generated output. Otherwise, no matter
-what character follows the '\', it appears in the generated text and the
-'\' does not, as shown in *note Table 9.4: table-gensub-escapes.
-
- You type 'gensub()' sees 'gensub()' generates
- ----- --------- ------------
- '&' '&' The matched text
- '\\&' '\&' A literal '&'
- '\\\\' '\\' A literal '\'
- '\\\\&' '\\&' A literal '\', then the matched text
- '\\\\\\&' '\\\&' A literal '\&'
- '\\q' '\q' A literal 'q'
-
-Table 9.4: Escape sequence processing for 'gensub()'
-
- Because of the complexity of the lexical- and runtime-level
-processing and the special cases for 'sub()' and 'gsub()', we recommend
-the use of 'gawk' and 'gensub()' when you have to do substitutions.
-
- ---------- Footnotes ----------
-
- (1) This was rather naive of him, despite there being a note in this
-minor node indicating that the next major version would move to the
-POSIX rules.
-
-
-File: gawk.info, Node: I/O Functions, Next: Time Functions, Prev: String Functions, Up: Built-in
-
-9.1.4 Input/Output Functions
-----------------------------
-
-The following functions relate to input/output (I/O). Optional
-parameters are enclosed in square brackets ([ ]):
-
-'close('FILENAME [',' HOW]')'
- Close the file FILENAME for input or output. Alternatively, the
- argument may be a shell command that was used for creating a
- coprocess, or for redirecting to or from a pipe; then the coprocess
- or pipe is closed. *Note Close Files And Pipes:: for more
- information.
-
- When closing a coprocess, it is occasionally useful to first close
- one end of the two-way pipe and then to close the other. This is
- done by providing a second argument to 'close()'. This second
- argument (HOW) should be one of the two string values '"to"' or
- '"from"', indicating which end of the pipe to close. Case in the
- string does not matter. *Note Two-way I/O::, which discusses this
- feature in more detail and gives an example.
-
- Note that the second argument to 'close()' is a 'gawk' extension;
- it is not available in compatibility mode (*note Options::).
-
-'fflush('[FILENAME]')'
- Flush any buffered output associated with FILENAME, which is either
- a file opened for writing or a shell command for redirecting output
- to a pipe or coprocess.
-
- Many utility programs "buffer" their output (i.e., they save
- information to write to a disk file or the screen in memory until
- there is enough for it to be worthwhile to send the data to the
- output device). This is often more efficient than writing every
- little bit of information as soon as it is ready. However,
- sometimes it is necessary to force a program to "flush" its buffers
- (i.e., write the information to its destination, even if a buffer
- is not full). This is the purpose of the 'fflush()'
- function--'gawk' also buffers its output, and the 'fflush()'
- function forces 'gawk' to flush its buffers.
-
- Brian Kernighan added 'fflush()' to his 'awk' in April 1992. For
- two decades, it was a common extension. In December 2012, it was
- accepted for inclusion into the POSIX standard. See the Austin
- Group website (http://austingroupbugs.net/view.php?id=634).
-
- POSIX standardizes 'fflush()' as follows: if there is no argument,
- or if the argument is the null string ('""'), then 'awk' flushes
- the buffers for _all_ open output files and pipes.
-
- NOTE: Prior to version 4.0.2, 'gawk' would flush only the
- standard output if there was no argument, and flush all output
- files and pipes if the argument was the null string. This was
- changed in order to be compatible with Brian Kernighan's
- 'awk', in the hope that standardizing this feature in POSIX
- would then be easier (which indeed proved to be the case).
-
- With 'gawk', you can use 'fflush("/dev/stdout")' if you wish
- to flush only the standard output.
-
- 'fflush()' returns zero if the buffer is successfully flushed;
- otherwise, it returns a nonzero value. ('gawk' returns -1.) In
- the case where all buffers are flushed, the return value is zero
- only if all buffers were flushed successfully. Otherwise, it is
- -1, and 'gawk' warns about the problem FILENAME.
-
- 'gawk' also issues a warning message if you attempt to flush a file
- or pipe that was opened for reading (such as with 'getline'), or if
- FILENAME is not an open file, pipe, or coprocess. In such a case,
- 'fflush()' returns -1, as well.
-
- Interactive Versus Noninteractive Buffering
-
- As a side point, buffering issues can be even more confusing if
- your program is "interactive" (i.e., communicating with a user
- sitting at a keyboard).(1)
-
- Interactive programs generally "line buffer" their output (i.e.,
- they write out every line). Noninteractive programs wait until
- they have a full buffer, which may be many lines of output. Here
- is an example of the difference:
-
- $ awk '{ print $1 + $2 }'
- 1 1
- -| 2
- 2 3
- -| 5
- Ctrl-d
-
- Each line of output is printed immediately. Compare that behavior
- with this example:
-
- $ awk '{ print $1 + $2 }' | cat
- 1 1
- 2 3
- Ctrl-d
- -| 2
- -| 5
-
- Here, no output is printed until after the 'Ctrl-d' is typed,
- because it is all buffered and sent down the pipe to 'cat' in one
- shot.
-
-'system(COMMAND)'
- Execute the operating system command COMMAND and then return to the
- 'awk' program. Return COMMAND's exit status (see further on).
-
- For example, if the following fragment of code is put in your 'awk'
- program:
-
- END {
- system("date | mail -s 'awk run done' root")
- }
-
- the system administrator is sent mail when the 'awk' program
- finishes processing input and begins its end-of-input processing.
-
- Note that redirecting 'print' or 'printf' into a pipe is often
- enough to accomplish your task. If you need to run many commands,
- it is more efficient to simply print them down a pipeline to the
- shell:
-
- while (MORE STUFF TO DO)
- print COMMAND | "/bin/sh"
- close("/bin/sh")
-
- However, if your 'awk' program is interactive, 'system()' is useful
- for running large self-contained programs, such as a shell or an
- editor. Some operating systems cannot implement the 'system()'
- function. 'system()' causes a fatal error if it is not supported.
-
- NOTE: When '--sandbox' is specified, the 'system()' function
- is disabled (*note Options::).
-
- On POSIX systems, a command's exit status is a 16-bit number. The
- exit value passed to the C 'exit()' function is held in the
- high-order eight bits. The low-order bits indicate if the process
- was killed by a signal (bit 7) and if so, the guilty signal number
- (bits 0-6).
-
- Traditionally, 'awk''s 'system()' function has simply returned the
- exit status value divided by 256. In the normal case this gives
- the exit status but in the case of death-by-signal it yields a
- fractional floating-point value.(2) POSIX states that 'awk''s
- 'system()' should return the full 16-bit value.
-
- 'gawk' steers a middle ground. The return values are summarized in
- *note Table 9.5: table-system-return-values.
-
- Situation Return value from 'system()'
- --------------------------------------------------------------------------
- '--traditional' C 'system()''s value divided by 256
- '--posix' C 'system()''s value
- Normal exit of command Command's exit status
- Death by signal of command 256 + number of murderous signal
- Death by signal of command 512 + number of murderous signal
- with core dump
- Some kind of error -1
-
- Table 9.5: Return values from 'system()'
-
- Controlling Output Buffering with 'system()'
-
- The 'fflush()' function provides explicit control over output
-buffering for individual files and pipes. However, its use is not
-portable to many older 'awk' implementations. An alternative method to
-flush output buffers is to call 'system()' with a null string as its
-argument:
-
- system("") # flush output
-
-'gawk' treats this use of the 'system()' function as a special case and
-is smart enough not to run a shell (or other command interpreter) with
-the empty command. Therefore, with 'gawk', this idiom is not only
-useful, it is also efficient. Although this method should work with
-other 'awk' implementations, it does not necessarily avoid starting an
-unnecessary shell. (Other implementations may only flush the buffer
-associated with the standard output and not necessarily all buffered
-output.)
-
- If you think about what a programmer expects, it makes sense that
-'system()' should flush any pending output. The following program:
-
- BEGIN {
- print "first print"
- system("echo system echo")
- print "second print"
- }
-
-must print:
-
- first print
- system echo
- second print
-
-and not:
-
- system echo
- first print
- second print
-
- If 'awk' did not flush its buffers before calling 'system()', you
-would see the latter (undesirable) output.
-
- ---------- Footnotes ----------
-
- (1) A program is interactive if the standard output is connected to a
-terminal device. On modern systems, this means your keyboard and
-screen.
-
- (2) In private correspondence, Dr. Kernighan has indicated to me that
-the way this was done was probably a mistake.
-
-
-File: gawk.info, Node: Time Functions, Next: Bitwise Functions, Prev: I/O Functions, Up: Built-in
-
-9.1.5 Time Functions
---------------------
-
-'awk' programs are commonly used to process log files containing
-timestamp information, indicating when a particular log record was
-written. Many programs log their timestamps in the form returned by the
-'time()' system call, which is the number of seconds since a particular
-epoch. On POSIX-compliant systems, it is the number of seconds since
-1970-01-01 00:00:00 UTC, not counting leap seconds.(1) All known
-POSIX-compliant systems support timestamps from 0 through 2^31 - 1,
-which is sufficient to represent times through 2038-01-19 03:14:07 UTC.
-Many systems support a wider range of timestamps, including negative
-timestamps that represent times before the epoch.
-
- In order to make it easier to process such log files and to produce
-useful reports, 'gawk' provides the following functions for working with
-timestamps. They are 'gawk' extensions; they are not specified in the
-POSIX standard.(2) However, recent versions of 'mawk' (*note Other
-Versions::) also support these functions. Optional parameters are
-enclosed in square brackets ([ ]):
-
-'mktime(DATESPEC)'
- Turn DATESPEC into a timestamp in the same form as is returned by
- 'systime()'. It is similar to the function of the same name in ISO
- C. The argument, DATESPEC, is a string of the form
- '"YYYY MM DD HH MM SS [DST]"'. The string consists of six or seven
- numbers representing, respectively, the full year including
- century, the month from 1 to 12, the day of the month from 1 to 31,
- the hour of the day from 0 to 23, the minute from 0 to 59, the
- second from 0 to 60,(3) and an optional daylight-savings flag.
-
- The values of these numbers need not be within the ranges
- specified; for example, an hour of -1 means 1 hour before midnight.
- The origin-zero Gregorian calendar is assumed, with year 0
- preceding year 1 and year -1 preceding year 0. The time is assumed
- to be in the local time zone. If the daylight-savings flag is
- positive, the time is assumed to be daylight savings time; if zero,
- the time is assumed to be standard time; and if negative (the
- default), 'mktime()' attempts to determine whether daylight savings
- time is in effect for the specified time.
-
- If DATESPEC does not contain enough elements or if the resulting
- time is out of range, 'mktime()' returns -1.
-
-'strftime('[FORMAT [',' TIMESTAMP [',' UTC-FLAG] ] ]')'
- Format the time specified by TIMESTAMP based on the contents of the
- FORMAT string and return the result. It is similar to the function
- of the same name in ISO C. If UTC-FLAG is present and is either
- nonzero or non-null, the value is formatted as UTC (Coordinated
- Universal Time, formerly GMT or Greenwich Mean Time). Otherwise,
- the value is formatted for the local time zone. The TIMESTAMP is
- in the same format as the value returned by the 'systime()'
- function. If no TIMESTAMP argument is supplied, 'gawk' uses the
- current time of day as the timestamp. Without a FORMAT argument,
- 'strftime()' uses the value of 'PROCINFO["strftime"]' as the format
- string (*note Built-in Variables::). The default string value is
- '"%a %b %e %H:%M:%S %Z %Y"'. This format string produces output
- that is equivalent to that of the 'date' utility. You can assign a
- new value to 'PROCINFO["strftime"]' to change the default format;
- see the following list for the various format directives.
-
-'systime()'
- Return the current time as the number of seconds since the system
- epoch. On POSIX systems, this is the number of seconds since
- 1970-01-01 00:00:00 UTC, not counting leap seconds. It may be a
- different number on other systems.
-
- The 'systime()' function allows you to compare a timestamp from a log
-file with the current time of day. In particular, it is easy to
-determine how long ago a particular record was logged. It also allows
-you to produce log records using the "seconds since the epoch" format.
-
- The 'mktime()' function allows you to convert a textual
-representation of a date and time into a timestamp. This makes it easy
-to do before/after comparisons of dates and times, particularly when
-dealing with date and time data coming from an external source, such as
-a log file.
-
- The 'strftime()' function allows you to easily turn a timestamp into
-human-readable information. It is similar in nature to the 'sprintf()'
-function (*note String Functions::), in that it copies nonformat
-specification characters verbatim to the returned string, while
-substituting date and time values for format specifications in the
-FORMAT string.
-
- 'strftime()' is guaranteed by the 1999 ISO C standard(4) to support
-the following date format specifications:
-
-'%a'
- The locale's abbreviated weekday name.
-
-'%A'
- The locale's full weekday name.
-
-'%b'
- The locale's abbreviated month name.
-
-'%B'
- The locale's full month name.
-
-'%c'
- The locale's "appropriate" date and time representation. (This is
- '%A %B %d %T %Y' in the '"C"' locale.)
-
-'%C'
- The century part of the current year. This is the year divided by
- 100 and truncated to the next lower integer.
-
-'%d'
- The day of the month as a decimal number (01-31).
-
-'%D'
- Equivalent to specifying '%m/%d/%y'.
-
-'%e'
- The day of the month, padded with a space if it is only one digit.
-
-'%F'
- Equivalent to specifying '%Y-%m-%d'. This is the ISO 8601 date
- format.
-
-'%g'
- The year modulo 100 of the ISO 8601 week number, as a decimal
- number (00-99). For example, January 1, 2012, is in week 53 of
- 2011. Thus, the year of its ISO 8601 week number is 2011, even
- though its year is 2012. Similarly, December 31, 2012, is in week
- 1 of 2013. Thus, the year of its ISO week number is 2013, even
- though its year is 2012.
-
-'%G'
- The full year of the ISO week number, as a decimal number.
-
-'%h'
- Equivalent to '%b'.
-
-'%H'
- The hour (24-hour clock) as a decimal number (00-23).
-
-'%I'
- The hour (12-hour clock) as a decimal number (01-12).
-
-'%j'
- The day of the year as a decimal number (001-366).
-
-'%m'
- The month as a decimal number (01-12).
-
-'%M'
- The minute as a decimal number (00-59).
-
-'%n'
- A newline character (ASCII LF).
-
-'%p'
- The locale's equivalent of the AM/PM designations associated with a
- 12-hour clock.
-
-'%r'
- The locale's 12-hour clock time. (This is '%I:%M:%S %p' in the
- '"C"' locale.)
-
-'%R'
- Equivalent to specifying '%H:%M'.
-
-'%S'
- The second as a decimal number (00-60).
-
-'%t'
- A TAB character.
-
-'%T'
- Equivalent to specifying '%H:%M:%S'.
-
-'%u'
- The weekday as a decimal number (1-7). Monday is day one.
-
-'%U'
- The week number of the year (with the first Sunday as the first day
- of week one) as a decimal number (00-53).
-
-'%V'
- The week number of the year (with the first Monday as the first day
- of week one) as a decimal number (01-53). The method for
- determining the week number is as specified by ISO 8601. (To wit:
- if the week containing January 1 has four or more days in the new
- year, then it is week one; otherwise it is the last week [52 or 53]
- of the previous year and the next week is week one.)
-
-'%w'
- The weekday as a decimal number (0-6). Sunday is day zero.
-
-'%W'
- The week number of the year (with the first Monday as the first day
- of week one) as a decimal number (00-53).
-
-'%x'
- The locale's "appropriate" date representation. (This is '%A %B %d
- %Y' in the '"C"' locale.)
-
-'%X'
- The locale's "appropriate" time representation. (This is '%T' in
- the '"C"' locale.)
-
-'%y'
- The year modulo 100 as a decimal number (00-99).
-
-'%Y'
- The full year as a decimal number (e.g., 2015).
-
-'%z'
- The time zone offset in a '+HHMM' format (e.g., the format
- necessary to produce RFC 822/RFC 1036 date headers).
-
-'%Z'
- The time zone name or abbreviation; no characters if no time zone
- is determinable.
-
-'%Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH'
-'%OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy'
- "Alternative representations" for the specifications that use only
- the second letter ('%c', '%C', and so on).(5) (These facilitate
- compliance with the POSIX 'date' utility.)
-
-'%%'
- A literal '%'.
-
- If a conversion specifier is not one of those just listed, the
-behavior is undefined.(6)
-
- For systems that are not yet fully standards-compliant, 'gawk'
-supplies a copy of 'strftime()' from the GNU C Library. It supports all
-of the just-listed format specifications. If that version is used to
-compile 'gawk' (*note Installation::), then the following additional
-format specifications are available:
-
-'%k'
- The hour (24-hour clock) as a decimal number (0-23). Single-digit
- numbers are padded with a space.
-
-'%l'
- The hour (12-hour clock) as a decimal number (1-12). Single-digit
- numbers are padded with a space.
-
-'%s'
- The time as a decimal timestamp in seconds since the epoch.
-
- Additionally, the alternative representations are recognized but
-their normal representations are used.
-
- The following example is an 'awk' implementation of the POSIX 'date'
-utility. Normally, the 'date' utility prints the current date and time
-of day in a well-known format. However, if you provide an argument to
-it that begins with a '+', 'date' copies nonformat specifier characters
-to the standard output and interprets the current time according to the
-format specifiers in the string. For example:
-
- $ date '+Today is %A, %B %d, %Y.'
- -| Today is Monday, September 22, 2014.
-
- Here is the 'gawk' version of the 'date' utility. It has a shell
-"wrapper" to handle the '-u' option, which requires that 'date' run as
-if the time zone is set to UTC:
-
- #! /bin/sh
- #
- # date --- approximate the POSIX 'date' command
-
- case $1 in
- -u) TZ=UTC0 # use UTC
- export TZ
- shift ;;
- esac
-
- gawk 'BEGIN {
- format = PROCINFO["strftime"]
- exitval = 0
-
- if (ARGC > 2)
- exitval = 1
- else if (ARGC == 2) {
- format = ARGV[1]
- if (format ~ /^\+/)
- format = substr(format, 2) # remove leading +
- }
- print strftime(format)
- exit exitval
- }' "$@"
-
- ---------- Footnotes ----------
-
- (1) *Note Glossary::, especially the entries "Epoch" and "UTC."
-
- (2) The GNU 'date' utility can also do many of the things described
-here. Its use may be preferable for simple time-related operations in
-shell scripts.
-
- (3) Occasionally there are minutes in a year with a leap second,
-which is why the seconds can go up to 60.
-
- (4) Unfortunately, not every system's 'strftime()' necessarily
-supports all of the conversions listed here.
-
- (5) If you don't understand any of this, don't worry about it; these
-facilities are meant to make it easier to "internationalize" programs.
-Other internationalization features are described in *note
-Internationalization::.
-
- (6) This is because ISO C leaves the behavior of the C version of
-'strftime()' undefined and 'gawk' uses the system's version of
-'strftime()' if it's there. Typically, the conversion specifier either
-does not appear in the returned string or appears literally.
-
-
-File: gawk.info, Node: Bitwise Functions, Next: Type Functions, Prev: Time Functions, Up: Built-in
-
-9.1.6 Bit-Manipulation Functions
---------------------------------
-
- I can explain it for you, but I can't understand it for you.
- -- _Anonymous_
-
- Many languages provide the ability to perform "bitwise" operations on
-two integer numbers. In other words, the operation is performed on each
-successive pair of bits in the operands. Three common operations are
-bitwise AND, OR, and XOR. The operations are described in *note Table
-9.6: table-bitwise-ops.
-
- Bit operator
- | AND | OR | XOR
- |--+--+--+--+--+--
- Operands | 0 | 1 | 0 | 1 | 0 | 1
- -------+--+--+--+--+--+--
- 0 | 0 0 | 0 1 | 0 1
- 1 | 0 1 | 1 1 | 1 0
-
-Table 9.6: Bitwise operations
-
- As you can see, the result of an AND operation is 1 only when _both_
-bits are 1. The result of an OR operation is 1 if _either_ bit is 1.
-The result of an XOR operation is 1 if either bit is 1, but not both.
-The next operation is the "complement"; the complement of 1 is 0 and the
-complement of 0 is 1. Thus, this operation "flips" all the bits of a
-given value.
-
- Finally, two other common operations are to shift the bits left or
-right. For example, if you have a bit string '10111001' and you shift
-it right by three bits, you end up with '00010111'.(1) If you start
-over again with '10111001' and shift it left by three bits, you end up
-with '11001000'. The following list describes 'gawk''s built-in
-functions that implement the bitwise operations. Optional parameters
-are enclosed in square brackets ([ ]):
-
-'and(V1, V2 [, ...])'
- Return the bitwise AND of the arguments. There must be at least
- two.
-
-'compl(VAL)'
- Return the bitwise complement of VAL.
-
-'lshift(VAL, COUNT)'
- Return the value of VAL, shifted left by COUNT bits.
-
-'or(V1, V2 [, ...])'
- Return the bitwise OR of the arguments. There must be at least
- two.
-
-'rshift(VAL, COUNT)'
- Return the value of VAL, shifted right by COUNT bits.
-
-'xor(V1, V2 [, ...])'
- Return the bitwise XOR of the arguments. There must be at least
- two.
-
- For all of these functions, first the double-precision floating-point
-value is converted to the widest C unsigned integer type, then the
-bitwise operation is performed. If the result cannot be represented
-exactly as a C 'double', leading nonzero bits are removed one by one
-until it can be represented exactly. The result is then converted back
-into a C 'double'. (If you don't understand this paragraph, don't worry
-about it.)
-
- Here is a user-defined function (*note User-defined::) that
-illustrates the use of these functions:
-
- # bits2str --- turn a byte into readable ones and zeros
-
- function bits2str(bits, data, mask)
- {
- if (bits == 0)
- return "0"
-
- mask = 1
- for (; bits != 0; bits = rshift(bits, 1))
- data = (and(bits, mask) ? "1" : "0") data
-
- while ((length(data) % 8) != 0)
- data = "0" data
-
- return data
- }
-
- BEGIN {
- printf "123 = %s\n", bits2str(123)
- printf "0123 = %s\n", bits2str(0123)
- printf "0x99 = %s\n", bits2str(0x99)
- comp = compl(0x99)
- printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp)
- shift = lshift(0x99, 2)
- printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
- shift = rshift(0x99, 2)
- printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
- }
-
-This program produces the following output when run:
-
- $ gawk -f testbits.awk
- -| 123 = 01111011
- -| 0123 = 01010011
- -| 0x99 = 10011001
- -| compl(0x99) = 0x3fffffffffff66 = 00111111111111111111111111111111111111111111111101100110
- -| lshift(0x99, 2) = 0x264 = 0000001001100100
- -| rshift(0x99, 2) = 0x26 = 00100110
-
- The 'bits2str()' function turns a binary number into a string.
-Initializing 'mask' to one creates a binary value where the rightmost
-bit is set to one. Using this mask, the function repeatedly checks the
-rightmost bit. ANDing the mask with the value indicates whether the
-rightmost bit is one or not. If so, a '"1"' is concatenated onto the
-front of the string. Otherwise, a '"0"' is added. The value is then
-shifted right by one bit and the loop continues until there are no more
-one bits.
-
- If the initial value is zero, it returns a simple '"0"'. Otherwise,
-at the end, it pads the value with zeros to represent multiples of 8-bit
-quantities. This is typical in modern computers.
-
- The main code in the 'BEGIN' rule shows the difference between the
-decimal and octal values for the same numbers (*note
-Nondecimal-numbers::), and then demonstrates the results of the
-'compl()', 'lshift()', and 'rshift()' functions.
-
- ---------- Footnotes ----------
-
- (1) This example shows that zeros come in on the left side. For
-'gawk', this is always true, but in some languages, it's possible to
-have the left side fill with ones.
-
-
-File: gawk.info, Node: Type Functions, Next: I18N Functions, Prev: Bitwise Functions, Up: Built-in
-
-9.1.7 Getting Type Information
-------------------------------
-
-'gawk' provides two functions that lets you distinguish the type of a
-variable. This is necessary for writing code that traverses every
-element of an array of arrays (*note Arrays of Arrays::), and in other
-contexts.
-
-'isarray(X)'
- Return a true value if X is an array. Otherwise, return false.
-
-'typeof(X)'
- Return one of the following strings, depending upon the type of X:
-
- '"array"'
- X is an array.
-
- '"number"'
- X is a number.
-
- '"string"'
- X is a string.
-
- '"strnum"'
- X is a string that might be a number, such as a field or the
- result of calling 'split()'. (I.e., X has the STRNUM
- attribute; *note Variable Typing::.)
-
- '"unassigned"'
- X is a scalar variable that has not been assigned a value yet.
- For example:
-
- BEGIN {
- a[1] # creates a[1] but it has no assigned value
- print typeof(a[1]) # scalar_u
- }
-
- '"untyped"'
- X has not yet been used yet at all; it can become a scalar or
- an array. For example:
-
- BEGIN {
- print typeof(x) # x never used --> untyped
- mk_arr(x)
- print typeof(x) # x now an array --> array
- }
-
- function mk_arr(a) { a[1] = 1 }
-
- 'isarray()' is meant for use in two circumstances. The first is when
-traversing a multidimensional array: you can test if an element is
-itself an array or not. The second is inside the body of a user-defined
-function (not discussed yet; *note User-defined::), to test if a
-parameter is an array or not.
-
- NOTE: Using 'isarray()' at the global level to test variables makes
- no sense. Because you are the one writing the program, you are
- supposed to know if your variables are arrays or not. And in fact,
- due to the way 'gawk' works, if you pass the name of a variable
- that has not been previously used to 'isarray()', 'gawk' ends up
- turning it into a scalar.
-
- The 'typeof()' function is general; it allows you to determine if a
-variable or function parameter is a scalar, an array.
-
- 'isarray()' is deprecated; you should use 'typeof()' instead. You
-should replace any existing uses of 'isarray(var)' in your code with
-'typeof(var) == "array"'.
-
-
-File: gawk.info, Node: I18N Functions, Prev: Type Functions, Up: Built-in
-
-9.1.8 String-Translation Functions
-----------------------------------
-
-'gawk' provides facilities for internationalizing 'awk' programs. These
-include the functions described in the following list. The descriptions
-here are purposely brief. *Note Internationalization::, for the full
-story. Optional parameters are enclosed in square brackets ([ ]):
-
-'bindtextdomain(DIRECTORY' [',' DOMAIN]')'
- Set the directory in which 'gawk' will look for message translation
- files, in case they will not or cannot be placed in the "standard"
- locations (e.g., during testing). It returns the directory in
- which DOMAIN is "bound."
-
- The default DOMAIN is the value of 'TEXTDOMAIN'. If DIRECTORY is
- the null string ('""'), then 'bindtextdomain()' returns the current
- binding for the given DOMAIN.
-
-'dcgettext(STRING' [',' DOMAIN [',' CATEGORY] ]')'
- Return the translation of STRING in text domain DOMAIN for locale
- category CATEGORY. The default value for DOMAIN is the current
- value of 'TEXTDOMAIN'. The default value for CATEGORY is
- '"LC_MESSAGES"'.
-
-'dcngettext(STRING1, STRING2, NUMBER' [',' DOMAIN [',' CATEGORY] ]')'
- Return the plural form used for NUMBER of the translation of
- STRING1 and STRING2 in text domain DOMAIN for locale category
- CATEGORY. STRING1 is the English singular variant of a message,
- and STRING2 is the English plural variant of the same message. The
- default value for DOMAIN is the current value of 'TEXTDOMAIN'. The
- default value for CATEGORY is '"LC_MESSAGES"'.
-
-
-File: gawk.info, Node: User-defined, Next: Indirect Calls, Prev: Built-in, Up: Functions
-
-9.2 User-Defined Functions
-==========================
-
-Complicated 'awk' programs can often be simplified by defining your own
-functions. User-defined functions can be called just like built-in ones
-(*note Function Calls::), but it is up to you to define them (i.e., to
-tell 'awk' what they should do).
-
-* Menu:
-
-* Definition Syntax:: How to write definitions and what they mean.
-* Function Example:: An example function definition and what it
- does.
-* Function Caveats:: Things to watch out for.
-* Return Statement:: Specifying the value a function returns.
-* Dynamic Typing:: How variable types can change at runtime.
-
-
-File: gawk.info, Node: Definition Syntax, Next: Function Example, Up: User-defined
-
-9.2.1 Function Definition Syntax
---------------------------------
-
- It's entirely fair to say that the awk syntax for local variable
- definitions is appallingly awful.
- -- _Brian Kernighan_
-
- Definitions of functions can appear anywhere between the rules of an
-'awk' program. Thus, the general form of an 'awk' program is extended
-to include sequences of rules _and_ user-defined function definitions.
-There is no need to put the definition of a function before all uses of
-the function. This is because 'awk' reads the entire program before
-starting to execute any of it.
-
- The definition of a function named NAME looks like this:
-
- 'function' NAME'('[PARAMETER-LIST]')'
- '{'
- BODY-OF-FUNCTION
- '}'
-
-Here, NAME is the name of the function to define. A valid function name
-is like a valid variable name: a sequence of letters, digits, and
-underscores that doesn't start with a digit. Here too, only the 52
-upper- and lowercase English letters may be used in a function name.
-Within a single 'awk' program, any particular name can only be used as a
-variable, array, or function.
-
- PARAMETER-LIST is an optional list of the function's arguments and
-local variable names, separated by commas. When the function is called,
-the argument names are used to hold the argument values given in the
-call.
-
- A function cannot have two parameters with the same name, nor may it
-have a parameter with the same name as the function itself.
-
- CAUTION: According to the POSIX standard, function parameters
- cannot have the same name as one of the special predefined
- variables (*note Built-in Variables::), nor may a function
- parameter have the same name as another function.
-
- Not all versions of 'awk' enforce these restrictions. 'gawk'
- always enforces the first restriction. With '--posix' (*note
- Options::), it also enforces the second restriction.
-
- Local variables act like the empty string if referenced where a
-string value is required, and like zero if referenced where a numeric
-value is required. This is the same as the behavior of regular
-variables that have never been assigned a value. (There is more to
-understand about local variables; *note Dynamic Typing::.)
-
- The BODY-OF-FUNCTION consists of 'awk' statements. It is the most
-important part of the definition, because it says what the function
-should actually _do_. The argument names exist to give the body a way
-to talk about the arguments; local variables exist to give the body
-places to keep temporary values.
-
- Argument names are not distinguished syntactically from local
-variable names. Instead, the number of arguments supplied when the
-function is called determines how many argument variables there are.
-Thus, if three argument values are given, the first three names in
-PARAMETER-LIST are arguments and the rest are local variables.
-
- It follows that if the number of arguments is not the same in all
-calls to the function, some of the names in PARAMETER-LIST may be
-arguments on some occasions and local variables on others. Another way
-to think of this is that omitted arguments default to the null string.
-
- Usually when you write a function, you know how many names you intend
-to use for arguments and how many you intend to use as local variables.
-It is conventional to place some extra space between the arguments and
-the local variables, in order to document how your function is supposed
-to be used.
-
- During execution of the function body, the arguments and local
-variable values hide, or "shadow", any variables of the same names used
-in the rest of the program. The shadowed variables are not accessible
-in the function definition, because there is no way to name them while
-their names have been taken away for the arguments and local variables.
-All other variables used in the 'awk' program can be referenced or set
-normally in the function's body.
-
- The arguments and local variables last only as long as the function
-body is executing. Once the body finishes, you can once again access
-the variables that were shadowed while the function was running.
-
- The function body can contain expressions that call functions. They
-can even call this function, either directly or by way of another
-function. When this happens, we say the function is "recursive". The
-act of a function calling itself is called "recursion".
-
- All the built-in functions return a value to their caller.
-User-defined functions can do so also, using the 'return' statement,
-which is described in detail in *note Return Statement::. Many of the
-subsequent examples in this minor node use the 'return' statement.
-
- In many 'awk' implementations, including 'gawk', the keyword
-'function' may be abbreviated 'func'. (c.e.) However, POSIX only
-specifies the use of the keyword 'function'. This actually has some
-practical implications. If 'gawk' is in POSIX-compatibility mode (*note
-Options::), then the following statement does _not_ define a function:
-
- func foo() { a = sqrt($1) ; print a }
-
-Instead, it defines a rule that, for each record, concatenates the value
-of the variable 'func' with the return value of the function 'foo'. If
-the resulting string is non-null, the action is executed. This is
-probably not what is desired. ('awk' accepts this input as
-syntactically valid, because functions may be used before they are
-defined in 'awk' programs.(1))
-
- To ensure that your 'awk' programs are portable, always use the
-keyword 'function' when defining a function.
-
- ---------- Footnotes ----------
-
- (1) This program won't actually run, because 'foo()' is undefined.
-
-
-File: gawk.info, Node: Function Example, Next: Function Caveats, Prev: Definition Syntax, Up: User-defined
-
-9.2.2 Function Definition Examples
-----------------------------------
-
-Here is an example of a user-defined function, called 'myprint()', that
-takes a number and prints it in a specific format:
-
- function myprint(num)
- {
- printf "%6.3g\n", num
- }
-
-To illustrate, here is an 'awk' rule that uses our 'myprint()' function:
-
- $3 > 0 { myprint($3) }
-
-This program prints, in our special format, all the third fields that
-contain a positive number in our input. Therefore, when given the
-following input:
-
- 1.2 3.4 5.6 7.8
- 9.10 11.12 -13.14 15.16
- 17.18 19.20 21.22 23.24
-
-this program, using our function to format the results, prints:
-
- 5.6
- 21.2
-
- This function deletes all the elements in an array (recall that the
-extra whitespace signifies the start of the local variable list):
-
- function delarray(a, i)
- {
- for (i in a)
- delete a[i]
- }
-
- When working with arrays, it is often necessary to delete all the
-elements in an array and start over with a new list of elements (*note
-Delete::). Instead of having to repeat this loop everywhere that you
-need to clear out an array, your program can just call 'delarray()'.
-(This guarantees portability. The use of 'delete ARRAY' to delete the
-contents of an entire array is a relatively recent(1) addition to the
-POSIX standard.)
-
- The following is an example of a recursive function. It takes a
-string as an input parameter and returns the string in reverse order.
-Recursive functions must always have a test that stops the recursion.
-In this case, the recursion terminates when the input string is already
-empty:
-
- function rev(str)
- {
- if (str == "")
- return ""
-
- return (rev(substr(str, 2)) substr(str, 1, 1))
- }
-
- If this function is in a file named 'rev.awk', it can be tested this
-way:
-
- $ echo "Don't Panic!" |
- > gawk -e '{ print rev($0) }' -f rev.awk
- -| !cinaP t'noD
-
- The C 'ctime()' function takes a timestamp and returns it as a
-string, formatted in a well-known fashion. The following example uses
-the built-in 'strftime()' function (*note Time Functions::) to create an
-'awk' version of 'ctime()':
-
- # ctime.awk
- #
- # awk version of C ctime(3) function
-
- function ctime(ts, format)
- {
- format = "%a %b %e %H:%M:%S %Z %Y"
-
- if (ts == 0)
- ts = systime() # use current time as default
- return strftime(format, ts)
- }
-
- You might think that 'ctime()' could use 'PROCINFO["strftime"]' for
-its format string. That would be a mistake, because 'ctime()' is
-supposed to return the time formatted in a standard fashion, and
-user-level code could have changed 'PROCINFO["strftime"]'.
-
- ---------- Footnotes ----------
-
- (1) Late in 2012.
-
-
-File: gawk.info, Node: Function Caveats, Next: Return Statement, Prev: Function Example, Up: User-defined
-
-9.2.3 Calling User-Defined Functions
-------------------------------------
-
-"Calling a function" means causing the function to run and do its job.
-A function call is an expression and its value is the value returned by
-the function.
-
-* Menu:
-
-* Calling A Function:: Don't use spaces.
-* Variable Scope:: Controlling variable scope.
-* Pass By Value/Reference:: Passing parameters.
-
-
-File: gawk.info, Node: Calling A Function, Next: Variable Scope, Up: Function Caveats
-
-9.2.3.1 Writing a Function Call
-...............................
-
-A function call consists of the function name followed by the arguments
-in parentheses. 'awk' expressions are what you write in the call for
-the arguments. Each time the call is executed, these expressions are
-evaluated, and the values become the actual arguments. For example,
-here is a call to 'foo()' with three arguments (the first being a string
-concatenation):
-
- foo(x y, "lose", 4 * z)
-
- CAUTION: Whitespace characters (spaces and TABs) are not allowed
- between the function name and the opening parenthesis of the
- argument list. If you write whitespace by mistake, 'awk' might
- think that you mean to concatenate a variable with an expression in
- parentheses. However, it notices that you used a function name and
- not a variable name, and reports an error.
-
-
-File: gawk.info, Node: Variable Scope, Next: Pass By Value/Reference, Prev: Calling A Function, Up: Function Caveats
-
-9.2.3.2 Controlling Variable Scope
-..................................
-
-Unlike in many languages, there is no way to make a variable local to a
-'{' ... '}' block in 'awk', but you can make a variable local to a
-function. It is good practice to do so whenever a variable is needed
-only in that function.
-
- To make a variable local to a function, simply declare the variable
-as an argument after the actual function arguments (*note Definition
-Syntax::). Look at the following example, where variable 'i' is a
-global variable used by both functions 'foo()' and 'bar()':
-
- function bar()
- {
- for (i = 0; i < 3; i++)
- print "bar's i=" i
- }
-
- function foo(j)
- {
- i = j + 1
- print "foo's i=" i
- bar()
- print "foo's i=" i
- }
-
- BEGIN {
- i = 10
- print "top's i=" i
- foo(0)
- print "top's i=" i
- }
-
- Running this script produces the following, because the 'i' in
-functions 'foo()' and 'bar()' and at the top level refer to the same
-variable instance:
-
- top's i=10
- foo's i=1
- bar's i=0
- bar's i=1
- bar's i=2
- foo's i=3
- top's i=3
-
- If you want 'i' to be local to both 'foo()' and 'bar()', do as
-follows (the extra space before 'i' is a coding convention to indicate
-that 'i' is a local variable, not an argument):
-
- function bar( i)
- {
- for (i = 0; i < 3; i++)
- print "bar's i=" i
- }
-
- function foo(j, i)
- {
- i = j + 1
- print "foo's i=" i
- bar()
- print "foo's i=" i
- }
-
- BEGIN {
- i = 10
- print "top's i=" i
- foo(0)
- print "top's i=" i
- }
-
- Running the corrected script produces the following:
-
- top's i=10
- foo's i=1
- bar's i=0
- bar's i=1
- bar's i=2
- foo's i=1
- top's i=10
-
- Besides scalar values (strings and numbers), you may also have local
-arrays. By using a parameter name as an array, 'awk' treats it as an
-array, and it is local to the function. In addition, recursive calls
-create new arrays. Consider this example:
-
- function some_func(p1, a)
- {
- if (p1++ > 3)
- return
-
- a[p1] = p1
-
- some_func(p1)
-
- printf("At level %d, index %d %s found in a\n",
- p1, (p1 - 1), (p1 - 1) in a ? "is" : "is not")
- printf("At level %d, index %d %s found in a\n",
- p1, p1, p1 in a ? "is" : "is not")
- print ""
- }
-
- BEGIN {
- some_func(1)
- }
-
- When run, this program produces the following output:
-
- At level 4, index 3 is not found in a
- At level 4, index 4 is found in a
-
- At level 3, index 2 is not found in a
- At level 3, index 3 is found in a
-
- At level 2, index 1 is not found in a
- At level 2, index 2 is found in a
-
-
-File: gawk.info, Node: Pass By Value/Reference, Prev: Variable Scope, Up: Function Caveats
-
-9.2.3.3 Passing Function Arguments by Value Or by Reference
-...........................................................
-
-In 'awk', when you declare a function, there is no way to declare
-explicitly whether the arguments are passed "by value" or "by
-reference".
-
- Instead, the passing convention is determined at runtime when the
-function is called, according to the following rule: if the argument is
-an array variable, then it is passed by reference. Otherwise, the
-argument is passed by value.
-
- Passing an argument by value means that when a function is called, it
-is given a _copy_ of the value of this argument. The caller may use a
-variable as the expression for the argument, but the called function
-does not know this--it only knows what value the argument had. For
-example, if you write the following code:
-
- foo = "bar"
- z = myfunc(foo)
-
-then you should not think of the argument to 'myfunc()' as being "the
-variable 'foo'." Instead, think of the argument as the string value
-'"bar"'. If the function 'myfunc()' alters the values of its local
-variables, this has no effect on any other variables. Thus, if
-'myfunc()' does this:
-
- function myfunc(str)
- {
- print str
- str = "zzz"
- print str
- }
-
-to change its first argument variable 'str', it does _not_ change the
-value of 'foo' in the caller. The role of 'foo' in calling 'myfunc()'
-ended when its value ('"bar"') was computed. If 'str' also exists
-outside of 'myfunc()', the function body cannot alter this outer value,
-because it is shadowed during the execution of 'myfunc()' and cannot be
-seen or changed from there.
-
- However, when arrays are the parameters to functions, they are _not_
-copied. Instead, the array itself is made available for direct
-manipulation by the function. This is usually termed "call by
-reference". Changes made to an array parameter inside the body of a
-function _are_ visible outside that function.
-
- NOTE: Changing an array parameter inside a function can be very
- dangerous if you do not watch what you are doing. For example:
-
- function changeit(array, ind, nvalue)
- {
- array[ind] = nvalue
- }
-
- BEGIN {
- a[1] = 1; a[2] = 2; a[3] = 3
- changeit(a, 2, "two")
- printf "a[1] = %s, a[2] = %s, a[3] = %s\n",
- a[1], a[2], a[3]
- }
-
- prints 'a[1] = 1, a[2] = two, a[3] = 3', because 'changeit()'
- stores '"two"' in the second element of 'a'.
-
- Some 'awk' implementations allow you to call a function that has not
-been defined. They only report a problem at runtime, when the program
-actually tries to call the function. For example:
-
- BEGIN {
- if (0)
- foo()
- else
- bar()
- }
- function bar() { ... }
- # note that `foo' is not defined
-
-Because the 'if' statement will never be true, it is not really a
-problem that 'foo()' has not been defined. Usually, though, it is a
-problem if a program calls an undefined function.
-
- If '--lint' is specified (*note Options::), 'gawk' reports calls to
-undefined functions.
-
- Some 'awk' implementations generate a runtime error if you use either
-the 'next' statement or the 'nextfile' statement (*note Next
-Statement::, and *note Nextfile Statement::) inside a user-defined
-function. 'gawk' does not have this limitation.
-
-
-File: gawk.info, Node: Return Statement, Next: Dynamic Typing, Prev: Function Caveats, Up: User-defined
-
-9.2.4 The 'return' Statement
-----------------------------
-
-As seen in several earlier examples, the body of a user-defined function
-can contain a 'return' statement. This statement returns control to the
-calling part of the 'awk' program. It can also be used to return a
-value for use in the rest of the 'awk' program. It looks like this:
-
- 'return' [EXPRESSION]
-
- The EXPRESSION part is optional. Due most likely to an oversight,
-POSIX does not define what the return value is if you omit the
-EXPRESSION. Technically speaking, this makes the returned value
-undefined, and therefore, unpredictable. In practice, though, all
-versions of 'awk' simply return the null string, which acts like zero if
-used in a numeric context.
-
- A 'return' statement without an EXPRESSION is assumed at the end of
-every function definition. So, if control reaches the end of the
-function body, then technically the function returns an unpredictable
-value. In practice, it returns the empty string. 'awk' does _not_ warn
-you if you use the return value of such a function.
-
- Sometimes, you want to write a function for what it does, not for
-what it returns. Such a function corresponds to a 'void' function in C,
-C++, or Java, or to a 'procedure' in Ada. Thus, it may be appropriate
-to not return any value; simply bear in mind that you should not be
-using the return value of such a function.
-
- The following is an example of a user-defined function that returns a
-value for the largest number among the elements of an array:
-
- function maxelt(vec, i, ret)
- {
- for (i in vec) {
- if (ret == "" || vec[i] > ret)
- ret = vec[i]
- }
- return ret
- }
-
-You call 'maxelt()' with one argument, which is an array name. The
-local variables 'i' and 'ret' are not intended to be arguments; there is
-nothing to stop you from passing more than one argument to 'maxelt()'
-but the results would be strange. The extra space before 'i' in the
-function parameter list indicates that 'i' and 'ret' are local
-variables. You should follow this convention when defining functions.
-
- The following program uses the 'maxelt()' function. It loads an
-array, calls 'maxelt()', and then reports the maximum number in that
-array:
-
- function maxelt(vec, i, ret)
- {
- for (i in vec) {
- if (ret == "" || vec[i] > ret)
- ret = vec[i]
- }
- return ret
- }
-
- # Load all fields of each record into nums.
- {
- for(i = 1; i <= NF; i++)
- nums[NR, i] = $i
- }
-
- END {
- print maxelt(nums)
- }
-
- Given the following input:
-
- 1 5 23 8 16
- 44 3 5 2 8 26
- 256 291 1396 2962 100
- -6 467 998 1101
- 99385 11 0 225
-
-the program reports (predictably) that 99,385 is the largest value in
-the array.
-
-
-File: gawk.info, Node: Dynamic Typing, Prev: Return Statement, Up: User-defined
-
-9.2.5 Functions and Their Effects on Variable Typing
-----------------------------------------------------
-
-'awk' is a very fluid language. It is possible that 'awk' can't tell if
-an identifier represents a scalar variable or an array until runtime.
-Here is an annotated sample program:
-
- function foo(a)
- {
- a[1] = 1 # parameter is an array
- }
-
- BEGIN {
- b = 1
- foo(b) # invalid: fatal type mismatch
-
- foo(x) # x uninitialized, becomes an array dynamically
- x = 1 # now not allowed, runtime error
- }
-
- In this example, the first call to 'foo()' generates a fatal error,
-so 'awk' will not report the second error. If you comment out that
-call, though, then 'awk' does report the second error.
-
- Usually, such things aren't a big issue, but it's worth being aware
-of them.
-
-
-File: gawk.info, Node: Indirect Calls, Next: Functions Summary, Prev: User-defined, Up: Functions
-
-9.3 Indirect Function Calls
-===========================
-
-This section describes an advanced, 'gawk'-specific extension.
-
- Often, you may wish to defer the choice of function to call until
-runtime. For example, you may have different kinds of records, each of
-which should be processed differently.
-
- Normally, you would have to use a series of 'if'-'else' statements to
-decide which function to call. By using "indirect" function calls, you
-can specify the name of the function to call as a string variable, and
-then call the function. Let's look at an example.
-
- Suppose you have a file with your test scores for the classes you are
-taking, and you wish to get the sum and the average of your test scores.
-The first field is the class name. The following fields are the
-functions to call to process the data, up to a "marker" field 'data:'.
-Following the marker, to the end of the record, are the various numeric
-test scores.
-
- Here is the initial file:
-
- Biology_101 sum average data: 87.0 92.4 78.5 94.9
- Chemistry_305 sum average data: 75.2 98.3 94.7 88.2
- English_401 sum average data: 100.0 95.6 87.1 93.4
-
- To process the data, you might write initially:
-
- {
- class = $1
- for (i = 2; $i != "data:"; i++) {
- if ($i == "sum")
- sum() # processes the whole record
- else if ($i == "average")
- average()
- ... # and so on
- }
- }
-
-This style of programming works, but can be awkward. With "indirect"
-function calls, you tell 'gawk' to use the _value_ of a variable as the
-_name_ of the function to call.
-
- The syntax is similar to that of a regular function call: an
-identifier immediately followed by an opening parenthesis, any
-arguments, and then a closing parenthesis, with the addition of a
-leading '@' character:
-
- the_func = "sum"
- result = @the_func() # calls the sum() function
-
- Here is a full program that processes the previously shown data,
-using indirect function calls:
-
- # indirectcall.awk --- Demonstrate indirect function calls
-
- # average --- return the average of the values in fields $first - $last
-
- function average(first, last, sum, i)
- {
- sum = 0;
- for (i = first; i <= last; i++)
- sum += $i
-
- return sum / (last - first + 1)
- }
-
- # sum --- return the sum of the values in fields $first - $last
-
- function sum(first, last, ret, i)
- {
- ret = 0;
- for (i = first; i <= last; i++)
- ret += $i
-
- return ret
- }
-
- These two functions expect to work on fields; thus, the parameters
-'first' and 'last' indicate where in the fields to start and end.
-Otherwise, they perform the expected computations and are not unusual:
-
- # For each record, print the class name and the requested statistics
- {
- class_name = $1
- gsub(/_/, " ", class_name) # Replace _ with spaces
-
- # find start
- for (i = 1; i <= NF; i++) {
- if ($i == "data:") {
- start = i + 1
- break
- }
- }
-
- printf("%s:\n", class_name)
- for (i = 2; $i != "data:"; i++) {
- the_function = $i
- printf("\t%s: <%s>\n", $i, @the_function(start, NF) "")
- }
- print ""
- }
-
- This is the main processing for each record. It prints the class
-name (with underscores replaced with spaces). It then finds the start
-of the actual data, saving it in 'start'. The last part of the code
-loops through each function name (from '$2' up to the marker, 'data:'),
-calling the function named by the field. The indirect function call
-itself occurs as a parameter in the call to 'printf'. (The 'printf'
-format string uses '%s' as the format specifier so that we can use
-functions that return strings, as well as numbers. Note that the result
-from the indirect call is concatenated with the empty string, in order
-to force it to be a string value.)
-
- Here is the result of running the program:
-
- $ gawk -f indirectcall.awk class_data1
- -| Biology 101:
- -| sum: <352.8>
- -| average: <88.2>
- -|
- -| Chemistry 305:
- -| sum: <356.4>
- -| average: <89.1>
- -|
- -| English 401:
- -| sum: <376.1>
- -| average: <94.025>
-
- The ability to use indirect function calls is more powerful than you
-may think at first. The C and C++ languages provide "function
-pointers," which are a mechanism for calling a function chosen at
-runtime. One of the most well-known uses of this ability is the C
-'qsort()' function, which sorts an array using the famous "quicksort"
-algorithm (see the Wikipedia article
-(http://en.wikipedia.org/wiki/Quicksort) for more information). To use
-this function, you supply a pointer to a comparison function. This
-mechanism allows you to sort arbitrary data in an arbitrary fashion.
-
- We can do something similar using 'gawk', like this:
-
- # quicksort.awk --- Quicksort algorithm, with user-supplied
- # comparison function
-
- # quicksort --- C.A.R. Hoare's quicksort algorithm. See Wikipedia
- # or almost any algorithms or computer science text.
-
- function quicksort(data, left, right, less_than, i, last)
- {
- if (left >= right) # do nothing if array contains fewer
- return # than two elements
-
- quicksort_swap(data, left, int((left + right) / 2))
- last = left
- for (i = left + 1; i <= right; i++)
- if (@less_than(data[i], data[left]))
- quicksort_swap(data, ++last, i)
- quicksort_swap(data, left, last)
- quicksort(data, left, last - 1, less_than)
- quicksort(data, last + 1, right, less_than)
- }
-
- # quicksort_swap --- helper function for quicksort, should really be inline
-
- function quicksort_swap(data, i, j, temp)
- {
- temp = data[i]
- data[i] = data[j]
- data[j] = temp
- }
-
- The 'quicksort()' function receives the 'data' array, the starting
-and ending indices to sort ('left' and 'right'), and the name of a
-function that performs a "less than" comparison. It then implements the
-quicksort algorithm.
-
- To make use of the sorting function, we return to our previous
-example. The first thing to do is write some comparison functions:
-
- # num_lt --- do a numeric less than comparison
-
- function num_lt(left, right)
- {
- return ((left + 0) < (right + 0))
- }
-
- # num_ge --- do a numeric greater than or equal to comparison
-
- function num_ge(left, right)
- {
- return ((left + 0) >= (right + 0))
- }
-
- The 'num_ge()' function is needed to perform a descending sort; when
-used to perform a "less than" test, it actually does the opposite
-(greater than or equal to), which yields data sorted in descending
-order.
-
- Next comes a sorting function. It is parameterized with the starting
-and ending field numbers and the comparison function. It builds an
-array with the data and calls 'quicksort()' appropriately, and then
-formats the results as a single string:
-
- # do_sort --- sort the data according to `compare'
- # and return it as a string
-
- function do_sort(first, last, compare, data, i, retval)
- {
- delete data
- for (i = 1; first <= last; first++) {
- data[i] = $first
- i++
- }
-
- quicksort(data, 1, i-1, compare)
-
- retval = data[1]
- for (i = 2; i in data; i++)
- retval = retval " " data[i]
-
- return retval
- }
-
- Finally, the two sorting functions call 'do_sort()', passing in the
-names of the two comparison functions:
-
- # sort --- sort the data in ascending order and return it as a string
-
- function sort(first, last)
- {
- return do_sort(first, last, "num_lt")
- }
-
- # rsort --- sort the data in descending order and return it as a string
-
- function rsort(first, last)
- {
- return do_sort(first, last, "num_ge")
- }
-
- Here is an extended version of the data file:
-
- Biology_101 sum average sort rsort data: 87.0 92.4 78.5 94.9
- Chemistry_305 sum average sort rsort data: 75.2 98.3 94.7 88.2
- English_401 sum average sort rsort data: 100.0 95.6 87.1 93.4
-
- Finally, here are the results when the enhanced program is run:
-
- $ gawk -f quicksort.awk -f indirectcall.awk class_data2
- -| Biology 101:
- -| sum: <352.8>
- -| average: <88.2>
- -| sort: <78.5 87.0 92.4 94.9>
- -| rsort: <94.9 92.4 87.0 78.5>
- -|
- -| Chemistry 305:
- -| sum: <356.4>
- -| average: <89.1>
- -| sort: <75.2 88.2 94.7 98.3>
- -| rsort: <98.3 94.7 88.2 75.2>
- -|
- -| English 401:
- -| sum: <376.1>
- -| average: <94.025>
- -| sort: <87.1 93.4 95.6 100.0>
- -| rsort: <100.0 95.6 93.4 87.1>
-
- Another example where indirect functions calls are useful can be
-found in processing arrays. This is described in *note Walking
-Arrays::.
-
- Remember that you must supply a leading '@' in front of an indirect
-function call.
-
- Starting with version 4.1.2 of 'gawk', indirect function calls may
-also be used with built-in functions and with extension functions (*note
-Dynamic Extensions::). There are some limitations when calling built-in
-functions indirectly, as follows.
-
- * You cannot pass a regular expression constant to a built-in
- function through an indirect function call.(1) This applies to the
- 'sub()', 'gsub()', 'gensub()', 'match()', 'split()' and
- 'patsplit()' functions.
-
- * If calling 'sub()' or 'gsub()', you may only pass two arguments,
- since those functions are unusual in that they update their third
- argument. This means that '$0' will be updated.
-
- 'gawk' does its best to make indirect function calls efficient. For
-example, in the following case:
-
- for (i = 1; i <= n; i++)
- @the_func()
-
-'gawk' looks up the actual function to call only once.
-
- ---------- Footnotes ----------
-
- (1) This may change in a future version; recheck the documentation
-that comes with your version of 'gawk' to see if it has.
-
-
-File: gawk.info, Node: Functions Summary, Prev: Indirect Calls, Up: Functions
-
-9.4 Summary
-===========
-
- * 'awk' provides built-in functions and lets you define your own
- functions.
-
- * POSIX 'awk' provides three kinds of built-in functions: numeric,
- string, and I/O. 'gawk' provides functions that sort arrays, work
- with values representing time, do bit manipulation, determine
- variable type (array versus scalar), and internationalize and
- localize programs. 'gawk' also provides several extensions to some
- of standard functions, typically in the form of additional
- arguments.
-
- * Functions accept zero or more arguments and return a value. The
- expressions that provide the argument values are completely
- evaluated before the function is called. Order of evaluation is
- not defined. The return value can be ignored.
-
- * The handling of backslash in 'sub()' and 'gsub()' is not simple.
- It is more straightforward in 'gawk''s 'gensub()' function, but
- that function still requires care in its use.
-
- * User-defined functions provide important capabilities but come with
- some syntactic inelegancies. In a function call, there cannot be
- any space between the function name and the opening left
- parenthesis of the argument list. Also, there is no provision for
- local variables, so the convention is to add extra parameters, and
- to separate them visually from the real parameters by extra
- whitespace.
-
- * User-defined functions may call other user-defined (and built-in)
- functions and may call themselves recursively. Function parameters
- "hide" any global variables of the same names. You cannot use the
- name of a reserved variable (such as 'ARGC') as the name of a
- parameter in user-defined functions.
-
- * Scalar values are passed to user-defined functions by value. Array
- parameters are passed by reference; any changes made by the
- function to array parameters are thus visible after the function
- has returned.
-
- * Use the 'return' statement to return from a user-defined function.
- An optional expression becomes the function's return value. Only
- scalar values may be returned by a function.
-
- * If a variable that has never been used is passed to a user-defined
- function, how that function treats the variable can set its nature:
- either scalar or array.
-
- * 'gawk' provides indirect function calls using a special syntax. By
- setting a variable to the name of a function, you can determine at
- runtime what function will be called at that point in the program.
- This is equivalent to function pointers in C and C++.
-
-
-File: gawk.info, Node: Library Functions, Next: Sample Programs, Prev: Functions, Up: Top
-
-10 A Library of 'awk' Functions
-*******************************
-
-*note User-defined:: describes how to write your own 'awk' functions.
-Writing functions is important, because it allows you to encapsulate
-algorithms and program tasks in a single place. It simplifies
-programming, making program development more manageable and making
-programs more readable.
-
- In their seminal 1976 book, 'Software Tools',(1) Brian Kernighan and
-P.J. Plauger wrote:
-
- Good Programming is not learned from generalities, but by seeing
- how significant programs can be made clean, easy to read, easy to
- maintain and modify, human-engineered, efficient and reliable, by
- the application of common sense and good programming practices.
- Careful study and imitation of good programs leads to better
- writing.
-
- In fact, they felt this idea was so important that they placed this
-statement on the cover of their book. Because we believe strongly that
-their statement is correct, this major node and *note Sample Programs::,
-provide a good-sized body of code for you to read and, we hope, to learn
-from.
-
- This major node presents a library of useful 'awk' functions. Many
-of the sample programs presented later in this Info file use these
-functions. The functions are presented here in a progression from
-simple to complex.
-
- *note Extract Program:: presents a program that you can use to
-extract the source code for these example library functions and programs
-from the Texinfo source for this Info file. (This has already been done
-as part of the 'gawk' distribution.)
-
- If you have written one or more useful, general-purpose 'awk'
-functions and would like to contribute them to the 'awk' user community,
-see *note How To Contribute::, for more information.
-
- The programs in this major node and in *note Sample Programs::,
-freely use 'gawk'-specific features. Rewriting these programs for
-different implementations of 'awk' is pretty straightforward:
-
- * Diagnostic error messages are sent to '/dev/stderr'. Use '| "cat
- 1>&2"' instead of '> "/dev/stderr"' if your system does not have a
- '/dev/stderr', or if you cannot use 'gawk'.
-
- * A number of programs use 'nextfile' (*note Nextfile Statement::) to
- skip any remaining input in the input file.
-
- * Finally, some of the programs choose to ignore upper- and lowercase
- distinctions in their input. They do so by assigning one to
- 'IGNORECASE'. You can achieve almost the same effect(2) by adding
- the following rule to the beginning of the program:
-
- # ignore case
- { $0 = tolower($0) }
-
- Also, verify that all regexp and string constants used in
- comparisons use only lowercase letters.
-
-* Menu:
-
-* Library Names:: How to best name private global variables in
- library functions.
-* General Functions:: Functions that are of general use.
-* Data File Management:: Functions for managing command-line data
- files.
-* Getopt Function:: A function for processing command-line
- arguments.
-* Passwd Functions:: Functions for getting user information.
-* Group Functions:: Functions for getting group information.
-* Walking Arrays:: A function to walk arrays of arrays.
-* Library Functions Summary:: Summary of library functions.
-* Library Exercises:: Exercises.
-
- ---------- Footnotes ----------
-
- (1) Sadly, over 35 years later, many of the lessons taught by this
-book have yet to be learned by a vast number of practicing programmers.
-
- (2) The effects are not identical. Output of the transformed record
-will be in all lowercase, while 'IGNORECASE' preserves the original
-contents of the input record.
-
-
-File: gawk.info, Node: Library Names, Next: General Functions, Up: Library Functions
-
-10.1 Naming Library Function Global Variables
-=============================================
-
-Due to the way the 'awk' language evolved, variables are either "global"
-(usable by the entire program) or "local" (usable just by a specific
-function). There is no intermediate state analogous to 'static'
-variables in C.
-
- Library functions often need to have global variables that they can
-use to preserve state information between calls to the function--for
-example, 'getopt()''s variable '_opti' (*note Getopt Function::). Such
-variables are called "private", as the only functions that need to use
-them are the ones in the library.
-
- When writing a library function, you should try to choose names for
-your private variables that will not conflict with any variables used by
-either another library function or a user's main program. For example,
-a name like 'i' or 'j' is not a good choice, because user programs often
-use variable names like these for their own purposes.
-
- The example programs shown in this major node all start the names of
-their private variables with an underscore ('_'). Users generally don't
-use leading underscores in their variable names, so this convention
-immediately decreases the chances that the variable names will be
-accidentally shared with the user's program.
-
- In addition, several of the library functions use a prefix that helps
-indicate what function or set of functions use the variables--for
-example, '_pw_byname()' in the user database routines (*note Passwd
-Functions::). This convention is recommended, as it even further
-decreases the chance of inadvertent conflict among variable names. Note
-that this convention is used equally well for variable names and for
-private function names.(1)
-
- As a final note on variable naming, if a function makes global
-variables available for use by a main program, it is a good convention
-to start those variables' names with a capital letter--for example,
-'getopt()''s 'Opterr' and 'Optind' variables (*note Getopt Function::).
-The leading capital letter indicates that it is global, while the fact
-that the variable name is not all capital letters indicates that the
-variable is not one of 'awk''s predefined variables, such as 'FS'.
-
- It is also important that _all_ variables in library functions that
-do not need to save state are, in fact, declared local.(2) If this is
-not done, the variables could accidentally be used in the user's
-program, leading to bugs that are very difficult to track down:
-
- function lib_func(x, y, l1, l2)
- {
- ...
- # some_var should be local but by oversight is not
- USE VARIABLE some_var
- ...
- }
-
- A different convention, common in the Tcl community, is to use a
-single associative array to hold the values needed by the library
-function(s), or "package." This significantly decreases the number of
-actual global names in use. For example, the functions described in
-*note Passwd Functions:: might have used array elements
-'PW_data["inited"]', 'PW_data["total"]', 'PW_data["count"]', and
-'PW_data["awklib"]', instead of '_pw_inited', '_pw_awklib', '_pw_total',
-and '_pw_count'.
-
- The conventions presented in this minor node are exactly that:
-conventions. You are not required to write your programs this way--we
-merely recommend that you do so.
-
- ---------- Footnotes ----------
-
- (1) Although all the library routines could have been rewritten to
-use this convention, this was not done, in order to show how our own
-'awk' programming style has evolved and to provide some basis for this
-discussion.
-
- (2) 'gawk''s '--dump-variables' command-line option is useful for
-verifying this.
-
-
-File: gawk.info, Node: General Functions, Next: Data File Management, Prev: Library Names, Up: Library Functions
-
-10.2 General Programming
-========================
-
-This minor node presents a number of functions that are of general
-programming use.
-
-* Menu:
-
-* Strtonum Function:: A replacement for the built-in
- 'strtonum()' function.
-* Assert Function:: A function for assertions in 'awk'
- programs.
-* Round Function:: A function for rounding if 'sprintf()'
- does not do it correctly.
-* Cliff Random Function:: The Cliff Random Number Generator.
-* Ordinal Functions:: Functions for using characters as numbers and
- vice versa.
-* Join Function:: A function to join an array into a string.
-* Getlocaltime Function:: A function to get formatted times.
-* Readfile Function:: A function to read an entire file at once.
-* Shell Quoting:: A function to quote strings for the shell.
-
-
-File: gawk.info, Node: Strtonum Function, Next: Assert Function, Up: General Functions
-
-10.2.1 Converting Strings to Numbers
-------------------------------------
-
-The 'strtonum()' function (*note String Functions::) is a 'gawk'
-extension. The following function provides an implementation for other
-versions of 'awk':
-
- # mystrtonum --- convert string to number
-
- function mystrtonum(str, ret, n, i, k, c)
- {
- if (str ~ /^0[0-7]*$/) {
- # octal
- n = length(str)
- ret = 0
- for (i = 1; i <= n; i++) {
- c = substr(str, i, 1)
- # index() returns 0 if c not in string,
- # includes c == "0"
- k = index("1234567", c)
-
- ret = ret * 8 + k
- }
- } else if (str ~ /^0[xX][[:xdigit:]]+$/) {
- # hexadecimal
- str = substr(str, 3) # lop off leading 0x
- n = length(str)
- ret = 0
- for (i = 1; i <= n; i++) {
- c = substr(str, i, 1)
- c = tolower(c)
- # index() returns 0 if c not in string,
- # includes c == "0"
- k = index("123456789abcdef", c)
-
- ret = ret * 16 + k
- }
- } else if (str ~ \
- /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) {
- # decimal number, possibly floating point
- ret = str + 0
- } else
- ret = "NOT-A-NUMBER"
-
- return ret
- }
-
- # BEGIN { # gawk test harness
- # a[1] = "25"
- # a[2] = ".31"
- # a[3] = "0123"
- # a[4] = "0xdeadBEEF"
- # a[5] = "123.45"
- # a[6] = "1.e3"
- # a[7] = "1.32"
- # a[8] = "1.32E2"
- #
- # for (i = 1; i in a; i++)
- # print a[i], strtonum(a[i]), mystrtonum(a[i])
- # }
-
- The function first looks for C-style octal numbers (base 8). If the
-input string matches a regular expression describing octal numbers, then
-'mystrtonum()' loops through each character in the string. It sets 'k'
-to the index in '"1234567"' of the current octal digit. The return
-value will either be the same number as the digit, or zero if the
-character is not there, which will be true for a '0'. This is safe,
-because the regexp test in the 'if' ensures that only octal values are
-converted.
-
- Similar logic applies to the code that checks for and converts a
-hexadecimal value, which starts with '0x' or '0X'. The use of
-'tolower()' simplifies the computation for finding the correct numeric
-value for each hexadecimal digit.
-
- Finally, if the string matches the (rather complicated) regexp for a
-regular decimal integer or floating-point number, the computation 'ret =
-str + 0' lets 'awk' convert the value to a number.
-
- A commented-out test program is included, so that the function can be
-tested with 'gawk' and the results compared to the built-in 'strtonum()'
-function.
-
-
-File: gawk.info, Node: Assert Function, Next: Round Function, Prev: Strtonum Function, Up: General Functions
-
-10.2.2 Assertions
------------------
-
-When writing large programs, it is often useful to know that a condition
-or set of conditions is true. Before proceeding with a particular
-computation, you make a statement about what you believe to be the case.
-Such a statement is known as an "assertion". The C language provides an
-'<assert.h>' header file and corresponding 'assert()' macro that a
-programmer can use to make assertions. If an assertion fails, the
-'assert()' macro arranges to print a diagnostic message describing the
-condition that should have been true but was not, and then it kills the
-program. In C, using 'assert()' looks this:
-
- #include <assert.h>
-
- int myfunc(int a, double b)
- {
- assert(a <= 5 && b >= 17.1);
- ...
- }
-
- If the assertion fails, the program prints a message similar to this:
-
- prog.c:5: assertion failed: a <= 5 && b >= 17.1
-
- The C language makes it possible to turn the condition into a string
-for use in printing the diagnostic message. This is not possible in
-'awk', so this 'assert()' function also requires a string version of the
-condition that is being tested. Following is the function:
-
- # assert --- assert that a condition is true. Otherwise, exit.
-
- function assert(condition, string)
- {
- if (! condition) {
- printf("%s:%d: assertion failed: %s\n",
- FILENAME, FNR, string) > "/dev/stderr"
- _assert_exit = 1
- exit 1
- }
- }
-
- END {
- if (_assert_exit)
- exit 1
- }
-
- The 'assert()' function tests the 'condition' parameter. If it is
-false, it prints a message to standard error, using the 'string'
-parameter to describe the failed condition. It then sets the variable
-'_assert_exit' to one and executes the 'exit' statement. The 'exit'
-statement jumps to the 'END' rule. If the 'END' rule finds
-'_assert_exit' to be true, it exits immediately.
-
- The purpose of the test in the 'END' rule is to keep any other 'END'
-rules from running. When an assertion fails, the program should exit
-immediately. If no assertions fail, then '_assert_exit' is still false
-when the 'END' rule is run normally, and the rest of the program's 'END'
-rules execute. For all of this to work correctly, 'assert.awk' must be
-the first source file read by 'awk'. The function can be used in a
-program in the following way:
-
- function myfunc(a, b)
- {
- assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1")
- ...
- }
-
-If the assertion fails, you see a message similar to the following:
-
- mydata:1357: assertion failed: a <= 5 && b >= 17.1
-
- There is a small problem with this version of 'assert()'. An 'END'
-rule is automatically added to the program calling 'assert()'.
-Normally, if a program consists of just a 'BEGIN' rule, the input files
-and/or standard input are not read. However, now that the program has
-an 'END' rule, 'awk' attempts to read the input data files or standard
-input (*note Using BEGIN/END::), most likely causing the program to hang
-as it waits for input.
-
- There is a simple workaround to this: make sure that such a 'BEGIN'
-rule always ends with an 'exit' statement.
-
-
-File: gawk.info, Node: Round Function, Next: Cliff Random Function, Prev: Assert Function, Up: General Functions
-
-10.2.3 Rounding Numbers
------------------------
-
-The way 'printf' and 'sprintf()' (*note Printf::) perform rounding often
-depends upon the system's C 'sprintf()' subroutine. On many machines,
-'sprintf()' rounding is "unbiased", which means it doesn't always round
-a trailing .5 up, contrary to naive expectations. In unbiased rounding,
-.5 rounds to even, rather than always up, so 1.5 rounds to 2 but 4.5
-rounds to 4. This means that if you are using a format that does
-rounding (e.g., '"%.0f"'), you should check what your system does. The
-following function does traditional rounding; it might be useful if your
-'awk''s 'printf' does unbiased rounding:
-
- # round.awk --- do normal rounding
-
- function round(x, ival, aval, fraction)
- {
- ival = int(x) # integer part, int() truncates
-
- # see if fractional part
- if (ival == x) # no fraction
- return ival # ensure no decimals
-
- if (x < 0) {
- aval = -x # absolute value
- ival = int(aval)
- fraction = aval - ival
- if (fraction >= .5)
- return int(x) - 1 # -2.5 --> -3
- else
- return int(x) # -2.3 --> -2
- } else {
- fraction = x - ival
- if (fraction >= .5)
- return ival + 1
- else
- return ival
- }
- }
-
- # test harness
- # { print $0, round($0) }
-
-
-File: gawk.info, Node: Cliff Random Function, Next: Ordinal Functions, Prev: Round Function, Up: General Functions
-
-10.2.4 The Cliff Random Number Generator
-----------------------------------------
-
-The Cliff random number generator
-(http://mathworld.wolfram.com/CliffRandomNumberGenerator.html) is a very
-simple random number generator that "passes the noise sphere test for
-randomness by showing no structure." It is easily programmed, in less
-than 10 lines of 'awk' code:
-
- # cliff_rand.awk --- generate Cliff random numbers
-
- BEGIN { _cliff_seed = 0.1 }
-
- function cliff_rand()
- {
- _cliff_seed = (100 * log(_cliff_seed)) % 1
- if (_cliff_seed < 0)
- _cliff_seed = - _cliff_seed
- return _cliff_seed
- }
-
- This algorithm requires an initial "seed" of 0.1. Each new value
-uses the current seed as input for the calculation. If the built-in
-'rand()' function (*note Numeric Functions::) isn't random enough, you
-might try using this function instead.
-
-
-File: gawk.info, Node: Ordinal Functions, Next: Join Function, Prev: Cliff Random Function, Up: General Functions
-
-10.2.5 Translating Between Characters and Numbers
--------------------------------------------------
-
-One commercial implementation of 'awk' supplies a built-in function,
-'ord()', which takes a character and returns the numeric value for that
-character in the machine's character set. If the string passed to
-'ord()' has more than one character, only the first one is used.
-
- The inverse of this function is 'chr()' (from the function of the
-same name in Pascal), which takes a number and returns the corresponding
-character. Both functions are written very nicely in 'awk'; there is no
-real reason to build them into the 'awk' interpreter:
-
- # ord.awk --- do ord and chr
-
- # Global identifiers:
- # _ord_: numerical values indexed by characters
- # _ord_init: function to initialize _ord_
-
- BEGIN { _ord_init() }
-
- function _ord_init( low, high, i, t)
- {
- low = sprintf("%c", 7) # BEL is ascii 7
- if (low == "\a") { # regular ascii
- low = 0
- high = 127
- } else if (sprintf("%c", 128 + 7) == "\a") {
- # ascii, mark parity
- low = 128
- high = 255
- } else { # ebcdic(!)
- low = 0
- high = 255
- }
-
- for (i = low; i <= high; i++) {
- t = sprintf("%c", i)
- _ord_[t] = i
- }
- }
-
- Some explanation of the numbers used by '_ord_init()' is worthwhile.
-The most prominent character set in use today is ASCII.(1) Although an
-8-bit byte can hold 256 distinct values (from 0 to 255), ASCII only
-defines characters that use the values from 0 to 127.(2) In the now
-distant past, at least one minicomputer manufacturer used ASCII, but
-with mark parity, meaning that the leftmost bit in the byte is always 1.
-This means that on those systems, characters have numeric values from
-128 to 255. Finally, large mainframe systems use the EBCDIC character
-set, which uses all 256 values. There are other character sets in use
-on some older systems, but they are not really worth worrying about:
-
- function ord(str, c)
- {
- # only first character is of interest
- c = substr(str, 1, 1)
- return _ord_[c]
- }
-
- function chr(c)
- {
- # force c to be numeric by adding 0
- return sprintf("%c", c + 0)
- }
-
- #### test code ####
- # BEGIN {
- # for (;;) {
- # printf("enter a character: ")
- # if (getline var <= 0)
- # break
- # printf("ord(%s) = %d\n", var, ord(var))
- # }
- # }
-
- An obvious improvement to these functions is to move the code for the
-'_ord_init' function into the body of the 'BEGIN' rule. It was written
-this way initially for ease of development. There is a "test program"
-in a 'BEGIN' rule, to test the function. It is commented out for
-production use.
-
- ---------- Footnotes ----------
-
- (1) This is changing; many systems use Unicode, a very large
-character set that includes ASCII as a subset. On systems with full
-Unicode support, a character can occupy up to 32 bits, making simple
-tests such as used here prohibitively expensive.
-
- (2) ASCII has been extended in many countries to use the values from
-128 to 255 for country-specific characters. If your system uses these
-extensions, you can simplify '_ord_init()' to loop from 0 to 255.
-
-
-File: gawk.info, Node: Join Function, Next: Getlocaltime Function, Prev: Ordinal Functions, Up: General Functions
-
-10.2.6 Merging an Array into a String
--------------------------------------
-
-When doing string processing, it is often useful to be able to join all
-the strings in an array into one long string. The following function,
-'join()', accomplishes this task. It is used later in several of the
-application programs (*note Sample Programs::).
-
- Good function design is important; this function needs to be general,
-but it should also have a reasonable default behavior. It is called
-with an array as well as the beginning and ending indices of the
-elements in the array to be merged. This assumes that the array indices
-are numeric--a reasonable assumption, as the array was likely created
-with 'split()' (*note String Functions::):
-
- # join.awk --- join an array into a string
-
- function join(array, start, end, sep, result, i)
- {
- if (sep == "")
- sep = " "
- else if (sep == SUBSEP) # magic value
- sep = ""
- result = array[start]
- for (i = start + 1; i <= end; i++)
- result = result sep array[i]
- return result
- }
-
- An optional additional argument is the separator to use when joining
-the strings back together. If the caller supplies a nonempty value,
-'join()' uses it; if it is not supplied, it has a null value. In this
-case, 'join()' uses a single space as a default separator for the
-strings. If the value is equal to 'SUBSEP', then 'join()' joins the
-strings with no separator between them. 'SUBSEP' serves as a "magic"
-value to indicate that there should be no separation between the
-component strings.(1)
-
- ---------- Footnotes ----------
-
- (1) It would be nice if 'awk' had an assignment operator for
-concatenation. The lack of an explicit operator for concatenation makes
-string operations more difficult than they really need to be.
-
-
-File: gawk.info, Node: Getlocaltime Function, Next: Readfile Function, Prev: Join Function, Up: General Functions
-
-10.2.7 Managing the Time of Day
--------------------------------
-
-The 'systime()' and 'strftime()' functions described in *note Time
-Functions:: provide the minimum functionality necessary for dealing with
-the time of day in human-readable form. Although 'strftime()' is
-extensive, the control formats are not necessarily easy to remember or
-intuitively obvious when reading a program.
-
- The following function, 'getlocaltime()', populates a user-supplied
-array with preformatted time information. It returns a string with the
-current time formatted in the same way as the 'date' utility:
-
- # getlocaltime.awk --- get the time of day in a usable format
-
- # Returns a string in the format of output of date(1)
- # Populates the array argument time with individual values:
- # time["second"] -- seconds (0 - 59)
- # time["minute"] -- minutes (0 - 59)
- # time["hour"] -- hours (0 - 23)
- # time["althour"] -- hours (0 - 12)
- # time["monthday"] -- day of month (1 - 31)
- # time["month"] -- month of year (1 - 12)
- # time["monthname"] -- name of the month
- # time["shortmonth"] -- short name of the month
- # time["year"] -- year modulo 100 (0 - 99)
- # time["fullyear"] -- full year
- # time["weekday"] -- day of week (Sunday = 0)
- # time["altweekday"] -- day of week (Monday = 0)
- # time["dayname"] -- name of weekday
- # time["shortdayname"] -- short name of weekday
- # time["yearday"] -- day of year (0 - 365)
- # time["timezone"] -- abbreviation of timezone name
- # time["ampm"] -- AM or PM designation
- # time["weeknum"] -- week number, Sunday first day
- # time["altweeknum"] -- week number, Monday first day
-
- function getlocaltime(time, ret, now, i)
- {
- # get time once, avoids unnecessary system calls
- now = systime()
-
- # return date(1)-style output
- ret = strftime("%a %b %e %H:%M:%S %Z %Y", now)
-
- # clear out target array
- delete time
-
- # fill in values, force numeric values to be
- # numeric by adding 0
- time["second"] = strftime("%S", now) + 0
- time["minute"] = strftime("%M", now) + 0
- time["hour"] = strftime("%H", now) + 0
- time["althour"] = strftime("%I", now) + 0
- time["monthday"] = strftime("%d", now) + 0
- time["month"] = strftime("%m", now) + 0
- time["monthname"] = strftime("%B", now)
- time["shortmonth"] = strftime("%b", now)
- time["year"] = strftime("%y", now) + 0
- time["fullyear"] = strftime("%Y", now) + 0
- time["weekday"] = strftime("%w", now) + 0
- time["altweekday"] = strftime("%u", now) + 0
- time["dayname"] = strftime("%A", now)
- time["shortdayname"] = strftime("%a", now)
- time["yearday"] = strftime("%j", now) + 0
- time["timezone"] = strftime("%Z", now)
- time["ampm"] = strftime("%p", now)
- time["weeknum"] = strftime("%U", now) + 0
- time["altweeknum"] = strftime("%W", now) + 0
-
- return ret
- }
-
- The string indices are easier to use and read than the various
-formats required by 'strftime()'. The 'alarm' program presented in
-*note Alarm Program:: uses this function. A more general design for the
-'getlocaltime()' function would have allowed the user to supply an
-optional timestamp value to use instead of the current time.
-
-
-File: gawk.info, Node: Readfile Function, Next: Shell Quoting, Prev: Getlocaltime Function, Up: General Functions
-
-10.2.8 Reading a Whole File at Once
------------------------------------
-
-Often, it is convenient to have the entire contents of a file available
-in memory as a single string. A straightforward but naive way to do
-that might be as follows:
-
- function readfile(file, tmp, contents)
- {
- if ((getline tmp < file) < 0)
- return
-
- contents = tmp
- while (getline tmp < file) > 0)
- contents = contents RT tmp
-
- close(file)
- return contents
- }
-
- This function reads from 'file' one record at a time, building up the
-full contents of the file in the local variable 'contents'. It works,
-but is not necessarily efficient.
-
- The following function, based on a suggestion by Denis Shirokov,
-reads the entire contents of the named file in one shot:
-
- # readfile.awk --- read an entire file at once
-
- function readfile(file, tmp, save_rs)
- {
- save_rs = RS
- RS = "^$"
- getline tmp < file
- close(file)
- RS = save_rs
-
- return tmp
- }
-
- It works by setting 'RS' to '^$', a regular expression that will
-never match if the file has contents. 'gawk' reads data from the file
-into 'tmp', attempting to match 'RS'. The match fails after each read,
-but fails quickly, such that 'gawk' fills 'tmp' with the entire contents
-of the file. (*Note Records:: for information on 'RT' and 'RS'.)
-
- In the case that 'file' is empty, the return value is the null
-string. Thus, calling code may use something like:
-
- contents = readfile("/some/path")
- if (length(contents) == 0)
- # file was empty ...
-
- This tests the result to see if it is empty or not. An equivalent
-test would be 'contents == ""'.
-
- *Note Extension Sample Readfile:: for an extension function that also
-reads an entire file into memory.
-
-
-File: gawk.info, Node: Shell Quoting, Prev: Readfile Function, Up: General Functions
-
-10.2.9 Quoting Strings to Pass to the Shell
--------------------------------------------
-
-Michael Brennan offers the following programming pattern, which he uses
-frequently:
-
- #! /bin/sh
-
- awkp='
- ...
- '
-
- INPUT_PROGRAM | awk "$awkp" | /bin/sh
-
- For example, a program of his named 'flac-edit' has this form:
-
- $ flac-edit -song="Whoope! That's Great" file.flac
-
- It generates the following output, which is to be piped to the shell
-('/bin/sh'):
-
- chmod +w file.flac
- metaflac --remove-tag=TITLE file.flac
- LANG=en_US.88591 metaflac --set-tag=TITLE='Whoope! That'"'"'s Great' file.flac
- chmod -w file.flac
-
- Note the need for shell quoting. The function 'shell_quote()' does
-it. 'SINGLE' is the one-character string '"'"' and 'QSINGLE' is the
-three-character string '"\"'\""':
-
- # shell_quote --- quote an argument for passing to the shell
-
- function shell_quote(s, # parameter
- SINGLE, QSINGLE, i, X, n, ret) # locals
- {
- if (s == "")
- return "\"\""
-
- SINGLE = "\x27" # single quote
- QSINGLE = "\"\x27\""
- n = split(s, X, SINGLE)
-
- ret = SINGLE X[1] SINGLE
- for (i = 2; i <= n; i++)
- ret = ret QSINGLE SINGLE X[i] SINGLE
-
- return ret
- }
-
-
-File: gawk.info, Node: Data File Management, Next: Getopt Function, Prev: General Functions, Up: Library Functions
-
-10.3 Data file Management
-=========================
-
-This minor node presents functions that are useful for managing
-command-line data files.
-
-* Menu:
-
-* Filetrans Function:: A function for handling data file transitions.
-* Rewind Function:: A function for rereading the current file.
-* File Checking:: Checking that data files are readable.
-* Empty Files:: Checking for zero-length files.
-* Ignoring Assigns:: Treating assignments as file names.
-
-
-File: gawk.info, Node: Filetrans Function, Next: Rewind Function, Up: Data File Management
-
-10.3.1 Noting Data file Boundaries
-----------------------------------
-
-The 'BEGIN' and 'END' rules are each executed exactly once, at the
-beginning and end of your 'awk' program, respectively (*note
-BEGIN/END::). We (the 'gawk' authors) once had a user who mistakenly
-thought that the 'BEGIN' rules were executed at the beginning of each
-data file and the 'END' rules were executed at the end of each data
-file.
-
- When informed that this was not the case, the user requested that we
-add new special patterns to 'gawk', named 'BEGIN_FILE' and 'END_FILE',
-that would have the desired behavior. He even supplied us the code to
-do so.
-
- Adding these special patterns to 'gawk' wasn't necessary; the job can
-be done cleanly in 'awk' itself, as illustrated by the following library
-program. It arranges to call two user-supplied functions, 'beginfile()'
-and 'endfile()', at the beginning and end of each data file. Besides
-solving the problem in only nine(!) lines of code, it does so
-_portably_; this works with any implementation of 'awk':
-
- # transfile.awk
- #
- # Give the user a hook for filename transitions
- #
- # The user must supply functions beginfile() and endfile()
- # that each take the name of the file being started or
- # finished, respectively.
-
- FILENAME != _oldfilename {
- if (_oldfilename != "")
- endfile(_oldfilename)
- _oldfilename = FILENAME
- beginfile(FILENAME)
- }
-
- END { endfile(FILENAME) }
-
- This file must be loaded before the user's "main" program, so that
-the rule it supplies is executed first.
-
- This rule relies on 'awk''s 'FILENAME' variable, which automatically
-changes for each new data file. The current file name is saved in a
-private variable, '_oldfilename'. If 'FILENAME' does not equal
-'_oldfilename', then a new data file is being processed and it is
-necessary to call 'endfile()' for the old file. Because 'endfile()'
-should only be called if a file has been processed, the program first
-checks to make sure that '_oldfilename' is not the null string. The
-program then assigns the current file name to '_oldfilename' and calls
-'beginfile()' for the file. Because, like all 'awk' variables,
-'_oldfilename' is initialized to the null string, this rule executes
-correctly even for the first data file.
-
- The program also supplies an 'END' rule to do the final processing
-for the last file. Because this 'END' rule comes before any 'END' rules
-supplied in the "main" program, 'endfile()' is called first. Once
-again, the value of multiple 'BEGIN' and 'END' rules should be clear.
-
- If the same data file occurs twice in a row on the command line, then
-'endfile()' and 'beginfile()' are not executed at the end of the first
-pass and at the beginning of the second pass. The following version
-solves the problem:
-
- # ftrans.awk --- handle datafile transitions
- #
- # user supplies beginfile() and endfile() functions
-
- FNR == 1 {
- if (_filename_ != "")
- endfile(_filename_)
- _filename_ = FILENAME
- beginfile(FILENAME)
- }
-
- END { endfile(_filename_) }
-
- *note Wc Program:: shows how this library function can be used and
-how it simplifies writing the main program.
-
- So Why Does 'gawk' Have 'BEGINFILE' and 'ENDFILE'?
-
- You are probably wondering, if 'beginfile()' and 'endfile()'
-functions can do the job, why does 'gawk' have 'BEGINFILE' and 'ENDFILE'
-patterns?
-
- Good question. Normally, if 'awk' cannot open a file, this causes an
-immediate fatal error. In this case, there is no way for a user-defined
-function to deal with the problem, as the mechanism for calling it
-relies on the file being open and at the first record. Thus, the main
-reason for 'BEGINFILE' is to give you a "hook" to catch files that
-cannot be processed. 'ENDFILE' exists for symmetry, and because it
-provides an easy way to do per-file cleanup processing. For more
-information, refer to *note BEGINFILE/ENDFILE::.
-
-
-File: gawk.info, Node: Rewind Function, Next: File Checking, Prev: Filetrans Function, Up: Data File Management
-
-10.3.2 Rereading the Current File
----------------------------------
-
-Another request for a new built-in function was for a function that
-would make it possible to reread the current file. The requesting user
-didn't want to have to use 'getline' (*note Getline::) inside a loop.
-
- However, as long as you are not in the 'END' rule, it is quite easy
-to arrange to immediately close the current input file and then start
-over with it from the top. For lack of a better name, we'll call the
-function 'rewind()':
-
- # rewind.awk --- rewind the current file and start over
-
- function rewind( i)
- {
- # shift remaining arguments up
- for (i = ARGC; i > ARGIND; i--)
- ARGV[i] = ARGV[i-1]
-
- # make sure gawk knows to keep going
- ARGC++
-
- # make current file next to get done
- ARGV[ARGIND+1] = FILENAME
-
- # do it
- nextfile
- }
-
- The 'rewind()' function relies on the 'ARGIND' variable (*note
-Auto-set::), which is specific to 'gawk'. It also relies on the
-'nextfile' keyword (*note Nextfile Statement::). Because of this, you
-should not call it from an 'ENDFILE' rule. (This isn't necessary
-anyway, because 'gawk' goes to the next file as soon as an 'ENDFILE'
-rule finishes!)
-
- You need to be careful calling 'rewind()'. You can end up causing
-infinite recursion if you don't pay attention. Here is an example use:
-
- $ cat data
- -| a
- -| b
- -| c
- -| d
- -| e
-
- $ cat test.awk
- -| FNR == 3 && ! rewound {
- -| rewound = 1
- -| rewind()
- -| }
- -|
- -| { print FILENAME, FNR, $0 }
-
- $ gawk -f rewind.awk -f test.awk data
- -| data 1 a
- -| data 2 b
- -| data 1 a
- -| data 2 b
- -| data 3 c
- -| data 4 d
- -| data 5 e
-
-
-File: gawk.info, Node: File Checking, Next: Empty Files, Prev: Rewind Function, Up: Data File Management
-
-10.3.3 Checking for Readable Data files
----------------------------------------
-
-Normally, if you give 'awk' a data file that isn't readable, it stops
-with a fatal error. There are times when you might want to just ignore
-such files and keep going.(1) You can do this by prepending the
-following program to your 'awk' program:
-
- # readable.awk --- library file to skip over unreadable files
-
- BEGIN {
- for (i = 1; i < ARGC; i++) {
- if (ARGV[i] ~ /^[a-zA-Z_][a-zA-Z0-9_]*=.*/ \
- || ARGV[i] == "-" || ARGV[i] == "/dev/stdin")
- continue # assignment or standard input
- else if ((getline junk < ARGV[i]) < 0) # unreadable
- delete ARGV[i]
- else
- close(ARGV[i])
- }
- }
-
- This works, because the 'getline' won't be fatal. Removing the
-element from 'ARGV' with 'delete' skips the file (because it's no longer
-in the list). See also *note ARGC and ARGV::.
-
- Because 'awk' variable names only allow the English letters, the
-regular expression check purposely does not use character classes such
-as '[:alpha:]' and '[:alnum:]' (*note Bracket Expressions::).
-
- ---------- Footnotes ----------
-
- (1) The 'BEGINFILE' special pattern (*note BEGINFILE/ENDFILE::)
-provides an alternative mechanism for dealing with files that can't be
-opened. However, the code here provides a portable solution.
-
-
-File: gawk.info, Node: Empty Files, Next: Ignoring Assigns, Prev: File Checking, Up: Data File Management
-
-10.3.4 Checking for Zero-Length Files
--------------------------------------
-
-All known 'awk' implementations silently skip over zero-length files.
-This is a by-product of 'awk''s implicit
-read-a-record-and-match-against-the-rules loop: when 'awk' tries to read
-a record from an empty file, it immediately receives an end-of-file
-indication, closes the file, and proceeds on to the next command-line
-data file, _without_ executing any user-level 'awk' program code.
-
- Using 'gawk''s 'ARGIND' variable (*note Built-in Variables::), it is
-possible to detect when an empty data file has been skipped. Similar to
-the library file presented in *note Filetrans Function::, the following
-library file calls a function named 'zerofile()' that the user must
-provide. The arguments passed are the file name and the position in
-'ARGV' where it was found:
-
- # zerofile.awk --- library file to process empty input files
-
- BEGIN { Argind = 0 }
-
- ARGIND > Argind + 1 {
- for (Argind++; Argind < ARGIND; Argind++)
- zerofile(ARGV[Argind], Argind)
- }
-
- ARGIND != Argind { Argind = ARGIND }
-
- END {
- if (ARGIND > Argind)
- for (Argind++; Argind <= ARGIND; Argind++)
- zerofile(ARGV[Argind], Argind)
- }
-
- The user-level variable 'Argind' allows the 'awk' program to track
-its progress through 'ARGV'. Whenever the program detects that 'ARGIND'
-is greater than 'Argind + 1', it means that one or more empty files were
-skipped. The action then calls 'zerofile()' for each such file,
-incrementing 'Argind' along the way.
-
- The 'Argind != ARGIND' rule simply keeps 'Argind' up to date in the
-normal case.
-
- Finally, the 'END' rule catches the case of any empty files at the
-end of the command-line arguments. Note that the test in the condition
-of the 'for' loop uses the '<=' operator, not '<'.
-
-
-File: gawk.info, Node: Ignoring Assigns, Prev: Empty Files, Up: Data File Management
-
-10.3.5 Treating Assignments as File names
------------------------------------------
-
-Occasionally, you might not want 'awk' to process command-line variable
-assignments (*note Assignment Options::). In particular, if you have a
-file name that contains an '=' character, 'awk' treats the file name as
-an assignment and does not process it.
-
- Some users have suggested an additional command-line option for
-'gawk' to disable command-line assignments. However, some simple
-programming with a library file does the trick:
-
- # noassign.awk --- library file to avoid the need for a
- # special option that disables command-line assignments
-
- function disable_assigns(argc, argv, i)
- {
- for (i = 1; i < argc; i++)
- if (argv[i] ~ /^[a-zA-Z_][a-zA-Z0-9_]*=.*/)
- argv[i] = ("./" argv[i])
- }
-
- BEGIN {
- if (No_command_assign)
- disable_assigns(ARGC, ARGV)
- }
-
- You then run your program this way:
-
- awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk *
-
- The function works by looping through the arguments. It prepends
-'./' to any argument that matches the form of a variable assignment,
-turning that argument into a file name.
-
- The use of 'No_command_assign' allows you to disable command-line
-assignments at invocation time, by giving the variable a true value.
-When not set, it is initially zero (i.e., false), so the command-line
-arguments are left alone.
-
-
-File: gawk.info, Node: Getopt Function, Next: Passwd Functions, Prev: Data File Management, Up: Library Functions
-
-10.4 Processing Command-Line Options
-====================================
-
-Most utilities on POSIX-compatible systems take options on the command
-line that can be used to change the way a program behaves. 'awk' is an
-example of such a program (*note Options::). Often, options take
-"arguments" (i.e., data that the program needs to correctly obey the
-command-line option). For example, 'awk''s '-F' option requires a
-string to use as the field separator. The first occurrence on the
-command line of either '--' or a string that does not begin with '-'
-ends the options.
-
- Modern Unix systems provide a C function named 'getopt()' for
-processing command-line arguments. The programmer provides a string
-describing the one-letter options. If an option requires an argument,
-it is followed in the string with a colon. 'getopt()' is also passed
-the count and values of the command-line arguments and is called in a
-loop. 'getopt()' processes the command-line arguments for option
-letters. Each time around the loop, it returns a single character
-representing the next option letter that it finds, or '?' if it finds an
-invalid option. When it returns -1, there are no options left on the
-command line.
-
- When using 'getopt()', options that do not take arguments can be
-grouped together. Furthermore, options that take arguments require that
-the argument be present. The argument can immediately follow the option
-letter, or it can be a separate command-line argument.
-
- Given a hypothetical program that takes three command-line options,
-'-a', '-b', and '-c', where '-b' requires an argument, all of the
-following are valid ways of invoking the program:
-
- prog -a -b foo -c data1 data2 data3
- prog -ac -bfoo -- data1 data2 data3
- prog -acbfoo data1 data2 data3
-
- Notice that when the argument is grouped with its option, the rest of
-the argument is considered to be the option's argument. In this
-example, '-acbfoo' indicates that all of the '-a', '-b', and '-c'
-options were supplied, and that 'foo' is the argument to the '-b'
-option.
-
- 'getopt()' provides four external variables that the programmer can
-use:
-
-'optind'
- The index in the argument value array ('argv') where the first
- nonoption command-line argument can be found.
-
-'optarg'
- The string value of the argument to an option.
-
-'opterr'
- Usually 'getopt()' prints an error message when it finds an invalid
- option. Setting 'opterr' to zero disables this feature. (An
- application might want to print its own error message.)
-
-'optopt'
- The letter representing the command-line option.
-
- The following C fragment shows how 'getopt()' might process
-command-line arguments for 'awk':
-
- int
- main(int argc, char *argv[])
- {
- ...
- /* print our own message */
- opterr = 0;
- while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) {
- switch (c) {
- case 'f': /* file */
- ...
- break;
- case 'F': /* field separator */
- ...
- break;
- case 'v': /* variable assignment */
- ...
- break;
- case 'W': /* extension */
- ...
- break;
- case '?':
- default:
- usage();
- break;
- }
- }
- ...
- }
-
- As a side point, 'gawk' actually uses the GNU 'getopt_long()'
-function to process both normal and GNU-style long options (*note
-Options::).
-
- The abstraction provided by 'getopt()' is very useful and is quite
-handy in 'awk' programs as well. Following is an 'awk' version of
-'getopt()'. This function highlights one of the greatest weaknesses in
-'awk', which is that it is very poor at manipulating single characters.
-Repeated calls to 'substr()' are necessary for accessing individual
-characters (*note String Functions::).(1)
-
- The discussion that follows walks through the code a bit at a time:
-
- # getopt.awk --- Do C library getopt(3) function in awk
-
- # External variables:
- # Optind -- index in ARGV of first nonoption argument
- # Optarg -- string value of argument to current option
- # Opterr -- if nonzero, print our own diagnostic
- # Optopt -- current option letter
-
- # Returns:
- # -1 at end of options
- # "?" for unrecognized option
- # <c> a character representing the current option
-
- # Private Data:
- # _opti -- index in multiflag option, e.g., -abc
-
- The function starts out with comments presenting a list of the global
-variables it uses, what the return values are, what they mean, and any
-global variables that are "private" to this library function. Such
-documentation is essential for any program, and particularly for library
-functions.
-
- The 'getopt()' function first checks that it was indeed called with a
-string of options (the 'options' parameter). If 'options' has a zero
-length, 'getopt()' immediately returns -1:
-
- function getopt(argc, argv, options, thisopt, i)
- {
- if (length(options) == 0) # no options given
- return -1
-
- if (argv[Optind] == "--") { # all done
- Optind++
- _opti = 0
- return -1
- } else if (argv[Optind] !~ /^-[^:[:space:]]/) {
- _opti = 0
- return -1
- }
-
- The next thing to check for is the end of the options. A '--' ends
-the command-line options, as does any command-line argument that does
-not begin with a '-'. 'Optind' is used to step through the array of
-command-line arguments; it retains its value across calls to 'getopt()',
-because it is a global variable.
-
- The regular expression that is used, '/^-[^:[:space:]/', checks for a
-'-' followed by anything that is not whitespace and not a colon. If the
-current command-line argument does not match this pattern, it is not an
-option, and it ends option processing. Continuing on:
-
- if (_opti == 0)
- _opti = 2
- thisopt = substr(argv[Optind], _opti, 1)
- Optopt = thisopt
- i = index(options, thisopt)
- if (i == 0) {
- if (Opterr)
- printf("%c -- invalid option\n", thisopt) > "/dev/stderr"
- if (_opti >= length(argv[Optind])) {
- Optind++
- _opti = 0
- } else
- _opti++
- return "?"
- }
-
- The '_opti' variable tracks the position in the current command-line
-argument ('argv[Optind]'). If multiple options are grouped together
-with one '-' (e.g., '-abx'), it is necessary to return them to the user
-one at a time.
-
- If '_opti' is equal to zero, it is set to two, which is the index in
-the string of the next character to look at (we skip the '-', which is
-at position one). The variable 'thisopt' holds the character, obtained
-with 'substr()'. It is saved in 'Optopt' for the main program to use.
-
- If 'thisopt' is not in the 'options' string, then it is an invalid
-option. If 'Opterr' is nonzero, 'getopt()' prints an error message on
-the standard error that is similar to the message from the C version of
-'getopt()'.
-
- Because the option is invalid, it is necessary to skip it and move on
-to the next option character. If '_opti' is greater than or equal to
-the length of the current command-line argument, it is necessary to move
-on to the next argument, so 'Optind' is incremented and '_opti' is reset
-to zero. Otherwise, 'Optind' is left alone and '_opti' is merely
-incremented.
-
- In any case, because the option is invalid, 'getopt()' returns '"?"'.
-The main program can examine 'Optopt' if it needs to know what the
-invalid option letter actually is. Continuing on:
-
- if (substr(options, i + 1, 1) == ":") {
- # get option argument
- if (length(substr(argv[Optind], _opti + 1)) > 0)
- Optarg = substr(argv[Optind], _opti + 1)
- else
- Optarg = argv[++Optind]
- _opti = 0
- } else
- Optarg = ""
-
- If the option requires an argument, the option letter is followed by
-a colon in the 'options' string. If there are remaining characters in
-the current command-line argument ('argv[Optind]'), then the rest of
-that string is assigned to 'Optarg'. Otherwise, the next command-line
-argument is used ('-xFOO' versus '-x FOO'). In either case, '_opti' is
-reset to zero, because there are no more characters left to examine in
-the current command-line argument. Continuing:
-
- if (_opti == 0 || _opti >= length(argv[Optind])) {
- Optind++
- _opti = 0
- } else
- _opti++
- return thisopt
- }
-
- Finally, if '_opti' is either zero or greater than the length of the
-current command-line argument, it means this element in 'argv' is
-through being processed, so 'Optind' is incremented to point to the next
-element in 'argv'. If neither condition is true, then only '_opti' is
-incremented, so that the next option letter can be processed on the next
-call to 'getopt()'.
-
- The 'BEGIN' rule initializes both 'Opterr' and 'Optind' to one.
-'Opterr' is set to one, because the default behavior is for 'getopt()'
-to print a diagnostic message upon seeing an invalid option. 'Optind'
-is set to one, because there's no reason to look at the program name,
-which is in 'ARGV[0]':
-
- BEGIN {
- Opterr = 1 # default is to diagnose
- Optind = 1 # skip ARGV[0]
-
- # test program
- if (_getopt_test) {
- while ((_go_c = getopt(ARGC, ARGV, "ab:cd")) != -1)
- printf("c = <%c>, Optarg = <%s>\n",
- _go_c, Optarg)
- printf("non-option arguments:\n")
- for (; Optind < ARGC; Optind++)
- printf("\tARGV[%d] = <%s>\n",
- Optind, ARGV[Optind])
- }
- }
-
- The rest of the 'BEGIN' rule is a simple test program. Here are the
-results of two sample runs of the test program:
-
- $ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x
- -| c = <a>, Optarg = <>
- -| c = <c>, Optarg = <>
- -| c = <b>, Optarg = <ARG>
- -| non-option arguments:
- -| ARGV[3] = <bax>
- -| ARGV[4] = <-x>
-
- $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc
- -| c = <a>, Optarg = <>
- error-> x -- invalid option
- -| c = <?>, Optarg = <>
- -| non-option arguments:
- -| ARGV[4] = <xyz>
- -| ARGV[5] = <abc>
-
- In both runs, the first '--' terminates the arguments to 'awk', so
-that it does not try to interpret the '-a', etc., as its own options.
-
- NOTE: After 'getopt()' is through, user-level code must clear out
- all the elements of 'ARGV' from 1 to 'Optind', so that 'awk' does
- not try to process the command-line options as file names.
-
- Using '#!' with the '-E' option may help avoid conflicts between your
-program's options and 'gawk''s options, as '-E' causes 'gawk' to abandon
-processing of further options (*note Executable Scripts:: and *note
-Options::).
-
- Several of the sample programs presented in *note Sample Programs::,
-use 'getopt()' to process their arguments.
-
- ---------- Footnotes ----------
-
- (1) This function was written before 'gawk' acquired the ability to
-split strings into single characters using '""' as the separator. We
-have left it alone, as using 'substr()' is more portable.
-
-
-File: gawk.info, Node: Passwd Functions, Next: Group Functions, Prev: Getopt Function, Up: Library Functions
-
-10.5 Reading the User Database
-==============================
-
-The 'PROCINFO' array (*note Built-in Variables::) provides access to the
-current user's real and effective user and group ID numbers, and, if
-available, the user's supplementary group set. However, because these
-are numbers, they do not provide very useful information to the average
-user. There needs to be some way to find the user information
-associated with the user and group ID numbers. This minor node presents
-a suite of functions for retrieving information from the user database.
-*Note Group Functions:: for a similar suite that retrieves information
-from the group database.
-
- The POSIX standard does not define the file where user information is
-kept. Instead, it provides the '<pwd.h>' header file and several C
-language subroutines for obtaining user information. The primary
-function is 'getpwent()', for "get password entry." The "password"
-comes from the original user database file, '/etc/passwd', which stores
-user information along with the encrypted passwords (hence the name).
-
- Although an 'awk' program could simply read '/etc/passwd' directly,
-this file may not contain complete information about the system's set of
-users.(1) To be sure you are able to produce a readable and complete
-version of the user database, it is necessary to write a small C program
-that calls 'getpwent()'. 'getpwent()' is defined as returning a pointer
-to a 'struct passwd'. Each time it is called, it returns the next entry
-in the database. When there are no more entries, it returns 'NULL', the
-null pointer. When this happens, the C program should call 'endpwent()'
-to close the database. Following is 'pwcat', a C program that "cats"
-the password database:
-
- /*
- * pwcat.c
- *
- * Generate a printable version of the password database.
- */
- #include <stdio.h>
- #include <pwd.h>
-
- int
- main(int argc, char **argv)
- {
- struct passwd *p;
-
- while ((p = getpwent()) != NULL)
- printf("%s:%s:%ld:%ld:%s:%s:%s\n",
- p->pw_name, p->pw_passwd, (long) p->pw_uid,
- (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell);
-
- endpwent();
- return 0;
- }
-
- If you don't understand C, don't worry about it. The output from
-'pwcat' is the user database, in the traditional '/etc/passwd' format of
-colon-separated fields. The fields are:
-
-Login name
- The user's login name.
-
-Encrypted password
- The user's encrypted password. This may not be available on some
- systems.
-
-User-ID
- The user's numeric user ID number. (On some systems, it's a C
- 'long', and not an 'int'. Thus, we cast it to 'long' for all
- cases.)
-
-Group-ID
- The user's numeric group ID number. (Similar comments about 'long'
- versus 'int' apply here.)
-
-Full name
- The user's full name, and perhaps other information associated with
- the user.
-
-Home directory
- The user's login (or "home") directory (familiar to shell
- programmers as '$HOME').
-
-Login shell
- The program that is run when the user logs in. This is usually a
- shell, such as Bash.
-
- A few lines representative of 'pwcat''s output are as follows:
-
- $ pwcat
- -| root:x:0:1:Operator:/:/bin/sh
- -| nobody:*:65534:65534::/:
- -| daemon:*:1:1::/:
- -| sys:*:2:2::/:/bin/csh
- -| bin:*:3:3::/bin:
- -| arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh
- -| miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh
- -| andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh
- ...
-
- With that introduction, following is a group of functions for getting
-user information. There are several functions here, corresponding to
-the C functions of the same names:
-
- # passwd.awk --- access password file information
-
- BEGIN {
- # tailor this to suit your system
- _pw_awklib = "/usr/local/libexec/awk/"
- }
-
- function _pw_init( oldfs, oldrs, olddol0, pwcat, using_fw, using_fpat)
- {
- if (_pw_inited)
- return
-
- oldfs = FS
- oldrs = RS
- olddol0 = $0
- using_fw = (PROCINFO["FS"] == "FIELDWIDTHS")
- using_fpat = (PROCINFO["FS"] == "FPAT")
- FS = ":"
- RS = "\n"
-
- pwcat = _pw_awklib "pwcat"
- while ((pwcat | getline) > 0) {
- _pw_byname[$1] = $0
- _pw_byuid[$3] = $0
- _pw_bycount[++_pw_total] = $0
- }
- close(pwcat)
- _pw_count = 0
- _pw_inited = 1
- FS = oldfs
- if (using_fw)
- FIELDWIDTHS = FIELDWIDTHS
- else if (using_fpat)
- FPAT = FPAT
- RS = oldrs
- $0 = olddol0
- }
-
- The 'BEGIN' rule sets a private variable to the directory where
-'pwcat' is stored. Because it is used to help out an 'awk' library
-routine, we have chosen to put it in '/usr/local/libexec/awk'; however,
-you might want it to be in a different directory on your system.
-
- The function '_pw_init()' fills three copies of the user information
-into three associative arrays. The arrays are indexed by username
-('_pw_byname'), by user ID number ('_pw_byuid'), and by order of
-occurrence ('_pw_bycount'). The variable '_pw_inited' is used for
-efficiency, as '_pw_init()' needs to be called only once.
-
- Because this function uses 'getline' to read information from
-'pwcat', it first saves the values of 'FS', 'RS', and '$0'. It notes in
-the variable 'using_fw' whether field splitting with 'FIELDWIDTHS' is in
-effect or not. Doing so is necessary, as these functions could be
-called from anywhere within a user's program, and the user may have his
-or her own way of splitting records and fields. This makes it possible
-to restore the correct field-splitting mechanism later. The test can
-only be true for 'gawk'. It is false if using 'FS' or 'FPAT', or on
-some other 'awk' implementation.
-
- The code that checks for using 'FPAT', using 'using_fpat' and
-'PROCINFO["FS"]', is similar.
-
- The main part of the function uses a loop to read database lines,
-split the lines into fields, and then store the lines into each array as
-necessary. When the loop is done, '_pw_init()' cleans up by closing the
-pipeline, setting '_pw_inited' to one, and restoring 'FS' (and
-'FIELDWIDTHS' or 'FPAT' if necessary), 'RS', and '$0'. The use of
-'_pw_count' is explained shortly.
-
- The 'getpwnam()' function takes a username as a string argument. If
-that user is in the database, it returns the appropriate line.
-Otherwise, it relies on the array reference to a nonexistent element to
-create the element with the null string as its value:
-
- function getpwnam(name)
- {
- _pw_init()
- return _pw_byname[name]
- }
-
- Similarly, the 'getpwuid()' function takes a user ID number argument.
-If that user number is in the database, it returns the appropriate line.
-Otherwise, it returns the null string:
-
- function getpwuid(uid)
- {
- _pw_init()
- return _pw_byuid[uid]
- }
-
- The 'getpwent()' function simply steps through the database, one
-entry at a time. It uses '_pw_count' to track its current position in
-the '_pw_bycount' array:
-
- function getpwent()
- {
- _pw_init()
- if (_pw_count < _pw_total)
- return _pw_bycount[++_pw_count]
- return ""
- }
-
- The 'endpwent()' function resets '_pw_count' to zero, so that
-subsequent calls to 'getpwent()' start over again:
-
- function endpwent()
- {
- _pw_count = 0
- }
-
- A conscious design decision in this suite is that each subroutine
-calls '_pw_init()' to initialize the database arrays. The overhead of
-running a separate process to generate the user database, and the I/O to
-scan it, are only incurred if the user's main program actually calls one
-of these functions. If this library file is loaded along with a user's
-program, but none of the routines are ever called, then there is no
-extra runtime overhead. (The alternative is move the body of
-'_pw_init()' into a 'BEGIN' rule, which always runs 'pwcat'. This
-simplifies the code but runs an extra process that may never be needed.)
-
- In turn, calling '_pw_init()' is not too expensive, because the
-'_pw_inited' variable keeps the program from reading the data more than
-once. If you are worried about squeezing every last cycle out of your
-'awk' program, the check of '_pw_inited' could be moved out of
-'_pw_init()' and duplicated in all the other functions. In practice,
-this is not necessary, as most 'awk' programs are I/O-bound, and such a
-change would clutter up the code.
-
- The 'id' program in *note Id Program:: uses these functions.
-
- ---------- Footnotes ----------
-
- (1) It is often the case that password information is stored in a
-network database.
-
-
-File: gawk.info, Node: Group Functions, Next: Walking Arrays, Prev: Passwd Functions, Up: Library Functions
-
-10.6 Reading the Group Database
-===============================
-
-Much of the discussion presented in *note Passwd Functions:: applies to
-the group database as well. Although there has traditionally been a
-well-known file ('/etc/group') in a well-known format, the POSIX
-standard only provides a set of C library routines ('<grp.h>' and
-'getgrent()') for accessing the information. Even though this file may
-exist, it may not have complete information. Therefore, as with the
-user database, it is necessary to have a small C program that generates
-the group database as its output. 'grcat', a C program that "cats" the
-group database, is as follows:
-
- /*
- * grcat.c
- *
- * Generate a printable version of the group database.
- */
- #include <stdio.h>
- #include <grp.h>
-
- int
- main(int argc, char **argv)
- {
- struct group *g;
- int i;
-
- while ((g = getgrent()) != NULL) {
- printf("%s:%s:%ld:", g->gr_name, g->gr_passwd,
- (long) g->gr_gid);
- for (i = 0; g->gr_mem[i] != NULL; i++) {
- printf("%s", g->gr_mem[i]);
- if (g->gr_mem[i+1] != NULL)
- putchar(',');
- }
- putchar('\n');
- }
- endgrent();
- return 0;
- }
-
- Each line in the group database represents one group. The fields are
-separated with colons and represent the following information:
-
-Group Name
- The group's name.
-
-Group Password
- The group's encrypted password. In practice, this field is never
- used; it is usually empty or set to '*'.
-
-Group ID Number
- The group's numeric group ID number; the association of name to
- number must be unique within the file. (On some systems it's a C
- 'long', and not an 'int'. Thus, we cast it to 'long' for all
- cases.)
-
-Group Member List
- A comma-separated list of usernames. These users are members of
- the group. Modern Unix systems allow users to be members of
- several groups simultaneously. If your system does, then there are
- elements '"group1"' through '"groupN"' in 'PROCINFO' for those
- group ID numbers. (Note that 'PROCINFO' is a 'gawk' extension;
- *note Built-in Variables::.)
-
- Here is what running 'grcat' might produce:
-
- $ grcat
- -| wheel:*:0:arnold
- -| nogroup:*:65534:
- -| daemon:*:1:
- -| kmem:*:2:
- -| staff:*:10:arnold,miriam,andy
- -| other:*:20:
- ...
-
- Here are the functions for obtaining information from the group
-database. There are several, modeled after the C library functions of
-the same names:
-
- # group.awk --- functions for dealing with the group file
-
- BEGIN {
- # Change to suit your system
- _gr_awklib = "/usr/local/libexec/awk/"
- }
-
- function _gr_init( oldfs, oldrs, olddol0, grcat,
- using_fw, using_fpat, n, a, i)
- {
- if (_gr_inited)
- return
-
- oldfs = FS
- oldrs = RS
- olddol0 = $0
- using_fw = (PROCINFO["FS"] == "FIELDWIDTHS")
- using_fpat = (PROCINFO["FS"] == "FPAT")
- FS = ":"
- RS = "\n"
-
- grcat = _gr_awklib "grcat"
- while ((grcat | getline) > 0) {
- if ($1 in _gr_byname)
- _gr_byname[$1] = _gr_byname[$1] "," $4
- else
- _gr_byname[$1] = $0
- if ($3 in _gr_bygid)
- _gr_bygid[$3] = _gr_bygid[$3] "," $4
- else
- _gr_bygid[$3] = $0
-
- n = split($4, a, "[ \t]*,[ \t]*")
- for (i = 1; i <= n; i++)
- if (a[i] in _gr_groupsbyuser)
- _gr_groupsbyuser[a[i]] = _gr_groupsbyuser[a[i]] " " $1
- else
- _gr_groupsbyuser[a[i]] = $1
-
- _gr_bycount[++_gr_count] = $0
- }
- close(grcat)
- _gr_count = 0
- _gr_inited++
- FS = oldfs
- if (using_fw)
- FIELDWIDTHS = FIELDWIDTHS
- else if (using_fpat)
- FPAT = FPAT
- RS = oldrs
- $0 = olddol0
- }
-
- The 'BEGIN' rule sets a private variable to the directory where
-'grcat' is stored. Because it is used to help out an 'awk' library
-routine, we have chosen to put it in '/usr/local/libexec/awk'. You
-might want it to be in a different directory on your system.
-
- These routines follow the same general outline as the user database
-routines (*note Passwd Functions::). The '_gr_inited' variable is used
-to ensure that the database is scanned no more than once. The
-'_gr_init()' function first saves 'FS', 'RS', and '$0', and then sets
-'FS' and 'RS' to the correct values for scanning the group information.
-It also takes care to note whether 'FIELDWIDTHS' or 'FPAT' is being
-used, and to restore the appropriate field-splitting mechanism.
-
- The group information is stored in several associative arrays. The
-arrays are indexed by group name ('_gr_byname'), by group ID number
-('_gr_bygid'), and by position in the database ('_gr_bycount'). There
-is an additional array indexed by username ('_gr_groupsbyuser'), which
-is a space-separated list of groups to which each user belongs.
-
- Unlike in the user database, it is possible to have multiple records
-in the database for the same group. This is common when a group has a
-large number of members. A pair of such entries might look like the
-following:
-
- tvpeople:*:101:johnny,jay,arsenio
- tvpeople:*:101:david,conan,tom,joan
-
- For this reason, '_gr_init()' looks to see if a group name or group
-ID number is already seen. If so, the usernames are simply concatenated
-onto the previous list of users.(1)
-
- Finally, '_gr_init()' closes the pipeline to 'grcat', restores 'FS'
-(and 'FIELDWIDTHS' or 'FPAT', if necessary), 'RS', and '$0', initializes
-'_gr_count' to zero (it is used later), and makes '_gr_inited' nonzero.
-
- The 'getgrnam()' function takes a group name as its argument, and if
-that group exists, it is returned. Otherwise, it relies on the array
-reference to a nonexistent element to create the element with the null
-string as its value:
-
- function getgrnam(group)
- {
- _gr_init()
- return _gr_byname[group]
- }
-
- The 'getgrgid()' function is similar; it takes a numeric group ID and
-looks up the information associated with that group ID:
-
- function getgrgid(gid)
- {
- _gr_init()
- return _gr_bygid[gid]
- }
-
- The 'getgruser()' function does not have a C counterpart. It takes a
-username and returns the list of groups that have the user as a member:
-
- function getgruser(user)
- {
- _gr_init()
- return _gr_groupsbyuser[user]
- }
-
- The 'getgrent()' function steps through the database one entry at a
-time. It uses '_gr_count' to track its position in the list:
-
- function getgrent()
- {
- _gr_init()
- if (++_gr_count in _gr_bycount)
- return _gr_bycount[_gr_count]
- return ""
- }
-
- The 'endgrent()' function resets '_gr_count' to zero so that
-'getgrent()' can start over again:
-
- function endgrent()
- {
- _gr_count = 0
- }
-
- As with the user database routines, each function calls '_gr_init()'
-to initialize the arrays. Doing so only incurs the extra overhead of
-running 'grcat' if these functions are used (as opposed to moving the
-body of '_gr_init()' into a 'BEGIN' rule).
-
- Most of the work is in scanning the database and building the various
-associative arrays. The functions that the user calls are themselves
-very simple, relying on 'awk''s associative arrays to do work.
-
- The 'id' program in *note Id Program:: uses these functions.
-
- ---------- Footnotes ----------
-
- (1) There is a subtle problem with the code just presented. Suppose
-that the first time there were no names. This code adds the names with
-a leading comma. It also doesn't check that there is a '$4'.
-
-
-File: gawk.info, Node: Walking Arrays, Next: Library Functions Summary, Prev: Group Functions, Up: Library Functions
-
-10.7 Traversing Arrays of Arrays
-================================
-
-*note Arrays of Arrays:: described how 'gawk' provides arrays of arrays.
-In particular, any element of an array may be either a scalar or another
-array. The 'isarray()' function (*note Type Functions::) lets you
-distinguish an array from a scalar. The following function,
-'walk_array()', recursively traverses an array, printing the element
-indices and values. You call it with the array and a string
-representing the name of the array:
-
- function walk_array(arr, name, i)
- {
- for (i in arr) {
- if (isarray(arr[i]))
- walk_array(arr[i], (name "[" i "]"))
- else
- printf("%s[%s] = %s\n", name, i, arr[i])
- }
- }
-
-It works by looping over each element of the array. If any given
-element is itself an array, the function calls itself recursively,
-passing the subarray and a new string representing the current index.
-Otherwise, the function simply prints the element's name, index, and
-value. Here is a main program to demonstrate:
-
- BEGIN {
- a[1] = 1
- a[2][1] = 21
- a[2][2] = 22
- a[3] = 3
- a[4][1][1] = 411
- a[4][2] = 42
-
- walk_array(a, "a")
- }
-
- When run, the program produces the following output:
-
- $ gawk -f walk_array.awk
- -| a[1] = 1
- -| a[2][1] = 21
- -| a[2][2] = 22
- -| a[3] = 3
- -| a[4][1][1] = 411
- -| a[4][2] = 42
-
- The function just presented simply prints the name and value of each
-scalar array element. However, it is easy to generalize it, by passing
-in the name of a function to call when walking an array. The modified
-function looks like this:
-
- function process_array(arr, name, process, do_arrays, i, new_name)
- {
- for (i in arr) {
- new_name = (name "[" i "]")
- if (isarray(arr[i])) {
- if (do_arrays)
- @process(new_name, arr[i])
- process_array(arr[i], new_name, process, do_arrays)
- } else
- @process(new_name, arr[i])
- }
- }
-
- The arguments are as follows:
-
-'arr'
- The array.
-
-'name'
- The name of the array (a string).
-
-'process'
- The name of the function to call.
-
-'do_arrays'
- If this is true, the function can handle elements that are
- subarrays.
-
- If subarrays are to be processed, that is done before walking them
-further.
-
- When run with the following scaffolding, the function produces the
-same results as does the earlier version of 'walk_array()':
-
- BEGIN {
- a[1] = 1
- a[2][1] = 21
- a[2][2] = 22
- a[3] = 3
- a[4][1][1] = 411
- a[4][2] = 42
-
- process_array(a, "a", "do_print", 0)
- }
-
- function do_print(name, element)
- {
- printf "%s = %s\n", name, element
- }
-
-
-File: gawk.info, Node: Library Functions Summary, Next: Library Exercises, Prev: Walking Arrays, Up: Library Functions
-
-10.8 Summary
-============
-
- * Reading programs is an excellent way to learn Good Programming.
- The functions and programs provided in this major node and the next
- are intended to serve that purpose.
-
- * When writing general-purpose library functions, put some thought
- into how to name any global variables so that they won't conflict
- with variables from a user's program.
-
- * The functions presented here fit into the following categories:
-
- General problems
- Number-to-string conversion, testing assertions, rounding,
- random number generation, converting characters to numbers,
- joining strings, getting easily usable time-of-day
- information, and reading a whole file in one shot
-
- Managing data files
- Noting data file boundaries, rereading the current file,
- checking for readable files, checking for zero-length files,
- and treating assignments as file names
-
- Processing command-line options
- An 'awk' version of the standard C 'getopt()' function
-
- Reading the user and group databases
- Two sets of routines that parallel the C library versions
-
- Traversing arrays of arrays
- Two functions that traverse an array of arrays to any depth
-
-
-File: gawk.info, Node: Library Exercises, Prev: Library Functions Summary, Up: Library Functions
-
-10.9 Exercises
-==============
-
- 1. In *note Empty Files::, we presented the 'zerofile.awk' program,
- which made use of 'gawk''s 'ARGIND' variable. Can this problem be
- solved without relying on 'ARGIND'? If so, how?
-
- 2. As a related challenge, revise that code to handle the case where
- an intervening value in 'ARGV' is a variable assignment.
-
-
-File: gawk.info, Node: Sample Programs, Next: Advanced Features, Prev: Library Functions, Up: Top
-
-11 Practical 'awk' Programs
-***************************
-
-*note Library Functions::, presents the idea that reading programs in a
-language contributes to learning that language. This major node
-continues that theme, presenting a potpourri of 'awk' programs for your
-reading enjoyment.
-
- Many of these programs use library functions presented in *note
-Library Functions::.
-
-* Menu:
-
-* Running Examples:: How to run these examples.
-* Clones:: Clones of common utilities.
-* Miscellaneous Programs:: Some interesting 'awk' programs.
-* Programs Summary:: Summary of programs.
-* Programs Exercises:: Exercises.
-
-
-File: gawk.info, Node: Running Examples, Next: Clones, Up: Sample Programs
-
-11.1 Running the Example Programs
-=================================
-
-To run a given program, you would typically do something like this:
-
- awk -f PROGRAM -- OPTIONS FILES
-
-Here, PROGRAM is the name of the 'awk' program (such as 'cut.awk'),
-OPTIONS are any command-line options for the program that start with a
-'-', and FILES are the actual data files.
-
- If your system supports the '#!' executable interpreter mechanism
-(*note Executable Scripts::), you can instead run your program directly:
-
- cut.awk -c1-8 myfiles > results
-
- If your 'awk' is not 'gawk', you may instead need to use this:
-
- cut.awk -- -c1-8 myfiles > results
-
-
-File: gawk.info, Node: Clones, Next: Miscellaneous Programs, Prev: Running Examples, Up: Sample Programs
-
-11.2 Reinventing Wheels for Fun and Profit
-==========================================
-
-This minor node presents a number of POSIX utilities implemented in
-'awk'. Reinventing these programs in 'awk' is often enjoyable, because
-the algorithms can be very clearly expressed, and the code is usually
-very concise and simple. This is true because 'awk' does so much for
-you.
-
- It should be noted that these programs are not necessarily intended
-to replace the installed versions on your system. Nor may all of these
-programs be fully compliant with the most recent POSIX standard. This
-is not a problem; their purpose is to illustrate 'awk' language
-programming for "real-world" tasks.
-
- The programs are presented in alphabetical order.
-
-* Menu:
-
-* Cut Program:: The 'cut' utility.
-* Egrep Program:: The 'egrep' utility.
-* Id Program:: The 'id' utility.
-* Split Program:: The 'split' utility.
-* Tee Program:: The 'tee' utility.
-* Uniq Program:: The 'uniq' utility.
-* Wc Program:: The 'wc' utility.
-
-
-File: gawk.info, Node: Cut Program, Next: Egrep Program, Up: Clones
-
-11.2.1 Cutting Out Fields and Columns
--------------------------------------
-
-The 'cut' utility selects, or "cuts," characters or fields from its
-standard input and sends them to its standard output. Fields are
-separated by TABs by default, but you may supply a command-line option
-to change the field "delimiter" (i.e., the field-separator character).
-'cut''s definition of fields is less general than 'awk''s.
-
- A common use of 'cut' might be to pull out just the login names of
-logged-on users from the output of 'who'. For example, the following
-pipeline generates a sorted, unique list of the logged-on users:
-
- who | cut -c1-8 | sort | uniq
-
- The options for 'cut' are:
-
-'-c LIST'
- Use LIST as the list of characters to cut out. Items within the
- list may be separated by commas, and ranges of characters can be
- separated with dashes. The list '1-8,15,22-35' specifies
- characters 1 through 8, 15, and 22 through 35.
-
-'-f LIST'
- Use LIST as the list of fields to cut out.
-
-'-d DELIM'
- Use DELIM as the field-separator character instead of the TAB
- character.
-
-'-s'
- Suppress printing of lines that do not contain the field delimiter.
-
- The 'awk' implementation of 'cut' uses the 'getopt()' library
-function (*note Getopt Function::) and the 'join()' library function
-(*note Join Function::).
-
- The program begins with a comment describing the options, the library
-functions needed, and a 'usage()' function that prints out a usage
-message and exits. 'usage()' is called if invalid arguments are
-supplied:
-
- # cut.awk --- implement cut in awk
-
- # Options:
- # -f list Cut fields
- # -d c Field delimiter character
- # -c list Cut characters
- #
- # -s Suppress lines without the delimiter
- #
- # Requires getopt() and join() library functions
-
- function usage()
- {
- print("usage: cut [-f list] [-d c] [-s] [files...]") > "/dev/stderr"
- print("usage: cut [-c list] [files...]") > "/dev/stderr"
- exit 1
- }
-
- Next comes a 'BEGIN' rule that parses the command-line options. It
-sets 'FS' to a single TAB character, because that is 'cut''s default
-field separator. The rule then sets the output field separator to be
-the same as the input field separator. A loop using 'getopt()' steps
-through the command-line options. Exactly one of the variables
-'by_fields' or 'by_chars' is set to true, to indicate that processing
-should be done by fields or by characters, respectively. When cutting
-by characters, the output field separator is set to the null string:
-
- BEGIN {
- FS = "\t" # default
- OFS = FS
- while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) {
- if (c == "f") {
- by_fields = 1
- fieldlist = Optarg
- } else if (c == "c") {
- by_chars = 1
- fieldlist = Optarg
- OFS = ""
- } else if (c == "d") {
- if (length(Optarg) > 1) {
- printf("cut: using first character of %s" \
- " for delimiter\n", Optarg) > "/dev/stderr"
- Optarg = substr(Optarg, 1, 1)
- }
- fs = FS = Optarg
- OFS = FS
- if (FS == " ") # defeat awk semantics
- FS = "[ ]"
- } else if (c == "s")
- suppress = 1
- else
- usage()
- }
-
- # Clear out options
- for (i = 1; i < Optind; i++)
- ARGV[i] = ""
-
- The code must take special care when the field delimiter is a space.
-Using a single space ('" "') for the value of 'FS' is incorrect--'awk'
-would separate fields with runs of spaces, TABs, and/or newlines, and we
-want them to be separated with individual spaces. To this end, we save
-the original space character in the variable 'fs' for later use; after
-setting 'FS' to '"[ ]"' we can't use it directly to see if the field
-delimiter character is in the string.
-
- Also remember that after 'getopt()' is through (as described in *note
-Getopt Function::), we have to clear out all the elements of 'ARGV' from
-1 to 'Optind', so that 'awk' does not try to process the command-line
-options as file names.
-
- After dealing with the command-line options, the program verifies
-that the options make sense. Only one or the other of '-c' and '-f'
-should be used, and both require a field list. Then the program calls
-either 'set_fieldlist()' or 'set_charlist()' to pull apart the list of
-fields or characters:
-
- if (by_fields && by_chars)
- usage()
-
- if (by_fields == 0 && by_chars == 0)
- by_fields = 1 # default
-
- if (fieldlist == "") {
- print "cut: needs list for -c or -f" > "/dev/stderr"
- exit 1
- }
-
- if (by_fields)
- set_fieldlist()
- else
- set_charlist()
- }
-
- 'set_fieldlist()' splits the field list apart at the commas into an
-array. Then, for each element of the array, it looks to see if the
-element is actually a range, and if so, splits it apart. The function
-checks the range to make sure that the first number is smaller than the
-second. Each number in the list is added to the 'flist' array, which
-simply lists the fields that will be printed. Normal field splitting is
-used. The program lets 'awk' handle the job of doing the field
-splitting:
-
- function set_fieldlist( n, m, i, j, k, f, g)
- {
- n = split(fieldlist, f, ",")
- j = 1 # index in flist
- for (i = 1; i <= n; i++) {
- if (index(f[i], "-") != 0) { # a range
- m = split(f[i], g, "-")
- if (m != 2 || g[1] >= g[2]) {
- printf("cut: bad field list: %s\n",
- f[i]) > "/dev/stderr"
- exit 1
- }
- for (k = g[1]; k <= g[2]; k++)
- flist[j++] = k
- } else
- flist[j++] = f[i]
- }
- nfields = j - 1
- }
-
- The 'set_charlist()' function is more complicated than
-'set_fieldlist()'. The idea here is to use 'gawk''s 'FIELDWIDTHS'
-variable (*note Constant Size::), which describes constant-width input.
-When using a character list, that is exactly what we have.
-
- Setting up 'FIELDWIDTHS' is more complicated than simply listing the
-fields that need to be printed. We have to keep track of the fields to
-print and also the intervening characters that have to be skipped. For
-example, suppose you wanted characters 1 through 8, 15, and 22 through
-35. You would use '-c 1-8,15,22-35'. The necessary value for
-'FIELDWIDTHS' is '"8 6 1 6 14"'. This yields five fields, and the
-fields to print are '$1', '$3', and '$5'. The intermediate fields are
-"filler", which is stuff in between the desired data. 'flist' lists the
-fields to print, and 't' tracks the complete field list, including
-filler fields:
-
- function set_charlist( field, i, j, f, g, n, m, t,
- filler, last, len)
- {
- field = 1 # count total fields
- n = split(fieldlist, f, ",")
- j = 1 # index in flist
- for (i = 1; i <= n; i++) {
- if (index(f[i], "-") != 0) { # range
- m = split(f[i], g, "-")
- if (m != 2 || g[1] >= g[2]) {
- printf("cut: bad character list: %s\n",
- f[i]) > "/dev/stderr"
- exit 1
- }
- len = g[2] - g[1] + 1
- if (g[1] > 1) # compute length of filler
- filler = g[1] - last - 1
- else
- filler = 0
- if (filler)
- t[field++] = filler
- t[field++] = len # length of field
- last = g[2]
- flist[j++] = field - 1
- } else {
- if (f[i] > 1)
- filler = f[i] - last - 1
- else
- filler = 0
- if (filler)
- t[field++] = filler
- t[field++] = 1
- last = f[i]
- flist[j++] = field - 1
- }
- }
- FIELDWIDTHS = join(t, 1, field - 1)
- nfields = j - 1
- }
-
- Next is the rule that processes the data. If the '-s' option is
-given, then 'suppress' is true. The first 'if' statement makes sure
-that the input record does have the field separator. If 'cut' is
-processing fields, 'suppress' is true, and the field separator character
-is not in the record, then the record is skipped.
-
- If the record is valid, then 'gawk' has split the data into fields,
-either using the character in 'FS' or using fixed-length fields and
-'FIELDWIDTHS'. The loop goes through the list of fields that should be
-printed. The corresponding field is printed if it contains data. If
-the next field also has data, then the separator character is written
-out between the fields:
-
- {
- if (by_fields && suppress && index($0, fs) == 0)
- next
-
- for (i = 1; i <= nfields; i++) {
- if ($flist[i] != "") {
- printf "%s", $flist[i]
- if (i < nfields && $flist[i+1] != "")
- printf "%s", OFS
- }
- }
- print ""
- }
-
- This version of 'cut' relies on 'gawk''s 'FIELDWIDTHS' variable to do
-the character-based cutting. It is possible in other 'awk'
-implementations to use 'substr()' (*note String Functions::), but it is
-also extremely painful. The 'FIELDWIDTHS' variable supplies an elegant
-solution to the problem of picking the input line apart by characters.
-
-
-File: gawk.info, Node: Egrep Program, Next: Id Program, Prev: Cut Program, Up: Clones
-
-11.2.2 Searching for Regular Expressions in Files
--------------------------------------------------
-
-The 'egrep' utility searches files for patterns. It uses regular
-expressions that are almost identical to those available in 'awk' (*note
-Regexp::). You invoke it as follows:
-
- 'egrep' [OPTIONS] ''PATTERN'' FILES ...
-
- The PATTERN is a regular expression. In typical usage, the regular
-expression is quoted to prevent the shell from expanding any of the
-special characters as file name wildcards. Normally, 'egrep' prints the
-lines that matched. If multiple file names are provided on the command
-line, each output line is preceded by the name of the file and a colon.
-
- The options to 'egrep' are as follows:
-
-'-c'
- Print out a count of the lines that matched the pattern, instead of
- the lines themselves.
-
-'-s'
- Be silent. No output is produced and the exit value indicates
- whether the pattern was matched.
-
-'-v'
- Invert the sense of the test. 'egrep' prints the lines that do
- _not_ match the pattern and exits successfully if the pattern is
- not matched.
-
-'-i'
- Ignore case distinctions in both the pattern and the input data.
-
-'-l'
- Only print (list) the names of the files that matched, not the
- lines that matched.
-
-'-e PATTERN'
- Use PATTERN as the regexp to match. The purpose of the '-e' option
- is to allow patterns that start with a '-'.
-
- This version uses the 'getopt()' library function (*note Getopt
-Function::) and the file transition library program (*note Filetrans
-Function::).
-
- The program begins with a descriptive comment and then a 'BEGIN' rule
-that processes the command-line arguments with 'getopt()'. The '-i'
-(ignore case) option is particularly easy with 'gawk'; we just use the
-'IGNORECASE' predefined variable (*note Built-in Variables::):
-
- # egrep.awk --- simulate egrep in awk
- #
- # Options:
- # -c count of lines
- # -s silent - use exit value
- # -v invert test, success if no match
- # -i ignore case
- # -l print filenames only
- # -e argument is pattern
- #
- # Requires getopt and file transition library functions
-
- BEGIN {
- while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) {
- if (c == "c")
- count_only++
- else if (c == "s")
- no_print++
- else if (c == "v")
- invert++
- else if (c == "i")
- IGNORECASE = 1
- else if (c == "l")
- filenames_only++
- else if (c == "e")
- pattern = Optarg
- else
- usage()
- }
-
- Next comes the code that handles the 'egrep'-specific behavior. If
-no pattern is supplied with '-e', the first nonoption on the command
-line is used. The 'awk' command-line arguments up to 'ARGV[Optind]' are
-cleared, so that 'awk' won't try to process them as files. If no files
-are specified, the standard input is used, and if multiple files are
-specified, we make sure to note this so that the file names can precede
-the matched lines in the output:
-
- if (pattern == "")
- pattern = ARGV[Optind++]
-
- for (i = 1; i < Optind; i++)
- ARGV[i] = ""
- if (Optind >= ARGC) {
- ARGV[1] = "-"
- ARGC = 2
- } else if (ARGC - Optind > 1)
- do_filenames++
-
- # if (IGNORECASE)
- # pattern = tolower(pattern)
- }
-
- The last two lines are commented out, as they are not needed in
-'gawk'. They should be uncommented if you have to use another version
-of 'awk'.
-
- The next set of lines should be uncommented if you are not using
-'gawk'. This rule translates all the characters in the input line into
-lowercase if the '-i' option is specified.(1) The rule is commented out
-as it is not necessary with 'gawk':
-
- #{
- # if (IGNORECASE)
- # $0 = tolower($0)
- #}
-
- The 'beginfile()' function is called by the rule in 'ftrans.awk' when
-each new file is processed. In this case, it is very simple; all it
-does is initialize a variable 'fcount' to zero. 'fcount' tracks how
-many lines in the current file matched the pattern. Naming the
-parameter 'junk' shows we know that 'beginfile()' is called with a
-parameter, but that we're not interested in its value:
-
- function beginfile(junk)
- {
- fcount = 0
- }
-
- The 'endfile()' function is called after each file has been
-processed. It affects the output only when the user wants a count of
-the number of lines that matched. 'no_print' is true only if the exit
-status is desired. 'count_only' is true if line counts are desired.
-'egrep' therefore only prints line counts if printing and counting are
-enabled. The output format must be adjusted depending upon the number
-of files to process. Finally, 'fcount' is added to 'total', so that we
-know the total number of lines that matched the pattern:
-
- function endfile(file)
- {
- if (! no_print && count_only) {
- if (do_filenames)
- print file ":" fcount
- else
- print fcount
- }
-
- total += fcount
- }
-
- The 'BEGINFILE' and 'ENDFILE' special patterns (*note
-BEGINFILE/ENDFILE::) could be used, but then the program would be
-'gawk'-specific. Additionally, this example was written before 'gawk'
-acquired 'BEGINFILE' and 'ENDFILE'.
-
- The following rule does most of the work of matching lines. The
-variable 'matches' is true if the line matched the pattern. If the user
-wants lines that did not match, the sense of 'matches' is inverted using
-the '!' operator. 'fcount' is incremented with the value of 'matches',
-which is either one or zero, depending upon a successful or unsuccessful
-match. If the line does not match, the 'next' statement just moves on
-to the next record.
-
- A number of additional tests are made, but they are only done if we
-are not counting lines. First, if the user only wants the exit status
-('no_print' is true), then it is enough to know that _one_ line in this
-file matched, and we can skip on to the next file with 'nextfile'.
-Similarly, if we are only printing file names, we can print the file
-name, and then skip to the next file with 'nextfile'. Finally, each
-line is printed, with a leading file name and colon if necessary:
-
- {
- matches = ($0 ~ pattern)
- if (invert)
- matches = ! matches
-
- fcount += matches # 1 or 0
-
- if (! matches)
- next
-
- if (! count_only) {
- if (no_print)
- nextfile
-
- if (filenames_only) {
- print FILENAME
- nextfile
- }
-
- if (do_filenames)
- print FILENAME ":" $0
- else
- print
- }
- }
-
- The 'END' rule takes care of producing the correct exit status. If
-there are no matches, the exit status is one; otherwise, it is zero:
-
- END {
- exit (total == 0)
- }
-
- The 'usage()' function prints a usage message in case of invalid
-options, and then exits:
-
- function usage()
- {
- print("Usage: egrep [-csvil] [-e pat] [files ...]") > "/dev/stderr"
- print("\n\tegrep [-csvil] pat [files ...]") > "/dev/stderr"
- exit 1
- }
-
- ---------- Footnotes ----------
-
- (1) It also introduces a subtle bug; if a match happens, we output
-the translated line, not the original.
-
-
-File: gawk.info, Node: Id Program, Next: Split Program, Prev: Egrep Program, Up: Clones
-
-11.2.3 Printing Out User Information
-------------------------------------
-
-The 'id' utility lists a user's real and effective user ID numbers, real
-and effective group ID numbers, and the user's group set, if any. 'id'
-only prints the effective user ID and group ID if they are different
-from the real ones. If possible, 'id' also supplies the corresponding
-user and group names. The output might look like this:
-
- $ id
- -| uid=1000(arnold) gid=1000(arnold) groups=1000(arnold),4(adm),7(lp),27(sudo)
-
- This information is part of what is provided by 'gawk''s 'PROCINFO'
-array (*note Built-in Variables::). However, the 'id' utility provides
-a more palatable output than just individual numbers.
-
- Here is a simple version of 'id' written in 'awk'. It uses the user
-database library functions (*note Passwd Functions::) and the group
-database library functions (*note Group Functions::) from *note Library
-Functions::.
-
- The program is fairly straightforward. All the work is done in the
-'BEGIN' rule. The user and group ID numbers are obtained from
-'PROCINFO'. The code is repetitive. The entry in the user database for
-the real user ID number is split into parts at the ':'. The name is the
-first field. Similar code is used for the effective user ID number and
-the group numbers:
-
- # id.awk --- implement id in awk
- #
- # Requires user and group library functions
- # output is:
- # uid=12(foo) euid=34(bar) gid=3(baz) \
- # egid=5(blat) groups=9(nine),2(two),1(one)
-
- BEGIN {
- uid = PROCINFO["uid"]
- euid = PROCINFO["euid"]
- gid = PROCINFO["gid"]
- egid = PROCINFO["egid"]
-
- printf("uid=%d", uid)
- pw = getpwuid(uid)
- pr_first_field(pw)
-
- if (euid != uid) {
- printf(" euid=%d", euid)
- pw = getpwuid(euid)
- pr_first_field(pw)
- }
-
- printf(" gid=%d", gid)
- pw = getgrgid(gid)
- pr_first_field(pw)
-
- if (egid != gid) {
- printf(" egid=%d", egid)
- pw = getgrgid(egid)
- pr_first_field(pw)
- }
-
- for (i = 1; ("group" i) in PROCINFO; i++) {
- if (i == 1)
- printf(" groups=")
- group = PROCINFO["group" i]
- printf("%d", group)
- pw = getgrgid(group)
- pr_first_field(pw)
- if (("group" (i+1)) in PROCINFO)
- printf(",")
- }
-
- print ""
- }
-
- function pr_first_field(str, a)
- {
- if (str != "") {
- split(str, a, ":")
- printf("(%s)", a[1])
- }
- }
-
- The test in the 'for' loop is worth noting. Any supplementary groups
-in the 'PROCINFO' array have the indices '"group1"' through '"groupN"'
-for some N (i.e., the total number of supplementary groups). However,
-we don't know in advance how many of these groups there are.
-
- This loop works by starting at one, concatenating the value with
-'"group"', and then using 'in' to see if that value is in the array
-(*note Reference to Elements::). Eventually, 'i' is incremented past
-the last group in the array and the loop exits.
-
- The loop is also correct if there are _no_ supplementary groups; then
-the condition is false the first time it's tested, and the loop body
-never executes.
-
- The 'pr_first_field()' function simply isolates out some code that is
-used repeatedly, making the whole program shorter and cleaner. In
-particular, moving the check for the empty string into this function
-saves several lines of code.
-
-
-File: gawk.info, Node: Split Program, Next: Tee Program, Prev: Id Program, Up: Clones
-
-11.2.4 Splitting a Large File into Pieces
------------------------------------------
-
-The 'split' program splits large text files into smaller pieces. Usage
-is as follows:(1)
-
- 'split' ['-COUNT'] [FILE] [PREFIX]
-
- By default, the output files are named 'xaa', 'xab', and so on. Each
-file has 1,000 lines in it, with the likely exception of the last file.
-To change the number of lines in each file, supply a number on the
-command line preceded with a minus sign (e.g., '-500' for files with 500
-lines in them instead of 1,000). To change the names of the output
-files to something like 'myfileaa', 'myfileab', and so on, supply an
-additional argument that specifies the file name prefix.
-
- Here is a version of 'split' in 'awk'. It uses the 'ord()' and
-'chr()' functions presented in *note Ordinal Functions::.
-
- The program first sets its defaults, and then tests to make sure
-there are not too many arguments. It then looks at each argument in
-turn. The first argument could be a minus sign followed by a number.
-If it is, this happens to look like a negative number, so it is made
-positive, and that is the count of lines. The data file name is skipped
-over and the final argument is used as the prefix for the output file
-names:
-
- # split.awk --- do split in awk
- #
- # Requires ord() and chr() library functions
- # usage: split [-count] [file] [outname]
-
- BEGIN {
- outfile = "x" # default
- count = 1000
- if (ARGC > 4)
- usage()
-
- i = 1
- if (i in ARGV && ARGV[i] ~ /^-[[:digit:]]+$/) {
- count = -ARGV[i]
- ARGV[i] = ""
- i++
- }
- # test argv in case reading from stdin instead of file
- if (i in ARGV)
- i++ # skip datafile name
- if (i in ARGV) {
- outfile = ARGV[i]
- ARGV[i] = ""
- }
-
- s1 = s2 = "a"
- out = (outfile s1 s2)
- }
-
- The next rule does most of the work. 'tcount' (temporary count)
-tracks how many lines have been printed to the output file so far. If
-it is greater than 'count', it is time to close the current file and
-start a new one. 's1' and 's2' track the current suffixes for the file
-name. If they are both 'z', the file is just too big. Otherwise, 's1'
-moves to the next letter in the alphabet and 's2' starts over again at
-'a':
-
- {
- if (++tcount > count) {
- close(out)
- if (s2 == "z") {
- if (s1 == "z") {
- printf("split: %s is too large to split\n",
- FILENAME) > "/dev/stderr"
- exit 1
- }
- s1 = chr(ord(s1) + 1)
- s2 = "a"
- }
- else
- s2 = chr(ord(s2) + 1)
- out = (outfile s1 s2)
- tcount = 1
- }
- print > out
- }
-
-The 'usage()' function simply prints an error message and exits:
-
- function usage()
- {
- print("usage: split [-num] [file] [outname]") > "/dev/stderr"
- exit 1
- }
-
- This program is a bit sloppy; it relies on 'awk' to automatically
-close the last file instead of doing it in an 'END' rule. It also
-assumes that letters are contiguous in the character set, which isn't
-true for EBCDIC systems.
-
- ---------- Footnotes ----------
-
- (1) This is the traditional usage. The POSIX usage is different, but
-not relevant for what the program aims to demonstrate.
-
-
-File: gawk.info, Node: Tee Program, Next: Uniq Program, Prev: Split Program, Up: Clones
-
-11.2.5 Duplicating Output into Multiple Files
----------------------------------------------
-
-The 'tee' program is known as a "pipe fitting." 'tee' copies its
-standard input to its standard output and also duplicates it to the
-files named on the command line. Its usage is as follows:
-
- 'tee' ['-a'] FILE ...
-
- The '-a' option tells 'tee' to append to the named files, instead of
-truncating them and starting over.
-
- The 'BEGIN' rule first makes a copy of all the command-line arguments
-into an array named 'copy'. 'ARGV[0]' is not needed, so it is not
-copied. 'tee' cannot use 'ARGV' directly, because 'awk' attempts to
-process each file name in 'ARGV' as input data.
-
- If the first argument is '-a', then the flag variable 'append' is set
-to true, and both 'ARGV[1]' and 'copy[1]' are deleted. If 'ARGC' is
-less than two, then no file names were supplied and 'tee' prints a usage
-message and exits. Finally, 'awk' is forced to read the standard input
-by setting 'ARGV[1]' to '"-"' and 'ARGC' to two:
-
- # tee.awk --- tee in awk
- #
- # Copy standard input to all named output files.
- # Append content if -a option is supplied.
- #
- BEGIN {
- for (i = 1; i < ARGC; i++)
- copy[i] = ARGV[i]
-
- if (ARGV[1] == "-a") {
- append = 1
- delete ARGV[1]
- delete copy[1]
- ARGC--
- }
- if (ARGC < 2) {
- print "usage: tee [-a] file ..." > "/dev/stderr"
- exit 1
- }
- ARGV[1] = "-"
- ARGC = 2
- }
-
- The following single rule does all the work. Because there is no
-pattern, it is executed for each line of input. The body of the rule
-simply prints the line into each file on the command line, and then to
-the standard output:
-
- {
- # moving the if outside the loop makes it run faster
- if (append)
- for (i in copy)
- print >> copy[i]
- else
- for (i in copy)
- print > copy[i]
- print
- }
-
-It is also possible to write the loop this way:
-
- for (i in copy)
- if (append)
- print >> copy[i]
- else
- print > copy[i]
-
-This is more concise, but it is also less efficient. The 'if' is tested
-for each record and for each output file. By duplicating the loop body,
-the 'if' is only tested once for each input record. If there are N
-input records and M output files, the first method only executes N 'if'
-statements, while the second executes N'*'M 'if' statements.
-
- Finally, the 'END' rule cleans up by closing all the output files:
-
- END {
- for (i in copy)
- close(copy[i])
- }
-
-
-File: gawk.info, Node: Uniq Program, Next: Wc Program, Prev: Tee Program, Up: Clones
-
-11.2.6 Printing Nonduplicated Lines of Text
--------------------------------------------
-
-The 'uniq' utility reads sorted lines of data on its standard input, and
-by default removes duplicate lines. In other words, it only prints
-unique lines--hence the name. 'uniq' has a number of options. The
-usage is as follows:
-
- 'uniq' ['-udc' ['-N']] ['+N'] [INPUTFILE [OUTPUTFILE]]
-
- The options for 'uniq' are:
-
-'-d'
- Print only repeated (duplicated) lines.
-
-'-u'
- Print only nonrepeated (unique) lines.
-
-'-c'
- Count lines. This option overrides '-d' and '-u'. Both repeated
- and nonrepeated lines are counted.
-
-'-N'
- Skip N fields before comparing lines. The definition of fields is
- similar to 'awk''s default: nonwhitespace characters separated by
- runs of spaces and/or TABs.
-
-'+N'
- Skip N characters before comparing lines. Any fields specified
- with '-N' are skipped first.
-
-'INPUTFILE'
- Data is read from the input file named on the command line, instead
- of from the standard input.
-
-'OUTPUTFILE'
- The generated output is sent to the named output file, instead of
- to the standard output.
-
- Normally 'uniq' behaves as if both the '-d' and '-u' options are
-provided.
-
- 'uniq' uses the 'getopt()' library function (*note Getopt Function::)
-and the 'join()' library function (*note Join Function::).
-
- The program begins with a 'usage()' function and then a brief outline
-of the options and their meanings in comments. The 'BEGIN' rule deals
-with the command-line arguments and options. It uses a trick to get
-'getopt()' to handle options of the form '-25', treating such an option
-as the option letter '2' with an argument of '5'. If indeed two or more
-digits are supplied ('Optarg' looks like a number), 'Optarg' is
-concatenated with the option digit and then the result is added to zero
-to make it into a number. If there is only one digit in the option,
-then 'Optarg' is not needed. In this case, 'Optind' must be decremented
-so that 'getopt()' processes it next time. This code is admittedly a
-bit tricky.
-
- If no options are supplied, then the default is taken, to print both
-repeated and nonrepeated lines. The output file, if provided, is
-assigned to 'outputfile'. Early on, 'outputfile' is initialized to the
-standard output, '/dev/stdout':
-
- # uniq.awk --- do uniq in awk
- #
- # Requires getopt() and join() library functions
-
- function usage()
- {
- print("Usage: uniq [-udc [-n]] [+n] [ in [ out ]]") > "/dev/stderr"
- exit 1
- }
-
- # -c count lines. overrides -d and -u
- # -d only repeated lines
- # -u only nonrepeated lines
- # -n skip n fields
- # +n skip n characters, skip fields first
-
- BEGIN {
- count = 1
- outputfile = "/dev/stdout"
- opts = "udc0:1:2:3:4:5:6:7:8:9:"
- while ((c = getopt(ARGC, ARGV, opts)) != -1) {
- if (c == "u")
- non_repeated_only++
- else if (c == "d")
- repeated_only++
- else if (c == "c")
- do_count++
- else if (index("0123456789", c) != 0) {
- # getopt() requires args to options
- # this messes us up for things like -5
- if (Optarg ~ /^[[:digit:]]+$/)
- fcount = (c Optarg) + 0
- else {
- fcount = c + 0
- Optind--
- }
- } else
- usage()
- }
-
- if (ARGV[Optind] ~ /^\+[[:digit:]]+$/) {
- charcount = substr(ARGV[Optind], 2) + 0
- Optind++
- }
-
- for (i = 1; i < Optind; i++)
- ARGV[i] = ""
-
- if (repeated_only == 0 && non_repeated_only == 0)
- repeated_only = non_repeated_only = 1
-
- if (ARGC - Optind == 2) {
- outputfile = ARGV[ARGC - 1]
- ARGV[ARGC - 1] = ""
- }
- }
-
- The following function, 'are_equal()', compares the current line,
-'$0', to the previous line, 'last'. It handles skipping fields and
-characters. If no field count and no character count are specified,
-'are_equal()' returns one or zero depending upon the result of a simple
-string comparison of 'last' and '$0'.
-
- Otherwise, things get more complicated. If fields have to be
-skipped, each line is broken into an array using 'split()' (*note String
-Functions::); the desired fields are then joined back into a line using
-'join()'. The joined lines are stored in 'clast' and 'cline'. If no
-fields are skipped, 'clast' and 'cline' are set to 'last' and '$0',
-respectively. Finally, if characters are skipped, 'substr()' is used to
-strip off the leading 'charcount' characters in 'clast' and 'cline'.
-The two strings are then compared and 'are_equal()' returns the result:
-
- function are_equal( n, m, clast, cline, alast, aline)
- {
- if (fcount == 0 && charcount == 0)
- return (last == $0)
-
- if (fcount > 0) {
- n = split(last, alast)
- m = split($0, aline)
- clast = join(alast, fcount+1, n)
- cline = join(aline, fcount+1, m)
- } else {
- clast = last
- cline = $0
- }
- if (charcount) {
- clast = substr(clast, charcount + 1)
- cline = substr(cline, charcount + 1)
- }
-
- return (clast == cline)
- }
-
- The following two rules are the body of the program. The first one
-is executed only for the very first line of data. It sets 'last' equal
-to '$0', so that subsequent lines of text have something to be compared
-to.
-
- The second rule does the work. The variable 'equal' is one or zero,
-depending upon the results of 'are_equal()''s comparison. If 'uniq' is
-counting repeated lines, and the lines are equal, then it increments the
-'count' variable. Otherwise, it prints the line and resets 'count',
-because the two lines are not equal.
-
- If 'uniq' is not counting, and if the lines are equal, 'count' is
-incremented. Nothing is printed, as the point is to remove duplicates.
-Otherwise, if 'uniq' is counting repeated lines and more than one line
-is seen, or if 'uniq' is counting nonrepeated lines and only one line is
-seen, then the line is printed, and 'count' is reset.
-
- Finally, similar logic is used in the 'END' rule to print the final
-line of input data:
-
- NR == 1 {
- last = $0
- next
- }
-
- {
- equal = are_equal()
-
- if (do_count) { # overrides -d and -u
- if (equal)
- count++
- else {
- printf("%4d %s\n", count, last) > outputfile
- last = $0
- count = 1 # reset
- }
- next
- }
-
- if (equal)
- count++
- else {
- if ((repeated_only && count > 1) ||
- (non_repeated_only && count == 1))
- print last > outputfile
- last = $0
- count = 1
- }
- }
-
- END {
- if (do_count)
- printf("%4d %s\n", count, last) > outputfile
- else if ((repeated_only && count > 1) ||
- (non_repeated_only && count == 1))
- print last > outputfile
- close(outputfile)
- }
-
-
-File: gawk.info, Node: Wc Program, Prev: Uniq Program, Up: Clones
-
-11.2.7 Counting Things
-----------------------
-
-The 'wc' (word count) utility counts lines, words, and characters in one
-or more input files. Its usage is as follows:
-
- 'wc' ['-lwc'] [FILES ...]
-
- If no files are specified on the command line, 'wc' reads its
-standard input. If there are multiple files, it also prints total
-counts for all the files. The options and their meanings are as
-follows:
-
-'-l'
- Count only lines.
-
-'-w'
- Count only words. A "word" is a contiguous sequence of
- nonwhitespace characters, separated by spaces and/or TABs.
- Luckily, this is the normal way 'awk' separates fields in its input
- data.
-
-'-c'
- Count only characters.
-
- Implementing 'wc' in 'awk' is particularly elegant, because 'awk'
-does a lot of the work for us; it splits lines into words (i.e., fields)
-and counts them, it counts lines (i.e., records), and it can easily tell
-us how long a line is.
-
- This program uses the 'getopt()' library function (*note Getopt
-Function::) and the file-transition functions (*note Filetrans
-Function::).
-
- This version has one notable difference from traditional versions of
-'wc': it always prints the counts in the order lines, words, and
-characters. Traditional versions note the order of the '-l', '-w', and
-'-c' options on the command line, and print the counts in that order.
-
- The 'BEGIN' rule does the argument processing. The variable
-'print_total' is true if more than one file is named on the command
-line:
-
- # wc.awk --- count lines, words, characters
-
- # Options:
- # -l only count lines
- # -w only count words
- # -c only count characters
- #
- # Default is to count lines, words, characters
- #
- # Requires getopt() and file transition library functions
-
- BEGIN {
- # let getopt() print a message about
- # invalid options. we ignore them
- while ((c = getopt(ARGC, ARGV, "lwc")) != -1) {
- if (c == "l")
- do_lines = 1
- else if (c == "w")
- do_words = 1
- else if (c == "c")
- do_chars = 1
- }
- for (i = 1; i < Optind; i++)
- ARGV[i] = ""
-
- # if no options, do all
- if (! do_lines && ! do_words && ! do_chars)
- do_lines = do_words = do_chars = 1
-
- print_total = (ARGC - i > 1)
- }
-
- The 'beginfile()' function is simple; it just resets the counts of
-lines, words, and characters to zero, and saves the current file name in
-'fname':
-
- function beginfile(file)
- {
- lines = words = chars = 0
- fname = FILENAME
- }
-
- The 'endfile()' function adds the current file's numbers to the
-running totals of lines, words, and characters. It then prints out
-those numbers for the file that was just read. It relies on
-'beginfile()' to reset the numbers for the following data file:
-
- function endfile(file)
- {
- tlines += lines
- twords += words
- tchars += chars
- if (do_lines)
- printf "\t%d", lines
- if (do_words)
- printf "\t%d", words
- if (do_chars)
- printf "\t%d", chars
- printf "\t%s\n", fname
- }
-
- There is one rule that is executed for each line. It adds the length
-of the record, plus one, to 'chars'.(1) Adding one plus the record
-length is needed because the newline character separating records (the
-value of 'RS') is not part of the record itself, and thus not included
-in its length. Next, 'lines' is incremented for each line read, and
-'words' is incremented by the value of 'NF', which is the number of
-"words" on this line:
-
- # do per line
- {
- chars += length($0) + 1 # get newline
- lines++
- words += NF
- }
-
- Finally, the 'END' rule simply prints the totals for all the files:
-
- END {
- if (print_total) {
- if (do_lines)
- printf "\t%d", tlines
- if (do_words)
- printf "\t%d", twords
- if (do_chars)
- printf "\t%d", tchars
- print "\ttotal"
- }
- }
-
- ---------- Footnotes ----------
-
- (1) Because 'gawk' understands multibyte locales, this code counts
-characters, not bytes.
-
-
-File: gawk.info, Node: Miscellaneous Programs, Next: Programs Summary, Prev: Clones, Up: Sample Programs
-
-11.3 A Grab Bag of 'awk' Programs
-=================================
-
-This minor node is a large "grab bag" of miscellaneous programs. We
-hope you find them both interesting and enjoyable.
-
-* Menu:
-
-* Dupword Program:: Finding duplicated words in a document.
-* Alarm Program:: An alarm clock.
-* Translate Program:: A program similar to the 'tr' utility.
-* Labels Program:: Printing mailing labels.
-* Word Sorting:: A program to produce a word usage count.
-* History Sorting:: Eliminating duplicate entries from a history
- file.
-* Extract Program:: Pulling out programs from Texinfo source
- files.
-* Simple Sed:: A Simple Stream Editor.
-* Igawk Program:: A wrapper for 'awk' that includes
- files.
-* Anagram Program:: Finding anagrams from a dictionary.
-* Signature Program:: People do amazing things with too much time on
- their hands.
-
-
-File: gawk.info, Node: Dupword Program, Next: Alarm Program, Up: Miscellaneous Programs
-
-11.3.1 Finding Duplicated Words in a Document
----------------------------------------------
-
-A common error when writing large amounts of prose is to accidentally
-duplicate words. Typically you will see this in text as something like
-"the the program does the following..." When the text is online, often
-the duplicated words occur at the end of one line and the beginning of
-another, making them very difficult to spot.
-
- This program, 'dupword.awk', scans through a file one line at a time
-and looks for adjacent occurrences of the same word. It also saves the
-last word on a line (in the variable 'prev') for comparison with the
-first word on the next line.
-
- The first two statements make sure that the line is all lowercase, so
-that, for example, "The" and "the" compare equal to each other. The
-next statement replaces nonalphanumeric and nonwhitespace characters
-with spaces, so that punctuation does not affect the comparison either.
-The characters are replaced with spaces so that formatting controls
-don't create nonsense words (e.g., the Texinfo '@code{NF}' becomes
-'codeNF' if punctuation is simply deleted). The record is then resplit
-into fields, yielding just the actual words on the line, and ensuring
-that there are no empty fields.
-
- If there are no fields left after removing all the punctuation, the
-current record is skipped. Otherwise, the program loops through each
-word, comparing it to the previous one:
-
- # dupword.awk --- find duplicate words in text
- {
- $0 = tolower($0)
- gsub(/[^[:alnum:][:blank:]]/, " ");
- $0 = $0 # re-split
- if (NF == 0)
- next
- if ($1 == prev)
- printf("%s:%d: duplicate %s\n",
- FILENAME, FNR, $1)
- for (i = 2; i <= NF; i++)
- if ($i == $(i-1))
- printf("%s:%d: duplicate %s\n",
- FILENAME, FNR, $i)
- prev = $NF
- }
-
-
-File: gawk.info, Node: Alarm Program, Next: Translate Program, Prev: Dupword Program, Up: Miscellaneous Programs
-
-11.3.2 An Alarm Clock Program
------------------------------
-
- Nothing cures insomnia like a ringing alarm clock.
- -- _Arnold Robbins_
- Sleep is for web developers.
- -- _Erik Quanstrom_
-
- The following program is a simple "alarm clock" program. You give it
-a time of day and an optional message. At the specified time, it prints
-the message on the standard output. In addition, you can give it the
-number of times to repeat the message as well as a delay between
-repetitions.
-
- This program uses the 'getlocaltime()' function from *note
-Getlocaltime Function::.
-
- All the work is done in the 'BEGIN' rule. The first part is argument
-checking and setting of defaults: the delay, the count, and the message
-to print. If the user supplied a message without the ASCII BEL
-character (known as the "alert" character, '"\a"'), then it is added to
-the message. (On many systems, printing the ASCII BEL generates an
-audible alert. Thus, when the alarm goes off, the system calls
-attention to itself in case the user is not looking at the computer.)
-Just for a change, this program uses a 'switch' statement (*note Switch
-Statement::), but the processing could be done with a series of
-'if'-'else' statements instead. Here is the program:
-
- # alarm.awk --- set an alarm
- #
- # Requires getlocaltime() library function
- # usage: alarm time [ "message" [ count [ delay ] ] ]
-
- BEGIN {
- # Initial argument sanity checking
- usage1 = "usage: alarm time ['message' [count [delay]]]"
- usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1])
-
- if (ARGC < 2) {
- print usage1 > "/dev/stderr"
- print usage2 > "/dev/stderr"
- exit 1
- }
- switch (ARGC) {
- case 5:
- delay = ARGV[4] + 0
- # fall through
- case 4:
- count = ARGV[3] + 0
- # fall through
- case 3:
- message = ARGV[2]
- break
- default:
- if (ARGV[1] !~ /[[:digit:]]?[[:digit:]]:[[:digit:]]{2}/) {
- print usage1 > "/dev/stderr"
- print usage2 > "/dev/stderr"
- exit 1
- }
- break
- }
-
- # set defaults for once we reach the desired time
- if (delay == 0)
- delay = 180 # 3 minutes
- if (count == 0)
- count = 5
- if (message == "")
- message = sprintf("\aIt is now %s!\a", ARGV[1])
- else if (index(message, "\a") == 0)
- message = "\a" message "\a"
-
- The next minor node of code turns the alarm time into hours and
-minutes, converts it (if necessary) to a 24-hour clock, and then turns
-that time into a count of the seconds since midnight. Next it turns the
-current time into a count of seconds since midnight. The difference
-between the two is how long to wait before setting off the alarm:
-
- # split up alarm time
- split(ARGV[1], atime, ":")
- hour = atime[1] + 0 # force numeric
- minute = atime[2] + 0 # force numeric
-
- # get current broken down time
- getlocaltime(now)
-
- # if time given is 12-hour hours and it's after that
- # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m.,
- # then add 12 to real hour
- if (hour < 12 && now["hour"] > hour)
- hour += 12
-
- # set target time in seconds since midnight
- target = (hour * 60 * 60) + (minute * 60)
-
- # get current time in seconds since midnight
- current = (now["hour"] * 60 * 60) + \
- (now["minute"] * 60) + now["second"]
-
- # how long to sleep for
- naptime = target - current
- if (naptime <= 0) {
- print "alarm: time is in the past!" > "/dev/stderr"
- exit 1
- }
-
- Finally, the program uses the 'system()' function (*note I/O
-Functions::) to call the 'sleep' utility. The 'sleep' utility simply
-pauses for the given number of seconds. If the exit status is not zero,
-the program assumes that 'sleep' was interrupted and exits. If 'sleep'
-exited with an OK status (zero), then the program prints the message in
-a loop, again using 'sleep' to delay for however many seconds are
-necessary:
-
- # zzzzzz..... go away if interrupted
- if (system(sprintf("sleep %d", naptime)) != 0)
- exit 1
-
- # time to notify!
- command = sprintf("sleep %d", delay)
- for (i = 1; i <= count; i++) {
- print message
- # if sleep command interrupted, go away
- if (system(command) != 0)
- break
- }
-
- exit 0
- }
-
-
-File: gawk.info, Node: Translate Program, Next: Labels Program, Prev: Alarm Program, Up: Miscellaneous Programs
-
-11.3.3 Transliterating Characters
----------------------------------
-
-The system 'tr' utility transliterates characters. For example, it is
-often used to map uppercase letters into lowercase for further
-processing:
-
- GENERATE DATA | tr 'A-Z' 'a-z' | PROCESS DATA ...
-
- 'tr' requires two lists of characters.(1) When processing the input,
-the first character in the first list is replaced with the first
-character in the second list, the second character in the first list is
-replaced with the second character in the second list, and so on. If
-there are more characters in the "from" list than in the "to" list, the
-last character of the "to" list is used for the remaining characters in
-the "from" list.
-
- Once upon a time, a user proposed adding a transliteration function
-to 'gawk'. The following program was written to prove that character
-transliteration could be done with a user-level function. This program
-is not as complete as the system 'tr' utility, but it does most of the
-job.
-
- The 'translate' program was written long before 'gawk' acquired the
-ability to split each character in a string into separate array
-elements. Thus, it makes repeated use of the 'substr()', 'index()', and
-'gsub()' built-in functions (*note String Functions::). There are two
-functions. The first, 'stranslate()', takes three arguments:
-
-'from'
- A list of characters from which to translate
-
-'to'
- A list of characters to which to translate
-
-'target'
- The string on which to do the translation
-
- Associative arrays make the translation part fairly easy. 't_ar'
-holds the "to" characters, indexed by the "from" characters. Then a
-simple loop goes through 'from', one character at a time. For each
-character in 'from', if the character appears in 'target', it is
-replaced with the corresponding 'to' character.
-
- The 'translate()' function calls 'stranslate()', using '$0' as the
-target. The main program sets two global variables, 'FROM' and 'TO',
-from the command line, and then changes 'ARGV' so that 'awk' reads from
-the standard input.
-
- Finally, the processing rule simply calls 'translate()' for each
-record:
-
- # translate.awk --- do tr-like stuff
- # Bugs: does not handle things like tr A-Z a-z; it has
- # to be spelled out. However, if `to' is shorter than `from',
- # the last character in `to' is used for the rest of `from'.
-
- function stranslate(from, to, target, lf, lt, ltarget, t_ar, i, c,
- result)
- {
- lf = length(from)
- lt = length(to)
- ltarget = length(target)
- for (i = 1; i <= lt; i++)
- t_ar[substr(from, i, 1)] = substr(to, i, 1)
- if (lt < lf)
- for (; i <= lf; i++)
- t_ar[substr(from, i, 1)] = substr(to, lt, 1)
- for (i = 1; i <= ltarget; i++) {
- c = substr(target, i, 1)
- if (c in t_ar)
- c = t_ar[c]
- result = result c
- }
- return result
- }
-
- function translate(from, to)
- {
- return $0 = stranslate(from, to, $0)
- }
-
- # main program
- BEGIN {
- if (ARGC < 3) {
- print "usage: translate from to" > "/dev/stderr"
- exit
- }
- FROM = ARGV[1]
- TO = ARGV[2]
- ARGC = 2
- ARGV[1] = "-"
- }
-
- {
- translate(FROM, TO)
- print
- }
-
- It is possible to do character transliteration in a user-level
-function, but it is not necessarily efficient, and we (the 'gawk'
-developers) started to consider adding a built-in function. However,
-shortly after writing this program, we learned that Brian Kernighan had
-added the 'toupper()' and 'tolower()' functions to his 'awk' (*note
-String Functions::). These functions handle the vast majority of the
-cases where character transliteration is necessary, and so we chose to
-simply add those functions to 'gawk' as well and then leave well enough
-alone.
-
- An obvious improvement to this program would be to set up the 't_ar'
-array only once, in a 'BEGIN' rule. However, this assumes that the
-"from" and "to" lists will never change throughout the lifetime of the
-program.
-
- Another obvious improvement is to enable the use of ranges, such as
-'a-z', as allowed by the 'tr' utility. Look at the code for 'cut.awk'
-(*note Cut Program::) for inspiration.
-
- ---------- Footnotes ----------
-
- (1) On some older systems, including Solaris, the system version of
-'tr' may require that the lists be written as range expressions enclosed
-in square brackets ('[a-z]') and quoted, to prevent the shell from
-attempting a file name expansion. This is not a feature.
-
-
-File: gawk.info, Node: Labels Program, Next: Word Sorting, Prev: Translate Program, Up: Miscellaneous Programs
-
-11.3.4 Printing Mailing Labels
-------------------------------
-
-Here is a "real-world"(1) program. This script reads lists of names and
-addresses and generates mailing labels. Each page of labels has 20
-labels on it, two across and 10 down. The addresses are guaranteed to
-be no more than five lines of data. Each address is separated from the
-next by a blank line.
-
- The basic idea is to read 20 labels' worth of data. Each line of
-each label is stored in the 'line' array. The single rule takes care of
-filling the 'line' array and printing the page when 20 labels have been
-read.
-
- The 'BEGIN' rule simply sets 'RS' to the empty string, so that 'awk'
-splits records at blank lines (*note Records::). It sets 'MAXLINES' to
-100, because 100 is the maximum number of lines on the page (20 * 5 =
-100).
-
- Most of the work is done in the 'printpage()' function. The label
-lines are stored sequentially in the 'line' array. But they have to
-print horizontally: 'line[1]' next to 'line[6]', 'line[2]' next to
-'line[7]', and so on. Two loops accomplish this. The outer loop,
-controlled by 'i', steps through every 10 lines of data; this is each
-row of labels. The inner loop, controlled by 'j', goes through the
-lines within the row. As 'j' goes from 0 to 4, 'i+j' is the 'j'th line
-in the row, and 'i+j+5' is the entry next to it. The output ends up
-looking something like this:
-
- line 1 line 6
- line 2 line 7
- line 3 line 8
- line 4 line 9
- line 5 line 10
- ...
-
-The 'printf' format string '%-41s' left-aligns the data and prints it
-within a fixed-width field.
-
- As a final note, an extra blank line is printed at lines 21 and 61,
-to keep the output lined up on the labels. This is dependent on the
-particular brand of labels in use when the program was written. You
-will also note that there are two blank lines at the top and two blank
-lines at the bottom.
-
- The 'END' rule arranges to flush the final page of labels; there may
-not have been an even multiple of 20 labels in the data:
-
- # labels.awk --- print mailing labels
-
- # Each label is 5 lines of data that may have blank lines.
- # The label sheets have 2 blank lines at the top and 2 at
- # the bottom.
-
- BEGIN { RS = "" ; MAXLINES = 100 }
-
- function printpage( i, j)
- {
- if (Nlines <= 0)
- return
-
- printf "\n\n" # header
-
- for (i = 1; i <= Nlines; i += 10) {
- if (i == 21 || i == 61)
- print ""
- for (j = 0; j < 5; j++) {
- if (i + j > MAXLINES)
- break
- printf " %-41s %s\n", line[i+j], line[i+j+5]
- }
- print ""
- }
-
- printf "\n\n" # footer
-
- delete line
- }
-
- # main rule
- {
- if (Count >= 20) {
- printpage()
- Count = 0
- Nlines = 0
- }
- n = split($0, a, "\n")
- for (i = 1; i <= n; i++)
- line[++Nlines] = a[i]
- for (; i <= 5; i++)
- line[++Nlines] = ""
- Count++
- }
-
- END {
- printpage()
- }
-
- ---------- Footnotes ----------
-
- (1) "Real world" is defined as "a program actually used to get
-something done."
-
-
-File: gawk.info, Node: Word Sorting, Next: History Sorting, Prev: Labels Program, Up: Miscellaneous Programs
-
-11.3.5 Generating Word-Usage Counts
------------------------------------
-
-When working with large amounts of text, it can be interesting to know
-how often different words appear. For example, an author may overuse
-certain words, in which case he or she might wish to find synonyms to
-substitute for words that appear too often. This node develops a
-program for counting words and presenting the frequency information in a
-useful format.
-
- At first glance, a program like this would seem to do the job:
-
- # wordfreq-first-try.awk --- print list of word frequencies
-
- {
- for (i = 1; i <= NF; i++)
- freq[$i]++
- }
-
- END {
- for (word in freq)
- printf "%s\t%d\n", word, freq[word]
- }
-
- The program relies on 'awk''s default field-splitting mechanism to
-break each line up into "words" and uses an associative array named
-'freq', indexed by each word, to count the number of times the word
-occurs. In the 'END' rule, it prints the counts.
-
- This program has several problems that prevent it from being useful
-on real text files:
-
- * The 'awk' language considers upper- and lowercase characters to be
- distinct. Therefore, "bartender" and "Bartender" are not treated
- as the same word. This is undesirable, because words are
- capitalized if they begin sentences in normal text, and a frequency
- analyzer should not be sensitive to capitalization.
-
- * Words are detected using the 'awk' convention that fields are
- separated just by whitespace. Other characters in the input
- (except newlines) don't have any special meaning to 'awk'. This
- means that punctuation characters count as part of words.
-
- * The output does not come out in any useful order. You're more
- likely to be interested in which words occur most frequently or in
- having an alphabetized table of how frequently each word occurs.
-
- The first problem can be solved by using 'tolower()' to remove case
-distinctions. The second problem can be solved by using 'gsub()' to
-remove punctuation characters. Finally, we solve the third problem by
-using the system 'sort' utility to process the output of the 'awk'
-script. Here is the new version of the program:
-
- # wordfreq.awk --- print list of word frequencies
-
- {
- $0 = tolower($0) # remove case distinctions
- # remove punctuation
- gsub(/[^[:alnum:]_[:blank:]]/, "", $0)
- for (i = 1; i <= NF; i++)
- freq[$i]++
- }
-
- END {
- for (word in freq)
- printf "%s\t%d\n", word, freq[word]
- }
-
- The regexp '/[^[:alnum:]_[:blank:]]/' might have been written
-'/[[:punct:]]/', but then underscores would also be removed, and we want
-to keep them.
-
- Assuming we have saved this program in a file named 'wordfreq.awk',
-and that the data is in 'file1', the following pipeline:
-
- awk -f wordfreq.awk file1 | sort -k 2nr
-
-produces a table of the words appearing in 'file1' in order of
-decreasing frequency.
-
- The 'awk' program suitably massages the data and produces a word
-frequency table, which is not ordered. The 'awk' script's output is
-then sorted by the 'sort' utility and printed on the screen.
-
- The options given to 'sort' specify a sort that uses the second field
-of each input line (skipping one field), that the sort keys should be
-treated as numeric quantities (otherwise '15' would come before '5'),
-and that the sorting should be done in descending (reverse) order.
-
- The 'sort' could even be done from within the program, by changing
-the 'END' action to:
-
- END {
- sort = "sort -k 2nr"
- for (word in freq)
- printf "%s\t%d\n", word, freq[word] | sort
- close(sort)
- }
-
- This way of sorting must be used on systems that do not have true
-pipes at the command-line (or batch-file) level. See the general
-operating system documentation for more information on how to use the
-'sort' program.
-
-
-File: gawk.info, Node: History Sorting, Next: Extract Program, Prev: Word Sorting, Up: Miscellaneous Programs
-
-11.3.6 Removing Duplicates from Unsorted Text
----------------------------------------------
-
-The 'uniq' program (*note Uniq Program::) removes duplicate lines from
-_sorted_ data.
-
- Suppose, however, you need to remove duplicate lines from a data file
-but that you want to preserve the order the lines are in. A good
-example of this might be a shell history file. The history file keeps a
-copy of all the commands you have entered, and it is not unusual to
-repeat a command several times in a row. Occasionally you might want to
-compact the history by removing duplicate entries. Yet it is desirable
-to maintain the order of the original commands.
-
- This simple program does the job. It uses two arrays. The 'data'
-array is indexed by the text of each line. For each line, 'data[$0]' is
-incremented. If a particular line has not been seen before, then
-'data[$0]' is zero. In this case, the text of the line is stored in
-'lines[count]'. Each element of 'lines' is a unique command, and the
-indices of 'lines' indicate the order in which those lines are
-encountered. The 'END' rule simply prints out the lines, in order:
-
- # histsort.awk --- compact a shell history file
- # Thanks to Byron Rakitzis for the general idea
-
- {
- if (data[$0]++ == 0)
- lines[++count] = $0
- }
-
- END {
- for (i = 1; i <= count; i++)
- print lines[i]
- }
-
- This program also provides a foundation for generating other useful
-information. For example, using the following 'print' statement in the
-'END' rule indicates how often a particular command is used:
-
- print data[lines[i]], lines[i]
-
-This works because 'data[$0]' is incremented each time a line is seen.
-
-
-File: gawk.info, Node: Extract Program, Next: Simple Sed, Prev: History Sorting, Up: Miscellaneous Programs
-
-11.3.7 Extracting Programs from Texinfo Source Files
-----------------------------------------------------
-
-The nodes *note Library Functions::, and *note Sample Programs::, are
-the top level nodes for a large number of 'awk' programs. If you want
-to experiment with these programs, it is tedious to type them in by
-hand. Here we present a program that can extract parts of a Texinfo
-input file into separate files.
-
- This Info file is written in Texinfo
-(http://www.gnu.org/software/texinfo/), the GNU Project's document
-formatting language. A single Texinfo source file can be used to
-produce both printed documentation, with TeX, and online documentation.
-(The Texinfo language is described fully, starting with *note (Texinfo,
-texinfo,Texinfo---The GNU Documentation Format)Top::.)
-
- For our purposes, it is enough to know three things about Texinfo
-input files:
-
- * The "at" symbol ('@') is special in Texinfo, much as the backslash
- ('\') is in C or 'awk'. Literal '@' symbols are represented in
- Texinfo source files as '@@'.
-
- * Comments start with either '@c' or '@comment'. The file-extraction
- program works by using special comments that start at the beginning
- of a line.
-
- * Lines containing '@group' and '@end group' commands bracket example
- text that should not be split across a page boundary.
- (Unfortunately, TeX isn't always smart enough to do things exactly
- right, so we have to give it some help.)
-
- The following program, 'extract.awk', reads through a Texinfo source
-file and does two things, based on the special comments. Upon seeing
-'@c system ...', it runs a command, by extracting the command text from
-the control line and passing it on to the 'system()' function (*note I/O
-Functions::). Upon seeing '@c file FILENAME', each subsequent line is
-sent to the file FILENAME, until '@c endfile' is encountered. The rules
-in 'extract.awk' match either '@c' or '@comment' by letting the 'omment'
-part be optional. Lines containing '@group' and '@end group' are simply
-removed. 'extract.awk' uses the 'join()' library function (*note Join
-Function::).
-
- The example programs in the online Texinfo source for 'GAWK:
-Effective AWK Programming' ('gawktexi.in') have all been bracketed
-inside 'file' and 'endfile' lines. The 'gawk' distribution uses a copy
-of 'extract.awk' to extract the sample programs and install many of them
-in a standard directory where 'gawk' can find them. The Texinfo file
-looks something like this:
-
- ...
- This program has a @code{BEGIN} rule
- that prints a nice message:
-
- @example
- @c file examples/messages.awk
- BEGIN @{ print "Don't panic!" @}
- @c endfile
- @end example
-
- It also prints some final advice:
-
- @example
- @c file examples/messages.awk
- END @{ print "Always avoid bored archaeologists!" @}
- @c endfile
- @end example
- ...
-
- 'extract.awk' begins by setting 'IGNORECASE' to one, so that mixed
-upper- and lowercase letters in the directives won't matter.
-
- The first rule handles calling 'system()', checking that a command is
-given ('NF' is at least three) and also checking that the command exits
-with a zero exit status, signifying OK:
-
- # extract.awk --- extract files and run programs from Texinfo files
-
- BEGIN { IGNORECASE = 1 }
-
- /^@c(omment)?[ \t]+system/ {
- if (NF < 3) {
- e = ("extract: " FILENAME ":" FNR)
- e = (e ": badly formed `system' line")
- print e > "/dev/stderr"
- next
- }
- $1 = ""
- $2 = ""
- stat = system($0)
- if (stat != 0) {
- e = ("extract: " FILENAME ":" FNR)
- e = (e ": warning: system returned " stat)
- print e > "/dev/stderr"
- }
- }
-
-The variable 'e' is used so that the rule fits nicely on the screen.
-
- The second rule handles moving data into files. It verifies that a
-file name is given in the directive. If the file named is not the
-current file, then the current file is closed. Keeping the current file
-open until a new file is encountered allows the use of the '>'
-redirection for printing the contents, keeping open-file management
-simple.
-
- The 'for' loop does the work. It reads lines using 'getline' (*note
-Getline::). For an unexpected end-of-file, it calls the
-'unexpected_eof()' function. If the line is an "endfile" line, then it
-breaks out of the loop. If the line is an '@group' or '@end group'
-line, then it ignores it and goes on to the next line. Similarly,
-comments within examples are also ignored.
-
- Most of the work is in the following few lines. If the line has no
-'@' symbols, the program can print it directly. Otherwise, each leading
-'@' must be stripped off. To remove the '@' symbols, the line is split
-into separate elements of the array 'a', using the 'split()' function
-(*note String Functions::). The '@' symbol is used as the separator
-character. Each element of 'a' that is empty indicates two successive
-'@' symbols in the original line. For each two empty elements ('@@' in
-the original file), we have to add a single '@' symbol back in.
-
- When the processing of the array is finished, 'join()' is called with
-the value of 'SUBSEP' (*note Multidimensional::), to rejoin the pieces
-back into a single line. That line is then printed to the output file:
-
- /^@c(omment)?[ \t]+file/ {
- if (NF != 3) {
- e = ("extract: " FILENAME ":" FNR ": badly formed `file' line")
- print e > "/dev/stderr"
- next
- }
- if ($3 != curfile) {
- if (curfile != "")
- close(curfile)
- curfile = $3
- }
-
- for (;;) {
- if ((getline line) <= 0)
- unexpected_eof()
- if (line ~ /^@c(omment)?[ \t]+endfile/)
- break
- else if (line ~ /^@(end[ \t]+)?group/)
- continue
- else if (line ~ /^@c(omment+)?[ \t]+/)
- continue
- if (index(line, "@") == 0) {
- print line > curfile
- continue
- }
- n = split(line, a, "@")
- # if a[1] == "", means leading @,
- # don't add one back in.
- for (i = 2; i <= n; i++) {
- if (a[i] == "") { # was an @@
- a[i] = "@"
- if (a[i+1] == "")
- i++
- }
- }
- print join(a, 1, n, SUBSEP) > curfile
- }
- }
-
- An important thing to note is the use of the '>' redirection. Output
-done with '>' only opens the file once; it stays open and subsequent
-output is appended to the file (*note Redirection::). This makes it
-easy to mix program text and explanatory prose for the same sample
-source file (as has been done here!) without any hassle. The file is
-only closed when a new data file name is encountered or at the end of
-the input file.
-
- Finally, the function 'unexpected_eof()' prints an appropriate error
-message and then exits. The 'END' rule handles the final cleanup,
-closing the open file:
-
- function unexpected_eof()
- {
- printf("extract: %s:%d: unexpected EOF or error\n",
- FILENAME, FNR) > "/dev/stderr"
- exit 1
- }
-
- END {
- if (curfile)
- close(curfile)
- }
-
-
-File: gawk.info, Node: Simple Sed, Next: Igawk Program, Prev: Extract Program, Up: Miscellaneous Programs
-
-11.3.8 A Simple Stream Editor
------------------------------
-
-The 'sed' utility is a "stream editor", a program that reads a stream of
-data, makes changes to it, and passes it on. It is often used to make
-global changes to a large file or to a stream of data generated by a
-pipeline of commands. Although 'sed' is a complicated program in its
-own right, its most common use is to perform global substitutions in the
-middle of a pipeline:
-
- COMMAND1 < orig.data | sed 's/old/new/g' | COMMAND2 > result
-
- Here, 's/old/new/g' tells 'sed' to look for the regexp 'old' on each
-input line and globally replace it with the text 'new' (i.e., all the
-occurrences on a line). This is similar to 'awk''s 'gsub()' function
-(*note String Functions::).
-
- The following program, 'awksed.awk', accepts at least two
-command-line arguments: the pattern to look for and the text to replace
-it with. Any additional arguments are treated as data file names to
-process. If none are provided, the standard input is used:
-
- # awksed.awk --- do s/foo/bar/g using just print
- # Thanks to Michael Brennan for the idea
-
- function usage()
- {
- print "usage: awksed pat repl [files...]" > "/dev/stderr"
- exit 1
- }
-
- BEGIN {
- # validate arguments
- if (ARGC < 3)
- usage()
-
- RS = ARGV[1]
- ORS = ARGV[2]
-
- # don't use arguments as files
- ARGV[1] = ARGV[2] = ""
- }
-
- # look ma, no hands!
- {
- if (RT == "")
- printf "%s", $0
- else
- print
- }
-
- The program relies on 'gawk''s ability to have 'RS' be a regexp, as
-well as on the setting of 'RT' to the actual text that terminates the
-record (*note Records::).
-
- The idea is to have 'RS' be the pattern to look for. 'gawk'
-automatically sets '$0' to the text between matches of the pattern.
-This is text that we want to keep, unmodified. Then, by setting 'ORS'
-to the replacement text, a simple 'print' statement outputs the text we
-want to keep, followed by the replacement text.
-
- There is one wrinkle to this scheme, which is what to do if the last
-record doesn't end with text that matches 'RS'. Using a 'print'
-statement unconditionally prints the replacement text, which is not
-correct. However, if the file did not end in text that matches 'RS',
-'RT' is set to the null string. In this case, we can print '$0' using
-'printf' (*note Printf::).
-
- The 'BEGIN' rule handles the setup, checking for the right number of
-arguments and calling 'usage()' if there is a problem. Then it sets
-'RS' and 'ORS' from the command-line arguments and sets 'ARGV[1]' and
-'ARGV[2]' to the null string, so that they are not treated as file names
-(*note ARGC and ARGV::).
-
- The 'usage()' function prints an error message and exits. Finally,
-the single rule handles the printing scheme outlined earlier, using
-'print' or 'printf' as appropriate, depending upon the value of 'RT'.
-
-
-File: gawk.info, Node: Igawk Program, Next: Anagram Program, Prev: Simple Sed, Up: Miscellaneous Programs
-
-11.3.9 An Easy Way to Use Library Functions
--------------------------------------------
-
-In *note Include Files::, we saw how 'gawk' provides a built-in
-file-inclusion capability. However, this is a 'gawk' extension. This
-minor node provides the motivation for making file inclusion available
-for standard 'awk', and shows how to do it using a combination of shell
-and 'awk' programming.
-
- Using library functions in 'awk' can be very beneficial. It
-encourages code reuse and the writing of general functions. Programs
-are smaller and therefore clearer. However, using library functions is
-only easy when writing 'awk' programs; it is painful when running them,
-requiring multiple '-f' options. If 'gawk' is unavailable, then so too
-is the 'AWKPATH' environment variable and the ability to put 'awk'
-functions into a library directory (*note Options::). It would be nice
-to be able to write programs in the following manner:
-
- # library functions
- @include getopt.awk
- @include join.awk
- ...
-
- # main program
- BEGIN {
- while ((c = getopt(ARGC, ARGV, "a:b:cde")) != -1)
- ...
- ...
- }
-
- The following program, 'igawk.sh', provides this service. It
-simulates 'gawk''s searching of the 'AWKPATH' variable and also allows
-"nested" includes (i.e., a file that is included with '@include' can
-contain further '@include' statements). 'igawk' makes an effort to only
-include files once, so that nested includes don't accidentally include a
-library function twice.
-
- 'igawk' should behave just like 'gawk' externally. This means it
-should accept all of 'gawk''s command-line arguments, including the
-ability to have multiple source files specified via '-f' and the ability
-to mix command-line and library source files.
-
- The program is written using the POSIX Shell ('sh') command
-language.(1) It works as follows:
-
- 1. Loop through the arguments, saving anything that doesn't represent
- 'awk' source code for later, when the expanded program is run.
-
- 2. For any arguments that do represent 'awk' text, put the arguments
- into a shell variable that will be expanded. There are two cases:
-
- a. Literal text, provided with '-e' or '--source'. This text is
- just appended directly.
-
- b. Source file names, provided with '-f'. We use a neat trick
- and append '@include FILENAME' to the shell variable's
- contents. Because the file-inclusion program works the way
- 'gawk' does, this gets the text of the file included in the
- program at the correct point.
-
- 3. Run an 'awk' program (naturally) over the shell variable's contents
- to expand '@include' statements. The expanded program is placed in
- a second shell variable.
-
- 4. Run the expanded program with 'gawk' and any other original
- command-line arguments that the user supplied (such as the data
- file names).
-
- This program uses shell variables extensively: for storing
-command-line arguments and the text of the 'awk' program that will
-expand the user's program, for the user's original program, and for the
-expanded program. Doing so removes some potential problems that might
-arise were we to use temporary files instead, at the cost of making the
-script somewhat more complicated.
-
- The initial part of the program turns on shell tracing if the first
-argument is 'debug'.
-
- The next part loops through all the command-line arguments. There
-are several cases of interest:
-
-'--'
- This ends the arguments to 'igawk'. Anything else should be passed
- on to the user's 'awk' program without being evaluated.
-
-'-W'
- This indicates that the next option is specific to 'gawk'. To make
- argument processing easier, the '-W' is appended to the front of
- the remaining arguments and the loop continues. (This is an 'sh'
- programming trick. Don't worry about it if you are not familiar
- with 'sh'.)
-
-'-v', '-F'
- These are saved and passed on to 'gawk'.
-
-'-f', '--file', '--file=', '-Wfile='
- The file name is appended to the shell variable 'program' with an
- '@include' statement. The 'expr' utility is used to remove the
- leading option part of the argument (e.g., '--file='). (Typical
- 'sh' usage would be to use the 'echo' and 'sed' utilities to do
- this work. Unfortunately, some versions of 'echo' evaluate escape
- sequences in their arguments, possibly mangling the program text.
- Using 'expr' avoids this problem.)
-
-'--source', '--source=', '-Wsource='
- The source text is appended to 'program'.
-
-'--version', '-Wversion'
- 'igawk' prints its version number, runs 'gawk --version' to get the
- 'gawk' version information, and then exits.
-
- If none of the '-f', '--file', '-Wfile', '--source', or '-Wsource'
-arguments are supplied, then the first nonoption argument should be the
-'awk' program. If there are no command-line arguments left, 'igawk'
-prints an error message and exits. Otherwise, the first argument is
-appended to 'program'. In any case, after the arguments have been
-processed, the shell variable 'program' contains the complete text of
-the original 'awk' program.
-
- The program is as follows:
-
- #! /bin/sh
- # igawk --- like gawk but do @include processing
-
- if [ "$1" = debug ]
- then
- set -x
- shift
- fi
-
- # A literal newline, so that program text is formatted correctly
- n='
- '
-
- # Initialize variables to empty
- program=
- opts=
-
- while [ $# -ne 0 ] # loop over arguments
- do
- case $1 in
- --) shift
- break ;;
-
- -W) shift
- # The ${x?'message here'} construct prints a
- # diagnostic if $x is the null string
- set -- -W"${@?'missing operand'}"
- continue ;;
-
- -[vF]) opts="$opts $1 '${2?'missing operand'}'"
- shift ;;
-
- -[vF]*) opts="$opts '$1'" ;;
-
- -f) program="$program$n@include ${2?'missing operand'}"
- shift ;;
-
- -f*) f=$(expr "$1" : '-f\(.*\)')
- program="$program$n@include $f" ;;
-
- -[W-]file=*)
- f=$(expr "$1" : '-.file=\(.*\)')
- program="$program$n@include $f" ;;
-
- -[W-]file)
- program="$program$n@include ${2?'missing operand'}"
- shift ;;
-
- -[W-]source=*)
- t=$(expr "$1" : '-.source=\(.*\)')
- program="$program$n$t" ;;
-
- -[W-]source)
- program="$program$n${2?'missing operand'}"
- shift ;;
-
- -[W-]version)
- echo igawk: version 3.0 1>&2
- gawk --version
- exit 0 ;;
-
- -[W-]*) opts="$opts '$1'" ;;
-
- *) break ;;
- esac
- shift
- done
-
- if [ -z "$program" ]
- then
- program=${1?'missing program'}
- shift
- fi
-
- # At this point, `program' has the program.
-
- The 'awk' program to process '@include' directives is stored in the
-shell variable 'expand_prog'. Doing this keeps the shell script
-readable. The 'awk' program reads through the user's program, one line
-at a time, using 'getline' (*note Getline::). The input file names and
-'@include' statements are managed using a stack. As each '@include' is
-encountered, the current file name is "pushed" onto the stack and the
-file named in the '@include' directive becomes the current file name.
-As each file is finished, the stack is "popped," and the previous input
-file becomes the current input file again. The process is started by
-making the original file the first one on the stack.
-
- The 'pathto()' function does the work of finding the full path to a
-file. It simulates 'gawk''s behavior when searching the 'AWKPATH'
-environment variable (*note AWKPATH Variable::). If a file name has a
-'/' in it, no path search is done. Similarly, if the file name is
-'"-"', then that string is used as-is. Otherwise, the file name is
-concatenated with the name of each directory in the path, and an attempt
-is made to open the generated file name. The only way to test if a file
-can be read in 'awk' is to go ahead and try to read it with 'getline';
-this is what 'pathto()' does.(2) If the file can be read, it is closed
-and the file name is returned:
-
- expand_prog='
-
- function pathto(file, i, t, junk)
- {
- if (index(file, "/") != 0)
- return file
-
- if (file == "-")
- return file
-
- for (i = 1; i <= ndirs; i++) {
- t = (pathlist[i] "/" file)
- if ((getline junk < t) > 0) {
- # found it
- close(t)
- return t
- }
- }
- return ""
- }
-
- The main program is contained inside one 'BEGIN' rule. The first
-thing it does is set up the 'pathlist' array that 'pathto()' uses.
-After splitting the path on ':', null elements are replaced with '"."',
-which represents the current directory:
-
- BEGIN {
- path = ENVIRON["AWKPATH"]
- ndirs = split(path, pathlist, ":")
- for (i = 1; i <= ndirs; i++) {
- if (pathlist[i] == "")
- pathlist[i] = "."
- }
-
- The stack is initialized with 'ARGV[1]', which will be
-'"/dev/stdin"'. The main loop comes next. Input lines are read in
-succession. Lines that do not start with '@include' are printed
-verbatim. If the line does start with '@include', the file name is in
-'$2'. 'pathto()' is called to generate the full path. If it cannot,
-then the program prints an error message and continues.
-
- The next thing to check is if the file is included already. The
-'processed' array is indexed by the full file name of each included file
-and it tracks this information for us. If the file is seen again, a
-warning message is printed. Otherwise, the new file name is pushed onto
-the stack and processing continues.
-
- Finally, when 'getline' encounters the end of the input file, the
-file is closed and the stack is popped. When 'stackptr' is less than
-zero, the program is done:
-
- stackptr = 0
- input[stackptr] = ARGV[1] # ARGV[1] is first file
-
- for (; stackptr >= 0; stackptr--) {
- while ((getline < input[stackptr]) > 0) {
- if (tolower($1) != "@include") {
- print
- continue
- }
- fpath = pathto($2)
- if (fpath == "") {
- printf("igawk: %s:%d: cannot find %s\n",
- input[stackptr], FNR, $2) > "/dev/stderr"
- continue
- }
- if (! (fpath in processed)) {
- processed[fpath] = input[stackptr]
- input[++stackptr] = fpath # push onto stack
- } else
- print $2, "included in", input[stackptr],
- "already included in",
- processed[fpath] > "/dev/stderr"
- }
- close(input[stackptr])
- }
- }' # close quote ends `expand_prog' variable
-
- processed_program=$(gawk -- "$expand_prog" /dev/stdin << EOF
- $program
- EOF
- )
-
- The shell construct 'COMMAND << MARKER' is called a "here document".
-Everything in the shell script up to the MARKER is fed to COMMAND as
-input. The shell processes the contents of the here document for
-variable and command substitution (and possibly other things as well,
-depending upon the shell).
-
- The shell construct '$(...)' is called "command substitution". The
-output of the command inside the parentheses is substituted into the
-command line. Because the result is used in a variable assignment, it
-is saved as a single string, even if the results contain whitespace.
-
- The expanded program is saved in the variable 'processed_program'.
-It's done in these steps:
-
- 1. Run 'gawk' with the '@include'-processing program (the value of the
- 'expand_prog' shell variable) reading standard input.
-
- 2. Standard input is the contents of the user's program, from the
- shell variable 'program'. Feed its contents to 'gawk' via a here
- document.
-
- 3. Save the results of this processing in the shell variable
- 'processed_program' by using command substitution.
-
- The last step is to call 'gawk' with the expanded program, along with
-the original options and command-line arguments that the user supplied:
-
- eval gawk $opts -- '"$processed_program"' '"$@"'
-
- The 'eval' command is a shell construct that reruns the shell's
-parsing process. This keeps things properly quoted.
-
- This version of 'igawk' represents the fifth version of this program.
-There are four key simplifications that make the program work better:
-
- * Using '@include' even for the files named with '-f' makes building
- the initial collected 'awk' program much simpler; all the
- '@include' processing can be done once.
-
- * Not trying to save the line read with 'getline' in the 'pathto()'
- function when testing for the file's accessibility for use with the
- main program simplifies things considerably.
-
- * Using a 'getline' loop in the 'BEGIN' rule does it all in one
- place. It is not necessary to call out to a separate loop for
- processing nested '@include' statements.
-
- * Instead of saving the expanded program in a temporary file, putting
- it in a shell variable avoids some potential security problems.
- This has the disadvantage that the script relies upon more features
- of the 'sh' language, making it harder to follow for those who
- aren't familiar with 'sh'.
-
- Also, this program illustrates that it is often worthwhile to combine
-'sh' and 'awk' programming together. You can usually accomplish quite a
-lot, without having to resort to low-level programming in C or C++, and
-it is frequently easier to do certain kinds of string and argument
-manipulation using the shell than it is in 'awk'.
-
- Finally, 'igawk' shows that it is not always necessary to add new
-features to a program; they can often be layered on top.(3)
-
- ---------- Footnotes ----------
-
- (1) Fully explaining the 'sh' language is beyond the scope of this
-book. We provide some minimal explanations, but see a good shell
-programming book if you wish to understand things in more depth.
-
- (2) On some very old versions of 'awk', the test 'getline junk < t'
-can loop forever if the file exists but is empty.
-
- (3) 'gawk' does '@include' processing itself in order to support the
-use of 'awk' programs as Web CGI scripts.
-
-
-File: gawk.info, Node: Anagram Program, Next: Signature Program, Prev: Igawk Program, Up: Miscellaneous Programs
-
-11.3.10 Finding Anagrams from a Dictionary
-------------------------------------------
-
-An interesting programming challenge is to search for "anagrams" in a
-word list (such as '/usr/share/dict/words' on many GNU/Linux systems).
-One word is an anagram of another if both words contain the same letters
-(e.g., "babbling" and "blabbing").
-
- Column 2, Problem C, of Jon Bentley's 'Programming Pearls', Second
-Edition, presents an elegant algorithm. The idea is to give words that
-are anagrams a common signature, sort all the words together by their
-signatures, and then print them. Dr. Bentley observes that taking the
-letters in each word and sorting them produces those common signatures.
-
- The following program uses arrays of arrays to bring together words
-with the same signature and array sorting to print the words in sorted
-order:
-
- # anagram.awk --- An implementation of the anagram-finding algorithm
- # from Jon Bentley's "Programming Pearls," 2nd edition.
- # Addison Wesley, 2000, ISBN 0-201-65788-0.
- # Column 2, Problem C, section 2.8, pp 18-20.
-
- /'s$/ { next } # Skip possessives
-
- The program starts with a header, and then a rule to skip possessives
-in the dictionary file. The next rule builds up the data structure.
-The first dimension of the array is indexed by the signature; the second
-dimension is the word itself:
-
- {
- key = word2key($1) # Build signature
- data[key][$1] = $1 # Store word with signature
- }
-
- The 'word2key()' function creates the signature. It splits the word
-apart into individual letters, sorts the letters, and then joins them
-back together:
-
- # word2key --- split word apart into letters, sort, and join back together
-
- function word2key(word, a, i, n, result)
- {
- n = split(word, a, "")
- asort(a)
-
- for (i = 1; i <= n; i++)
- result = result a[i]
-
- return result
- }
-
- Finally, the 'END' rule traverses the array and prints out the
-anagram lists. It sends the output to the system 'sort' command because
-otherwise the anagrams would appear in arbitrary order:
-
- END {
- sort = "sort"
- for (key in data) {
- # Sort words with same key
- nwords = asorti(data[key], words)
- if (nwords == 1)
- continue
-
- # And print. Minor glitch: trailing space at end of each line
- for (j = 1; j <= nwords; j++)
- printf("%s ", words[j]) | sort
- print "" | sort
- }
- close(sort)
- }
-
- Here is some partial output when the program is run:
-
- $ gawk -f anagram.awk /usr/share/dict/words | grep '^b'
- ...
- babbled blabbed
- babbler blabber brabble
- babblers blabbers brabbles
- babbling blabbing
- babbly blabby
- babel bable
- babels beslab
- babery yabber
- ...
-
-
-File: gawk.info, Node: Signature Program, Prev: Anagram Program, Up: Miscellaneous Programs
-
-11.3.11 And Now for Something Completely Different
---------------------------------------------------
-
-The following program was written by Davide Brini and is published on
-his website (http://backreference.org/2011/02/03/obfuscated-awk/). It
-serves as his signature in the Usenet group 'comp.lang.awk'. He
-supplies the following copyright terms:
-
- Copyright (C) 2008 Davide Brini
-
- Copying and distribution of the code published in this page, with
- or without modification, are permitted in any medium without
- royalty provided the copyright notice and this notice are
- preserved.
-
- Here is the program:
-
- awk 'BEGIN{O="~"~"~";o="=="=="==";o+=+o;x=O""O;while(X++<=x+o+o)c=c"%c";
- printf c,(x-O)*(x-O),x*(x-o)-o,x*(x-O)+x-O-o,+x*(x-O)-x+o,X*(o*o+O)+x-O,
- X*(X-x)-o*o,(x+X)*o*o+o,x*(X-x)-O-O,x-O+(O+o+X+x)*(o+O),X*X-X*(x-O)-x+O,
- O+X*(o*(o+O)+O),+x+O+X*o,x*(x-o),(o+X+x)*o*o-(x-O-O),O+(X-x)*(X+O),x-O}'
-
- We leave it to you to determine what the program does. (If you are
-truly desperate to understand it, see Chris Johansen's explanation,
-which is embedded in the Texinfo source file for this Info file.)
-
-
-File: gawk.info, Node: Programs Summary, Next: Programs Exercises, Prev: Miscellaneous Programs, Up: Sample Programs
-
-11.4 Summary
-============
-
- * The programs provided in this major node continue on the theme that
- reading programs is an excellent way to learn Good Programming.
-
- * Using '#!' to make 'awk' programs directly runnable makes them
- easier to use. Otherwise, invoke the program using 'awk -f ...'.
-
- * Reimplementing standard POSIX programs in 'awk' is a pleasant
- exercise; 'awk''s expressive power lets you write such programs in
- relatively few lines of code, yet they are functionally complete
- and usable.
-
- * One of standard 'awk''s weaknesses is working with individual
- characters. The ability to use 'split()' with the empty string as
- the separator can considerably simplify such tasks.
-
- * The examples here demonstrate the usefulness of the library
- functions from *note Library Functions:: for a number of real (if
- small) programs.
-
- * Besides reinventing POSIX wheels, other programs solved a selection
- of interesting problems, such as finding duplicate words in text,
- printing mailing labels, and finding anagrams.
-
-
-File: gawk.info, Node: Programs Exercises, Prev: Programs Summary, Up: Sample Programs
-
-11.5 Exercises
-==============
-
- 1. Rewrite 'cut.awk' (*note Cut Program::) using 'split()' with '""'
- as the separator.
-
- 2. In *note Egrep Program::, we mentioned that 'egrep -i' could be
- simulated in versions of 'awk' without 'IGNORECASE' by using
- 'tolower()' on the line and the pattern. In a footnote there, we
- also mentioned that this solution has a bug: the translated line is
- output, and not the original one. Fix this problem.
-
- 3. The POSIX version of 'id' takes options that control which
- information is printed. Modify the 'awk' version (*note Id
- Program::) to accept the same arguments and perform in the same
- way.
-
- 4. The 'split.awk' program (*note Split Program::) assumes that
- letters are contiguous in the character set, which isn't true for
- EBCDIC systems. Fix this problem. (Hint: Consider a different way
- to work through the alphabet, without relying on 'ord()' and
- 'chr()'.)
-
- 5. In 'uniq.awk' (*note Uniq Program::, the logic for choosing which
- lines to print represents a "state machine", which is "a device
- that can be in one of a set number of stable conditions depending
- on its previous condition and on the present values of its
- inputs."(1) Brian Kernighan suggests that "an alternative approach
- to state machines is to just read the input into an array, then use
- indexing. It's almost always easier code, and for most inputs
- where you would use this, just as fast." Rewrite the logic to
- follow this suggestion.
-
- 6. Why can't the 'wc.awk' program (*note Wc Program::) just use the
- value of 'FNR' in 'endfile()'? Hint: Examine the code in *note
- Filetrans Function::.
-
- 7. Manipulation of individual characters in the 'translate' program
- (*note Translate Program::) is painful using standard 'awk'
- functions. Given that 'gawk' can split strings into individual
- characters using '""' as the separator, how might you use this
- feature to simplify the program?
-
- 8. The 'extract.awk' program (*note Extract Program::) was written
- before 'gawk' had the 'gensub()' function. Use it to simplify the
- code.
-
- 9. Compare the performance of the 'awksed.awk' program (*note Simple
- Sed::) with the more straightforward:
-
- BEGIN {
- pat = ARGV[1]
- repl = ARGV[2]
- ARGV[1] = ARGV[2] = ""
- }
-
- { gsub(pat, repl); print }
-
- 10. What are the advantages and disadvantages of 'awksed.awk' versus
- the real 'sed' utility?
-
- 11. In *note Igawk Program::, we mentioned that not trying to save the
- line read with 'getline' in the 'pathto()' function when testing
- for the file's accessibility for use with the main program
- simplifies things considerably. What problem does this engender
- though?
-
- 12. As an additional example of the idea that it is not always
- necessary to add new features to a program, consider the idea of
- having two files in a directory in the search path:
-
- 'default.awk'
- This file contains a set of default library functions, such as
- 'getopt()' and 'assert()'.
-
- 'site.awk'
- This file contains library functions that are specific to a
- site or installation; i.e., locally developed functions.
- Having a separate file allows 'default.awk' to change with new
- 'gawk' releases, without requiring the system administrator to
- update it each time by adding the local functions.
-
- One user suggested that 'gawk' be modified to automatically read
- these files upon startup. Instead, it would be very simple to
- modify 'igawk' to do this. Since 'igawk' can process nested
- '@include' directives, 'default.awk' could simply contain
- '@include' statements for the desired library functions. Make this
- change.
-
- 13. Modify 'anagram.awk' (*note Anagram Program::), to avoid the use
- of the external 'sort' utility.
-
- ---------- Footnotes ----------
-
- (1) This is the definition returned from entering 'define: state
-machine' into Google.
-
-
-File: gawk.info, Node: Advanced Features, Next: Internationalization, Prev: Sample Programs, Up: Top
-
-12 Advanced Features of 'gawk'
-******************************
-
- Write documentation as if whoever reads it is a violent psychopath
- who knows where you live.
- -- _Steve English, as quoted by Peter Langston_
-
- This major node discusses advanced features in 'gawk'. It's a bit of
-a "grab bag" of items that are otherwise unrelated to each other.
-First, we look at a command-line option that allows 'gawk' to recognize
-nondecimal numbers in input data, not just in 'awk' programs. Then,
-'gawk''s special features for sorting arrays are presented. Next,
-two-way I/O, discussed briefly in earlier parts of this Info file, is
-described in full detail, along with the basics of TCP/IP networking.
-Finally, we see how 'gawk' can "profile" an 'awk' program, making it
-possible to tune it for performance.
-
- Additional advanced features are discussed in separate major nodes of
-their own:
-
- * *note Internationalization::, discusses how to internationalize
- your 'awk' programs, so that they can speak multiple national
- languages.
-
- * *note Debugger::, describes 'gawk''s built-in command-line debugger
- for debugging 'awk' programs.
-
- * *note Arbitrary Precision Arithmetic::, describes how you can use
- 'gawk' to perform arbitrary-precision arithmetic.
-
- * *note Dynamic Extensions::, discusses the ability to dynamically
- add new built-in functions to 'gawk'.
-
-* Menu:
-
-* Nondecimal Data:: Allowing nondecimal input data.
-* Array Sorting:: Facilities for controlling array traversal and
- sorting arrays.
-* Two-way I/O:: Two-way communications with another process.
-* TCP/IP Networking:: Using 'gawk' for network programming.
-* Profiling:: Profiling your 'awk' programs.
-* Advanced Features Summary:: Summary of advanced features.
-
-
-File: gawk.info, Node: Nondecimal Data, Next: Array Sorting, Up: Advanced Features
-
-12.1 Allowing Nondecimal Input Data
-===================================
-
-If you run 'gawk' with the '--non-decimal-data' option, you can have
-nondecimal values in your input data:
-
- $ echo 0123 123 0x123 |
- > gawk --non-decimal-data '{ printf "%d, %d, %d\n", $1, $2, $3 }'
- -| 83, 123, 291
-
- For this feature to work, write your program so that 'gawk' treats
-your data as numeric:
-
- $ echo 0123 123 0x123 | gawk '{ print $1, $2, $3 }'
- -| 0123 123 0x123
-
-The 'print' statement treats its expressions as strings. Although the
-fields can act as numbers when necessary, they are still strings, so
-'print' does not try to treat them numerically. You need to add zero to
-a field to force it to be treated as a number. For example:
-
- $ echo 0123 123 0x123 | gawk --non-decimal-data '
- > { print $1, $2, $3
- > print $1 + 0, $2 + 0, $3 + 0 }'
- -| 0123 123 0x123
- -| 83 123 291
-
- Because it is common to have decimal data with leading zeros, and
-because using this facility could lead to surprising results, the
-default is to leave it disabled. If you want it, you must explicitly
-request it.
-
- CAUTION: _Use of this option is not recommended._ It can break old
- programs very badly. Instead, use the 'strtonum()' function to
- convert your data (*note String Functions::). This makes your
- programs easier to write and easier to read, and leads to less
- surprising results.
-
- This option may disappear in a future version of 'gawk'.
-
-
-File: gawk.info, Node: Array Sorting, Next: Two-way I/O, Prev: Nondecimal Data, Up: Advanced Features
-
-12.2 Controlling Array Traversal and Array Sorting
-==================================================
-
-'gawk' lets you control the order in which a 'for (INDX in ARRAY)' loop
-traverses an array.
-
- In addition, two built-in functions, 'asort()' and 'asorti()', let
-you sort arrays based on the array values and indices, respectively.
-These two functions also provide control over the sorting criteria used
-to order the elements during sorting.
-
-* Menu:
-
-* Controlling Array Traversal:: How to use PROCINFO["sorted_in"].
-* Array Sorting Functions:: How to use 'asort()' and 'asorti()'.
-
-
-File: gawk.info, Node: Controlling Array Traversal, Next: Array Sorting Functions, Up: Array Sorting
-
-12.2.1 Controlling Array Traversal
-----------------------------------
-
-By default, the order in which a 'for (INDX in ARRAY)' loop scans an
-array is not defined; it is generally based upon the internal
-implementation of arrays inside 'awk'.
-
- Often, though, it is desirable to be able to loop over the elements
-in a particular order that you, the programmer, choose. 'gawk' lets you
-do this.
-
- *note Controlling Scanning:: describes how you can assign special,
-predefined values to 'PROCINFO["sorted_in"]' in order to control the
-order in which 'gawk' traverses an array during a 'for' loop.
-
- In addition, the value of 'PROCINFO["sorted_in"]' can be a function
-name.(1) This lets you traverse an array based on any custom criterion.
-The array elements are ordered according to the return value of this
-function. The comparison function should be defined with at least four
-arguments:
-
- function comp_func(i1, v1, i2, v2)
- {
- COMPARE ELEMENTS 1 AND 2 IN SOME FASHION
- RETURN < 0; 0; OR > 0
- }
-
- Here, 'i1' and 'i2' are the indices, and 'v1' and 'v2' are the
-corresponding values of the two elements being compared. Either 'v1' or
-'v2', or both, can be arrays if the array being traversed contains
-subarrays as values. (*Note Arrays of Arrays:: for more information
-about subarrays.) The three possible return values are interpreted as
-follows:
-
-'comp_func(i1, v1, i2, v2) < 0'
- Index 'i1' comes before index 'i2' during loop traversal.
-
-'comp_func(i1, v1, i2, v2) == 0'
- Indices 'i1' and 'i2' come together, but the relative order with
- respect to each other is undefined.
-
-'comp_func(i1, v1, i2, v2) > 0'
- Index 'i1' comes after index 'i2' during loop traversal.
-
- Our first comparison function can be used to scan an array in
-numerical order of the indices:
-
- function cmp_num_idx(i1, v1, i2, v2)
- {
- # numerical index comparison, ascending order
- return (i1 - i2)
- }
-
- Our second function traverses an array based on the string order of
-the element values rather than by indices:
-
- function cmp_str_val(i1, v1, i2, v2)
- {
- # string value comparison, ascending order
- v1 = v1 ""
- v2 = v2 ""
- if (v1 < v2)
- return -1
- return (v1 != v2)
- }
-
- The third comparison function makes all numbers, and numeric strings
-without any leading or trailing spaces, come out first during loop
-traversal:
-
- function cmp_num_str_val(i1, v1, i2, v2, n1, n2)
- {
- # numbers before string value comparison, ascending order
- n1 = v1 + 0
- n2 = v2 + 0
- if (n1 == v1)
- return (n2 == v2) ? (n1 - n2) : -1
- else if (n2 == v2)
- return 1
- return (v1 < v2) ? -1 : (v1 != v2)
- }
-
- Here is a main program to demonstrate how 'gawk' behaves using each
-of the previous functions:
-
- BEGIN {
- data["one"] = 10
- data["two"] = 20
- data[10] = "one"
- data[100] = 100
- data[20] = "two"
-
- f[1] = "cmp_num_idx"
- f[2] = "cmp_str_val"
- f[3] = "cmp_num_str_val"
- for (i = 1; i <= 3; i++) {
- printf("Sort function: %s\n", f[i])
- PROCINFO["sorted_in"] = f[i]
- for (j in data)
- printf("\tdata[%s] = %s\n", j, data[j])
- print ""
- }
- }
-
- Here are the results when the program is run:
-
- $ gawk -f compdemo.awk
- -| Sort function: cmp_num_idx Sort by numeric index
- -| data[two] = 20
- -| data[one] = 10 Both strings are numerically zero
- -| data[10] = one
- -| data[20] = two
- -| data[100] = 100
- -|
- -| Sort function: cmp_str_val Sort by element values as strings
- -| data[one] = 10
- -| data[100] = 100 String 100 is less than string 20
- -| data[two] = 20
- -| data[10] = one
- -| data[20] = two
- -|
- -| Sort function: cmp_num_str_val Sort all numeric values before all strings
- -| data[one] = 10
- -| data[two] = 20
- -| data[100] = 100
- -| data[10] = one
- -| data[20] = two
-
- Consider sorting the entries of a GNU/Linux system password file
-according to login name. The following program sorts records by a
-specific field position and can be used for this purpose:
-
- # passwd-sort.awk --- simple program to sort by field position
- # field position is specified by the global variable POS
-
- function cmp_field(i1, v1, i2, v2)
- {
- # comparison by value, as string, and ascending order
- return v1[POS] < v2[POS] ? -1 : (v1[POS] != v2[POS])
- }
-
- {
- for (i = 1; i <= NF; i++)
- a[NR][i] = $i
- }
-
- END {
- PROCINFO["sorted_in"] = "cmp_field"
- if (POS < 1 || POS > NF)
- POS = 1
- for (i in a) {
- for (j = 1; j <= NF; j++)
- printf("%s%c", a[i][j], j < NF ? ":" : "")
- print ""
- }
- }
-
- The first field in each entry of the password file is the user's
-login name, and the fields are separated by colons. Each record defines
-a subarray, with each field as an element in the subarray. Running the
-program produces the following output:
-
- $ gawk -v POS=1 -F: -f sort.awk /etc/passwd
- -| adm:x:3:4:adm:/var/adm:/sbin/nologin
- -| apache:x:48:48:Apache:/var/www:/sbin/nologin
- -| avahi:x:70:70:Avahi daemon:/:/sbin/nologin
- ...
-
- The comparison should normally always return the same value when
-given a specific pair of array elements as its arguments. If
-inconsistent results are returned, then the order is undefined. This
-behavior can be exploited to introduce random order into otherwise
-seemingly ordered data:
-
- function cmp_randomize(i1, v1, i2, v2)
- {
- # random order (caution: this may never terminate!)
- return (2 - 4 * rand())
- }
-
- As already mentioned, the order of the indices is arbitrary if two
-elements compare equal. This is usually not a problem, but letting the
-tied elements come out in arbitrary order can be an issue, especially
-when comparing item values. The partial ordering of the equal elements
-may change the next time the array is traversed, if other elements are
-added to or removed from the array. One way to resolve ties when
-comparing elements with otherwise equal values is to include the indices
-in the comparison rules. Note that doing this may make the loop
-traversal less efficient, so consider it only if necessary. The
-following comparison functions force a deterministic order, and are
-based on the fact that the (string) indices of two elements are never
-equal:
-
- function cmp_numeric(i1, v1, i2, v2)
- {
- # numerical value (and index) comparison, descending order
- return (v1 != v2) ? (v2 - v1) : (i2 - i1)
- }
-
- function cmp_string(i1, v1, i2, v2)
- {
- # string value (and index) comparison, descending order
- v1 = v1 i1
- v2 = v2 i2
- return (v1 > v2) ? -1 : (v1 != v2)
- }
-
- A custom comparison function can often simplify ordered loop
-traversal, and the sky is really the limit when it comes to designing
-such a function.
-
- When string comparisons are made during a sort, either for element
-values where one or both aren't numbers, or for element indices handled
-as strings, the value of 'IGNORECASE' (*note Built-in Variables::)
-controls whether the comparisons treat corresponding upper- and
-lowercase letters as equivalent or distinct.
-
- Another point to keep in mind is that in the case of subarrays, the
-element values can themselves be arrays; a production comparison
-function should use the 'isarray()' function (*note Type Functions::) to
-check for this, and choose a defined sorting order for subarrays.
-
- All sorting based on 'PROCINFO["sorted_in"]' is disabled in POSIX
-mode, because the 'PROCINFO' array is not special in that case.
-
- As a side note, sorting the array indices before traversing the array
-has been reported to add a 15% to 20% overhead to the execution time of
-'awk' programs. For this reason, sorted array traversal is not the
-default.
-
- ---------- Footnotes ----------
-
- (1) This is why the predefined sorting orders start with an '@'
-character, which cannot be part of an identifier.
-
-
-File: gawk.info, Node: Array Sorting Functions, Prev: Controlling Array Traversal, Up: Array Sorting
-
-12.2.2 Sorting Array Values and Indices with 'gawk'
----------------------------------------------------
-
-In most 'awk' implementations, sorting an array requires writing a
-'sort()' function. This can be educational for exploring different
-sorting algorithms, but usually that's not the point of the program.
-'gawk' provides the built-in 'asort()' and 'asorti()' functions (*note
-String Functions::) for sorting arrays. For example:
-
- POPULATE THE ARRAY data
- n = asort(data)
- for (i = 1; i <= n; i++)
- DO SOMETHING WITH data[i]
-
- After the call to 'asort()', the array 'data' is indexed from 1 to
-some number N, the total number of elements in 'data'. (This count is
-'asort()''s return value.) 'data[1]' <= 'data[2]' <= 'data[3]', and so
-on. The default comparison is based on the type of the elements (*note
-Typing and Comparison::). All numeric values come before all string
-values, which in turn come before all subarrays.
-
- An important side effect of calling 'asort()' is that _the array's
-original indices are irrevocably lost_. As this isn't always desirable,
-'asort()' accepts a second argument:
-
- POPULATE THE ARRAY source
- n = asort(source, dest)
- for (i = 1; i <= n; i++)
- DO SOMETHING WITH dest[i]
-
- In this case, 'gawk' copies the 'source' array into the 'dest' array
-and then sorts 'dest', destroying its indices. However, the 'source'
-array is not affected.
-
- Often, what's needed is to sort on the values of the _indices_
-instead of the values of the elements. To do that, use the 'asorti()'
-function. The interface and behavior are identical to that of
-'asort()', except that the index values are used for sorting and become
-the values of the result array:
-
- { source[$0] = some_func($0) }
-
- END {
- n = asorti(source, dest)
- for (i = 1; i <= n; i++) {
- Work with sorted indices directly:
- DO SOMETHING WITH dest[i]
- ...
- Access original array via sorted indices:
- DO SOMETHING WITH source[dest[i]]
- }
- }
-
- So far, so good. Now it starts to get interesting. Both 'asort()'
-and 'asorti()' accept a third string argument to control comparison of
-array elements. When we introduced 'asort()' and 'asorti()' in *note
-String Functions::, we ignored this third argument; however, now is the
-time to describe how this argument affects these two functions.
-
- Basically, the third argument specifies how the array is to be
-sorted. There are two possibilities. As with 'PROCINFO["sorted_in"]',
-this argument may be one of the predefined names that 'gawk' provides
-(*note Controlling Scanning::), or it may be the name of a user-defined
-function (*note Controlling Array Traversal::).
-
- In the latter case, _the function can compare elements in any way it
-chooses_, taking into account just the indices, just the values, or
-both. This is extremely powerful.
-
- Once the array is sorted, 'asort()' takes the _values_ in their final
-order and uses them to fill in the result array, whereas 'asorti()'
-takes the _indices_ in their final order and uses them to fill in the
-result array.
-
- NOTE: Copying array indices and elements isn't expensive in terms
- of memory. Internally, 'gawk' maintains "reference counts" to
- data. For example, when 'asort()' copies the first array to the
- second one, there is only one copy of the original array elements'
- data, even though both arrays use the values.
-
- Because 'IGNORECASE' affects string comparisons, the value of
-'IGNORECASE' also affects sorting for both 'asort()' and 'asorti()'.
-Note also that the locale's sorting order does _not_ come into play;
-comparisons are based on character values only.(1)
-
- The following example demonstrates the use of a comparison function
-with 'asort()'. The comparison function, 'case_fold_compare()', maps
-both values to lowercase in order to compare them ignoring case.
-
- # case_fold_compare --- compare as strings, ignoring case
-
- function case_fold_compare(i1, v1, i2, v2, l, r)
- {
- l = tolower(v1)
- r = tolower(v2)
-
- if (l < r)
- return -1
- else if (l == r)
- return 0
- else
- return 1
- }
-
- And here is the test program for it:
-
- # Test program
-
- BEGIN {
- Letters = "abcdefghijklmnopqrstuvwxyz" \
- "ABCDEFGHIJKLMNOPQRSTUVWXYZ"
- split(Letters, data, "")
-
- asort(data, result, "case_fold_compare")
-
- j = length(result)
- for (i = 1; i <= j; i++) {
- printf("%s", result[i])
- if (i % (j/2) == 0)
- printf("\n")
- else
- printf(" ")
- }
- }
-
- When run, we get the following:
-
- $ gawk -f case_fold_compare.awk
- -| A a B b c C D d e E F f g G H h i I J j k K l L M m
- -| n N O o p P Q q r R S s t T u U V v w W X x y Y z Z
-
- ---------- Footnotes ----------
-
- (1) This is true because locale-based comparison occurs only when in
-POSIX-compatibility mode, and because 'asort()' and 'asorti()' are
-'gawk' extensions, they are not available in that case.
-
-
-File: gawk.info, Node: Two-way I/O, Next: TCP/IP Networking, Prev: Array Sorting, Up: Advanced Features
-
-12.3 Two-Way Communications with Another Process
-================================================
-
-It is often useful to be able to send data to a separate program for
-processing and then read the result. This can always be done with
-temporary files:
-
- # Write the data for processing
- tempfile = ("mydata." PROCINFO["pid"])
- while (NOT DONE WITH DATA)
- print DATA | ("subprogram > " tempfile)
- close("subprogram > " tempfile)
-
- # Read the results, remove tempfile when done
- while ((getline newdata < tempfile) > 0)
- PROCESS newdata APPROPRIATELY
- close(tempfile)
- system("rm " tempfile)
-
-This works, but not elegantly. Among other things, it requires that the
-program be run in a directory that cannot be shared among users; for
-example, '/tmp' will not do, as another user might happen to be using a
-temporary file with the same name.(1)
-
- However, with 'gawk', it is possible to open a _two-way_ pipe to
-another process. The second process is termed a "coprocess", as it runs
-in parallel with 'gawk'. The two-way connection is created using the
-'|&' operator (borrowed from the Korn shell, 'ksh'):(2)
-
- do {
- print DATA |& "subprogram"
- "subprogram" |& getline results
- } while (DATA LEFT TO PROCESS)
- close("subprogram")
-
- The first time an I/O operation is executed using the '|&' operator,
-'gawk' creates a two-way pipeline to a child process that runs the other
-program. Output created with 'print' or 'printf' is written to the
-program's standard input, and output from the program's standard output
-can be read by the 'gawk' program using 'getline'. As is the case with
-processes started by '|', the subprogram can be any program, or pipeline
-of programs, that can be started by the shell.
-
- There are some cautionary items to be aware of:
-
- * As the code inside 'gawk' currently stands, the coprocess's
- standard error goes to the same place that the parent 'gawk''s
- standard error goes. It is not possible to read the child's
- standard error separately.
-
- * I/O buffering may be a problem. 'gawk' automatically flushes all
- output down the pipe to the coprocess. However, if the coprocess
- does not flush its output, 'gawk' may hang when doing a 'getline'
- in order to read the coprocess's results. This could lead to a
- situation known as "deadlock", where each process is waiting for
- the other one to do something.
-
- It is possible to close just one end of the two-way pipe to a
-coprocess, by supplying a second argument to the 'close()' function of
-either '"to"' or '"from"' (*note Close Files And Pipes::). These
-strings tell 'gawk' to close the end of the pipe that sends data to the
-coprocess or the end that reads from it, respectively.
-
- This is particularly necessary in order to use the system 'sort'
-utility as part of a coprocess; 'sort' must read _all_ of its input data
-before it can produce any output. The 'sort' program does not receive
-an end-of-file indication until 'gawk' closes the write end of the pipe.
-
- When you have finished writing data to the 'sort' utility, you can
-close the '"to"' end of the pipe, and then start reading sorted data via
-'getline'. For example:
-
- BEGIN {
- command = "LC_ALL=C sort"
- n = split("abcdefghijklmnopqrstuvwxyz", a, "")
-
- for (i = n; i > 0; i--)
- print a[i] |& command
- close(command, "to")
-
- while ((command |& getline line) > 0)
- print "got", line
- close(command)
- }
-
- This program writes the letters of the alphabet in reverse order, one
-per line, down the two-way pipe to 'sort'. It then closes the write end
-of the pipe, so that 'sort' receives an end-of-file indication. This
-causes 'sort' to sort the data and write the sorted data back to the
-'gawk' program. Once all of the data has been read, 'gawk' terminates
-the coprocess and exits.
-
- As a side note, the assignment 'LC_ALL=C' in the 'sort' command
-ensures traditional Unix (ASCII) sorting from 'sort'. This is not
-strictly necessary here, but it's good to know how to do this.
-
- Be careful when closing the '"from"' end of a two-way pipe; in this
-case 'gawk' waits for the child process to exit, which may cause your
-program to hang. (Thus, this particular feature is of much less use in
-practice than being able to close the '"to"' end.)
-
- CAUTION: Normally, it is a fatal error to write to the '"to"' end
- of a two-way pipe which has been closed, and it is also a fatal
- error to read from the '"from"' end of a two-way pipe that has been
- closed.
-
- You may set 'PROCINFO["COMMAND", "NONFATAL"]' to make such
- operations become nonfatal, in which case you then need to check
- 'ERRNO' after each 'print', 'printf', or 'getline'. *Note
- Nonfatal::, for more information.
-
- You may also use pseudo-ttys (ptys) for two-way communication instead
-of pipes, if your system supports them. This is done on a per-command
-basis, by setting a special element in the 'PROCINFO' array (*note
-Auto-set::), like so:
-
- command = "sort -nr" # command, save in convenience variable
- PROCINFO[command, "pty"] = 1 # update PROCINFO
- print ... |& command # start two-way pipe
- ...
-
-If your system does not have ptys, or if all the system's ptys are in
-use, 'gawk' automatically falls back to using regular pipes.
-
- Using ptys usually avoids the buffer deadlock issues described
-earlier, at some loss in performance. This is because the tty driver
-buffers and sends data line-by-line. On systems with the 'stdbuf' (part
-of the GNU Coreutils package
-(http://www.gnu.org/software/coreutils/coreutils.html)), you can use
-that program instead of ptys.
-
- Note also that ptys are not fully transparent. Certain binary
-control codes, such 'Ctrl-d' for end-of-file, are interpreted by the tty
-driver and not passed through.
-
- CAUTION: Finally, coprocesses open up the possibility of "deadlock"
- between 'gawk' and the program running in the coprocess. This can
- occur if you send "too much" data to the coprocess before reading
- any back; each process is blocked writing data with noone available
- to read what they've already written. There is no workaround for
- deadlock; careful programming and knowledge of the behavior of the
- coprocess are required.
-
- ---------- Footnotes ----------
-
- (1) Michael Brennan suggests the use of 'rand()' to generate unique
-file names. This is a valid point; nevertheless, temporary files remain
-more difficult to use than two-way pipes.
-
- (2) This is very different from the same operator in the C shell and
-in Bash.
-
-
-File: gawk.info, Node: TCP/IP Networking, Next: Profiling, Prev: Two-way I/O, Up: Advanced Features
-
-12.4 Using 'gawk' for Network Programming
-=========================================
-
- 'EMRED':
- A host is a host from coast to coast,
- and nobody talks to a host that's close,
- unless the host that isn't close
- is busy, hung, or dead.
- -- _Mike O'Brien (aka Mr. Protocol)_
-
- In addition to being able to open a two-way pipeline to a coprocess
-on the same system (*note Two-way I/O::), it is possible to make a
-two-way connection to another process on another system across an IP
-network connection.
-
- You can think of this as just a _very long_ two-way pipeline to a
-coprocess. The way 'gawk' decides that you want to use TCP/IP
-networking is by recognizing special file names that begin with one of
-'/inet/', '/inet4/', or '/inet6/'.
-
- The full syntax of the special file name is
-'/NET-TYPE/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'. The components
-are:
-
-NET-TYPE
- Specifies the kind of Internet connection to make. Use '/inet4/'
- to force IPv4, and '/inet6/' to force IPv6. Plain '/inet/' (which
- used to be the only option) uses the system default, most likely
- IPv4.
-
-PROTOCOL
- The protocol to use over IP. This must be either 'tcp', or 'udp',
- for a TCP or UDP IP connection, respectively. TCP should be used
- for most applications.
-
-LOCAL-PORT
- The local TCP or UDP port number to use. Use a port number of '0'
- when you want the system to pick a port. This is what you should
- do when writing a TCP or UDP client. You may also use a well-known
- service name, such as 'smtp' or 'http', in which case 'gawk'
- attempts to determine the predefined port number using the C
- 'getaddrinfo()' function.
-
-REMOTE-HOST
- The IP address or fully qualified domain name of the Internet host
- to which you want to connect.
-
-REMOTE-PORT
- The TCP or UDP port number to use on the given REMOTE-HOST. Again,
- use '0' if you don't care, or else a well-known service name.
-
- NOTE: Failure in opening a two-way socket will result in a nonfatal
- error being returned to the calling code. The value of 'ERRNO'
- indicates the error (*note Auto-set::).
-
- Consider the following very simple example:
-
- BEGIN {
- Service = "/inet/tcp/0/localhost/daytime"
- Service |& getline
- print $0
- close(Service)
- }
-
- This program reads the current date and time from the local system's
-TCP 'daytime' server. It then prints the results and closes the
-connection.
-
- Because this topic is extensive, the use of 'gawk' for TCP/IP
-programming is documented separately. See *note (General Introduction,
-gawkinet, TCP/IP Internetworking with 'gawk')Top::, for a much more
-complete introduction and discussion, as well as extensive examples.
-
- NOTE: 'gawk' can only open direct sockets. There is currently no
- way to access services available over Secure Socket Layer (SSL);
- this includes any web service whose URL starts with 'https://'.
-
-
-File: gawk.info, Node: Profiling, Next: Advanced Features Summary, Prev: TCP/IP Networking, Up: Advanced Features
-
-12.5 Profiling Your 'awk' Programs
-==================================
-
-You may produce execution traces of your 'awk' programs. This is done
-by passing the option '--profile' to 'gawk'. When 'gawk' has finished
-running, it creates a profile of your program in a file named
-'awkprof.out'. Because it is profiling, it also executes up to 45%
-slower than 'gawk' normally does.
-
- As shown in the following example, the '--profile' option can be used
-to change the name of the file where 'gawk' will write the profile:
-
- gawk --profile=myprog.prof -f myprog.awk data1 data2
-
-In the preceding example, 'gawk' places the profile in 'myprog.prof'
-instead of in 'awkprof.out'.
-
- Here is a sample session showing a simple 'awk' program, its input
-data, and the results from running 'gawk' with the '--profile' option.
-First, the 'awk' program:
-
- BEGIN { print "First BEGIN rule" }
-
- END { print "First END rule" }
-
- /foo/ {
- print "matched /foo/, gosh"
- for (i = 1; i <= 3; i++)
- sing()
- }
-
- {
- if (/foo/)
- print "if is true"
- else
- print "else is true"
- }
-
- BEGIN { print "Second BEGIN rule" }
-
- END { print "Second END rule" }
-
- function sing( dummy)
- {
- print "I gotta be me!"
- }
-
- Following is the input data:
-
- foo
- bar
- baz
- foo
- junk
-
- Here is the 'awkprof.out' that results from running the 'gawk'
-profiler on this program and data (this example also illustrates that
-'awk' programmers sometimes get up very early in the morning to work):
-
- # gawk profile, created Mon Sep 29 05:16:21 2014
-
- # BEGIN rule(s)
-
- BEGIN {
- 1 print "First BEGIN rule"
- }
-
- BEGIN {
- 1 print "Second BEGIN rule"
- }
-
- # Rule(s)
-
- 5 /foo/ { # 2
- 2 print "matched /foo/, gosh"
- 6 for (i = 1; i <= 3; i++) {
- 6 sing()
- }
- }
-
- 5 {
- 5 if (/foo/) { # 2
- 2 print "if is true"
- 3 } else {
- 3 print "else is true"
- }
- }
-
- # END rule(s)
-
- END {
- 1 print "First END rule"
- }
-
- END {
- 1 print "Second END rule"
- }
-
-
- # Functions, listed alphabetically
-
- 6 function sing(dummy)
- {
- 6 print "I gotta be me!"
- }
-
- This example illustrates many of the basic features of profiling
-output. They are as follows:
-
- * The program is printed in the order 'BEGIN' rules, 'BEGINFILE'
- rules, pattern-action rules, 'ENDFILE' rules, 'END' rules, and
- functions, listed alphabetically. Multiple 'BEGIN' and 'END' rules
- retain their separate identities, as do multiple 'BEGINFILE' and
- 'ENDFILE' rules.
-
- * Pattern-action rules have two counts. The first count, to the left
- of the rule, shows how many times the rule's pattern was _tested_.
- The second count, to the right of the rule's opening left brace in
- a comment, shows how many times the rule's action was _executed_.
- The difference between the two indicates how many times the rule's
- pattern evaluated to false.
-
- * Similarly, the count for an 'if'-'else' statement shows how many
- times the condition was tested. To the right of the opening left
- brace for the 'if''s body is a count showing how many times the
- condition was true. The count for the 'else' indicates how many
- times the test failed.
-
- * The count for a loop header (such as 'for' or 'while') shows how
- many times the loop test was executed. (Because of this, you can't
- just look at the count on the first statement in a rule to
- determine how many times the rule was executed. If the first
- statement is a loop, the count is misleading.)
-
- * For user-defined functions, the count next to the 'function'
- keyword indicates how many times the function was called. The
- counts next to the statements in the body show how many times those
- statements were executed.
-
- * The layout uses "K&R" style with TABs. Braces are used everywhere,
- even when the body of an 'if', 'else', or loop is only a single
- statement.
-
- * Parentheses are used only where needed, as indicated by the
- structure of the program and the precedence rules. For example,
- '(3 + 5) * 4' means add three and five, then multiply the total by
- four. However, '3 + 5 * 4' has no parentheses, and means '3 + (5 *
- 4)'.
-
- * Parentheses are used around the arguments to 'print' and 'printf'
- only when the 'print' or 'printf' statement is followed by a
- redirection. Similarly, if the target of a redirection isn't a
- scalar, it gets parenthesized.
-
- * 'gawk' supplies leading comments in front of the 'BEGIN' and 'END'
- rules, the 'BEGINFILE' and 'ENDFILE' rules, the pattern-action
- rules, and the functions.
-
- The profiled version of your program may not look exactly like what
-you typed when you wrote it. This is because 'gawk' creates the
-profiled version by "pretty-printing" its internal representation of the
-program. The advantage to this is that 'gawk' can produce a standard
-representation. Also, things such as:
-
- /foo/
-
-come out as:
-
- /foo/ {
- print $0
- }
-
-which is correct, but possibly unexpected.
-
- Besides creating profiles when a program has completed, 'gawk' can
-produce a profile while it is running. This is useful if your 'awk'
-program goes into an infinite loop and you want to see what has been
-executed. To use this feature, run 'gawk' with the '--profile' option
-in the background:
-
- $ gawk --profile -f myprog &
- [1] 13992
-
-The shell prints a job number and process ID number; in this case,
-13992. Use the 'kill' command to send the 'USR1' signal to 'gawk':
-
- $ kill -USR1 13992
-
-As usual, the profiled version of the program is written to
-'awkprof.out', or to a different file if one was specified with the
-'--profile' option.
-
- Along with the regular profile, as shown earlier, the profile file
-includes a trace of any active functions:
-
- # Function Call Stack:
-
- # 3. baz
- # 2. bar
- # 1. foo
- # -- main --
-
- You may send 'gawk' the 'USR1' signal as many times as you like.
-Each time, the profile and function call trace are appended to the
-output profile file.
-
- If you use the 'HUP' signal instead of the 'USR1' signal, 'gawk'
-produces the profile and the function call trace and then exits.
-
- When 'gawk' runs on MS-Windows systems, it uses the 'INT' and 'QUIT'
-signals for producing the profile, and in the case of the 'INT' signal,
-'gawk' exits. This is because these systems don't support the 'kill'
-command, so the only signals you can deliver to a program are those
-generated by the keyboard. The 'INT' signal is generated by the
-'Ctrl-c' or 'Ctrl-BREAK' key, while the 'QUIT' signal is generated by
-the 'Ctrl-\' key.
-
- Finally, 'gawk' also accepts another option, '--pretty-print'. When
-called this way, 'gawk' "pretty-prints" the program into 'awkprof.out',
-without any execution counts.
-
- NOTE: Once upon a time, the '--pretty-print' option would also run
- your program. This is is no longer the case.
-
- There is a significant difference between the output created when
-profiling, and that created when pretty-printing. Pretty-printed output
-preserves the original comments that were in the program, although their
-placement may not correspond exactly to their original locations in the
-source code.(1)
-
- However, as a deliberate design decision, profiling output _omits_
-the original program's comments. This allows you to focus on the
-execution count data and helps you avoid the temptation to use the
-profiler for pretty-printing.
-
- Additionally, pretty-printed output does not have the leading
-indentation that the profiling output does. This makes it easy to
-pretty-print your code once development is completed, and then use the
-result as the final version of your program.
-
- Because the internal representation of your program is formatted to
-recreate an 'awk' program, profiling and pretty-printing automatically
-disable 'gawk''s default optimizations.
-
- ---------- Footnotes ----------
-
- (1) 'gawk' does the best it can to preserve the distinction between
-comments at the end of a statement and comments on lines by themselves.
-Due to implementation constraints, it does not always do so correctly,
-particularly for 'switch' statements. The 'gawk' maintainers hope to
-improve this in a subsequent release.
-
-
-File: gawk.info, Node: Advanced Features Summary, Prev: Profiling, Up: Advanced Features
-
-12.6 Summary
-============
-
- * The '--non-decimal-data' option causes 'gawk' to treat octal- and
- hexadecimal-looking input data as octal and hexadecimal. This
- option should be used with caution or not at all; use of
- 'strtonum()' is preferable. Note that this option may disappear in
- a future version of 'gawk'.
-
- * You can take over complete control of sorting in 'for (INDX in
- ARRAY)' array traversal by setting 'PROCINFO["sorted_in"]' to the
- name of a user-defined function that does the comparison of array
- elements based on index and value.
-
- * Similarly, you can supply the name of a user-defined comparison
- function as the third argument to either 'asort()' or 'asorti()' to
- control how those functions sort arrays. Or you may provide one of
- the predefined control strings that work for
- 'PROCINFO["sorted_in"]'.
-
- * You can use the '|&' operator to create a two-way pipe to a
- coprocess. You read from the coprocess with 'getline' and write to
- it with 'print' or 'printf'. Use 'close()' to close off the
- coprocess completely, or optionally, close off one side of the
- two-way communications.
-
- * By using special file names with the '|&' operator, you can open a
- TCP/IP (or UDP/IP) connection to remote hosts on the Internet.
- 'gawk' supports both IPv4 and IPv6.
-
- * You can generate statement count profiles of your program. This
- can help you determine which parts of your program may be taking
- the most time and let you tune them more easily. Sending the
- 'USR1' signal while profiling causes 'gawk' to dump the profile and
- keep going, including a function call stack.
-
- * You can also just "pretty-print" the program.
-
-
-File: gawk.info, Node: Internationalization, Next: Debugger, Prev: Advanced Features, Up: Top
-
-13 Internationalization with 'gawk'
-***********************************
-
-Once upon a time, computer makers wrote software that worked only in
-English. Eventually, hardware and software vendors noticed that if
-their systems worked in the native languages of non-English-speaking
-countries, they were able to sell more systems. As a result,
-internationalization and localization of programs and software systems
-became a common practice.
-
- For many years, the ability to provide internationalization was
-largely restricted to programs written in C and C++. This major node
-describes the underlying library 'gawk' uses for internationalization,
-as well as how 'gawk' makes internationalization features available at
-the 'awk' program level. Having internationalization available at the
-'awk' level gives software developers additional flexibility--they are
-no longer forced to write in C or C++ when internationalization is a
-requirement.
-
-* Menu:
-
-* I18N and L10N:: Internationalization and Localization.
-* Explaining gettext:: How GNU 'gettext' works.
-* Programmer i18n:: Features for the programmer.
-* Translator i18n:: Features for the translator.
-* I18N Example:: A simple i18n example.
-* Gawk I18N:: 'gawk' is also internationalized.
-* I18N Summary:: Summary of I18N stuff.
-
-
-File: gawk.info, Node: I18N and L10N, Next: Explaining gettext, Up: Internationalization
-
-13.1 Internationalization and Localization
-==========================================
-
-"Internationalization" means writing (or modifying) a program once, in
-such a way that it can use multiple languages without requiring further
-source code changes. "Localization" means providing the data necessary
-for an internationalized program to work in a particular language. Most
-typically, these terms refer to features such as the language used for
-printing error messages, the language used to read responses, and
-information related to how numerical and monetary values are printed and
-read.
-
-
-File: gawk.info, Node: Explaining gettext, Next: Programmer i18n, Prev: I18N and L10N, Up: Internationalization
-
-13.2 GNU 'gettext'
-==================
-
-'gawk' uses GNU 'gettext' to provide its internationalization features.
-The facilities in GNU 'gettext' focus on messages: strings printed by a
-program, either directly or via formatting with 'printf' or
-'sprintf()'.(1)
-
- When using GNU 'gettext', each application has its own "text domain".
-This is a unique name, such as 'kpilot' or 'gawk', that identifies the
-application. A complete application may have multiple
-components--programs written in C or C++, as well as scripts written in
-'sh' or 'awk'. All of the components use the same text domain.
-
- To make the discussion concrete, assume we're writing an application
-named 'guide'. Internationalization consists of the following steps, in
-this order:
-
- 1. The programmer reviews the source for all of 'guide''s components
- and marks each string that is a candidate for translation. For
- example, '"`-F': option required"' is a good candidate for
- translation. A table with strings of option names is not (e.g.,
- 'gawk''s '--profile' option should remain the same, no matter what
- the local language).
-
- 2. The programmer indicates the application's text domain ('"guide"')
- to the 'gettext' library, by calling the 'textdomain()' function.
-
- 3. Messages from the application are extracted from the source code
- and collected into a portable object template file ('guide.pot'),
- which lists the strings and their translations. The translations
- are initially empty. The original (usually English) messages serve
- as the key for lookup of the translations.
-
- 4. For each language with a translator, 'guide.pot' is copied to a
- portable object file ('.po') and translations are created and
- shipped with the application. For example, there might be a
- 'fr.po' for a French translation.
-
- 5. Each language's '.po' file is converted into a binary message
- object ('.gmo') file. A message object file contains the original
- messages and their translations in a binary format that allows fast
- lookup of translations at runtime.
-
- 6. When 'guide' is built and installed, the binary translation files
- are installed in a standard place.
-
- 7. For testing and development, it is possible to tell 'gettext' to
- use '.gmo' files in a different directory than the standard one by
- using the 'bindtextdomain()' function.
-
- 8. At runtime, 'guide' looks up each string via a call to 'gettext()'.
- The returned string is the translated string if available, or the
- original string if not.
-
- 9. If necessary, it is possible to access messages from a different
- text domain than the one belonging to the application, without
- having to switch the application's default text domain back and
- forth.
-
- In C (or C++), the string marking and dynamic translation lookup are
-accomplished by wrapping each string in a call to 'gettext()':
-
- printf("%s", gettext("Don't Panic!\n"));
-
- The tools that extract messages from source code pull out all strings
-enclosed in calls to 'gettext()'.
-
- The GNU 'gettext' developers, recognizing that typing 'gettext(...)'
-over and over again is both painful and ugly to look at, use the macro
-'_' (an underscore) to make things easier:
-
- /* In the standard header file: */
- #define _(str) gettext(str)
-
- /* In the program text: */
- printf("%s", _("Don't Panic!\n"));
-
-This reduces the typing overhead to just three extra characters per
-string and is considerably easier to read as well.
-
- There are locale "categories" for different types of locale-related
-information. The defined locale categories that 'gettext' knows about
-are:
-
-'LC_MESSAGES'
- Text messages. This is the default category for 'gettext'
- operations, but it is possible to supply a different one
- explicitly, if necessary. (It is almost never necessary to supply
- a different category.)
-
-'LC_COLLATE'
- Text-collation information (i.e., how different characters and/or
- groups of characters sort in a given language).
-
-'LC_CTYPE'
- Character-type information (alphabetic, digit, upper- or lowercase,
- and so on) as well as character encoding. This information is
- accessed via the POSIX character classes in regular expressions,
- such as '/[[:alnum:]]/' (*note Bracket Expressions::).
-
-'LC_MONETARY'
- Monetary information, such as the currency symbol, and whether the
- symbol goes before or after a number.
-
-'LC_NUMERIC'
- Numeric information, such as which characters to use for the
- decimal point and the thousands separator.(2)
-
-'LC_TIME'
- Time- and date-related information, such as 12- or 24-hour clock,
- month printed before or after the day in a date, local month
- abbreviations, and so on.
-
-'LC_ALL'
- All of the above. (Not too useful in the context of 'gettext'.)
-
- NOTE: As described in *note Locales::, environment variables with
- the same name as the locale categories ('LC_CTYPE', 'LC_ALL', etc.)
- influence 'gawk''s behavior (and that of other utilities).
-
- Normally, these variables also affect how the 'gettext' library
- finds translations. However, the 'LANGUAGE' environment variable
- overrides the 'LC_XXX' variables. Many GNU/Linux systems may
- define this variable without your knowledge, causing 'gawk' to not
- find the correct translations. If this happens to you, look to see
- if 'LANGUAGE' is defined, and if so, use the shell's 'unset'
- command to remove it.
-
- For testing translations of 'gawk' itself, you can set the
-'GAWK_LOCALE_DIR' environment variable. See the documentation for the C
-'bindtextdomain()' function and also see *note Other Environment
-Variables::.
-
- ---------- Footnotes ----------
-
- (1) For some operating systems, the 'gawk' port doesn't support GNU
-'gettext'. Therefore, these features are not available if you are using
-one of those operating systems. Sorry.
-
- (2) Americans use a comma every three decimal places and a period for
-the decimal point, while many Europeans do exactly the opposite:
-1,234.56 versus 1.234,56.
-
-
-File: gawk.info, Node: Programmer i18n, Next: Translator i18n, Prev: Explaining gettext, Up: Internationalization
-
-13.3 Internationalizing 'awk' Programs
-======================================
-
-'gawk' provides the following variables for internationalization:
-
-'TEXTDOMAIN'
- This variable indicates the application's text domain. For
- compatibility with GNU 'gettext', the default value is
- '"messages"'.
-
-'_"your message here"'
- String constants marked with a leading underscore are candidates
- for translation at runtime. String constants without a leading
- underscore are not translated.
-
- 'gawk' provides the following functions for internationalization:
-
-'dcgettext(STRING [, DOMAIN [, CATEGORY]])'
- Return the translation of STRING in text domain DOMAIN for locale
- category CATEGORY. The default value for DOMAIN is the current
- value of 'TEXTDOMAIN'. The default value for CATEGORY is
- '"LC_MESSAGES"'.
-
- If you supply a value for CATEGORY, it must be a string equal to
- one of the known locale categories described in *note Explaining
- gettext::. You must also supply a text domain. Use 'TEXTDOMAIN'
- if you want to use the current domain.
-
- CAUTION: The order of arguments to the 'awk' version of the
- 'dcgettext()' function is purposely different from the order
- for the C version. The 'awk' version's order was chosen to be
- simple and to allow for reasonable 'awk'-style default
- arguments.
-
-'dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])'
- Return the plural form used for NUMBER of the translation of
- STRING1 and STRING2 in text domain DOMAIN for locale category
- CATEGORY. STRING1 is the English singular variant of a message,
- and STRING2 is the English plural variant of the same message. The
- default value for DOMAIN is the current value of 'TEXTDOMAIN'. The
- default value for CATEGORY is '"LC_MESSAGES"'.
-
- The same remarks about argument order as for the 'dcgettext()'
- function apply.
-
-'bindtextdomain(DIRECTORY [, DOMAIN ])'
- Change the directory in which 'gettext' looks for '.gmo' files, in
- case they will not or cannot be placed in the standard locations
- (e.g., during testing). Return the directory in which DOMAIN is
- "bound."
-
- The default DOMAIN is the value of 'TEXTDOMAIN'. If DIRECTORY is
- the null string ('""'), then 'bindtextdomain()' returns the current
- binding for the given DOMAIN.
-
- To use these facilities in your 'awk' program, follow these steps:
-
- 1. Set the variable 'TEXTDOMAIN' to the text domain of your program.
- This is best done in a 'BEGIN' rule (*note BEGIN/END::), or it can
- also be done via the '-v' command-line option (*note Options::):
-
- BEGIN {
- TEXTDOMAIN = "guide"
- ...
- }
-
- 2. Mark all translatable strings with a leading underscore ('_')
- character. It _must_ be adjacent to the opening quote of the
- string. For example:
-
- print _"hello, world"
- x = _"you goofed"
- printf(_"Number of users is %d\n", nusers)
-
- 3. If you are creating strings dynamically, you can still translate
- them, using the 'dcgettext()' built-in function:(1)
-
- if (groggy)
- message = dcgettext("%d customers disturbing me\n", "adminprog")
- else
- message = dcgettext("enjoying %d customers\n", "adminprog")
- printf(message, ncustomers)
-
- Here, the call to 'dcgettext()' supplies a different text domain
- ('"adminprog"') in which to find the message, but it uses the
- default '"LC_MESSAGES"' category.
-
- The previous example only works if 'ncustomers' is greater than
- one. This example would be better done with 'dcngettext()':
-
- if (groggy)
- message = dcngettext("%d customer disturbing me\n",
- "%d customers disturbing me\n", "adminprog")
- else
- message = dcngettext("enjoying %d customer\n",
- "enjoying %d customers\n", "adminprog")
- printf(message, ncustomers)
-
- 4. During development, you might want to put the '.gmo' file in a
- private directory for testing. This is done with the
- 'bindtextdomain()' built-in function:
-
- BEGIN {
- TEXTDOMAIN = "guide" # our text domain
- if (Testing) {
- # where to find our files
- bindtextdomain("testdir")
- # joe is in charge of adminprog
- bindtextdomain("../joe/testdir", "adminprog")
- }
- ...
- }
-
- *Note I18N Example:: for an example program showing the steps to
-create and use translations from 'awk'.
-
- ---------- Footnotes ----------
-
- (1) Thanks to Bruno Haible for this example.
-
-
-File: gawk.info, Node: Translator i18n, Next: I18N Example, Prev: Programmer i18n, Up: Internationalization
-
-13.4 Translating 'awk' Programs
-===============================
-
-Once a program's translatable strings have been marked, they must be
-extracted to create the initial '.pot' file. As part of translation, it
-is often helpful to rearrange the order in which arguments to 'printf'
-are output.
-
- 'gawk''s '--gen-pot' command-line option extracts the messages and is
-discussed next. After that, 'printf''s ability to rearrange the order
-for 'printf' arguments at runtime is covered.
-
-* Menu:
-
-* String Extraction:: Extracting marked strings.
-* Printf Ordering:: Rearranging 'printf' arguments.
-* I18N Portability:: 'awk'-level portability issues.
-
-
-File: gawk.info, Node: String Extraction, Next: Printf Ordering, Up: Translator i18n
-
-13.4.1 Extracting Marked Strings
---------------------------------
-
-Once your 'awk' program is working, and all the strings have been marked
-and you've set (and perhaps bound) the text domain, it is time to
-produce translations. First, use the '--gen-pot' command-line option to
-create the initial '.pot' file:
-
- gawk --gen-pot -f guide.awk > guide.pot
-
- When run with '--gen-pot', 'gawk' does not execute your program.
-Instead, it parses it as usual and prints all marked strings to standard
-output in the format of a GNU 'gettext' Portable Object file. Also
-included in the output are any constant strings that appear as the first
-argument to 'dcgettext()' or as the first and second argument to
-'dcngettext()'.(1) You should distribute the generated '.pot' file with
-your 'awk' program; translators will eventually use it to provide you
-translations that you can also then distribute. *Note I18N Example::
-for the full list of steps to go through to create and test translations
-for 'guide'.
-
- ---------- Footnotes ----------
-
- (1) The 'xgettext' utility that comes with GNU 'gettext' can handle
-'.awk' files.
-
-
-File: gawk.info, Node: Printf Ordering, Next: I18N Portability, Prev: String Extraction, Up: Translator i18n
-
-13.4.2 Rearranging 'printf' Arguments
--------------------------------------
-
-Format strings for 'printf' and 'sprintf()' (*note Printf::) present a
-special problem for translation. Consider the following:(1)
-
- printf(_"String `%s' has %d characters\n",
- string, length(string)))
-
- A possible German translation for this might be:
-
- "%d Zeichen lang ist die Zeichenkette `%s'\n"
-
- The problem should be obvious: the order of the format specifications
-is different from the original! Even though 'gettext()' can return the
-translated string at runtime, it cannot change the argument order in the
-call to 'printf'.
-
- To solve this problem, 'printf' format specifiers may have an
-additional optional element, which we call a "positional specifier".
-For example:
-
- "%2$d Zeichen lang ist die Zeichenkette `%1$s'\n"
-
- Here, the positional specifier consists of an integer count, which
-indicates which argument to use, and a '$'. Counts are one-based, and
-the format string itself is _not_ included. Thus, in the following
-example, 'string' is the first argument and 'length(string)' is the
-second:
-
- $ gawk 'BEGIN {
- > string = "Don\47t Panic"
- > printf "%2$d characters live in \"%1$s\"\n",
- > string, length(string)
- > }'
- -| 11 characters live in "Don't Panic"
-
- If present, positional specifiers come first in the format
-specification, before the flags, the field width, and/or the precision.
-
- Positional specifiers can be used with the dynamic field width and
-precision capability:
-
- $ gawk 'BEGIN {
- > printf("%*.*s\n", 10, 20, "hello")
- > printf("%3$*2$.*1$s\n", 20, 10, "hello")
- > }'
- -| hello
- -| hello
-
- NOTE: When using '*' with a positional specifier, the '*' comes
- first, then the integer position, and then the '$'. This is
- somewhat counterintuitive.
-
- 'gawk' does not allow you to mix regular format specifiers and those
-with positional specifiers in the same string:
-
- $ gawk 'BEGIN { printf "%d %3$s\n", 1, 2, "hi" }'
- error-> gawk: cmd. line:1: fatal: must use `count$' on all formats or none
-
- NOTE: There are some pathological cases that 'gawk' may fail to
- diagnose. In such cases, the output may not be what you expect.
- It's still a bad idea to try mixing them, even if 'gawk' doesn't
- detect it.
-
- Although positional specifiers can be used directly in 'awk'
-programs, their primary purpose is to help in producing correct
-translations of format strings into languages different from the one in
-which the program is first written.
-
- ---------- Footnotes ----------
-
- (1) This example is borrowed from the GNU 'gettext' manual.
-
-
-File: gawk.info, Node: I18N Portability, Prev: Printf Ordering, Up: Translator i18n
-
-13.4.3 'awk' Portability Issues
--------------------------------
-
-'gawk''s internationalization features were purposely chosen to have as
-little impact as possible on the portability of 'awk' programs that use
-them to other versions of 'awk'. Consider this program:
-
- BEGIN {
- TEXTDOMAIN = "guide"
- if (Test_Guide) # set with -v
- bindtextdomain("/test/guide/messages")
- print _"don't panic!"
- }
-
-As written, it won't work on other versions of 'awk'. However, it is
-actually almost portable, requiring very little change:
-
- * Assignments to 'TEXTDOMAIN' won't have any effect, because
- 'TEXTDOMAIN' is not special in other 'awk' implementations.
-
- * Non-GNU versions of 'awk' treat marked strings as the concatenation
- of a variable named '_' with the string following it.(1)
- Typically, the variable '_' has the null string ('""') as its
- value, leaving the original string constant as the result.
-
- * By defining "dummy" functions to replace 'dcgettext()',
- 'dcngettext()', and 'bindtextdomain()', the 'awk' program can be
- made to run, but all the messages are output in the original
- language. For example:
-
- function bindtextdomain(dir, domain)
- {
- return dir
- }
-
- function dcgettext(string, domain, category)
- {
- return string
- }
-
- function dcngettext(string1, string2, number, domain, category)
- {
- return (number == 1 ? string1 : string2)
- }
-
- * The use of positional specifications in 'printf' or 'sprintf()' is
- _not_ portable. To support 'gettext()' at the C level, many
- systems' C versions of 'sprintf()' do support positional
- specifiers. But it works only if enough arguments are supplied in
- the function call. Many versions of 'awk' pass 'printf' formats
- and arguments unchanged to the underlying C library version of
- 'sprintf()', but only one format and argument at a time. What
- happens if a positional specification is used is anybody's guess.
- However, because the positional specifications are primarily for
- use in _translated_ format strings, and because non-GNU 'awk's
- never retrieve the translated string, this should not be a problem
- in practice.
-
- ---------- Footnotes ----------
-
- (1) This is good fodder for an "Obfuscated 'awk'" contest.
-
-
-File: gawk.info, Node: I18N Example, Next: Gawk I18N, Prev: Translator i18n, Up: Internationalization
-
-13.5 A Simple Internationalization Example
-==========================================
-
-Now let's look at a step-by-step example of how to internationalize and
-localize a simple 'awk' program, using 'guide.awk' as our original
-source:
-
- BEGIN {
- TEXTDOMAIN = "guide"
- bindtextdomain(".") # for testing
- print _"Don't Panic"
- print _"The Answer Is", 42
- print "Pardon me, Zaphod who?"
- }
-
-Run 'gawk --gen-pot' to create the '.pot' file:
-
- $ gawk --gen-pot -f guide.awk > guide.pot
-
-This produces:
-
- #: guide.awk:4
- msgid "Don't Panic"
- msgstr ""
-
- #: guide.awk:5
- msgid "The Answer Is"
- msgstr ""
-
-
- This original portable object template file is saved and reused for
-each language into which the application is translated. The 'msgid' is
-the original string and the 'msgstr' is the translation.
-
- NOTE: Strings not marked with a leading underscore do not appear in
- the 'guide.pot' file.
-
- Next, the messages must be translated. Here is a translation to a
-hypothetical dialect of English, called "Mellow":(1)
-
- $ cp guide.pot guide-mellow.po
- ADD TRANSLATIONS TO guide-mellow.po ...
-
-Following are the translations:
-
- #: guide.awk:4
- msgid "Don't Panic"
- msgstr "Hey man, relax!"
-
- #: guide.awk:5
- msgid "The Answer Is"
- msgstr "Like, the scoop is"
-
-
- The next step is to make the directory to hold the binary message
-object file and then to create the 'guide.mo' file. We pretend that our
-file is to be used in the 'en_US.UTF-8' locale, because we have to use a
-locale name known to the C 'gettext' routines. The directory layout
-shown here is standard for GNU 'gettext' on GNU/Linux systems. Other
-versions of 'gettext' may use a different layout:
-
- $ mkdir en_US.UTF-8 en_US.UTF-8/LC_MESSAGES
-
- The 'msgfmt' utility does the conversion from human-readable '.po'
-file to machine-readable '.mo' file. By default, 'msgfmt' creates a
-file named 'messages'. This file must be renamed and placed in the
-proper directory (using the '-o' option) so that 'gawk' can find it:
-
- $ msgfmt guide-mellow.po -o en_US.UTF-8/LC_MESSAGES/guide.mo
-
- Finally, we run the program to test it:
-
- $ gawk -f guide.awk
- -| Hey man, relax!
- -| Like, the scoop is 42
- -| Pardon me, Zaphod who?
-
- If the three replacement functions for 'dcgettext()', 'dcngettext()',
-and 'bindtextdomain()' (*note I18N Portability::) are in a file named
-'libintl.awk', then we can run 'guide.awk' unchanged as follows:
-
- $ gawk --posix -f guide.awk -f libintl.awk
- -| Don't Panic
- -| The Answer Is 42
- -| Pardon me, Zaphod who?
-
- ---------- Footnotes ----------
-
- (1) Perhaps it would be better if it were called "Hippy." Ah, well.
-
-
-File: gawk.info, Node: Gawk I18N, Next: I18N Summary, Prev: I18N Example, Up: Internationalization
-
-13.6 'gawk' Can Speak Your Language
-===================================
-
-'gawk' itself has been internationalized using the GNU 'gettext'
-package. (GNU 'gettext' is described in complete detail in *note (GNU
-'gettext' utilities, gettext, GNU 'gettext' utilities)Top::.) As of
-this writing, the latest version of GNU 'gettext' is version 0.19.4
-(ftp://ftp.gnu.org/gnu/gettext/gettext-0.19.4.tar.gz).
-
- If a translation of 'gawk''s messages exists, then 'gawk' produces
-usage messages, warnings, and fatal errors in the local language.
-
-
-File: gawk.info, Node: I18N Summary, Prev: Gawk I18N, Up: Internationalization
-
-13.7 Summary
-============
-
- * Internationalization means writing a program such that it can use
- multiple languages without requiring source code changes.
- Localization means providing the data necessary for an
- internationalized program to work in a particular language.
-
- * 'gawk' uses GNU 'gettext' to let you internationalize and localize
- 'awk' programs. A program's text domain identifies the program for
- grouping all messages and other data together.
-
- * You mark a program's strings for translation by preceding them with
- an underscore. Once that is done, the strings are extracted into a
- '.pot' file. This file is copied for each language into a '.po'
- file, and the '.po' files are compiled into '.gmo' files for use at
- runtime.
-
- * You can use positional specifications with 'sprintf()' and 'printf'
- to rearrange the placement of argument values in formatted strings
- and output. This is useful for the translation of format control
- strings.
-
- * The internationalization features have been designed so that they
- can be easily worked around in a standard 'awk'.
-
- * 'gawk' itself has been internationalized and ships with a number of
- translations for its messages.
-
-
-File: gawk.info, Node: Debugger, Next: Arbitrary Precision Arithmetic, Prev: Internationalization, Up: Top
-
-14 Debugging 'awk' Programs
-***************************
-
-It would be nice if computer programs worked perfectly the first time
-they were run, but in real life, this rarely happens for programs of any
-complexity. Thus, most programming languages have facilities available
-for "debugging" programs, and now 'awk' is no exception.
-
- The 'gawk' debugger is purposely modeled after the GNU Debugger (GDB)
-(http://www.gnu.org/software/gdb/) command-line debugger. If you are
-familiar with GDB, learning how to use 'gawk' for debugging your program
-is easy.
-
-* Menu:
-
-* Debugging:: Introduction to 'gawk' debugger.
-* Sample Debugging Session:: Sample debugging session.
-* List of Debugger Commands:: Main debugger commands.
-* Readline Support:: Readline support.
-* Limitations:: Limitations and future plans.
-* Debugging Summary:: Debugging summary.
-
-
-File: gawk.info, Node: Debugging, Next: Sample Debugging Session, Up: Debugger
-
-14.1 Introduction to the 'gawk' Debugger
-========================================
-
-This minor node introduces debugging in general and begins the
-discussion of debugging in 'gawk'.
-
-* Menu:
-
-* Debugging Concepts:: Debugging in General.
-* Debugging Terms:: Additional Debugging Concepts.
-* Awk Debugging:: Awk Debugging.
-
-
-File: gawk.info, Node: Debugging Concepts, Next: Debugging Terms, Up: Debugging
-
-14.1.1 Debugging in General
----------------------------
-
-(If you have used debuggers in other languages, you may want to skip
-ahead to *note Awk Debugging::.)
-
- Of course, a debugging program cannot remove bugs for you, because it
-has no way of knowing what you or your users consider a "bug" versus a
-"feature." (Sometimes, we humans have a hard time with this ourselves.)
-In that case, what can you expect from such a tool? The answer to that
-depends on the language being debugged, but in general, you can expect
-at least the following:
-
- * The ability to watch a program execute its instructions one by one,
- giving you, the programmer, the opportunity to think about what is
- happening on a time scale of seconds, minutes, or hours, rather
- than the nanosecond time scale at which the code usually runs.
-
- * The opportunity to not only passively observe the operation of your
- program, but to control it and try different paths of execution,
- without having to change your source files.
-
- * The chance to see the values of data in the program at any point in
- execution, and also to change that data on the fly, to see how that
- affects what happens afterward. (This often includes the ability
- to look at internal data structures besides the variables you
- actually defined in your code.)
-
- * The ability to obtain additional information about your program's
- state or even its internal structure.
-
- All of these tools provide a great amount of help in using your own
-skills and understanding of the goals of your program to find where it
-is going wrong (or, for that matter, to better comprehend a perfectly
-functional program that you or someone else wrote).
-
-
-File: gawk.info, Node: Debugging Terms, Next: Awk Debugging, Prev: Debugging Concepts, Up: Debugging
-
-14.1.2 Debugging Concepts
--------------------------
-
-Before diving in to the details, we need to introduce several important
-concepts that apply to just about all debuggers. The following list
-defines terms used throughout the rest of this major node:
-
-"Stack frame"
- Programs generally call functions during the course of their
- execution. One function can call another, or a function can call
- itself (recursion). You can view the chain of called functions
- (main program calls A, which calls B, which calls C), as a stack of
- executing functions: the currently running function is the topmost
- one on the stack, and when it finishes (returns), the next one down
- then becomes the active function. Such a stack is termed a "call
- stack".
-
- For each function on the call stack, the system maintains a data
- area that contains the function's parameters, local variables, and
- return value, as well as any other "bookkeeping" information needed
- to manage the call stack. This data area is termed a "stack
- frame".
-
- 'gawk' also follows this model, and gives you access to the call
- stack and to each stack frame. You can see the call stack, as well
- as from where each function on the stack was invoked. Commands
- that print the call stack print information about each stack frame
- (as detailed later on).
-
-"Breakpoint"
- During debugging, you often wish to let the program run until it
- reaches a certain point, and then continue execution from there one
- statement (or instruction) at a time. The way to do this is to set
- a "breakpoint" within the program. A breakpoint is where the
- execution of the program should break off (stop), so that you can
- take over control of the program's execution. You can add and
- remove as many breakpoints as you like.
-
-"Watchpoint"
- A watchpoint is similar to a breakpoint. The difference is that
- breakpoints are oriented around the code: stop when a certain point
- in the code is reached. A watchpoint, however, specifies that
- program execution should stop when a _data value_ is changed. This
- is useful, as sometimes it happens that a variable receives an
- erroneous value, and it's hard to track down where this happens
- just by looking at the code. By using a watchpoint, you can stop
- whenever a variable is assigned to, and usually find the errant
- code quite quickly.
-
-
-File: gawk.info, Node: Awk Debugging, Prev: Debugging Terms, Up: Debugging
-
-14.1.3 'awk' Debugging
-----------------------
-
-Debugging an 'awk' program has some specific aspects that are not shared
-with programs written in other languages.
-
- First of all, the fact that 'awk' programs usually take input line by
-line from a file or files and operate on those lines using specific
-rules makes it especially useful to organize viewing the execution of
-the program in terms of these rules. As we will see, each 'awk' rule is
-treated almost like a function call, with its own specific block of
-instructions.
-
- In addition, because 'awk' is by design a very concise language, it
-is easy to lose sight of everything that is going on "inside" each line
-of 'awk' code. The debugger provides the opportunity to look at the
-individual primitive instructions carried out by the higher-level 'awk'
-commands.
-
-
-File: gawk.info, Node: Sample Debugging Session, Next: List of Debugger Commands, Prev: Debugging, Up: Debugger
-
-14.2 Sample 'gawk' Debugging Session
-====================================
-
-In order to illustrate the use of 'gawk' as a debugger, let's look at a
-sample debugging session. We will use the 'awk' implementation of the
-POSIX 'uniq' command described earlier (*note Uniq Program::) as our
-example.
-
-* Menu:
-
-* Debugger Invocation:: How to Start the Debugger.
-* Finding The Bug:: Finding the Bug.
-
-
-File: gawk.info, Node: Debugger Invocation, Next: Finding The Bug, Up: Sample Debugging Session
-
-14.2.1 How to Start the Debugger
---------------------------------
-
-Starting the debugger is almost exactly like running 'gawk' normally,
-except you have to pass an additional option, '--debug', or the
-corresponding short option, '-D'. The file(s) containing the program
-and any supporting code are given on the command line as arguments to
-one or more '-f' options. ('gawk' is not designed to debug command-line
-programs, only programs contained in files.) In our case, we invoke the
-debugger like this:
-
- $ gawk -D -f getopt.awk -f join.awk -f uniq.awk -1 inputfile
-
-where both 'getopt.awk' and 'uniq.awk' are in '$AWKPATH'. (Experienced
-users of GDB or similar debuggers should note that this syntax is
-slightly different from what you are used to. With the 'gawk' debugger,
-you give the arguments for running the program in the command line to
-the debugger rather than as part of the 'run' command at the debugger
-prompt.) The '-1' is an option to 'uniq.awk'.
-
- Instead of immediately running the program on 'inputfile', as 'gawk'
-would ordinarily do, the debugger merely loads all the program source
-files, compiles them internally, and then gives us a prompt:
-
- gawk>
-
-from which we can issue commands to the debugger. At this point, no
-code has been executed.
-
-
-File: gawk.info, Node: Finding The Bug, Prev: Debugger Invocation, Up: Sample Debugging Session
-
-14.2.2 Finding the Bug
-----------------------
-
-Let's say that we are having a problem using (a faulty version of)
-'uniq.awk' in the "field-skipping" mode, and it doesn't seem to be
-catching lines which should be identical when skipping the first field,
-such as:
-
- awk is a wonderful program!
- gawk is a wonderful program!
-
- This could happen if we were thinking (C-like) of the fields in a
-record as being numbered in a zero-based fashion, so instead of the
-lines:
-
- clast = join(alast, fcount+1, n)
- cline = join(aline, fcount+1, m)
-
-we wrote:
-
- clast = join(alast, fcount, n)
- cline = join(aline, fcount, m)
-
- The first thing we usually want to do when trying to investigate a
-problem like this is to put a breakpoint in the program so that we can
-watch it at work and catch what it is doing wrong. A reasonable spot
-for a breakpoint in 'uniq.awk' is at the beginning of the function
-'are_equal()', which compares the current line with the previous one.
-To set the breakpoint, use the 'b' (breakpoint) command:
-
- gawk> b are_equal
- -| Breakpoint 1 set at file `awklib/eg/prog/uniq.awk', line 63
-
- The debugger tells us the file and line number where the breakpoint
-is. Now type 'r' or 'run' and the program runs until it hits the
-breakpoint for the first time:
-
- gawk> r
- -| Starting program:
- -| Stopping in Rule ...
- -| Breakpoint 1, are_equal(n, m, clast, cline, alast, aline)
- at `awklib/eg/prog/uniq.awk':63
- -| 63 if (fcount == 0 && charcount == 0)
- gawk>
-
- Now we can look at what's going on inside our program. First of all,
-let's see how we got to where we are. At the prompt, we type 'bt'
-(short for "backtrace"), and the debugger responds with a listing of the
-current stack frames:
-
- gawk> bt
- -| #0 are_equal(n, m, clast, cline, alast, aline)
- at `awklib/eg/prog/uniq.awk':68
- -| #1 in main() at `awklib/eg/prog/uniq.awk':88
-
- This tells us that 'are_equal()' was called by the main program at
-line 88 of 'uniq.awk'. (This is not a big surprise, because this is the
-only call to 'are_equal()' in the program, but in more complex programs,
-knowing who called a function and with what parameters can be the key to
-finding the source of the problem.)
-
- Now that we're in 'are_equal()', we can start looking at the values
-of some variables. Let's say we type 'p n' ('p' is short for "print").
-We would expect to see the value of 'n', a parameter to 'are_equal()'.
-Actually, the debugger gives us:
-
- gawk> p n
- -| n = untyped variable
-
-In this case, 'n' is an uninitialized local variable, because the
-function was called without arguments (*note Function Calls::).
-
- A more useful variable to display might be the current record:
-
- gawk> p $0
- -| $0 = "gawk is a wonderful program!"
-
-This might be a bit puzzling at first, as this is the second line of our
-test input. Let's look at 'NR':
-
- gawk> p NR
- -| NR = 2
-
-So we can see that 'are_equal()' was only called for the second record
-of the file. Of course, this is because our program contains a rule for
-'NR == 1':
-
- NR == 1 {
- last = $0
- next
- }
-
- OK, let's just check that that rule worked correctly:
-
- gawk> p last
- -| last = "awk is a wonderful program!"
-
- Everything we have done so far has verified that the program has
-worked as planned, up to and including the call to 'are_equal()', so the
-problem must be inside this function. To investigate further, we must
-begin "stepping through" the lines of 'are_equal()'. We start by typing
-'n' (for "next"):
-
- gawk> n
- -| 66 if (fcount > 0) {
-
- This tells us that 'gawk' is now ready to execute line 66, which
-decides whether to give the lines the special "field-skipping" treatment
-indicated by the '-1' command-line option. (Notice that we skipped from
-where we were before, at line 63, to here, because the condition in line
-63, 'if (fcount == 0 && charcount == 0)', was false.)
-
- Continuing to step, we now get to the splitting of the current and
-last records:
-
- gawk> n
- -| 67 n = split(last, alast)
- gawk> n
- -| 68 m = split($0, aline)
-
- At this point, we should be curious to see what our records were
-split into, so we try to look:
-
- gawk> p n m alast aline
- -| n = 5
- -| m = untyped variable
- -| alast = array, 5 elements
- -| aline = untyped variable
-
-(The 'p' command can take more than one argument, similar to 'awk''s
-'print' statement.)
-
- This is kind of disappointing, though. All we found out is that
-there are five elements in 'alast'; 'm' and 'aline' don't have values
-because we are at line 68 but haven't executed it yet. This information
-is useful enough (we now know that none of the words were accidentally
-left out), but what if we want to see inside the array?
-
- The first choice would be to use subscripts:
-
- gawk> p alast[0]
- -| "0" not in array `alast'
-
-Oops!
-
- gawk> p alast[1]
- -| alast["1"] = "awk"
-
- This would be kind of slow for a 100-member array, though, so 'gawk'
-provides a shortcut (reminiscent of another language not to be
-mentioned):
-
- gawk> p @alast
- -| alast["1"] = "awk"
- -| alast["2"] = "is"
- -| alast["3"] = "a"
- -| alast["4"] = "wonderful"
- -| alast["5"] = "program!"
-
- It looks like we got this far OK. Let's take another step or two:
-
- gawk> n
- -| 69 clast = join(alast, fcount, n)
- gawk> n
- -| 70 cline = join(aline, fcount, m)
-
- Well, here we are at our error (sorry to spoil the suspense). What
-we had in mind was to join the fields starting from the second one to
-make the virtual record to compare, and if the first field were numbered
-zero, this would work. Let's look at what we've got:
-
- gawk> p cline clast
- -| cline = "gawk is a wonderful program!"
- -| clast = "awk is a wonderful program!"
-
- Hey, those look pretty familiar! They're just our original,
-unaltered input records. A little thinking (the human brain is still
-the best debugging tool), and we realize that we were off by one!
-
- We get out of the debugger:
-
- gawk> q
- -| The program is running. Exit anyway (y/n)? y
-
-Then we get into an editor:
-
- clast = join(alast, fcount+1, n)
- cline = join(aline, fcount+1, m)
-
-and problem solved!
-
-
-File: gawk.info, Node: List of Debugger Commands, Next: Readline Support, Prev: Sample Debugging Session, Up: Debugger
-
-14.3 Main Debugger Commands
-===========================
-
-The 'gawk' debugger command set can be divided into the following
-categories:
-
- * Breakpoint control
-
- * Execution control
-
- * Viewing and changing data
-
- * Working with the stack
-
- * Getting information
-
- * Miscellaneous
-
- Each of these are discussed in the following subsections. In the
-following descriptions, commands that may be abbreviated show the
-abbreviation on a second description line. A debugger command name may
-also be truncated if that partial name is unambiguous. The debugger has
-the built-in capability to automatically repeat the previous command
-just by hitting 'Enter'. This works for the commands 'list', 'next',
-'nexti', 'step', 'stepi', and 'continue' executed without any argument.
-
-* Menu:
-
-* Breakpoint Control:: Control of Breakpoints.
-* Debugger Execution Control:: Control of Execution.
-* Viewing And Changing Data:: Viewing and Changing Data.
-* Execution Stack:: Dealing with the Stack.
-* Debugger Info:: Obtaining Information about the Program and
- the Debugger State.
-* Miscellaneous Debugger Commands:: Miscellaneous Commands.
-
-
-File: gawk.info, Node: Breakpoint Control, Next: Debugger Execution Control, Up: List of Debugger Commands
-
-14.3.1 Control of Breakpoints
------------------------------
-
-As we saw earlier, the first thing you probably want to do in a
-debugging session is to get your breakpoints set up, because your
-program will otherwise just run as if it was not under the debugger.
-The commands for controlling breakpoints are:
-
-'break' [[FILENAME':']N | FUNCTION] ['"EXPRESSION"']
-'b' [[FILENAME':']N | FUNCTION] ['"EXPRESSION"']
- Without any argument, set a breakpoint at the next instruction to
- be executed in the selected stack frame. Arguments can be one of
- the following:
-
- N
- Set a breakpoint at line number N in the current source file.
-
- FILENAME':'N
- Set a breakpoint at line number N in source file FILENAME.
-
- FUNCTION
- Set a breakpoint at entry to (the first instruction of)
- function FUNCTION.
-
- Each breakpoint is assigned a number that can be used to delete it
- from the breakpoint list using the 'delete' command.
-
- With a breakpoint, you may also supply a condition. This is an
- 'awk' expression (enclosed in double quotes) that the debugger
- evaluates whenever the breakpoint is reached. If the condition is
- true, then the debugger stops execution and prompts for a command.
- Otherwise, it continues executing the program.
-
-'clear' [[FILENAME':']N | FUNCTION]
- Without any argument, delete any breakpoint at the next instruction
- to be executed in the selected stack frame. If the program stops
- at a breakpoint, this deletes that breakpoint so that the program
- does not stop at that location again. Arguments can be one of the
- following:
-
- N
- Delete breakpoint(s) set at line number N in the current
- source file.
-
- FILENAME':'N
- Delete breakpoint(s) set at line number N in source file
- FILENAME.
-
- FUNCTION
- Delete breakpoint(s) set at entry to function FUNCTION.
-
-'condition' N '"EXPRESSION"'
- Add a condition to existing breakpoint or watchpoint N. The
- condition is an 'awk' expression _enclosed in double quotes_ that
- the debugger evaluates whenever the breakpoint or watchpoint is
- reached. If the condition is true, then the debugger stops
- execution and prompts for a command. Otherwise, the debugger
- continues executing the program. If the condition expression is
- not specified, any existing condition is removed (i.e., the
- breakpoint or watchpoint is made unconditional).
-
-'delete' [N1 N2 ...] [N-M]
-'d' [N1 N2 ...] [N-M]
- Delete specified breakpoints or a range of breakpoints. Delete all
- defined breakpoints if no argument is supplied.
-
-'disable' [N1 N2 ... | N-M]
- Disable specified breakpoints or a range of breakpoints. Without
- any argument, disable all breakpoints.
-
-'enable' ['del' | 'once'] [N1 N2 ...] [N-M]
-'e' ['del' | 'once'] [N1 N2 ...] [N-M]
- Enable specified breakpoints or a range of breakpoints. Without
- any argument, enable all breakpoints. Optionally, you can specify
- how to enable the breakpoints:
-
- 'del'
- Enable the breakpoints temporarily, then delete each one when
- the program stops at it.
-
- 'once'
- Enable the breakpoints temporarily, then disable each one when
- the program stops at it.
-
-'ignore' N COUNT
- Ignore breakpoint number N the next COUNT times it is hit.
-
-'tbreak' [[FILENAME':']N | FUNCTION]
-'t' [[FILENAME':']N | FUNCTION]
- Set a temporary breakpoint (enabled for only one stop). The
- arguments are the same as for 'break'.
-
-
-File: gawk.info, Node: Debugger Execution Control, Next: Viewing And Changing Data, Prev: Breakpoint Control, Up: List of Debugger Commands
-
-14.3.2 Control of Execution
----------------------------
-
-Now that your breakpoints are ready, you can start running the program
-and observing its behavior. There are more commands for controlling
-execution of the program than we saw in our earlier example:
-
-'commands' [N]
-'silent'
-...
-'end'
- Set a list of commands to be executed upon stopping at a breakpoint
- or watchpoint. N is the breakpoint or watchpoint number. Without
- a number, the last one set is used. The actual commands follow,
- starting on the next line, and terminated by the 'end' command. If
- the command 'silent' is in the list, the usual messages about
- stopping at a breakpoint and the source line are not printed. Any
- command in the list that resumes execution (e.g., 'continue')
- terminates the list (an implicit 'end'), and subsequent commands
- are ignored. For example:
-
- gawk> commands
- > silent
- > printf "A silent breakpoint; i = %d\n", i
- > info locals
- > set i = 10
- > continue
- > end
- gawk>
-
-'continue' [COUNT]
-'c' [COUNT]
- Resume program execution. If continued from a breakpoint and COUNT
- is specified, ignore the breakpoint at that location the next COUNT
- times before stopping.
-
-'finish'
- Execute until the selected stack frame returns. Print the returned
- value.
-
-'next' [COUNT]
-'n' [COUNT]
- Continue execution to the next source line, stepping over function
- calls. The argument COUNT controls how many times to repeat the
- action, as in 'step'.
-
-'nexti' [COUNT]
-'ni' [COUNT]
- Execute one (or COUNT) instruction(s), stepping over function
- calls.
-
-'return' [VALUE]
- Cancel execution of a function call. If VALUE (either a string or
- a number) is specified, it is used as the function's return value.
- If used in a frame other than the innermost one (the currently
- executing function; i.e., frame number 0), discard all inner frames
- in addition to the selected one, and the caller of that frame
- becomes the innermost frame.
-
-'run'
-'r'
- Start/restart execution of the program. When restarting, the
- debugger retains the current breakpoints, watchpoints, command
- history, automatic display variables, and debugger options.
-
-'step' [COUNT]
-'s' [COUNT]
- Continue execution until control reaches a different source line in
- the current stack frame, stepping inside any function called within
- the line. If the argument COUNT is supplied, steps that many times
- before stopping, unless it encounters a breakpoint or watchpoint.
-
-'stepi' [COUNT]
-'si' [COUNT]
- Execute one (or COUNT) instruction(s), stepping inside function
- calls. (For illustration of what is meant by an "instruction" in
- 'gawk', see the output shown under 'dump' in *note Miscellaneous
- Debugger Commands::.)
-
-'until' [[FILENAME':']N | FUNCTION]
-'u' [[FILENAME':']N | FUNCTION]
- Without any argument, continue execution until a line past the
- current line in the current stack frame is reached. With an
- argument, continue execution until the specified location is
- reached, or the current stack frame returns.
-
-
-File: gawk.info, Node: Viewing And Changing Data, Next: Execution Stack, Prev: Debugger Execution Control, Up: List of Debugger Commands
-
-14.3.3 Viewing and Changing Data
---------------------------------
-
-The commands for viewing and changing variables inside of 'gawk' are:
-
-'display' [VAR | '$'N]
- Add variable VAR (or field '$N') to the display list. The value of
- the variable or field is displayed each time the program stops.
- Each variable added to the list is identified by a unique number:
-
- gawk> display x
- -| 10: x = 1
-
- This displays the assigned item number, the variable name, and its
- current value. If the display variable refers to a function
- parameter, it is silently deleted from the list as soon as the
- execution reaches a context where no such variable of the given
- name exists. Without argument, 'display' displays the current
- values of items on the list.
-
-'eval "AWK STATEMENTS"'
- Evaluate AWK STATEMENTS in the context of the running program. You
- can do anything that an 'awk' program would do: assign values to
- variables, call functions, and so on.
-
-'eval' PARAM, ...
-AWK STATEMENTS
-'end'
- This form of 'eval' is similar, but it allows you to define "local
- variables" that exist in the context of the AWK STATEMENTS, instead
- of using variables or function parameters defined by the program.
-
-'print' VAR1[',' VAR2 ...]
-'p' VAR1[',' VAR2 ...]
- Print the value of a 'gawk' variable or field. Fields must be
- referenced by constants:
-
- gawk> print $3
-
- This prints the third field in the input record (if the specified
- field does not exist, it prints 'Null field'). A variable can be
- an array element, with the subscripts being constant string values.
- To print the contents of an array, prefix the name of the array
- with the '@' symbol:
-
- gawk> print @a
-
- This prints the indices and the corresponding values for all
- elements in the array 'a'.
-
-'printf' FORMAT [',' ARG ...]
- Print formatted text. The FORMAT may include escape sequences,
- such as '\n' (*note Escape Sequences::). No newline is printed
- unless one is specified.
-
-'set' VAR'='VALUE
- Assign a constant (number or string) value to an 'awk' variable or
- field. String values must be enclosed between double quotes
- ('"'...'"').
-
- You can also set special 'awk' variables, such as 'FS', 'NF', 'NR',
- and so on.
-
-'watch' VAR | '$'N ['"EXPRESSION"']
-'w' VAR | '$'N ['"EXPRESSION"']
- Add variable VAR (or field '$N') to the watch list. The debugger
- then stops whenever the value of the variable or field changes.
- Each watched item is assigned a number that can be used to delete
- it from the watch list using the 'unwatch' command.
-
- With a watchpoint, you may also supply a condition. This is an
- 'awk' expression (enclosed in double quotes) that the debugger
- evaluates whenever the watchpoint is reached. If the condition is
- true, then the debugger stops execution and prompts for a command.
- Otherwise, 'gawk' continues executing the program.
-
-'undisplay' [N]
- Remove item number N (or all items, if no argument) from the
- automatic display list.
-
-'unwatch' [N]
- Remove item number N (or all items, if no argument) from the watch
- list.
-
-
-File: gawk.info, Node: Execution Stack, Next: Debugger Info, Prev: Viewing And Changing Data, Up: List of Debugger Commands
-
-14.3.4 Working with the Stack
------------------------------
-
-Whenever you run a program that contains any function calls, 'gawk'
-maintains a stack of all of the function calls leading up to where the
-program is right now. You can see how you got to where you are, and
-also move around in the stack to see what the state of things was in the
-functions that called the one you are in. The commands for doing this
-are:
-
-'backtrace' [COUNT]
-'bt' [COUNT]
-'where' [COUNT]
- Print a backtrace of all function calls (stack frames), or
- innermost COUNT frames if COUNT > 0. Print the outermost COUNT
- frames if COUNT < 0. The backtrace displays the name and arguments
- to each function, the source file name, and the line number. The
- alias 'where' for 'backtrace' is provided for longtime GDB users
- who may be used to that command.
-
-'down' [COUNT]
- Move COUNT (default 1) frames down the stack toward the innermost
- frame. Then select and print the frame.
-
-'frame' [N]
-'f' [N]
- Select and print stack frame N. Frame 0 is the currently
- executing, or "innermost", frame (function call); frame 1 is the
- frame that called the innermost one. The highest-numbered frame is
- the one for the main program. The printed information consists of
- the frame number, function and argument names, source file, and the
- source line.
-
-'up' [COUNT]
- Move COUNT (default 1) frames up the stack toward the outermost
- frame. Then select and print the frame.
-
-
-File: gawk.info, Node: Debugger Info, Next: Miscellaneous Debugger Commands, Prev: Execution Stack, Up: List of Debugger Commands
-
-14.3.5 Obtaining Information About the Program and the Debugger State
----------------------------------------------------------------------
-
-Besides looking at the values of variables, there is often a need to get
-other sorts of information about the state of your program and of the
-debugging environment itself. The 'gawk' debugger has one command that
-provides this information, appropriately called 'info'. 'info' is used
-with one of a number of arguments that tell it exactly what you want to
-know:
-
-'info' WHAT
-'i' WHAT
- The value for WHAT should be one of the following:
-
- 'args'
- List arguments of the selected frame.
-
- 'break'
- List all currently set breakpoints.
-
- 'display'
- List all items in the automatic display list.
-
- 'frame'
- Give a description of the selected stack frame.
-
- 'functions'
- List all function definitions including source file names and
- line numbers.
-
- 'locals'
- List local variables of the selected frame.
-
- 'source'
- Print the name of the current source file. Each time the
- program stops, the current source file is the file containing
- the current instruction. When the debugger first starts, the
- current source file is the first file included via the '-f'
- option. The 'list FILENAME:LINENO' command can be used at any
- time to change the current source.
-
- 'sources'
- List all program sources.
-
- 'variables'
- List all global variables.
-
- 'watch'
- List all items in the watch list.
-
- Additional commands give you control over the debugger, the ability
-to save the debugger's state, and the ability to run debugger commands
-from a file. The commands are:
-
-'option' [NAME['='VALUE]]
-'o' [NAME['='VALUE]]
- Without an argument, display the available debugger options and
- their current values. 'option NAME' shows the current value of the
- named option. 'option NAME=VALUE' assigns a new value to the named
- option. The available options are:
-
- 'history_size'
- Set the maximum number of lines to keep in the history file
- './.gawk_history'. The default is 100.
-
- 'listsize'
- Specify the number of lines that 'list' prints. The default
- is 15.
-
- 'outfile'
- Send 'gawk' output to a file; debugger output still goes to
- standard output. An empty string ('""') resets output to
- standard output.
-
- 'prompt'
- Change the debugger prompt. The default is 'gawk> '.
-
- 'save_history' ['on' | 'off']
- Save command history to file './.gawk_history'. The default
- is 'on'.
-
- 'save_options' ['on' | 'off']
- Save current options to file './.gawkrc' upon exit. The
- default is 'on'. Options are read back into the next session
- upon startup.
-
- 'trace' ['on' | 'off']
- Turn instruction tracing on or off. The default is 'off'.
-
-'save' FILENAME
- Save the commands from the current session to the given file name,
- so that they can be replayed using the 'source' command.
-
-'source' FILENAME
- Run command(s) from a file; an error in any command does not
- terminate execution of subsequent commands. Comments (lines
- starting with '#') are allowed in a command file. Empty lines are
- ignored; they do _not_ repeat the last command. You can't restart
- the program by having more than one 'run' command in the file.
- Also, the list of commands may include additional 'source'
- commands; however, the 'gawk' debugger will not source the same
- file more than once in order to avoid infinite recursion.
-
- In addition to, or instead of, the 'source' command, you can use
- the '-D FILE' or '--debug=FILE' command-line options to execute
- commands from a file non-interactively (*note Options::).
-
-
-File: gawk.info, Node: Miscellaneous Debugger Commands, Prev: Debugger Info, Up: List of Debugger Commands
-
-14.3.6 Miscellaneous Commands
------------------------------
-
-There are a few more commands that do not fit into the previous
-categories, as follows:
-
-'dump' [FILENAME]
- Dump byte code of the program to standard output or to the file
- named in FILENAME. This prints a representation of the internal
- instructions that 'gawk' executes to implement the 'awk' commands
- in a program. This can be very enlightening, as the following
- partial dump of Davide Brini's obfuscated code (*note Signature
- Program::) demonstrates:
-
- gawk> dump
- -| # BEGIN
- -|
- -| [ 1:0xfcd340] Op_rule : [in_rule = BEGIN] [source_file = brini.awk]
- -| [ 1:0xfcc240] Op_push_i : "~" [MALLOC|STRING|STRCUR]
- -| [ 1:0xfcc2a0] Op_push_i : "~" [MALLOC|STRING|STRCUR]
- -| [ 1:0xfcc280] Op_match :
- -| [ 1:0xfcc1e0] Op_store_var : O
- -| [ 1:0xfcc2e0] Op_push_i : "==" [MALLOC|STRING|STRCUR]
- -| [ 1:0xfcc340] Op_push_i : "==" [MALLOC|STRING|STRCUR]
- -| [ 1:0xfcc320] Op_equal :
- -| [ 1:0xfcc200] Op_store_var : o
- -| [ 1:0xfcc380] Op_push : o
- -| [ 1:0xfcc360] Op_plus_i : 0 [MALLOC|NUMCUR|NUMBER]
- -| [ 1:0xfcc220] Op_push_lhs : o [do_reference = true]
- -| [ 1:0xfcc300] Op_assign_plus :
- -| [ :0xfcc2c0] Op_pop :
- -| [ 1:0xfcc400] Op_push : O
- -| [ 1:0xfcc420] Op_push_i : "" [MALLOC|STRING|STRCUR]
- -| [ :0xfcc4a0] Op_no_op :
- -| [ 1:0xfcc480] Op_push : O
- -| [ :0xfcc4c0] Op_concat : [expr_count = 3] [concat_flag = 0]
- -| [ 1:0xfcc3c0] Op_store_var : x
- -| [ 1:0xfcc440] Op_push_lhs : X [do_reference = true]
- -| [ 1:0xfcc3a0] Op_postincrement :
- -| [ 1:0xfcc4e0] Op_push : x
- -| [ 1:0xfcc540] Op_push : o
- -| [ 1:0xfcc500] Op_plus :
- -| [ 1:0xfcc580] Op_push : o
- -| [ 1:0xfcc560] Op_plus :
- -| [ 1:0xfcc460] Op_leq :
- -| [ :0xfcc5c0] Op_jmp_false : [target_jmp = 0xfcc5e0]
- -| [ 1:0xfcc600] Op_push_i : "%c" [MALLOC|STRING|STRCUR]
- -| [ :0xfcc660] Op_no_op :
- -| [ 1:0xfcc520] Op_assign_concat : c
- -| [ :0xfcc620] Op_jmp : [target_jmp = 0xfcc440]
- -|
- ...
- -|
- -| [ 2:0xfcc5a0] Op_K_printf : [expr_count = 17] [redir_type = ""]
- -| [ :0xfcc140] Op_no_op :
- -| [ :0xfcc1c0] Op_atexit :
- -| [ :0xfcc640] Op_stop :
- -| [ :0xfcc180] Op_no_op :
- -| [ :0xfcd150] Op_after_beginfile :
- -| [ :0xfcc160] Op_no_op :
- -| [ :0xfcc1a0] Op_after_endfile :
- gawk>
-
-'exit'
- Exit the debugger. See the entry for 'quit', later in this list.
-
-'help'
-'h'
- Print a list of all of the 'gawk' debugger commands with a short
- summary of their usage. 'help COMMAND' prints the information
- about the command COMMAND.
-
-'list' ['-' | '+' | N | FILENAME':'N | N-M | FUNCTION]
-'l' ['-' | '+' | N | FILENAME':'N | N-M | FUNCTION]
- Print the specified lines (default 15) from the current source file
- or the file named FILENAME. The possible arguments to 'list' are
- as follows:
-
- '-' (Minus)
- Print lines before the lines last printed.
-
- '+'
- Print lines after the lines last printed. 'list' without any
- argument does the same thing.
-
- N
- Print lines centered around line number N.
-
- N-M
- Print lines from N to M.
-
- FILENAME':'N
- Print lines centered around line number N in source file
- FILENAME. This command may change the current source file.
-
- FUNCTION
- Print lines centered around the beginning of the function
- FUNCTION. This command may change the current source file.
-
-'quit'
-'q'
- Exit the debugger. Debugging is great fun, but sometimes we all
- have to tend to other obligations in life, and sometimes we find
- the bug and are free to go on to the next one! As we saw earlier,
- if you are running a program, the debugger warns you when you type
- 'q' or 'quit', to make sure you really want to quit.
-
-'trace' ['on' | 'off']
- Turn on or off continuous printing of the instructions that are
- about to be executed, along with the 'awk' lines they implement.
- The default is 'off'.
-
- It is to be hoped that most of the "opcodes" in these instructions
- are fairly self-explanatory, and using 'stepi' and 'nexti' while
- 'trace' is on will make them into familiar friends.
-
-
-File: gawk.info, Node: Readline Support, Next: Limitations, Prev: List of Debugger Commands, Up: Debugger
-
-14.4 Readline Support
-=====================
-
-If 'gawk' is compiled with the GNU Readline library
-(http://cnswww.cns.cwru.edu/php/chet/readline/readline.html), you can
-take advantage of that library's command completion and history
-expansion features. The following types of completion are available:
-
-Command completion
- Command names.
-
-Source file name completion
- Source file names. Relevant commands are 'break', 'clear', 'list',
- 'tbreak', and 'until'.
-
-Argument completion
- Non-numeric arguments to a command. Relevant commands are 'enable'
- and 'info'.
-
-Variable name completion
- Global variable names, and function arguments in the current
- context if the program is running. Relevant commands are
- 'display', 'print', 'set', and 'watch'.
-
-
-File: gawk.info, Node: Limitations, Next: Debugging Summary, Prev: Readline Support, Up: Debugger
-
-14.5 Limitations
-================
-
-We hope you find the 'gawk' debugger useful and enjoyable to work with,
-but as with any program, especially in its early releases, it still has
-some limitations. A few that it's worth being aware of are:
-
- * At this point, the debugger does not give a detailed explanation of
- what you did wrong when you type in something it doesn't like.
- Rather, it just responds 'syntax error'. When you do figure out
- what your mistake was, though, you'll feel like a real guru.
-
- * If you perused the dump of opcodes in *note Miscellaneous Debugger
- Commands:: (or if you are already familiar with 'gawk' internals),
- you will realize that much of the internal manipulation of data in
- 'gawk', as in many interpreters, is done on a stack. 'Op_push',
- 'Op_pop', and the like are the "bread and butter" of most 'gawk'
- code.
-
- Unfortunately, as of now, the 'gawk' debugger does not allow you to
- examine the stack's contents. That is, the intermediate results of
- expression evaluation are on the stack, but cannot be printed.
- Rather, only variables that are defined in the program can be
- printed. Of course, a workaround for this is to use more explicit
- variables at the debugging stage and then change back to obscure,
- perhaps more optimal code later.
-
- * There is no way to look "inside" the process of compiling regular
- expressions to see if you got it right. As an 'awk' programmer,
- you are expected to know the meaning of '/[^[:alnum:][:blank:]]/'.
-
- * The 'gawk' debugger is designed to be used by running a program
- (with all its parameters) on the command line, as described in
- *note Debugger Invocation::. There is no way (as of now) to attach
- or "break into" a running program. This seems reasonable for a
- language that is used mainly for quickly executing, short programs.
-
- * The 'gawk' debugger only accepts source code supplied with the '-f'
- option.
-
- One other point is worth discussing. Conventional debuggers run in a
-separate process (and thus address space) from the programs that they
-debug (the "debuggee", if you will).
-
- The 'gawk' debugger is different; it is an integrated part of 'gawk'
-itself. This makes it possible, in rare cases, for 'gawk' to become an
-excellent demonstrator of Heisenberg Uncertainty physics, where the mere
-act of observing something can change it. Consider the following:(1)
-
- $ cat test.awk
- -| { print typeof($1), typeof($2) }
- $ cat test.data
- -| abc 123
- $ gawk -f test.awk test.data
- -| strnum strnum
-
- This is all as expected: field data has the STRNUM attribute (*note
-Variable Typing::). Now watch what happens when we run this program
-under the debugger:
-
- $ gawk -D -f test.awk test.data
- gawk> w $1 Set watchpoint on $1
- -| Watchpoint 1: $1
- gawk> w $2 Set watchpoint on $2
- -| Watchpoint 2: $2
- gawk> r Start the program
- -| Starting program:
- -| Stopping in Rule ...
- -| Watchpoint 1: $1 Watchpoint fires
- -| Old value: ""
- -| New value: "abc"
- -| main() at `test.awk':1
- -| 1 { print typeof($1), typeof($2) }
- gawk> n Keep going ...
- -| Watchpoint 2: $2 Watchpoint fires
- -| Old value: ""
- -| New value: "123"
- -| main() at `test.awk':1
- -| 1 { print typeof($1), typeof($2) }
- gawk> n Get result from typeof()
- -| strnum number Result for $2 isn't right
- -| Program exited normally with exit value: 0
- gawk> quit
-
- In this case, the act of comparing the new value of '$2' with the old
-one caused 'gawk' to evaluate it and determine that it is indeed a
-number, and this is reflected in the result of 'typeof()'.
-
- Cases like this where the debugger is not transparent to the
-program's execution should be rare. If you encounter one, please report
-it (*note Bugs::).
-
- ---------- Footnotes ----------
-
- (1) Thanks to Hermann Peifer for this example.
-
-
-File: gawk.info, Node: Debugging Summary, Prev: Limitations, Up: Debugger
-
-14.6 Summary
-============
-
- * Programs rarely work correctly the first time. Finding bugs is
- called debugging, and a program that helps you find bugs is a
- debugger. 'gawk' has a built-in debugger that works very similarly
- to the GNU Debugger, GDB.
-
- * Debuggers let you step through your program one statement at a
- time, examine and change variable and array values, and do a number
- of other things that let you understand what your program is
- actually doing (as opposed to what it is supposed to do).
-
- * Like most debuggers, the 'gawk' debugger works in terms of stack
- frames, and lets you set both breakpoints (stop at a point in the
- code) and watchpoints (stop when a data value changes).
-
- * The debugger command set is fairly complete, providing control over
- breakpoints, execution, viewing and changing data, working with the
- stack, getting information, and other tasks.
-
- * If the GNU Readline library is available when 'gawk' is compiled,
- it is used by the debugger to provide command-line history and
- editing.
-
- * Usually, the debugger does not not affect the program being
- debugged, but occasionally it can.
-
-
-File: gawk.info, Node: Arbitrary Precision Arithmetic, Next: Dynamic Extensions, Prev: Debugger, Up: Top
-
-15 Arithmetic and Arbitrary-Precision Arithmetic with 'gawk'
-************************************************************
-
-This major node introduces some basic concepts relating to how computers
-do arithmetic and defines some important terms. It then proceeds to
-describe floating-point arithmetic, which is what 'awk' uses for all its
-computations, including a discussion of arbitrary-precision
-floating-point arithmetic, which is a feature available only in 'gawk'.
-It continues on to present arbitrary-precision integers, and concludes
-with a description of some points where 'gawk' and the POSIX standard
-are not quite in agreement.
-
- NOTE: Most users of 'gawk' can safely skip this chapter. But if
- you want to do scientific calculations with 'gawk', this is the
- place to be.
-
-* Menu:
-
-* Computer Arithmetic:: A quick intro to computer math.
-* Math Definitions:: Defining terms used.
-* MPFR features:: The MPFR features in 'gawk'.
-* FP Math Caution:: Things to know.
-* Arbitrary Precision Integers:: Arbitrary Precision Integer Arithmetic with
- 'gawk'.
-* POSIX Floating Point Problems:: Standards Versus Existing Practice.
-* Floating point summary:: Summary of floating point discussion.
-
-
-File: gawk.info, Node: Computer Arithmetic, Next: Math Definitions, Up: Arbitrary Precision Arithmetic
-
-15.1 A General Description of Computer Arithmetic
-=================================================
-
-Until now, we have worked with data as either numbers or strings.
-Ultimately, however, computers represent everything in terms of "binary
-digits", or "bits". A decimal digit can take on any of 10 values: zero
-through nine. A binary digit can take on any of two values, zero or
-one. Using binary, computers (and computer software) can represent and
-manipulate numerical and character data. In general, the more bits you
-can use to represent a particular thing, the greater the range of
-possible values it can take on.
-
- Modern computers support at least two, and often more, ways to do
-arithmetic. Each kind of arithmetic uses a different representation
-(organization of the bits) for the numbers. The kinds of arithmetic
-that interest us are:
-
-Decimal arithmetic
- This is the kind of arithmetic you learned in elementary school,
- using paper and pencil (and/or a calculator). In theory, numbers
- can have an arbitrary number of digits on either side (or both
- sides) of the decimal point, and the results of a computation are
- always exact.
-
- Some modern systems can do decimal arithmetic in hardware, but
- usually you need a special software library to provide access to
- these instructions. There are also libraries that do decimal
- arithmetic entirely in software.
-
- Despite the fact that some users expect 'gawk' to be performing
- decimal arithmetic,(1) it does not do so.
-
-Integer arithmetic
- In school, integer values were referred to as "whole" numbers--that
- is, numbers without any fractional part, such as 1, 42, or -17.
- The advantage to integer numbers is that they represent values
- exactly. The disadvantage is that their range is limited.
-
- In computers, integer values come in two flavors: "signed" and
- "unsigned". Signed values may be negative or positive, whereas
- unsigned values are always greater than or equal to zero.
-
- In computer systems, integer arithmetic is exact, but the possible
- range of values is limited. Integer arithmetic is generally faster
- than floating-point arithmetic.
-
-Floating-point arithmetic
- Floating-point numbers represent what were called in school "real"
- numbers (i.e., those that have a fractional part, such as
- 3.1415927). The advantage to floating-point numbers is that they
- can represent a much larger range of values than can integers. The
- disadvantage is that there are numbers that they cannot represent
- exactly.
-
- Modern systems support floating-point arithmetic in hardware, with
- a limited range of values. There are software libraries that allow
- the use of arbitrary-precision floating-point calculations.
-
- POSIX 'awk' uses "double-precision" floating-point numbers, which
- can hold more digits than "single-precision" floating-point
- numbers. 'gawk' has facilities for performing arbitrary-precision
- floating-point arithmetic, which we describe in more detail
- shortly.
-
- Computers work with integer and floating-point values of different
-ranges. Integer values are usually either 32 or 64 bits in size.
-Single-precision floating-point values occupy 32 bits, whereas
-double-precision floating-point values occupy 64 bits. Floating-point
-values are always signed. The possible ranges of values are shown in
-*note Table 15.1: table-numeric-ranges.
-
-Numeric representation Minimum value Maximum value
----------------------------------------------------------------------------
-32-bit signed integer -2,147,483,648 2,147,483,647
-32-bit unsigned 0 4,294,967,295
-integer
-64-bit signed integer -9,223,372,036,854,775,8089,223,372,036,854,775,807
-64-bit unsigned 0 18,446,744,073,709,551,615
-integer
-Single-precision 1.175494e-38 3.402823e38
-floating point
-(approximate)
-Double-precision 2.225074e-308 1.797693e308
-floating point
-(approximate)
-
-Table 15.1: Value ranges for different numeric representations
-
- ---------- Footnotes ----------
-
- (1) We don't know why they expect this, but they do.
-
-
-File: gawk.info, Node: Math Definitions, Next: MPFR features, Prev: Computer Arithmetic, Up: Arbitrary Precision Arithmetic
-
-15.2 Other Stuff to Know
-========================
-
-The rest of this major node uses a number of terms. Here are some
-informal definitions that should help you work your way through the
-material here:
-
-"Accuracy"
- A floating-point calculation's accuracy is how close it comes to
- the real (paper and pencil) value.
-
-"Error"
- The difference between what the result of a computation "should be"
- and what it actually is. It is best to minimize error as much as
- possible.
-
-"Exponent"
- The order of magnitude of a value; some number of bits in a
- floating-point value store the exponent.
-
-"Inf"
- A special value representing infinity. Operations involving
- another number and infinity produce infinity.
-
-"NaN"
- "Not a number."(1) A special value that results from attempting a
- calculation that has no answer as a real number. In such a case,
- programs can either receive a floating-point exception, or get
- 'NaN' back as the result. The IEEE 754 standard recommends that
- systems return 'NaN'. Some examples:
-
- 'sqrt(-1)'
- This makes sense in the range of complex numbers, but not in
- the range of real numbers, so the result is 'NaN'.
-
- 'log(-8)'
- -8 is out of the domain of 'log()', so the result is 'NaN'.
-
-"Normalized"
- How the significand (see later in this list) is usually stored.
- The value is adjusted so that the first bit is one, and then that
- leading one is assumed instead of physically stored. This provides
- one extra bit of precision.
-
-"Precision"
- The number of bits used to represent a floating-point number. The
- more bits, the more digits you can represent. Binary and decimal
- precisions are related approximately, according to the formula:
-
- PREC = 3.322 * DPS
-
- Here, _prec_ denotes the binary precision (measured in bits) and
- _dps_ (short for decimal places) is the decimal digits.
-
-"Rounding mode"
- How numbers are rounded up or down when necessary. More details
- are provided later.
-
-"Significand"
- A floating-point value consists of the significand multiplied by 10
- to the power of the exponent. For example, in '1.2345e67', the
- significand is '1.2345'.
-
-"Stability"
- From the Wikipedia article on numerical stability
- (http://en.wikipedia.org/wiki/Numerical_stability): "Calculations
- that can be proven not to magnify approximation errors are called
- "numerically stable"."
-
- See the Wikipedia article on accuracy and precision
-(http://en.wikipedia.org/wiki/Accuracy_and_precision) for more
-information on some of those terms.
-
- On modern systems, floating-point hardware uses the representation
-and operations defined by the IEEE 754 standard. Three of the standard
-IEEE 754 types are 32-bit single precision, 64-bit double precision, and
-128-bit quadruple precision. The standard also specifies extended
-precision formats to allow greater precisions and larger exponent
-ranges. ('awk' uses only the 64-bit double-precision format.)
-
- *note Table 15.2: table-ieee-formats. lists the precision and
-exponent field values for the basic IEEE 754 binary formats.
-
-Name Total bits Precision Minimum Maximum
- exponent exponent
----------------------------------------------------------------------------
-Single 32 24 -126 +127
-Double 64 53 -1022 +1023
-Quadruple 128 113 -16382 +16383
-
-Table 15.2: Basic IEEE format values
-
- NOTE: The precision numbers include the implied leading one that
- gives them one extra bit of significand.
-
- ---------- Footnotes ----------
-
- (1) Thanks to Michael Brennan for this description, which we have
-paraphrased, and for the examples.
-
-
-File: gawk.info, Node: MPFR features, Next: FP Math Caution, Prev: Math Definitions, Up: Arbitrary Precision Arithmetic
-
-15.3 Arbitrary-Precision Arithmetic Features in 'gawk'
-======================================================
-
-By default, 'gawk' uses the double-precision floating-point values
-supplied by the hardware of the system it runs on. However, if it was
-compiled to do so, and the '-M' command-line option is supplied, 'gawk'
-uses the GNU MPFR (http://www.mpfr.org) and GNU MP (http://gmplib.org)
-(GMP) libraries for arbitrary-precision arithmetic on numbers. You can
-see if MPFR support is available like so:
-
- $ gawk --version
- -| GNU Awk 4.1.2, API: 1.1 (GNU MPFR 3.1.0-p3, GNU MP 5.0.2)
- -| Copyright (C) 1989, 1991-2015 Free Software Foundation.
- ...
-
-(You may see different version numbers than what's shown here. That's
-OK; what's important is to see that GNU MPFR and GNU MP are listed in
-the output.)
-
- Additionally, there are a few elements available in the 'PROCINFO'
-array to provide information about the MPFR and GMP libraries (*note
-Auto-set::).
-
- The MPFR library provides precise control over precisions and
-rounding modes, and gives correctly rounded, reproducible,
-platform-independent results. With the '-M' command-line option, all
-floating-point arithmetic operators and numeric functions can yield
-results to any desired precision level supported by MPFR.
-
- Two predefined variables, 'PREC' and 'ROUNDMODE', provide control
-over the working precision and the rounding mode. The precision and the
-rounding mode are set globally for every operation to follow. *Note
-Setting precision:: and *note Setting the rounding mode:: for more
-information.
-
-
-File: gawk.info, Node: FP Math Caution, Next: Arbitrary Precision Integers, Prev: MPFR features, Up: Arbitrary Precision Arithmetic
-
-15.4 Floating-Point Arithmetic: Caveat Emptor!
-==============================================
-
- Math class is tough!
- -- _Teen Talk Barbie, July 1992_
-
- This minor node provides a high-level overview of the issues involved
-when doing lots of floating-point arithmetic.(1) The discussion applies
-to both hardware and arbitrary-precision floating-point arithmetic.
-
- CAUTION: The material here is purposely general. If you need to do
- serious computer arithmetic, you should do some research first, and
- not rely just on what we tell you.
-
-* Menu:
-
-* Inexactness of computations:: Floating point math is not exact.
-* Getting Accuracy:: Getting more accuracy takes some work.
-* Try To Round:: Add digits and round.
-* Setting precision:: How to set the precision.
-* Setting the rounding mode:: How to set the rounding mode.
-
- ---------- Footnotes ----------
-
- (1) There is a very nice paper on floating-point arithmetic
-(http://www.validlab.com/goldberg/paper.pdf) by David Goldberg, "What
-Every Computer Scientist Should Know About Floating-Point Arithmetic,"
-'ACM Computing Surveys' *23*, 1 (1991-03): 5-48. This is worth reading
-if you are interested in the details, but it does require a background
-in computer science.
-
-
-File: gawk.info, Node: Inexactness of computations, Next: Getting Accuracy, Up: FP Math Caution
-
-15.4.1 Floating-Point Arithmetic Is Not Exact
----------------------------------------------
-
-Binary floating-point representations and arithmetic are inexact.
-Simple values like 0.1 cannot be precisely represented using binary
-floating-point numbers, and the limited precision of floating-point
-numbers means that slight changes in the order of operations or the
-precision of intermediate storage can change the result. To make
-matters worse, with arbitrary-precision floating-point arithmetic, you
-can set the precision before starting a computation, but then you cannot
-be sure of the number of significant decimal places in the final result.
-
-* Menu:
-
-* Inexact representation:: Numbers are not exactly represented.
-* Comparing FP Values:: How to compare floating point values.
-* Errors accumulate:: Errors get bigger as they go.
-
-
-File: gawk.info, Node: Inexact representation, Next: Comparing FP Values, Up: Inexactness of computations
-
-15.4.1.1 Many Numbers Cannot Be Represented Exactly
-...................................................
-
-So, before you start to write any code, you should think about what you
-really want and what's really happening. Consider the two numbers in
-the following example:
-
- x = 0.875 # 1/2 + 1/4 + 1/8
- y = 0.425
-
- Unlike the number in 'y', the number stored in 'x' is exactly
-representable in binary because it can be written as a finite sum of one
-or more fractions whose denominators are all powers of two. When 'gawk'
-reads a floating-point number from program source, it automatically
-rounds that number to whatever precision your machine supports. If you
-try to print the numeric content of a variable using an output format
-string of '"%.17g"', it may not produce the same number as you assigned
-to it:
-
- $ gawk 'BEGIN { x = 0.875; y = 0.425
- > printf("%0.17g, %0.17g\n", x, y) }'
- -| 0.875, 0.42499999999999999
-
- Often the error is so small you do not even notice it, and if you do,
-you can always specify how much precision you would like in your output.
-Usually this is a format string like '"%.15g"', which, when used in the
-previous example, produces an output identical to the input.
-
-
-File: gawk.info, Node: Comparing FP Values, Next: Errors accumulate, Prev: Inexact representation, Up: Inexactness of computations
-
-15.4.1.2 Be Careful Comparing Values
-....................................
-
-Because the underlying representation can be a little bit off from the
-exact value, comparing floating-point values to see if they are exactly
-equal is generally a bad idea. Here is an example where it does not
-work like you would expect:
-
- $ gawk 'BEGIN { print (0.1 + 12.2 == 12.3) }'
- -| 0
-
- The general wisdom when comparing floating-point values is to see if
-they are within some small range of each other (called a "delta", or
-"tolerance"). You have to decide how small a delta is important to you.
-Code to do this looks something like the following:
-
- delta = 0.00001 # for example
- difference = abs(a) - abs(b) # subtract the two values
- if (difference < delta)
- # all ok
- else
- # not ok
-
-(We assume that you have a simple absolute value function named 'abs()'
-defined elsewhere in your program.)
-
-
-File: gawk.info, Node: Errors accumulate, Prev: Comparing FP Values, Up: Inexactness of computations
-
-15.4.1.3 Errors Accumulate
-..........................
-
-The loss of accuracy during a single computation with floating-point
-numbers usually isn't enough to worry about. However, if you compute a
-value that is the result of a sequence of floating-point operations, the
-error can accumulate and greatly affect the computation itself. Here is
-an attempt to compute the value of pi using one of its many series
-representations:
-
- BEGIN {
- x = 1.0 / sqrt(3.0)
- n = 6
- for (i = 1; i < 30; i++) {
- n = n * 2.0
- x = (sqrt(x * x + 1) - 1) / x
- printf("%.15f\n", n * x)
- }
- }
-
- When run, the early errors propagate through later computations,
-causing the loop to terminate prematurely after attempting to divide by
-zero:
-
- $ gawk -f pi.awk
- -| 3.215390309173475
- -| 3.159659942097510
- -| 3.146086215131467
- -| 3.142714599645573
- ...
- -| 3.224515243534819
- -| 2.791117213058638
- -| 0.000000000000000
- error-> gawk: pi.awk:6: fatal: division by zero attempted
-
- Here is an additional example where the inaccuracies in internal
-representations yield an unexpected result:
-
- $ gawk 'BEGIN {
- > for (d = 1.1; d <= 1.5; d += 0.1) # loop five times (?)
- > i++
- > print i
- > }'
- -| 4
-
-
-File: gawk.info, Node: Getting Accuracy, Next: Try To Round, Prev: Inexactness of computations, Up: FP Math Caution
-
-15.4.2 Getting the Accuracy You Need
-------------------------------------
-
-Can arbitrary-precision arithmetic give exact results? There are no
-easy answers. The standard rules of algebra often do not apply when
-using floating-point arithmetic. Among other things, the distributive
-and associative laws do not hold completely, and order of operation may
-be important for your computation. Rounding error, cumulative precision
-loss, and underflow are often troublesome.
-
- When 'gawk' tests the expressions '0.1 + 12.2' and '12.3' for
-equality using the machine double-precision arithmetic, it decides that
-they are not equal! (*Note Comparing FP Values::.) You can get the
-result you want by increasing the precision; 56 bits in this case does
-the job:
-
- $ gawk -M -v PREC=56 'BEGIN { print (0.1 + 12.2 == 12.3) }'
- -| 1
-
- If adding more bits is good, perhaps adding even more bits of
-precision is better? Here is what happens if we use an even larger
-value of 'PREC':
-
- $ gawk -M -v PREC=201 'BEGIN { print (0.1 + 12.2 == 12.3) }'
- -| 0
-
- This is not a bug in 'gawk' or in the MPFR library. It is easy to
-forget that the finite number of bits used to store the value is often
-just an approximation after proper rounding. The test for equality
-succeeds if and only if _all_ bits in the two operands are exactly the
-same. Because this is not necessarily true after floating-point
-computations with a particular precision and effective rounding mode, a
-straight test for equality may not work. Instead, compare the two
-numbers to see if they are within the desirable delta of each other.
-
- In applications where 15 or fewer decimal places suffice, hardware
-double-precision arithmetic can be adequate, and is usually much faster.
-But you need to keep in mind that every floating-point operation can
-suffer a new rounding error with catastrophic consequences, as
-illustrated by our earlier attempt to compute the value of pi. Extra
-precision can greatly enhance the stability and the accuracy of your
-computation in such cases.
-
- Additionally, you should understand that repeated addition is not
-necessarily equivalent to multiplication in floating-point arithmetic.
-In the example in *note Errors accumulate:::
-
- $ gawk 'BEGIN {
- > for (d = 1.1; d <= 1.5; d += 0.1) # loop five times (?)
- > i++
- > print i
- > }'
- -| 4
-
-you may or may not succeed in getting the correct result by choosing an
-arbitrarily large value for 'PREC'. Reformulation of the problem at
-hand is often the correct approach in such situations.
-
-
-File: gawk.info, Node: Try To Round, Next: Setting precision, Prev: Getting Accuracy, Up: FP Math Caution
-
-15.4.3 Try a Few Extra Bits of Precision and Rounding
------------------------------------------------------
-
-Instead of arbitrary-precision floating-point arithmetic, often all you
-need is an adjustment of your logic or a different order for the
-operations in your calculation. The stability and the accuracy of the
-computation of pi in the earlier example can be enhanced by using the
-following simple algebraic transformation:
-
- (sqrt(x * x + 1) - 1) / x == x / (sqrt(x * x + 1) + 1)
-
-After making this change, the program converges to pi in under 30
-iterations:
-
- $ gawk -f pi2.awk
- -| 3.215390309173473
- -| 3.159659942097501
- -| 3.146086215131436
- -| 3.142714599645370
- -| 3.141873049979825
- ...
- -| 3.141592653589797
- -| 3.141592653589797
-
-
-File: gawk.info, Node: Setting precision, Next: Setting the rounding mode, Prev: Try To Round, Up: FP Math Caution
-
-15.4.4 Setting the Precision
-----------------------------
-
-'gawk' uses a global working precision; it does not keep track of the
-precision or accuracy of individual numbers. Performing an arithmetic
-operation or calling a built-in function rounds the result to the
-current working precision. The default working precision is 53 bits,
-which you can modify using the predefined variable 'PREC'. You can also
-set the value to one of the predefined case-insensitive strings shown in
-*note Table 15.3: table-predefined-precision-strings, to emulate an IEEE
-754 binary format.
-
-'PREC' IEEE 754 binary format
----------------------------------------------------
-'"half"' 16-bit half-precision
-'"single"' Basic 32-bit single precision
-'"double"' Basic 64-bit double precision
-'"quad"' Basic 128-bit quadruple precision
-'"oct"' 256-bit octuple precision
-
-Table 15.3: Predefined precision strings for 'PREC'
-
- The following example illustrates the effects of changing precision
-on arithmetic operations:
-
- $ gawk -M -v PREC=100 'BEGIN { x = 1.0e-400; print x + 0
- > PREC = "double"; print x + 0 }'
- -| 1e-400
- -| 0
-
- CAUTION: Be wary of floating-point constants! When reading a
- floating-point constant from program source code, 'gawk' uses the
- default precision (that of a C 'double'), unless overridden by an
- assignment to the special variable 'PREC' on the command line, to
- store it internally as an MPFR number. Changing the precision
- using 'PREC' in the program text does _not_ change the precision of
- a constant.
-
- If you need to represent a floating-point constant at a higher
- precision than the default and cannot use a command-line assignment
- to 'PREC', you should either specify the constant as a string, or
- as a rational number, whenever possible. The following example
- illustrates the differences among various ways to print a
- floating-point constant:
-
- $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", 0.1) }'
- -| 0.1000000000000000055511151
- $ gawk -M -v PREC=113 'BEGIN { printf("%0.25f\n", 0.1) }'
- -| 0.1000000000000000000000000
- $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", "0.1") }'
- -| 0.1000000000000000000000000
- $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", 1/10) }'
- -| 0.1000000000000000000000000
-
-
-File: gawk.info, Node: Setting the rounding mode, Prev: Setting precision, Up: FP Math Caution
-
-15.4.5 Setting the Rounding Mode
---------------------------------
-
-The 'ROUNDMODE' variable provides program-level control over the
-rounding mode. The correspondence between 'ROUNDMODE' and the IEEE
-rounding modes is shown in *note Table 15.4: table-gawk-rounding-modes.
-
-Rounding mode IEEE name 'ROUNDMODE'
----------------------------------------------------------------------------
-Round to nearest, ties to even 'roundTiesToEven' '"N"' or '"n"'
-Round toward positive infinity 'roundTowardPositive' '"U"' or '"u"'
-Round toward negative infinity 'roundTowardNegative' '"D"' or '"d"'
-Round toward zero 'roundTowardZero' '"Z"' or '"z"'
-Round to nearest, ties away 'roundTiesToAway' '"A"' or '"a"'
-from zero
-
-Table 15.4: 'gawk' rounding modes
-
- 'ROUNDMODE' has the default value '"N"', which selects the IEEE 754
-rounding mode 'roundTiesToEven'. In *note Table 15.4:
-table-gawk-rounding-modes, the value '"A"' selects 'roundTiesToAway'.
-This is only available if your version of the MPFR library supports it;
-otherwise, setting 'ROUNDMODE' to '"A"' has no effect.
-
- The default mode 'roundTiesToEven' is the most preferred, but the
-least intuitive. This method does the obvious thing for most values, by
-rounding them up or down to the nearest digit. For example, rounding
-1.132 to two digits yields 1.13, and rounding 1.157 yields 1.16.
-
- However, when it comes to rounding a value that is exactly halfway
-between, things do not work the way you probably learned in school. In
-this case, the number is rounded to the nearest even digit. So rounding
-0.125 to two digits rounds down to 0.12, but rounding 0.6875 to three
-digits rounds up to 0.688. You probably have already encountered this
-rounding mode when using 'printf' to format floating-point numbers. For
-example:
-
- BEGIN {
- x = -4.5
- for (i = 1; i < 10; i++) {
- x += 1.0
- printf("%4.1f => %2.0f\n", x, x)
- }
- }
-
-produces the following output when run on the author's system:(1)
-
- -3.5 => -4
- -2.5 => -2
- -1.5 => -2
- -0.5 => 0
- 0.5 => 0
- 1.5 => 2
- 2.5 => 2
- 3.5 => 4
- 4.5 => 4
-
- The theory behind 'roundTiesToEven' is that it more or less evenly
-distributes upward and downward rounds of exact halves, which might
-cause any accumulating round-off error to cancel itself out. This is
-the default rounding mode for IEEE 754 computing functions and
-operators.
-
- The other rounding modes are rarely used. Rounding toward positive
-infinity ('roundTowardPositive') and toward negative infinity
-('roundTowardNegative') are often used to implement interval arithmetic,
-where you adjust the rounding mode to calculate upper and lower bounds
-for the range of output. The 'roundTowardZero' mode can be used for
-converting floating-point numbers to integers. The rounding mode
-'roundTiesToAway' rounds the result to the nearest number and selects
-the number with the larger magnitude if a tie occurs.
-
- Some numerical analysts will tell you that your choice of rounding
-style has tremendous impact on the final outcome, and advise you to wait
-until final output for any rounding. Instead, you can often avoid
-round-off error problems by setting the precision initially to some
-value sufficiently larger than the final desired precision, so that the
-accumulation of round-off error does not influence the outcome. If you
-suspect that results from your computation are sensitive to accumulation
-of round-off error, look for a significant difference in output when you
-change the rounding mode to be sure.
-
- ---------- Footnotes ----------
-
- (1) It is possible for the output to be completely different if the C
-library in your system does not use the IEEE 754 even-rounding rule to
-round halfway cases for 'printf'.
-
-
-File: gawk.info, Node: Arbitrary Precision Integers, Next: POSIX Floating Point Problems, Prev: FP Math Caution, Up: Arbitrary Precision Arithmetic
-
-15.5 Arbitrary-Precision Integer Arithmetic with 'gawk'
-=======================================================
-
-When given the '-M' option, 'gawk' performs all integer arithmetic using
-GMP arbitrary-precision integers. Any number that looks like an integer
-in a source or data file is stored as an arbitrary-precision integer.
-The size of the integer is limited only by the available memory. For
-example, the following computes 5^4^3^2, the result of which is beyond
-the limits of ordinary hardware double-precision floating-point values:
-
- $ gawk -M 'BEGIN {
- > x = 5^4^3^2
- > print "number of digits =", length(x)
- > print substr(x, 1, 20), "...", substr(x, length(x) - 19, 20)
- > }'
- -| number of digits = 183231
- -| 62060698786608744707 ... 92256259918212890625
-
- If instead you were to compute the same value using
-arbitrary-precision floating-point values, the precision needed for
-correct output (using the formula 'prec = 3.322 * dps') would be 3.322 x
-183231, or 608693.
-
- The result from an arithmetic operation with an integer and a
-floating-point value is a floating-point value with a precision equal to
-the working precision. The following program calculates the eighth term
-in Sylvester's sequence(1) using a recurrence:
-
- $ gawk -M 'BEGIN {
- > s = 2.0
- > for (i = 1; i <= 7; i++)
- > s = s * (s - 1) + 1
- > print s
- > }'
- -| 113423713055421845118910464
-
- The output differs from the actual number,
-113,423,713,055,421,844,361,000,443, because the default precision of 53
-bits is not enough to represent the floating-point results exactly. You
-can either increase the precision (100 bits is enough in this case), or
-replace the floating-point constant '2.0' with an integer, to perform
-all computations using integer arithmetic to get the correct output.
-
- Sometimes 'gawk' must implicitly convert an arbitrary-precision
-integer into an arbitrary-precision floating-point value. This is
-primarily because the MPFR library does not always provide the relevant
-interface to process arbitrary-precision integers or mixed-mode numbers
-as needed by an operation or function. In such a case, the precision is
-set to the minimum value necessary for exact conversion, and the working
-precision is not used for this purpose. If this is not what you need or
-want, you can employ a subterfuge and convert the integer to floating
-point first, like this:
-
- gawk -M 'BEGIN { n = 13; print (n + 0.0) % 2.0 }'
-
- You can avoid this issue altogether by specifying the number as a
-floating-point value to begin with:
-
- gawk -M 'BEGIN { n = 13.0; print n % 2.0 }'
-
- Note that for this particular example, it is likely best to just use
-the following:
-
- gawk -M 'BEGIN { n = 13; print n % 2 }'
-
- When dividing two arbitrary precision integers with either '/' or
-'%', the result is typically an arbitrary precision floating point value
-(unless the denominator evenly divides into the numerator). In order to
-do integer division or remainder with arbitrary precision integers, use
-the built-in 'intdiv()' function (*note Numeric Functions::).
-
- You can simulate the 'intdiv()' function in standard 'awk' using this
-user-defined function:
-
- # intdiv --- do integer division
-
- function intdiv(numerator, denominator, result)
- {
- split("", result)
-
- numerator = int(numerator)
- denominator = int(denominator)
- result["quotient"] = int(numerator / denominator)
- result["remainder"] = int(numerator % denominator)
-
- return 0.0
- }
-
- The following example program, contributed by Katie Wasserman, uses
-'intdiv()' to compute the digits of pi to as many places as you choose
-to set:
-
- # pi.awk --- compute the digits of pi
-
- BEGIN {
- digits = 100000
- two = 2 * 10 ^ digits
- pi = two
- for (m = digits * 4; m > 0; --m) {
- d = m * 2 + 1
- x = pi * m
- intdiv(x, d, result)
- pi = result["quotient"]
- pi = pi + two
- }
- print pi
- }
-
- When asked about the algorithm used, Katie replied:
-
- It's not that well known but it's not that obscure either. It's
- Euler's modification to Newton's method for calculating pi. Take a
- look at lines (23) - (25) here:
- <http://mathworld.wolfram.com/PiFormulas.html>.
-
- The algorithm I wrote simply expands the multiply by 2 and works
- from the innermost expression outwards. I used this to program HP
- calculators because it's quite easy to modify for tiny memory
- devices with smallish word sizes. See
- <http://www.hpmuseum.org/cgi-sys/cgiwrap/hpmuseum/articles.cgi?read=899>.
-
- ---------- Footnotes ----------
-
- (1) Weisstein, Eric W. 'Sylvester's Sequence'. From MathWorld--A
-Wolfram Web Resource
-(<http://mathworld.wolfram.com/SylvestersSequence.html>).
-
-
-File: gawk.info, Node: POSIX Floating Point Problems, Next: Floating point summary, Prev: Arbitrary Precision Integers, Up: Arbitrary Precision Arithmetic
-
-15.6 Standards Versus Existing Practice
-=======================================
-
-Historically, 'awk' has converted any nonnumeric-looking string to the
-numeric value zero, when required. Furthermore, the original definition
-of the language and the original POSIX standards specified that 'awk'
-only understands decimal numbers (base 10), and not octal (base 8) or
-hexadecimal numbers (base 16).
-
- Changes in the language of the 2001 and 2004 POSIX standards can be
-interpreted to imply that 'awk' should support additional features.
-These features are:
-
- * Interpretation of floating-point data values specified in
- hexadecimal notation (e.g., '0xDEADBEEF'). (Note: data values,
- _not_ source code constants.)
-
- * Support for the special IEEE 754 floating-point values "not a
- number" (NaN), positive infinity ("inf"), and negative infinity
- ("-inf"). In particular, the format for these values is as
- specified by the ISO 1999 C standard, which ignores case and can
- allow implementation-dependent additional characters after the
- 'nan' and allow either 'inf' or 'infinity'.
-
- The first problem is that both of these are clear changes to
-historical practice:
-
- * The 'gawk' maintainer feels that supporting hexadecimal
- floating-point values, in particular, is ugly, and was never
- intended by the original designers to be part of the language.
-
- * Allowing completely alphabetic strings to have valid numeric values
- is also a very severe departure from historical practice.
-
- The second problem is that the 'gawk' maintainer feels that this
-interpretation of the standard, which required a certain amount of
-"language lawyering" to arrive at in the first place, was not even
-intended by the standard developers. In other words, "We see how you
-got where you are, but we don't think that that's where you want to be."
-
- Recognizing these issues, but attempting to provide compatibility
-with the earlier versions of the standard, the 2008 POSIX standard added
-explicit wording to allow, but not require, that 'awk' support
-hexadecimal floating-point values and special values for "not a number"
-and infinity.
-
- Although the 'gawk' maintainer continues to feel that providing those
-features is inadvisable, nevertheless, on systems that support IEEE
-floating point, it seems reasonable to provide _some_ way to support NaN
-and infinity values. The solution implemented in 'gawk' is as follows:
-
- * With the '--posix' command-line option, 'gawk' becomes "hands off."
- String values are passed directly to the system library's
- 'strtod()' function, and if it successfully returns a numeric
- value, that is what's used.(1) By definition, the results are not
- portable across different systems. They are also a little
- surprising:
-
- $ echo nanny | gawk --posix '{ print $1 + 0 }'
- -| nan
- $ echo 0xDeadBeef | gawk --posix '{ print $1 + 0 }'
- -| 3735928559
-
- * Without '--posix', 'gawk' interprets the four string values '+inf',
- '-inf', '+nan', and '-nan' specially, producing the corresponding
- special numeric values. The leading sign acts a signal to 'gawk'
- (and the user) that the value is really numeric. Hexadecimal
- floating point is not supported (unless you also use
- '--non-decimal-data', which is _not_ recommended). For example:
-
- $ echo nanny | gawk '{ print $1 + 0 }'
- -| 0
- $ echo +nan | gawk '{ print $1 + 0 }'
- -| nan
- $ echo 0xDeadBeef | gawk '{ print $1 + 0 }'
- -| 0
-
- 'gawk' ignores case in the four special values. Thus, '+nan' and
- '+NaN' are the same.
-
- ---------- Footnotes ----------
-
- (1) You asked for it, you got it.
-
-
-File: gawk.info, Node: Floating point summary, Prev: POSIX Floating Point Problems, Up: Arbitrary Precision Arithmetic
-
-15.7 Summary
-============
-
- * Most computer arithmetic is done using either integers or
- floating-point values. Standard 'awk' uses double-precision
- floating-point values.
-
- * In the early 1990s Barbie mistakenly said, "Math class is tough!"
- Although math isn't tough, floating-point arithmetic isn't the same
- as pencil-and-paper math, and care must be taken:
-
- - Not all numbers can be represented exactly.
-
- - Comparing values should use a delta, instead of being done
- directly with '==' and '!='.
-
- - Errors accumulate.
-
- - Operations are not always truly associative or distributive.
-
- * Increasing the accuracy can help, but it is not a panacea.
-
- * Often, increasing the accuracy and then rounding to the desired
- number of digits produces reasonable results.
-
- * Use '-M' (or '--bignum') to enable MPFR arithmetic. Use 'PREC' to
- set the precision in bits, and 'ROUNDMODE' to set the IEEE 754
- rounding mode.
-
- * With '-M', 'gawk' performs arbitrary-precision integer arithmetic
- using the GMP library. This is faster and more space-efficient
- than using MPFR for the same calculations.
-
- * There are several areas with respect to floating-point numbers
- where 'gawk' disagrees with the POSIX standard. It pays to be
- aware of them.
-
- * Overall, there is no need to be unduly suspicious about the results
- from floating-point arithmetic. The lesson to remember is that
- floating-point arithmetic is always more complex than arithmetic
- using pencil and paper. In order to take advantage of the power of
- floating-point arithmetic, you need to know its limitations and
- work within them. For most casual use of floating-point
- arithmetic, you will often get the expected result if you simply
- round the display of your final results to the correct number of
- significant decimal digits.
-
- * As general advice, avoid presenting numerical data in a manner that
- implies better precision than is actually the case.
-
-
-File: gawk.info, Node: Dynamic Extensions, Next: Language History, Prev: Arbitrary Precision Arithmetic, Up: Top
-
-16 Writing Extensions for 'gawk'
-********************************
-
-It is possible to add new functions written in C or C++ to 'gawk' using
-dynamically loaded libraries. This facility is available on systems
-that support the C 'dlopen()' and 'dlsym()' functions. This major node
-describes how to create extensions using code written in C or C++.
-
- If you don't know anything about C programming, you can safely skip
-this major node, although you may wish to review the documentation on
-the extensions that come with 'gawk' (*note Extension Samples::), and
-the information on the 'gawkextlib' project (*note gawkextlib::). The
-sample extensions are automatically built and installed when 'gawk' is.
-
- NOTE: When '--sandbox' is specified, extensions are disabled (*note
- Options::).
-
-* Menu:
-
-* Extension Intro:: What is an extension.
-* Plugin License:: A note about licensing.
-* Extension Mechanism Outline:: An outline of how it works.
-* Extension API Description:: A full description of the API.
-* Finding Extensions:: How 'gawk' finds compiled extensions.
-* Extension Example:: Example C code for an extension.
-* Extension Samples:: The sample extensions that ship with
- 'gawk'.
-* gawkextlib:: The 'gawkextlib' project.
-* Extension summary:: Extension summary.
-* Extension Exercises:: Exercises.
-
-
-File: gawk.info, Node: Extension Intro, Next: Plugin License, Up: Dynamic Extensions
-
-16.1 Introduction
-=================
-
-An "extension" (sometimes called a "plug-in") is a piece of external
-compiled code that 'gawk' can load at runtime to provide additional
-functionality, over and above the built-in capabilities described in the
-rest of this Info file.
-
- Extensions are useful because they allow you (of course) to extend
-'gawk''s functionality. For example, they can provide access to system
-calls (such as 'chdir()' to change directory) and to other C library
-routines that could be of use. As with most software, "the sky is the
-limit"; if you can imagine something that you might want to do and can
-write in C or C++, you can write an extension to do it!
-
- Extensions are written in C or C++, using the "application
-programming interface" (API) defined for this purpose by the 'gawk'
-developers. The rest of this major node explains the facilities that
-the API provides and how to use them, and presents a small example
-extension. In addition, it documents the sample extensions included in
-the 'gawk' distribution and describes the 'gawkextlib' project. *Note
-Extension Design::, for a discussion of the extension mechanism goals
-and design.
-
-
-File: gawk.info, Node: Plugin License, Next: Extension Mechanism Outline, Prev: Extension Intro, Up: Dynamic Extensions
-
-16.2 Extension Licensing
-========================
-
-Every dynamic extension must be distributed under a license that is
-compatible with the GNU GPL (*note Copying::).
-
- In order for the extension to tell 'gawk' that it is properly
-licensed, the extension must define the global symbol
-'plugin_is_GPL_compatible'. If this symbol does not exist, 'gawk' emits
-a fatal error and exits when it tries to load your extension.
-
- The declared type of the symbol should be 'int'. It does not need to
-be in any allocated section, though. The code merely asserts that the
-symbol exists in the global scope. Something like this is enough:
-
- int plugin_is_GPL_compatible;
-
-
-File: gawk.info, Node: Extension Mechanism Outline, Next: Extension API Description, Prev: Plugin License, Up: Dynamic Extensions
-
-16.3 How It Works at a High Level
-=================================
-
-Communication between 'gawk' and an extension is two-way. First, when
-an extension is loaded, 'gawk' passes it a pointer to a 'struct' whose
-fields are function pointers. This is shown in *note Figure 16.1:
-figure-load-extension.
-
-
- Struct
- +---+
- | |
- +---+
- +---------------| |
- | +---+ dl_load(api_p, id);
- | | | ___________________
- | +---+ |
- | +---------| | __________________ |
- | | +---+ ||
- | | | | ||
- | | +---+ ||
- | | +---| | ||
- | | | +---+ \\ || /
- | | | \\ /
- v v v \\/
-+-------+-+---+-+---+-+------------------+--------------------+
-| |x| |x| |x| |OOOOOOOOOOOOOOOOOOOO|
-| |x| |x| |x| |OOOOOOOOOOOOOOOOOOOO|
-| |x| |x| |x| |OOOOOOOOOOOOOOOOOOOO|
-+-------+-+---+-+---+-+------------------+--------------------+
-
- gawk Main Program Address Space Extension"
-
-Figure 16.1: Loading the extension
-
- The extension can call functions inside 'gawk' through these function
-pointers, at runtime, without needing (link-time) access to 'gawk''s
-symbols. One of these function pointers is to a function for
-"registering" new functions. This is shown in *note Figure 16.2:
-figure-register-new-function.
-
-
-
- +--------------------------------------------+
- | |
- V |
-+-------+-+---+-+---+-+------------------+--------------+-+---+
-| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO|
-| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO|
-| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO|
-+-------+-+---+-+---+-+------------------+--------------+-+---+
-
- gawk Main Program Address Space Extension"
-
-Figure 16.2: Registering a new function
-
- In the other direction, the extension registers its new functions
-with 'gawk' by passing function pointers to the functions that provide
-the new feature ('do_chdir()', for example). 'gawk' associates the
-function pointer with a name and can then call it, using a defined
-calling convention. This is shown in *note Figure 16.3:
-figure-call-new-function.
-
-
- chdir(\"/path\") (*fnptr)(1);
- }
- +--------------------------------------------+
- | |
- | V
-+-------+-+---+-+---+-+------------------+--------------+-+---+
-| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO|
-| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO|
-| |x| |x| |x| |OOOOOOOOOOOOOO|X|OOO|
-+-------+-+---+-+---+-+------------------+--------------+-+---+
-
- gawk Main Program Address Space Extension"
-
-Figure 16.3: Calling the new function
-
- The 'do_XXX()' function, in turn, then uses the function pointers in
-the API 'struct' to do its work, such as updating variables or arrays,
-printing messages, setting 'ERRNO', and so on.
-
- Convenience macros make calling through the function pointers look
-like regular function calls so that extension code is quite readable and
-understandable.
-
- Although all of this sounds somewhat complicated, the result is that
-extension code is quite straightforward to write and to read. You can
-see this in the sample extension 'filefuncs.c' (*note Extension
-Example::) and also in the 'testext.c' code for testing the APIs.
-
- Some other bits and pieces:
-
- * The API provides access to 'gawk''s 'do_XXX' values, reflecting
- command-line options, like 'do_lint', 'do_profiling', and so on
- (*note Extension API Variables::). These are informational: an
- extension cannot affect their values inside 'gawk'. In addition,
- attempting to assign to them produces a compile-time error.
-
- * The API also provides major and minor version numbers, so that an
- extension can check if the 'gawk' it is loaded with supports the
- facilities it was compiled with. (Version mismatches "shouldn't"
- happen, but we all know how _that_ goes.) *Note Extension
- Versioning:: for details.
-
-
-File: gawk.info, Node: Extension API Description, Next: Finding Extensions, Prev: Extension Mechanism Outline, Up: Dynamic Extensions
-
-16.4 API Description
-====================
-
-C or C++ code for an extension must include the header file 'gawkapi.h',
-which declares the functions and defines the data types used to
-communicate with 'gawk'. This (rather large) minor node describes the
-API in detail.
-
-* Menu:
-
-* Extension API Functions Introduction:: Introduction to the API functions.
-* General Data Types:: The data types.
-* Memory Allocation Functions:: Functions for allocating memory.
-* Constructor Functions:: Functions for creating values.
-* Registration Functions:: Functions to register things with
- 'gawk'.
-* Printing Messages:: Functions for printing messages.
-* Updating ERRNO:: Functions for updating 'ERRNO'.
-* Requesting Values:: How to get a value.
-* Accessing Parameters:: Functions for accessing parameters.
-* Symbol Table Access:: Functions for accessing global
- variables.
-* Array Manipulation:: Functions for working with arrays.
-* Redirection API:: How to access and manipulate redirections.
-* Extension API Variables:: Variables provided by the API.
-* Extension API Boilerplate:: Boilerplate code for using the API.
-
-
-File: gawk.info, Node: Extension API Functions Introduction, Next: General Data Types, Up: Extension API Description
-
-16.4.1 Introduction
--------------------
-
-Access to facilities within 'gawk' is achieved by calling through
-function pointers passed into your extension.
-
- API function pointers are provided for the following kinds of
-operations:
-
- * Allocating, reallocating, and releasing memory.
-
- * Registration functions. You may register:
-
- - Extension functions
- - Exit callbacks
- - A version string
- - Input parsers
- - Output wrappers
- - Two-way processors
-
- All of these are discussed in detail later in this major node.
-
- * Printing fatal, warning, and "lint" warning messages.
-
- * Updating 'ERRNO', or unsetting it.
-
- * Accessing parameters, including converting an undefined parameter
- into an array.
-
- * Symbol table access: retrieving a global variable, creating one, or
- changing one.
-
- * Creating and releasing cached values; this provides an efficient
- way to use values for multiple variables and can be a big
- performance win.
-
- * Manipulating arrays:
-
- - Retrieving, adding, deleting, and modifying elements
-
- - Getting the count of elements in an array
-
- - Creating a new array
-
- - Clearing an array
-
- - Flattening an array for easy C-style looping over all its
- indices and elements
-
- * Accessing and manipulating redirections.
-
- Some points about using the API:
-
- * The following types, macros, and/or functions are referenced in
- 'gawkapi.h'. For correct use, you must therefore include the
- corresponding standard header file _before_ including 'gawkapi.h':
-
- C entity Header file
- -------------------------------------------
- 'EOF' '<stdio.h>'
- Values for 'errno' '<errno.h>'
- 'FILE' '<stdio.h>'
- 'NULL' '<stddef.h>'
- 'memcpy()' '<string.h>'
- 'memset()' '<string.h>'
- 'size_t' '<sys/types.h>'
- 'struct stat' '<sys/stat.h>'
-
- Due to portability concerns, especially to systems that are not
- fully standards-compliant, it is your responsibility to include the
- correct files in the correct way. This requirement is necessary in
- order to keep 'gawkapi.h' clean, instead of becoming a portability
- hodge-podge as can be seen in some parts of the 'gawk' source code.
-
- * The 'gawkapi.h' file may be included more than once without ill
- effect. Doing so, however, is poor coding practice.
-
- * Although the API only uses ISO C 90 features, there is an
- exception; the "constructor" functions use the 'inline' keyword.
- If your compiler does not support this keyword, you should either
- place '-Dinline=''' on your command line or use the GNU Autotools
- and include a 'config.h' file in your extensions.
-
- * All pointers filled in by 'gawk' point to memory managed by 'gawk'
- and should be treated by the extension as read-only. Memory for
- _all_ strings passed into 'gawk' from the extension _must_ come
- from calling one of 'gawk_malloc()', 'gawk_calloc()', or
- 'gawk_realloc()', and is managed by 'gawk' from then on.
-
- * The API defines several simple 'struct's that map values as seen
- from 'awk'. A value can be a 'double', a string, or an array (as
- in multidimensional arrays, or when creating a new array). String
- values maintain both pointer and length, because embedded NUL
- characters are allowed.
-
- NOTE: By intent, strings are maintained using the current
- multibyte encoding (as defined by 'LC_XXX' environment
- variables) and not using wide characters. This matches how
- 'gawk' stores strings internally and also how characters are
- likely to be input into and output from files.
-
- * When retrieving a value (such as a parameter or that of a global
- variable or array element), the extension requests a specific type
- (number, string, scalar, value cookie, array, or "undefined").
- When the request is "undefined," the returned value will have the
- real underlying type.
-
- However, if the request and actual type don't match, the access
- function returns "false" and fills in the type of the actual value
- that is there, so that the extension can, e.g., print an error
- message (such as "scalar passed where array expected").
-
- You may call the API functions by using the function pointers
-directly, but the interface is not so pretty. To make extension code
-look more like regular code, the 'gawkapi.h' header file defines several
-macros that you should use in your code. This minor node presents the
-macros as if they were functions.
-
-
-File: gawk.info, Node: General Data Types, Next: Memory Allocation Functions, Prev: Extension API Functions Introduction, Up: Extension API Description
-
-16.4.2 General-Purpose Data Types
----------------------------------
-
- I have a true love/hate relationship with unions.
- -- _Arnold Robbins_
-
- That's the thing about unions: the compiler will arrange things so
- they can accommodate both love and hate.
- -- _Chet Ramey_
-
- The extension API defines a number of simple types and structures for
-general-purpose use. Additional, more specialized, data structures are
-introduced in subsequent minor nodes, together with the functions that
-use them.
-
- The general-purpose types and structures are as follows:
-
-'typedef void *awk_ext_id_t;'
- A value of this type is received from 'gawk' when an extension is
- loaded. That value must then be passed back to 'gawk' as the first
- parameter of each API function.
-
-'#define awk_const ...'
- This macro expands to 'const' when compiling an extension, and to
- nothing when compiling 'gawk' itself. This makes certain fields in
- the API data structures unwritable from extension code, while
- allowing 'gawk' to use them as it needs to.
-
-'typedef enum awk_bool {'
-' awk_false = 0,'
-' awk_true'
-'} awk_bool_t;'
- A simple Boolean type.
-
-'typedef struct awk_string {'
-' char *str; /* data */'
-' size_t len; /* length thereof, in chars */'
-'} awk_string_t;'
- This represents a mutable string. 'gawk' owns the memory pointed
- to if it supplied the value. Otherwise, it takes ownership of the
- memory pointed to. _Such memory must come from calling one of the
- 'gawk_malloc()', 'gawk_calloc()', or 'gawk_realloc()' functions!_
-
- As mentioned earlier, strings are maintained using the current
- multibyte encoding.
-
-'typedef enum {'
-' AWK_UNDEFINED,'
-' AWK_NUMBER,'
-' AWK_STRING,'
-' AWK_ARRAY,'
-' AWK_SCALAR, /* opaque access to a variable */'
-' AWK_VALUE_COOKIE /* for updating a previously created value */'
-'} awk_valtype_t;'
- This 'enum' indicates the type of a value. It is used in the
- following 'struct'.
-
-'typedef struct awk_value {'
-' awk_valtype_t val_type;'
-' union {'
-' awk_string_t s;'
-' double d;'
-' awk_array_t a;'
-' awk_scalar_t scl;'
-' awk_value_cookie_t vc;'
-' } u;'
-'} awk_value_t;'
- An "'awk' value." The 'val_type' member indicates what kind of
- value the 'union' holds, and each member is of the appropriate
- type.
-
-'#define str_value u.s'
-'#define num_value u.d'
-'#define array_cookie u.a'
-'#define scalar_cookie u.scl'
-'#define value_cookie u.vc'
- Using these macros makes accessing the fields of the 'awk_value_t'
- more readable.
-
-'typedef void *awk_scalar_t;'
- Scalars can be represented as an opaque type. These values are
- obtained from 'gawk' and then passed back into it. This is
- discussed in a general fashion in the text following this list, and
- in more detail in *note Symbol table by cookie::.
-
-'typedef void *awk_value_cookie_t;'
- A "value cookie" is an opaque type representing a cached value.
- This is also discussed in a general fashion in the text following
- this list, and in more detail in *note Cached values::.
-
- Scalar values in 'awk' are either numbers or strings. The
-'awk_value_t' struct represents values. The 'val_type' member indicates
-what is in the 'union'.
-
- Representing numbers is easy--the API uses a C 'double'. Strings
-require more work. Because 'gawk' allows embedded NUL bytes in string
-values, a string must be represented as a pair containing a data pointer
-and length. This is the 'awk_string_t' type.
-
- Identifiers (i.e., the names of global variables) can be associated
-with either scalar values or with arrays. In addition, 'gawk' provides
-true arrays of arrays, where any given array element can itself be an
-array. Discussion of arrays is delayed until *note Array
-Manipulation::.
-
- The various macros listed earlier make it easier to use the elements
-of the 'union' as if they were fields in a 'struct'; this is a common
-coding practice in C. Such code is easier to write and to read, but it
-remains _your_ responsibility to make sure that the 'val_type' member
-correctly reflects the type of the value in the 'awk_value_t' struct.
-
- Conceptually, the first three members of the 'union' (number, string,
-and array) are all that is needed for working with 'awk' values.
-However, because the API provides routines for accessing and changing
-the value of a global scalar variable only by using the variable's name,
-there is a performance penalty: 'gawk' must find the variable each time
-it is accessed and changed. This turns out to be a real issue, not just
-a theoretical one.
-
- Thus, if you know that your extension will spend considerable time
-reading and/or changing the value of one or more scalar variables, you
-can obtain a "scalar cookie"(1) object for that variable, and then use
-the cookie for getting the variable's value or for changing the
-variable's value. The 'awk_scalar_t' type holds a scalar cookie, and
-the 'scalar_cookie' macro provides access to the value of that type in
-the 'awk_value_t' struct. Given a scalar cookie, 'gawk' can directly
-retrieve or modify the value, as required, without having to find it
-first.
-
- The 'awk_value_cookie_t' type and 'value_cookie' macro are similar.
-If you know that you wish to use the same numeric or string _value_ for
-one or more variables, you can create the value once, retaining a "value
-cookie" for it, and then pass in that value cookie whenever you wish to
-set the value of a variable. This saves storage space within the
-running 'gawk' process and reduces the time needed to create the value.
-
- ---------- Footnotes ----------
-
- (1) See the "cookie" entry in the Jargon file
-(http://catb.org/jargon/html/C/cookie.html) for a definition of
-"cookie", and the "magic cookie" entry in the Jargon file
-(http://catb.org/jargon/html/M/magic-cookie.html) for a nice example.
-See also the entry for "Cookie" in the *note Glossary::.
-
-
-File: gawk.info, Node: Memory Allocation Functions, Next: Constructor Functions, Prev: General Data Types, Up: Extension API Description
-
-16.4.3 Memory Allocation Functions and Convenience Macros
----------------------------------------------------------
-
-The API provides a number of "memory allocation" functions for
-allocating memory that can be passed to 'gawk', as well as a number of
-convenience macros. This node presents them all as function prototypes,
-in the way that extension code would use them:
-
-'void *gawk_malloc(size_t size);'
- Call the correct version of 'malloc()' to allocate storage that may
- be passed to 'gawk'.
-
-'void *gawk_calloc(size_t nmemb, size_t size);'
- Call the correct version of 'calloc()' to allocate storage that may
- be passed to 'gawk'.
-
-'void *gawk_realloc(void *ptr, size_t size);'
- Call the correct version of 'realloc()' to allocate storage that
- may be passed to 'gawk'.
-
-'void gawk_free(void *ptr);'
- Call the correct version of 'free()' to release storage that was
- allocated with 'gawk_malloc()', 'gawk_calloc()', or
- 'gawk_realloc()'.
-
- The API has to provide these functions because it is possible for an
-extension to be compiled and linked against a different version of the C
-library than was used for the 'gawk' executable.(1) If 'gawk' were to
-use its version of 'free()' when the memory came from an unrelated
-version of 'malloc()', unexpected behavior would likely result.
-
- Two convenience macros may be used for allocating storage from
-'gawk_malloc()' and 'gawk_realloc()'. If the allocation fails, they
-cause 'gawk' to exit with a fatal error message. They should be used as
-if they were procedure calls that do not return a value:
-
-'#define emalloc(pointer, type, size, message) ...'
- The arguments to this macro are as follows:
-
- 'pointer'
- The pointer variable to point at the allocated storage.
-
- 'type'
- The type of the pointer variable. This is used to create a
- cast for the call to 'gawk_malloc()'.
-
- 'size'
- The total number of bytes to be allocated.
-
- 'message'
- A message to be prefixed to the fatal error message.
- Typically this is the name of the function using the macro.
-
- For example, you might allocate a string value like so:
-
- awk_value_t result;
- char *message;
- const char greet[] = "Don't Panic!";
-
- emalloc(message, char *, sizeof(greet), "myfunc");
- strcpy(message, greet);
- make_malloced_string(message, strlen(message), & result);
-
-'#define erealloc(pointer, type, size, message) ...'
- This is like 'emalloc()', but it calls 'gawk_realloc()' instead of
- 'gawk_malloc()'. The arguments are the same as for the 'emalloc()'
- macro.
-
- ---------- Footnotes ----------
-
- (1) This is more common on MS-Windows systems, but it can happen on
-Unix-like systems as well.
-
-
-File: gawk.info, Node: Constructor Functions, Next: Registration Functions, Prev: Memory Allocation Functions, Up: Extension API Description
-
-16.4.4 Constructor Functions
-----------------------------
-
-The API provides a number of "constructor" functions for creating string
-and numeric values, as well as a number of convenience macros. This
-node presents them all as function prototypes, in the way that extension
-code would use them:
-
-'static inline awk_value_t *'
-'make_const_string(const char *string, size_t length, awk_value_t *result);'
- This function creates a string value in the 'awk_value_t' variable
- pointed to by 'result'. It expects 'string' to be a C string
- constant (or other string data), and automatically creates a _copy_
- of the data for storage in 'result'. It returns 'result'.
-
-'static inline awk_value_t *'
-'make_malloced_string(const char *string, size_t length, awk_value_t *result);'
- This function creates a string value in the 'awk_value_t' variable
- pointed to by 'result'. It expects 'string' to be a 'char *' value
- pointing to data previously obtained from 'gawk_malloc()',
- 'gawk_calloc()', or 'gawk_realloc()'. The idea here is that the
- data is passed directly to 'gawk', which assumes responsibility for
- it. It returns 'result'.
-
-'static inline awk_value_t *'
-'make_null_string(awk_value_t *result);'
- This specialized function creates a null string (the "undefined"
- value) in the 'awk_value_t' variable pointed to by 'result'. It
- returns 'result'.
-
-'static inline awk_value_t *'
-'make_number(double num, awk_value_t *result);'
- This function simply creates a numeric value in the 'awk_value_t'
- variable pointed to by 'result'.
-
-
-File: gawk.info, Node: Registration Functions, Next: Printing Messages, Prev: Constructor Functions, Up: Extension API Description
-
-16.4.5 Registration Functions
------------------------------
-
-This minor node describes the API functions for registering parts of
-your extension with 'gawk'.
-
-* Menu:
-
-* Extension Functions:: Registering extension functions.
-* Exit Callback Functions:: Registering an exit callback.
-* Extension Version String:: Registering a version string.
-* Input Parsers:: Registering an input parser.
-* Output Wrappers:: Registering an output wrapper.
-* Two-way processors:: Registering a two-way processor.
-
-
-File: gawk.info, Node: Extension Functions, Next: Exit Callback Functions, Up: Registration Functions
-
-16.4.5.1 Registering An Extension Function
-..........................................
-
-Extension functions are described by the following record:
-
- typedef struct awk_ext_func {
- const char *name;
- awk_value_t *(*function)(int num_actual_args, awk_value_t *result);
- size_t max_expected_args;
- } awk_ext_func_t;
-
- The fields are:
-
-'const char *name;'
- The name of the new function. 'awk'-level code calls the function
- by this name. This is a regular C string.
-
- Function names must obey the rules for 'awk' identifiers. That is,
- they must begin with either an English letter or an underscore,
- which may be followed by any number of letters, digits, and
- underscores. Letter case in function names is significant.
-
-'awk_value_t *(*function)(int num_actual_args, awk_value_t *result);'
- This is a pointer to the C function that provides the extension's
- functionality. The function must fill in '*result' with either a
- number or a string. 'gawk' takes ownership of any string memory.
- As mentioned earlier, string memory _must_ come from one of
- 'gawk_malloc()', 'gawk_calloc()', or 'gawk_realloc()'.
-
- The 'num_actual_args' argument tells the C function how many actual
- parameters were passed from the calling 'awk' code.
-
- The function must return the value of 'result'. This is for the
- convenience of the calling code inside 'gawk'.
-
-'size_t max_expected_args;'
- This is the maximum number of arguments the function expects to
- receive. Each extension function may decide what to do if the
- number of arguments isn't what it expected. As with real 'awk'
- functions, it is likely OK to ignore extra arguments. This value
- does not affect actual program execution.
-
- Extension functions should compare this value to the number of
- actual arguments passed and possibly issue a lint warning if there
- is an undesirable mismatch. Of course, if '--lint=fatal' is used,
- this would cause the program to exit.
-
- Once you have a record representing your extension function, you
-register it with 'gawk' using this API function:
-
-'awk_bool_t add_ext_func(const char *namespace, const awk_ext_func_t *func);'
- This function returns true upon success, false otherwise. The
- 'namespace' parameter is currently not used; you should pass in an
- empty string ('""'). The 'func' pointer is the address of a
- 'struct' representing your function, as just described.
-
-
-File: gawk.info, Node: Exit Callback Functions, Next: Extension Version String, Prev: Extension Functions, Up: Registration Functions
-
-16.4.5.2 Registering An Exit Callback Function
-..............................................
-
-An "exit callback" function is a function that 'gawk' calls before it
-exits. Such functions are useful if you have general "cleanup" tasks
-that should be performed in your extension (such as closing database
-connections or other resource deallocations). You can register such a
-function with 'gawk' using the following function:
-
-'void awk_atexit(void (*funcp)(void *data, int exit_status),'
-' void *arg0);'
- The parameters are:
-
- 'funcp'
- A pointer to the function to be called before 'gawk' exits.
- The 'data' parameter will be the original value of 'arg0'.
- The 'exit_status' parameter is the exit status value that
- 'gawk' intends to pass to the 'exit()' system call.
-
- 'arg0'
- A pointer to private data that 'gawk' saves in order to pass
- to the function pointed to by 'funcp'.
-
- Exit callback functions are called in last-in, first-out (LIFO)
-order--that is, in the reverse order in which they are registered with
-'gawk'.
-
-
-File: gawk.info, Node: Extension Version String, Next: Input Parsers, Prev: Exit Callback Functions, Up: Registration Functions
-
-16.4.5.3 Registering An Extension Version String
-................................................
-
-You can register a version string that indicates the name and version of
-your extension with 'gawk', as follows:
-
-'void register_ext_version(const char *version);'
- Register the string pointed to by 'version' with 'gawk'. Note that
- 'gawk' does _not_ copy the 'version' string, so it should not be
- changed.
-
- 'gawk' prints all registered extension version strings when it is
-invoked with the '--version' option.
-
-
-File: gawk.info, Node: Input Parsers, Next: Output Wrappers, Prev: Extension Version String, Up: Registration Functions
-
-16.4.5.4 Customized Input Parsers
-.................................
-
-By default, 'gawk' reads text files as its input. It uses the value of
-'RS' to find the end of the record, and then uses 'FS' (or 'FIELDWIDTHS'
-or 'FPAT') to split it into fields (*note Reading Files::).
-Additionally, it sets the value of 'RT' (*note Built-in Variables::).
-
- If you want, you can provide your own custom input parser. An input
-parser's job is to return a record to the 'gawk' record-processing code,
-along with indicators for the value and length of the data to be used
-for 'RT', if any.
-
- To provide an input parser, you must first provide two functions
-(where XXX is a prefix name for your extension):
-
-'awk_bool_t XXX_can_take_file(const awk_input_buf_t *iobuf);'
- This function examines the information available in 'iobuf' (which
- we discuss shortly). Based on the information there, it decides if
- the input parser should be used for this file. If so, it should
- return true. Otherwise, it should return false. It should not
- change any state (variable values, etc.) within 'gawk'.
-
-'awk_bool_t XXX_take_control_of(awk_input_buf_t *iobuf);'
- When 'gawk' decides to hand control of the file over to the input
- parser, it calls this function. This function in turn must fill in
- certain fields in the 'awk_input_buf_t' structure and ensure that
- certain conditions are true. It should then return true. If an
- error of some kind occurs, it should not fill in any fields and
- should return false; then 'gawk' will not use the input parser.
- The details are presented shortly.
-
- Your extension should package these functions inside an
-'awk_input_parser_t', which looks like this:
-
- typedef struct awk_input_parser {
- const char *name; /* name of parser */
- awk_bool_t (*can_take_file)(const awk_input_buf_t *iobuf);
- awk_bool_t (*take_control_of)(awk_input_buf_t *iobuf);
- awk_const struct awk_input_parser *awk_const next; /* for gawk */
- } awk_input_parser_t;
-
- The fields are:
-
-'const char *name;'
- The name of the input parser. This is a regular C string.
-
-'awk_bool_t (*can_take_file)(const awk_input_buf_t *iobuf);'
- A pointer to your 'XXX_can_take_file()' function.
-
-'awk_bool_t (*take_control_of)(awk_input_buf_t *iobuf);'
- A pointer to your 'XXX_take_control_of()' function.
-
-'awk_const struct input_parser *awk_const next;'
- This is for use by 'gawk'; therefore it is marked 'awk_const' so
- that the extension cannot modify it.
-
- The steps are as follows:
-
- 1. Create a 'static awk_input_parser_t' variable and initialize it
- appropriately.
-
- 2. When your extension is loaded, register your input parser with
- 'gawk' using the 'register_input_parser()' API function (described
- next).
-
- An 'awk_input_buf_t' looks like this:
-
- typedef struct awk_input {
- const char *name; /* filename */
- int fd; /* file descriptor */
- #define INVALID_HANDLE (-1)
- void *opaque; /* private data for input parsers */
- int (*get_record)(char **out, struct awk_input *iobuf,
- int *errcode, char **rt_start, size_t *rt_len);
- ssize_t (*read_func)();
- void (*close_func)(struct awk_input *iobuf);
- struct stat sbuf; /* stat buf */
- } awk_input_buf_t;
-
- The fields can be divided into two categories: those for use
-(initially, at least) by 'XXX_can_take_file()', and those for use by
-'XXX_take_control_of()'. The first group of fields and their uses are
-as follows:
-
-'const char *name;'
- The name of the file.
-
-'int fd;'
- A file descriptor for the file. If 'gawk' was able to open the
- file, then 'fd' will _not_ be equal to 'INVALID_HANDLE'.
- Otherwise, it will.
-
-'struct stat sbuf;'
- If the file descriptor is valid, then 'gawk' will have filled in
- this structure via a call to the 'fstat()' system call.
-
- The 'XXX_can_take_file()' function should examine these fields and
-decide if the input parser should be used for the file. The decision
-can be made based upon 'gawk' state (the value of a variable defined
-previously by the extension and set by 'awk' code), the name of the
-file, whether or not the file descriptor is valid, the information in
-the 'struct stat', or any combination of these factors.
-
- Once 'XXX_can_take_file()' has returned true, and 'gawk' has decided
-to use your input parser, it calls 'XXX_take_control_of()'. That
-function then fills either the 'get_record' field or the 'read_func'
-field in the 'awk_input_buf_t'. It must also ensure that 'fd' is _not_
-set to 'INVALID_HANDLE'. The following list describes the fields that
-may be filled by 'XXX_take_control_of()':
-
-'void *opaque;'
- This is used to hold any state information needed by the input
- parser for this file. It is "opaque" to 'gawk'. The input parser
- is not required to use this pointer.
-
-'int (*get_record)(char **out,'
-' struct awk_input *iobuf,'
-' int *errcode,'
-' char **rt_start,'
-' size_t *rt_len);'
- This function pointer should point to a function that creates the
- input records. Said function is the core of the input parser. Its
- behavior is described in the text following this list.
-
-'ssize_t (*read_func)();'
- This function pointer should point to a function that has the same
- behavior as the standard POSIX 'read()' system call. It is an
- alternative to the 'get_record' pointer. Its behavior is also
- described in the text following this list.
-
-'void (*close_func)(struct awk_input *iobuf);'
- This function pointer should point to a function that does the
- "teardown." It should release any resources allocated by
- 'XXX_take_control_of()'. It may also close the file. If it does
- so, it should set the 'fd' field to 'INVALID_HANDLE'.
-
- If 'fd' is still not 'INVALID_HANDLE' after the call to this
- function, 'gawk' calls the regular 'close()' system call.
-
- Having a "teardown" function is optional. If your input parser
- does not need it, do not set this field. Then, 'gawk' calls the
- regular 'close()' system call on the file descriptor, so it should
- be valid.
-
- The 'XXX_get_record()' function does the work of creating input
-records. The parameters are as follows:
-
-'char **out'
- This is a pointer to a 'char *' variable that is set to point to
- the record. 'gawk' makes its own copy of the data, so the
- extension must manage this storage.
-
-'struct awk_input *iobuf'
- This is the 'awk_input_buf_t' for the file. The fields should be
- used for reading data ('fd') and for managing private state
- ('opaque'), if any.
-
-'int *errcode'
- If an error occurs, '*errcode' should be set to an appropriate code
- from '<errno.h>'.
-
-'char **rt_start'
-'size_t *rt_len'
- If the concept of a "record terminator" makes sense, then
- '*rt_start' should be set to point to the data to be used for 'RT',
- and '*rt_len' should be set to the length of the data. Otherwise,
- '*rt_len' should be set to zero. 'gawk' makes its own copy of this
- data, so the extension must manage this storage.
-
- The return value is the length of the buffer pointed to by '*out', or
-'EOF' if end-of-file was reached or an error occurred.
-
- It is guaranteed that 'errcode' is a valid pointer, so there is no
-need to test for a 'NULL' value. 'gawk' sets '*errcode' to zero, so
-there is no need to set it unless an error occurs.
-
- If an error does occur, the function should return 'EOF' and set
-'*errcode' to a value greater than zero. In that case, if '*errcode'
-does not equal zero, 'gawk' automatically updates the 'ERRNO' variable
-based on the value of '*errcode'. (In general, setting '*errcode =
-errno' should do the right thing.)
-
- As an alternative to supplying a function that returns an input
-record, you may instead supply a function that simply reads bytes, and
-let 'gawk' parse the data into records. If you do so, the data should
-be returned in the multibyte encoding of the current locale. Such a
-function should follow the same behavior as the 'read()' system call,
-and you fill in the 'read_func' pointer with its address in the
-'awk_input_buf_t' structure.
-
- By default, 'gawk' sets the 'read_func' pointer to point to the
-'read()' system call. So your extension need not set this field
-explicitly.
-
- NOTE: You must choose one method or the other: either a function
- that returns a record, or one that returns raw data. In
- particular, if you supply a function to get a record, 'gawk' will
- call it, and will never call the raw read function.
-
- 'gawk' ships with a sample extension that reads directories,
-returning records for each entry in a directory (*note Extension Sample
-Readdir::). You may wish to use that code as a guide for writing your
-own input parser.
-
- When writing an input parser, you should think about (and document)
-how it is expected to interact with 'awk' code. You may want it to
-always be called, and to take effect as appropriate (as the 'readdir'
-extension does). Or you may want it to take effect based upon the value
-of an 'awk' variable, as the XML extension from the 'gawkextlib' project
-does (*note gawkextlib::). In the latter case, code in a 'BEGINFILE'
-rule can look at 'FILENAME' and 'ERRNO' to decide whether or not to
-activate an input parser (*note BEGINFILE/ENDFILE::).
-
- You register your input parser with the following function:
-
-'void register_input_parser(awk_input_parser_t *input_parser);'
- Register the input parser pointed to by 'input_parser' with 'gawk'.
-
-
-File: gawk.info, Node: Output Wrappers, Next: Two-way processors, Prev: Input Parsers, Up: Registration Functions
-
-16.4.5.5 Customized Output Wrappers
-...................................
-
-An "output wrapper" is the mirror image of an input parser. It allows
-an extension to take over the output to a file opened with the '>' or
-'>>' I/O redirection operators (*note Redirection::).
-
- The output wrapper is very similar to the input parser structure:
-
- typedef struct awk_output_wrapper {
- const char *name; /* name of the wrapper */
- awk_bool_t (*can_take_file)(const awk_output_buf_t *outbuf);
- awk_bool_t (*take_control_of)(awk_output_buf_t *outbuf);
- awk_const struct awk_output_wrapper *awk_const next; /* for gawk */
- } awk_output_wrapper_t;
-
- The members are as follows:
-
-'const char *name;'
- This is the name of the output wrapper.
-
-'awk_bool_t (*can_take_file)(const awk_output_buf_t *outbuf);'
- This points to a function that examines the information in the
- 'awk_output_buf_t' structure pointed to by 'outbuf'. It should
- return true if the output wrapper wants to take over the file, and
- false otherwise. It should not change any state (variable values,
- etc.) within 'gawk'.
-
-'awk_bool_t (*take_control_of)(awk_output_buf_t *outbuf);'
- The function pointed to by this field is called when 'gawk' decides
- to let the output wrapper take control of the file. It should fill
- in appropriate members of the 'awk_output_buf_t' structure, as
- described next, and return true if successful, false otherwise.
-
-'awk_const struct output_wrapper *awk_const next;'
- This is for use by 'gawk'; therefore it is marked 'awk_const' so
- that the extension cannot modify it.
-
- The 'awk_output_buf_t' structure looks like this:
-
- typedef struct awk_output_buf {
- const char *name; /* name of output file */
- const char *mode; /* mode argument to fopen */
- FILE *fp; /* stdio file pointer */
- awk_bool_t redirected; /* true if a wrapper is active */
- void *opaque; /* for use by output wrapper */
- size_t (*gawk_fwrite)(const void *buf, size_t size, size_t count,
- FILE *fp, void *opaque);
- int (*gawk_fflush)(FILE *fp, void *opaque);
- int (*gawk_ferror)(FILE *fp, void *opaque);
- int (*gawk_fclose)(FILE *fp, void *opaque);
- } awk_output_buf_t;
-
- Here too, your extension will define 'XXX_can_take_file()' and
-'XXX_take_control_of()' functions that examine and update data members
-in the 'awk_output_buf_t'. The data members are as follows:
-
-'const char *name;'
- The name of the output file.
-
-'const char *mode;'
- The mode string (as would be used in the second argument to
- 'fopen()') with which the file was opened.
-
-'FILE *fp;'
- The 'FILE' pointer from '<stdio.h>'. 'gawk' opens the file before
- attempting to find an output wrapper.
-
-'awk_bool_t redirected;'
- This field must be set to true by the 'XXX_take_control_of()'
- function.
-
-'void *opaque;'
- This pointer is opaque to 'gawk'. The extension should use it to
- store a pointer to any private data associated with the file.
-
-'size_t (*gawk_fwrite)(const void *buf, size_t size, size_t count,'
-' FILE *fp, void *opaque);'
-'int (*gawk_fflush)(FILE *fp, void *opaque);'
-'int (*gawk_ferror)(FILE *fp, void *opaque);'
-'int (*gawk_fclose)(FILE *fp, void *opaque);'
- These pointers should be set to point to functions that perform the
- equivalent function as the '<stdio.h>' functions do, if
- appropriate. 'gawk' uses these function pointers for all output.
- 'gawk' initializes the pointers to point to internal "pass-through"
- functions that just call the regular '<stdio.h>' functions, so an
- extension only needs to redefine those functions that are
- appropriate for what it does.
-
- The 'XXX_can_take_file()' function should make a decision based upon
-the 'name' and 'mode' fields, and any additional state (such as 'awk'
-variable values) that is appropriate.
-
- When 'gawk' calls 'XXX_take_control_of()', that function should fill
-in the other fields as appropriate, except for 'fp', which it should
-just use normally.
-
- You register your output wrapper with the following function:
-
-'void register_output_wrapper(awk_output_wrapper_t *output_wrapper);'
- Register the output wrapper pointed to by 'output_wrapper' with
- 'gawk'.
-
-
-File: gawk.info, Node: Two-way processors, Prev: Output Wrappers, Up: Registration Functions
-
-16.4.5.6 Customized Two-way Processors
-......................................
-
-A "two-way processor" combines an input parser and an output wrapper for
-two-way I/O with the '|&' operator (*note Redirection::). It makes
-identical use of the 'awk_input_parser_t' and 'awk_output_buf_t'
-structures as described earlier.
-
- A two-way processor is represented by the following structure:
-
- typedef struct awk_two_way_processor {
- const char *name; /* name of the two-way processor */
- awk_bool_t (*can_take_two_way)(const char *name);
- awk_bool_t (*take_control_of)(const char *name,
- awk_input_buf_t *inbuf,
- awk_output_buf_t *outbuf);
- awk_const struct awk_two_way_processor *awk_const next; /* for gawk */
- } awk_two_way_processor_t;
-
- The fields are as follows:
-
-'const char *name;'
- The name of the two-way processor.
-
-'awk_bool_t (*can_take_two_way)(const char *name);'
- The function pointed to by this field should return true if it
- wants to take over two-way I/O for this file name. It should not
- change any state (variable values, etc.) within 'gawk'.
-
-'awk_bool_t (*take_control_of)(const char *name,'
-' awk_input_buf_t *inbuf,'
-' awk_output_buf_t *outbuf);'
- The function pointed to by this field should fill in the
- 'awk_input_buf_t' and 'awk_output_buf_t' structures pointed to by
- 'inbuf' and 'outbuf', respectively. These structures were
- described earlier.
-
-'awk_const struct two_way_processor *awk_const next;'
- This is for use by 'gawk'; therefore it is marked 'awk_const' so
- that the extension cannot modify it.
-
- As with the input parser and output processor, you provide "yes I can
-take this" and "take over for this" functions, 'XXX_can_take_two_way()'
-and 'XXX_take_control_of()'.
-
- You register your two-way processor with the following function:
-
-'void register_two_way_processor(awk_two_way_processor_t *two_way_processor);'
- Register the two-way processor pointed to by 'two_way_processor'
- with 'gawk'.
-
-
-File: gawk.info, Node: Printing Messages, Next: Updating ERRNO, Prev: Registration Functions, Up: Extension API Description
-
-16.4.6 Printing Messages
-------------------------
-
-You can print different kinds of warning messages from your extension,
-as described here. Note that for these functions, you must pass in the
-extension ID received from 'gawk' when the extension was loaded:(1)
-
-'void fatal(awk_ext_id_t id, const char *format, ...);'
- Print a message and then cause 'gawk' to exit immediately.
-
-'void nonfatal(awk_ext_id_t id, const char *format, ...);'
- Print a nonfatal error message.
-
-'void warning(awk_ext_id_t id, const char *format, ...);'
- Print a warning message.
-
-'void lintwarn(awk_ext_id_t id, const char *format, ...);'
- Print a "lint warning." Normally this is the same as printing a
- warning message, but if 'gawk' was invoked with '--lint=fatal',
- then lint warnings become fatal error messages.
-
- All of these functions are otherwise like the C 'printf()' family of
-functions, where the 'format' parameter is a string with literal
-characters and formatting codes intermixed.
-
- ---------- Footnotes ----------
-
- (1) Because the API uses only ISO C 90 features, it cannot make use
-of the ISO C 99 variadic macro feature to hide that parameter. More's
-the pity.
-
-
-File: gawk.info, Node: Updating ERRNO, Next: Requesting Values, Prev: Printing Messages, Up: Extension API Description
-
-16.4.7 Updating 'ERRNO'
------------------------
-
-The following functions allow you to update the 'ERRNO' variable:
-
-'void update_ERRNO_int(int errno_val);'
- Set 'ERRNO' to the string equivalent of the error code in
- 'errno_val'. The value should be one of the defined error codes in
- '<errno.h>', and 'gawk' turns it into a (possibly translated)
- string using the C 'strerror()' function.
-
-'void update_ERRNO_string(const char *string);'
- Set 'ERRNO' directly to the string value of 'ERRNO'. 'gawk' makes
- a copy of the value of 'string'.
-
-'void unset_ERRNO(void);'
- Unset 'ERRNO'.
-
-
-File: gawk.info, Node: Requesting Values, Next: Accessing Parameters, Prev: Updating ERRNO, Up: Extension API Description
-
-16.4.8 Requesting Values
-------------------------
-
-All of the functions that return values from 'gawk' work in the same
-way. You pass in an 'awk_valtype_t' value to indicate what kind of
-value you expect. If the actual value matches what you requested, the
-function returns true and fills in the 'awk_value_t' result. Otherwise,
-the function returns false, and the 'val_type' member indicates the type
-of the actual value. You may then print an error message or reissue the
-request for the actual value type, as appropriate. This behavior is
-summarized in *note Table 16.1: table-value-types-returned.
-
- Type of Actual Value
---------------------------------------------------------------------------
- String Number Array Undefined
-------------------------------------------------------------------------------
- String String String False False
- Number Number if Number False False
- can be
- converted,
- else false
-Type Array False False Array False
-Requested Scalar Scalar Scalar False False
- Undefined String Number Array Undefined
- Value False False False False
- cookie
-
-Table 16.1: API value types returned
-
-
-File: gawk.info, Node: Accessing Parameters, Next: Symbol Table Access, Prev: Requesting Values, Up: Extension API Description
-
-16.4.9 Accessing and Updating Parameters
-----------------------------------------
-
-Two functions give you access to the arguments (parameters) passed to
-your extension function. They are:
-
-'awk_bool_t get_argument(size_t count,'
-' awk_valtype_t wanted,'
-' awk_value_t *result);'
- Fill in the 'awk_value_t' structure pointed to by 'result' with the
- 'count'th argument. Return true if the actual type matches
- 'wanted', and false otherwise. In the latter case,
- 'result->val_type' indicates the actual type (*note Table 16.1:
- table-value-types-returned.). Counts are zero-based--the first
- argument is numbered zero, the second one, and so on. 'wanted'
- indicates the type of value expected.
-
-'awk_bool_t set_argument(size_t count, awk_array_t array);'
- Convert a parameter that was undefined into an array; this provides
- call by reference for arrays. Return false if 'count' is too big,
- or if the argument's type is not undefined. *Note Array
- Manipulation:: for more information on creating arrays.
-
-
-File: gawk.info, Node: Symbol Table Access, Next: Array Manipulation, Prev: Accessing Parameters, Up: Extension API Description
-
-16.4.10 Symbol Table Access
----------------------------
-
-Two sets of routines provide access to global variables, and one set
-allows you to create and release cached values.
-
-* Menu:
-
-* Symbol table by name:: Accessing variables by name.
-* Symbol table by cookie:: Accessing variables by "cookie".
-* Cached values:: Creating and using cached values.
-
-
-File: gawk.info, Node: Symbol table by name, Next: Symbol table by cookie, Up: Symbol Table Access
-
-16.4.10.1 Variable Access and Update by Name
-............................................
-
-The following routines provide the ability to access and update global
-'awk'-level variables by name. In compiler terminology, identifiers of
-different kinds are termed "symbols", thus the "sym" in the routines'
-names. The data structure that stores information about symbols is
-termed a "symbol table". The functions are as follows:
-
-'awk_bool_t sym_lookup(const char *name,'
-' awk_valtype_t wanted,'
-' awk_value_t *result);'
- Fill in the 'awk_value_t' structure pointed to by 'result' with the
- value of the variable named by the string 'name', which is a
- regular C string. 'wanted' indicates the type of value expected.
- Return true if the actual type matches 'wanted', and false
- otherwise. In the latter case, 'result->val_type' indicates the
- actual type (*note Table 16.1: table-value-types-returned.).
-
-'awk_bool_t sym_update(const char *name, awk_value_t *value);'
- Update the variable named by the string 'name', which is a regular
- C string. The variable is added to 'gawk''s symbol table if it is
- not there. Return true if everything worked, and false otherwise.
-
- Changing types (scalar to array or vice versa) of an existing
- variable is _not_ allowed, nor may this routine be used to update
- an array. This routine cannot be used to update any of the
- predefined variables (such as 'ARGC' or 'NF').
-
- An extension can look up the value of 'gawk''s special variables.
-However, with the exception of the 'PROCINFO' array, an extension cannot
-change any of those variables.
-
- CAUTION: It is possible for the lookup of 'PROCINFO' to fail. This
- happens if the 'awk' program being run does not reference
- 'PROCINFO'; in this case, 'gawk' doesn't bother to create the array
- and populate it.
-
-
-File: gawk.info, Node: Symbol table by cookie, Next: Cached values, Prev: Symbol table by name, Up: Symbol Table Access
-
-16.4.10.2 Variable Access and Update by Cookie
-..............................................
-
-A "scalar cookie" is an opaque handle that provides access to a global
-variable or array. It is an optimization that avoids looking up
-variables in 'gawk''s symbol table every time access is needed. This
-was discussed earlier, in *note General Data Types::.
-
- The following functions let you work with scalar cookies:
-
-'awk_bool_t sym_lookup_scalar(awk_scalar_t cookie,'
-' awk_valtype_t wanted,'
-' awk_value_t *result);'
- Retrieve the current value of a scalar cookie. Once you have
- obtained a scalar cookie using 'sym_lookup()', you can use this
- function to get its value more efficiently. Return false if the
- value cannot be retrieved.
-
-'awk_bool_t sym_update_scalar(awk_scalar_t cookie, awk_value_t *value);'
- Update the value associated with a scalar cookie. Return false if
- the new value is not of type 'AWK_STRING' or 'AWK_NUMBER'. Here
- too, the predefined variables may not be updated.
-
- It is not obvious at first glance how to work with scalar cookies or
-what their raison d'e^tre really is. In theory, the 'sym_lookup()' and
-'sym_update()' routines are all you really need to work with variables.
-For example, you might have code that looks up the value of a variable,
-evaluates a condition, and then possibly changes the value of the
-variable based on the result of that evaluation, like so:
-
- /* do_magic --- do something really great */
-
- static awk_value_t *
- do_magic(int nargs, awk_value_t *result)
- {
- awk_value_t value;
-
- if ( sym_lookup("MAGIC_VAR", AWK_NUMBER, & value)
- && some_condition(value.num_value)) {
- value.num_value += 42;
- sym_update("MAGIC_VAR", & value);
- }
-
- return make_number(0.0, result);
- }
-
-This code looks (and is) simple and straightforward. So what's the
-problem?
-
- Well, consider what happens if 'awk'-level code associated with your
-extension calls the 'magic()' function (implemented in C by
-'do_magic()'), once per record, while processing hundreds of thousands
-or millions of records. The 'MAGIC_VAR' variable is looked up in the
-symbol table once or twice per function call!
-
- The symbol table lookup is really pure overhead; it is considerably
-more efficient to get a cookie that represents the variable, and use
-that to get the variable's value and update it as needed.(1)
-
- Thus, the way to use cookies is as follows. First, install your
-extension's variable in 'gawk''s symbol table using 'sym_update()', as
-usual. Then get a scalar cookie for the variable using 'sym_lookup()':
-
- static awk_scalar_t magic_var_cookie; /* cookie for MAGIC_VAR */
-
- static void
- my_extension_init()
- {
- awk_value_t value;
-
- /* install initial value */
- sym_update("MAGIC_VAR", make_number(42.0, & value));
-
- /* get the cookie */
- sym_lookup("MAGIC_VAR", AWK_SCALAR, & value);
-
- /* save the cookie */
- magic_var_cookie = value.scalar_cookie;
- ...
- }
-
- Next, use the routines in this minor node for retrieving and updating
-the value through the cookie. Thus, 'do_magic()' now becomes something
-like this:
-
- /* do_magic --- do something really great */
-
- static awk_value_t *
- do_magic(int nargs, awk_value_t *result)
- {
- awk_value_t value;
-
- if ( sym_lookup_scalar(magic_var_cookie, AWK_NUMBER, & value)
- && some_condition(value.num_value)) {
- value.num_value += 42;
- sym_update_scalar(magic_var_cookie, & value);
- }
- ...
-
- return make_number(0.0, result);
- }
-
- NOTE: The previous code omitted error checking for presentation
- purposes. Your extension code should be more robust and carefully
- check the return values from the API functions.
-
- ---------- Footnotes ----------
-
- (1) The difference is measurable and quite real. Trust us.
-
-
-File: gawk.info, Node: Cached values, Prev: Symbol table by cookie, Up: Symbol Table Access
-
-16.4.10.3 Creating and Using Cached Values
-..........................................
-
-The routines in this minor node allow you to create and release cached
-values. Like scalar cookies, in theory, cached values are not
-necessary. You can create numbers and strings using the functions in
-*note Constructor Functions::. You can then assign those values to
-variables using 'sym_update()' or 'sym_update_scalar()', as you like.
-
- However, you can understand the point of cached values if you
-remember that _every_ string value's storage _must_ come from
-'gawk_malloc()', 'gawk_calloc()', or 'gawk_realloc()'. If you have 20
-variables, all of which have the same string value, you must create 20
-identical copies of the string.(1)
-
- It is clearly more efficient, if possible, to create a value once,
-and then tell 'gawk' to reuse the value for multiple variables. That is
-what the routines in this minor node let you do. The functions are as
-follows:
-
-'awk_bool_t create_value(awk_value_t *value, awk_value_cookie_t *result);'
- Create a cached string or numeric value from 'value' for efficient
- later assignment. Only values of type 'AWK_NUMBER' and
- 'AWK_STRING' are allowed. Any other type is rejected.
- 'AWK_UNDEFINED' could be allowed, but doing so would result in
- inferior performance.
-
-'awk_bool_t release_value(awk_value_cookie_t vc);'
- Release the memory associated with a value cookie obtained from
- 'create_value()'.
-
- You use value cookies in a fashion similar to the way you use scalar
-cookies. In the extension initialization routine, you create the value
-cookie:
-
- static awk_value_cookie_t answer_cookie; /* static value cookie */
-
- static void
- my_extension_init()
- {
- awk_value_t value;
- char *long_string;
- size_t long_string_len;
-
- /* code from earlier */
- ...
- /* ... fill in long_string and long_string_len ... */
- make_malloced_string(long_string, long_string_len, & value);
- create_value(& value, & answer_cookie); /* create cookie */
- ...
- }
-
- Once the value is created, you can use it as the value of any number
-of variables:
-
- static awk_value_t *
- do_magic(int nargs, awk_value_t *result)
- {
- awk_value_t new_value;
-
- ... /* as earlier */
-
- value.val_type = AWK_VALUE_COOKIE;
- value.value_cookie = answer_cookie;
- sym_update("VAR1", & value);
- sym_update("VAR2", & value);
- ...
- sym_update("VAR100", & value);
- ...
- }
-
-Using value cookies in this way saves considerable storage, as all of
-'VAR1' through 'VAR100' share the same value.
-
- You might be wondering, "Is this sharing problematic? What happens
-if 'awk' code assigns a new value to 'VAR1'; are all the others changed
-too?"
-
- That's a great question. The answer is that no, it's not a problem.
-Internally, 'gawk' uses "reference-counted strings". This means that
-many variables can share the same string value, and 'gawk' keeps track
-of the usage. When a variable's value changes, 'gawk' simply decrements
-the reference count on the old value and updates the variable to use the
-new value.
-
- Finally, as part of your cleanup action (*note Exit Callback
-Functions::) you should release any cached values that you created,
-using 'release_value()'.
-
- ---------- Footnotes ----------
-
- (1) Numeric values are clearly less problematic, requiring only a C
-'double' to store.
-
-
-File: gawk.info, Node: Array Manipulation, Next: Redirection API, Prev: Symbol Table Access, Up: Extension API Description
-
-16.4.11 Array Manipulation
---------------------------
-
-The primary data structure(1) in 'awk' is the associative array (*note
-Arrays::). Extensions need to be able to manipulate 'awk' arrays. The
-API provides a number of data structures for working with arrays,
-functions for working with individual elements, and functions for
-working with arrays as a whole. This includes the ability to "flatten"
-an array so that it is easy for C code to traverse every element in an
-array. The array data structures integrate nicely with the data
-structures for values to make it easy to both work with and create true
-arrays of arrays (*note General Data Types::).
-
-* Menu:
-
-* Array Data Types:: Data types for working with arrays.
-* Array Functions:: Functions for working with arrays.
-* Flattening Arrays:: How to flatten arrays.
-* Creating Arrays:: How to create and populate arrays.
-
- ---------- Footnotes ----------
-
- (1) OK, the only data structure.
-
-
-File: gawk.info, Node: Array Data Types, Next: Array Functions, Up: Array Manipulation
-
-16.4.11.1 Array Data Types
-..........................
-
-The data types associated with arrays are as follows:
-
-'typedef void *awk_array_t;'
- If you request the value of an array variable, you get back an
- 'awk_array_t' value. This value is opaque(1) to the extension; it
- uniquely identifies the array but can only be used by passing it
- into API functions or receiving it from API functions. This is
- very similar to way 'FILE *' values are used with the '<stdio.h>'
- library routines.
-
-'typedef struct awk_element {'
-' /* convenience linked list pointer, not used by gawk */'
-' struct awk_element *next;'
-' enum {'
-' AWK_ELEMENT_DEFAULT = 0, /* set by gawk */'
-' AWK_ELEMENT_DELETE = 1 /* set by extension */'
-' } flags;'
-' awk_value_t index;'
-' awk_value_t value;'
-'} awk_element_t;'
- The 'awk_element_t' is a "flattened" array element. 'awk' produces
- an array of these inside the 'awk_flat_array_t' (see the next
- item). Individual elements may be marked for deletion. New
- elements must be added individually, one at a time, using the
- separate API for that purpose. The fields are as follows:
-
- 'struct awk_element *next;'
- This pointer is for the convenience of extension writers. It
- allows an extension to create a linked list of new elements
- that can then be added to an array in a loop that traverses
- the list.
-
- 'enum { ... } flags;'
- A set of flag values that convey information between the
- extension and 'gawk'. Currently there is only one:
- 'AWK_ELEMENT_DELETE'. Setting it causes 'gawk' to delete the
- element from the original array upon release of the flattened
- array.
-
- 'index'
- 'value'
- The index and value of the element, respectively. _All_
- memory pointed to by 'index' and 'value' belongs to 'gawk'.
-
-'typedef struct awk_flat_array {'
-' awk_const void *awk_const opaque1; /* for use by gawk */'
-' awk_const void *awk_const opaque2; /* for use by gawk */'
-' awk_const size_t count; /* how many elements */'
-' awk_element_t elements[1]; /* will be extended */'
-'} awk_flat_array_t;'
- This is a flattened array. When an extension gets one of these
- from 'gawk', the 'elements' array is of actual size 'count'. The
- 'opaque1' and 'opaque2' pointers are for use by 'gawk'; therefore
- they are marked 'awk_const' so that the extension cannot modify
- them.
-
- ---------- Footnotes ----------
-
- (1) It is also a "cookie," but the 'gawk' developers did not wish to
-overuse this term.
-
-
-File: gawk.info, Node: Array Functions, Next: Flattening Arrays, Prev: Array Data Types, Up: Array Manipulation
-
-16.4.11.2 Array Functions
-.........................
-
-The following functions relate to individual array elements:
-
-'awk_bool_t get_element_count(awk_array_t a_cookie, size_t *count);'
- For the array represented by 'a_cookie', place in '*count' the
- number of elements it contains. A subarray counts as a single
- element. Return false if there is an error.
-
-'awk_bool_t get_array_element(awk_array_t a_cookie,'
-' const awk_value_t *const index,'
-' awk_valtype_t wanted,'
-' awk_value_t *result);'
- For the array represented by 'a_cookie', return in '*result' the
- value of the element whose index is 'index'. 'wanted' specifies
- the type of value you wish to retrieve. Return false if 'wanted'
- does not match the actual type or if 'index' is not in the array
- (*note Table 16.1: table-value-types-returned.).
-
- The value for 'index' can be numeric, in which case 'gawk' converts
- it to a string. Using nonintegral values is possible, but requires
- that you understand how such values are converted to strings (*note
- Conversion::); thus, using integral values is safest.
-
- As with _all_ strings passed into 'gawk' from an extension, the
- string value of 'index' must come from 'gawk_malloc()',
- 'gawk_calloc()', or 'gawk_realloc()', and 'gawk' releases the
- storage.
-
-'awk_bool_t set_array_element(awk_array_t a_cookie,'
-' const awk_value_t *const index,'
-' const awk_value_t *const value);'
- In the array represented by 'a_cookie', create or modify the
- element whose index is given by 'index'. The 'ARGV' and 'ENVIRON'
- arrays may not be changed, although the 'PROCINFO' array can be.
-
-'awk_bool_t set_array_element_by_elem(awk_array_t a_cookie,'
-' awk_element_t element);'
- Like 'set_array_element()', but take the 'index' and 'value' from
- 'element'. This is a convenience macro.
-
-'awk_bool_t del_array_element(awk_array_t a_cookie,'
-' const awk_value_t* const index);'
- Remove the element with the given index from the array represented
- by 'a_cookie'. Return true if the element was removed, or false if
- the element did not exist in the array.
-
- The following functions relate to arrays as a whole:
-
-'awk_array_t create_array(void);'
- Create a new array to which elements may be added. *Note Creating
- Arrays:: for a discussion of how to create a new array and add
- elements to it.
-
-'awk_bool_t clear_array(awk_array_t a_cookie);'
- Clear the array represented by 'a_cookie'. Return false if there
- was some kind of problem, true otherwise. The array remains an
- array, but after calling this function, it has no elements. This
- is equivalent to using the 'delete' statement (*note Delete::).
-
-'awk_bool_t flatten_array(awk_array_t a_cookie, awk_flat_array_t **data);'
- For the array represented by 'a_cookie', create an
- 'awk_flat_array_t' structure and fill it in. Set the pointer whose
- address is passed as 'data' to point to this structure. Return
- true upon success, or false otherwise. *Note Flattening Arrays::,
- for a discussion of how to flatten an array and work with it.
-
-'awk_bool_t release_flattened_array(awk_array_t a_cookie,'
-' awk_flat_array_t *data);'
- When done with a flattened array, release the storage using this
- function. You must pass in both the original array cookie and the
- address of the created 'awk_flat_array_t' structure. The function
- returns true upon success, false otherwise.
-
-
-File: gawk.info, Node: Flattening Arrays, Next: Creating Arrays, Prev: Array Functions, Up: Array Manipulation
-
-16.4.11.3 Working With All The Elements of an Array
-...................................................
-
-To "flatten" an array is to create a structure that represents the full
-array in a fashion that makes it easy for C code to traverse the entire
-array. Some of the code in 'extension/testext.c' does this, and also
-serves as a nice example showing how to use the APIs.
-
- We walk through that part of the code one step at a time. First, the
-'gawk' script that drives the test extension:
-
- @load "testext"
- BEGIN {
- n = split("blacky rusty sophie raincloud lucky", pets)
- printf("pets has %d elements\n", length(pets))
- ret = dump_array_and_delete("pets", "3")
- printf("dump_array_and_delete(pets) returned %d\n", ret)
- if ("3" in pets)
- printf("dump_array_and_delete() did NOT remove index \"3\"!\n")
- else
- printf("dump_array_and_delete() did remove index \"3\"!\n")
- print ""
- }
-
-This code creates an array with 'split()' (*note String Functions::) and
-then calls 'dump_array_and_delete()'. That function looks up the array
-whose name is passed as the first argument, and deletes the element at
-the index passed in the second argument. The 'awk' code then prints the
-return value and checks if the element was indeed deleted. Here is the
-C code that implements 'dump_array_and_delete()'. It has been edited
-slightly for presentation.
-
- The first part declares variables, sets up the default return value
-in 'result', and checks that the function was called with the correct
-number of arguments:
-
- static awk_value_t *
- dump_array_and_delete(int nargs, awk_value_t *result)
- {
- awk_value_t value, value2, value3;
- awk_flat_array_t *flat_array;
- size_t count;
- char *name;
- int i;
-
- assert(result != NULL);
- make_number(0.0, result);
-
- if (nargs != 2) {
- printf("dump_array_and_delete: nargs not right "
- "(%d should be 2)\n", nargs);
- goto out;
- }
-
- The function then proceeds in steps, as follows. First, retrieve the
-name of the array, passed as the first argument, followed by the array
-itself. If either operation fails, print an error message and return:
-
- /* get argument named array as flat array and print it */
- if (get_argument(0, AWK_STRING, & value)) {
- name = value.str_value.str;
- if (sym_lookup(name, AWK_ARRAY, & value2))
- printf("dump_array_and_delete: sym_lookup of %s passed\n",
- name);
- else {
- printf("dump_array_and_delete: sym_lookup of %s failed\n",
- name);
- goto out;
- }
- } else {
- printf("dump_array_and_delete: get_argument(0) failed\n");
- goto out;
- }
-
- For testing purposes and to make sure that the C code sees the same
-number of elements as the 'awk' code, the second step is to get the
-count of elements in the array and print it:
-
- if (! get_element_count(value2.array_cookie, & count)) {
- printf("dump_array_and_delete: get_element_count failed\n");
- goto out;
- }
-
- printf("dump_array_and_delete: incoming size is %lu\n",
- (unsigned long) count);
-
- The third step is to actually flatten the array, and then to
-double-check that the count in the 'awk_flat_array_t' is the same as the
-count just retrieved:
-
- if (! flatten_array(value2.array_cookie, & flat_array)) {
- printf("dump_array_and_delete: could not flatten array\n");
- goto out;
- }
-
- if (flat_array->count != count) {
- printf("dump_array_and_delete: flat_array->count (%lu)"
- " != count (%lu)\n",
- (unsigned long) flat_array->count,
- (unsigned long) count);
- goto out;
- }
-
- The fourth step is to retrieve the index of the element to be
-deleted, which was passed as the second argument. Remember that
-argument counts passed to 'get_argument()' are zero-based, and thus the
-second argument is numbered one:
-
- if (! get_argument(1, AWK_STRING, & value3)) {
- printf("dump_array_and_delete: get_argument(1) failed\n");
- goto out;
- }
-
- The fifth step is where the "real work" is done. The function loops
-over every element in the array, printing the index and element values.
-In addition, upon finding the element with the index that is supposed to
-be deleted, the function sets the 'AWK_ELEMENT_DELETE' bit in the
-'flags' field of the element. When the array is released, 'gawk'
-traverses the flattened array, and deletes any elements that have this
-flag bit set:
-
- for (i = 0; i < flat_array->count; i++) {
- printf("\t%s[\"%.*s\"] = %s\n",
- name,
- (int) flat_array->elements[i].index.str_value.len,
- flat_array->elements[i].index.str_value.str,
- valrep2str(& flat_array->elements[i].value));
-
- if (strcmp(value3.str_value.str,
- flat_array->elements[i].index.str_value.str) == 0) {
- flat_array->elements[i].flags |= AWK_ELEMENT_DELETE;
- printf("dump_array_and_delete: marking element \"%s\" "
- "for deletion\n",
- flat_array->elements[i].index.str_value.str);
- }
- }
-
- The sixth step is to release the flattened array. This tells 'gawk'
-that the extension is no longer using the array, and that it should
-delete any elements marked for deletion. 'gawk' also frees any storage
-that was allocated, so you should not use the pointer ('flat_array' in
-this code) once you have called 'release_flattened_array()':
-
- if (! release_flattened_array(value2.array_cookie, flat_array)) {
- printf("dump_array_and_delete: could not release flattened array\n");
- goto out;
- }
-
- Finally, because everything was successful, the function sets the
-return value to success, and returns:
-
- make_number(1.0, result);
- out:
- return result;
- }
-
- Here is the output from running this part of the test:
-
- pets has 5 elements
- dump_array_and_delete: sym_lookup of pets passed
- dump_array_and_delete: incoming size is 5
- pets["1"] = "blacky"
- pets["2"] = "rusty"
- pets["3"] = "sophie"
- dump_array_and_delete: marking element "3" for deletion
- pets["4"] = "raincloud"
- pets["5"] = "lucky"
- dump_array_and_delete(pets) returned 1
- dump_array_and_delete() did remove index "3"!
-
-
-File: gawk.info, Node: Creating Arrays, Prev: Flattening Arrays, Up: Array Manipulation
-
-16.4.11.4 How To Create and Populate Arrays
-...........................................
-
-Besides working with arrays created by 'awk' code, you can create arrays
-and populate them as you see fit, and then 'awk' code can access them
-and manipulate them.
-
- There are two important points about creating arrays from extension
-code:
-
- * You must install a new array into 'gawk''s symbol table immediately
- upon creating it. Once you have done so, you can then populate the
- array.
-
- Similarly, if installing a new array as a subarray of an existing
- array, you must add the new array to its parent before adding any
- elements to it.
-
- Thus, the correct way to build an array is to work "top down."
- Create the array, and immediately install it in 'gawk''s symbol
- table using 'sym_update()', or install it as an element in a
- previously existing array using 'set_array_element()'. We show
- example code shortly.
-
- * Due to 'gawk' internals, after using 'sym_update()' to install an
- array into 'gawk', you have to retrieve the array cookie from the
- value passed in to 'sym_update()' before doing anything else with
- it, like so:
-
- awk_value_t val;
- awk_array_t new_array;
-
- new_array = create_array();
- val.val_type = AWK_ARRAY;
- val.array_cookie = new_array;
-
- /* install array in the symbol table */
- sym_update("array", & val);
-
- new_array = val.array_cookie; /* YOU MUST DO THIS */
-
- If installing an array as a subarray, you must also retrieve the
- value of the array cookie after the call to 'set_element()'.
-
- The following C code is a simple test extension to create an array
-with two regular elements and with a subarray. The leading '#include'
-directives and boilerplate variable declarations (*note Extension API
-Boilerplate::) are omitted for brevity. The first step is to create a
-new array and then install it in the symbol table:
-
- /* create_new_array --- create a named array */
-
- static void
- create_new_array()
- {
- awk_array_t a_cookie;
- awk_array_t subarray;
- awk_value_t index, value;
-
- a_cookie = create_array();
- value.val_type = AWK_ARRAY;
- value.array_cookie = a_cookie;
-
- if (! sym_update("new_array", & value))
- printf("create_new_array: sym_update(\"new_array\") failed!\n");
- a_cookie = value.array_cookie;
-
-Note how 'a_cookie' is reset from the 'array_cookie' field in the
-'value' structure.
-
- The second step is to install two regular values into 'new_array':
-
- (void) make_const_string("hello", 5, & index);
- (void) make_const_string("world", 5, & value);
- if (! set_array_element(a_cookie, & index, & value)) {
- printf("fill_in_array: set_array_element failed\n");
- return;
- }
-
- (void) make_const_string("answer", 6, & index);
- (void) make_number(42.0, & value);
- if (! set_array_element(a_cookie, & index, & value)) {
- printf("fill_in_array: set_array_element failed\n");
- return;
- }
-
- The third step is to create the subarray and install it:
-
- (void) make_const_string("subarray", 8, & index);
- subarray = create_array();
- value.val_type = AWK_ARRAY;
- value.array_cookie = subarray;
- if (! set_array_element(a_cookie, & index, & value)) {
- printf("fill_in_array: set_array_element failed\n");
- return;
- }
- subarray = value.array_cookie;
-
- The final step is to populate the subarray with its own element:
-
- (void) make_const_string("foo", 3, & index);
- (void) make_const_string("bar", 3, & value);
- if (! set_array_element(subarray, & index, & value)) {
- printf("fill_in_array: set_array_element failed\n");
- return;
- }
- }
-
- Here is a sample script that loads the extension and then dumps the
-array:
-
- @load "subarray"
-
- function dumparray(name, array, i)
- {
- for (i in array)
- if (isarray(array[i]))
- dumparray(name "[\"" i "\"]", array[i])
- else
- printf("%s[\"%s\"] = %s\n", name, i, array[i])
- }
-
- BEGIN {
- dumparray("new_array", new_array);
- }
-
- Here is the result of running the script:
-
- $ AWKLIBPATH=$PWD ./gawk -f subarray.awk
- -| new_array["subarray"]["foo"] = bar
- -| new_array["hello"] = world
- -| new_array["answer"] = 42
-
-(*Note Finding Extensions:: for more information on the 'AWKLIBPATH'
-environment variable.)
-
-
-File: gawk.info, Node: Redirection API, Next: Extension API Variables, Prev: Array Manipulation, Up: Extension API Description
-
-16.4.12 Accessing and Manipulating Redirections
------------------------------------------------
-
-The following function allows extensions to access and manipulate
-redirections.
-
-'awk_bool_t get_file(const char *name,'
-' size_t name_len,'
-' const char *filetype,'
-' int fd,'
-' const awk_input_buf_t **ibufp,'
-' const awk_output_buf_t **obufp);'
- Look up a file in 'gawk''s internal redirection table. If 'name'
- is 'NULL' or 'name_len' is zero, return data for the currently open
- input file corresponding to 'FILENAME'. (This does not access the
- 'filetype' argument, so that may be undefined). If the file is not
- already open, attempt to open it. The 'filetype' argument must be
- zero-terminated and should be one of:
-
- '">"'
- A file opened for output.
-
- '">>"'
- A file opened for append.
-
- '"<"'
- A file opened for input.
-
- '"|>"'
- A pipe opened for output.
-
- '"|<"'
- A pipe opened for input.
-
- '"|&"'
- A two-way coprocess.
-
- On error, return a 'false' value. Otherwise, return 'true', and
- return additional information about the redirection in the 'ibufp'
- and 'obufp' pointers. For input redirections, the '*ibufp' value
- should be non-'NULL', and '*obufp' should be 'NULL'. For output
- redirections, the '*obufp' value should be non-'NULL', and '*ibufp'
- should be 'NULL'. For two-way coprocesses, both values should be
- non-'NULL'.
-
- In the usual case, the extension is interested in '(*ibufp)->fd'
- and/or 'fileno((*obufp)->fp)'. If the file is not already open,
- and the 'fd' argument is non-negative, 'gawk' will use that file
- descriptor instead of opening the file in the usual way. If 'fd'
- is non-negative, but the file exists already, 'gawk' ignores 'fd'
- and returns the existing file. It is the caller's responsibility
- to notice that neither the 'fd' in the returned 'awk_input_buf_t'
- nor the 'fd' in the returned 'awk_output_buf_t' matches the
- requested value.
-
- Note that supplying a file descriptor is currently _not_ supported
- for pipes. However, supplying a file descriptor should work for
- input, output, append, and two-way (coprocess) sockets. If
- 'filetype' is two-way, 'gawk' assumes that it is a socket! Note
- that in the two-way case, the input and output file descriptors may
- differ. To check for success, you must check whether either
- matches.
-
- It is anticipated that this API function will be used to implement
-I/O multiplexing and a socket library.
-
-
-File: gawk.info, Node: Extension API Variables, Next: Extension API Boilerplate, Prev: Redirection API, Up: Extension API Description
-
-16.4.13 API Variables
----------------------
-
-The API provides two sets of variables. The first provides information
-about the version of the API (both with which the extension was
-compiled, and with which 'gawk' was compiled). The second provides
-information about how 'gawk' was invoked.
-
-* Menu:
-
-* Extension Versioning:: API Version information.
-* Extension API Informational Variables:: Variables providing information about
- 'gawk''s invocation.
-
-
-File: gawk.info, Node: Extension Versioning, Next: Extension API Informational Variables, Up: Extension API Variables
-
-16.4.13.1 API Version Constants and Variables
-.............................................
-
-The API provides both a "major" and a "minor" version number. The API
-versions are available at compile time as C preprocessor defines to
-support conditional compilation, and as enum constants to facilitate
-debugging:
-
-API Version C preprocessor define enum constant
----------------------------------------------------------------------------
-Major gawk_api_major_version GAWK_API_MAJOR_VERSION
-Minor gawk_api_minor_version GAWK_API_MINOR_VERSION
-
-Table 16.2: gawk API version constants
-
- The minor version increases when new functions are added to the API.
-Such new functions are always added to the end of the API 'struct'.
-
- The major version increases (and the minor version is reset to zero)
-if any of the data types change size or member order, or if any of the
-existing functions change signature.
-
- It could happen that an extension may be compiled against one version
-of the API but loaded by a version of 'gawk' using a different version.
-For this reason, the major and minor API versions of the running 'gawk'
-are included in the API 'struct' as read-only constant integers:
-
-'api->major_version'
- The major version of the running 'gawk'
-
-'api->minor_version'
- The minor version of the running 'gawk'
-
- It is up to the extension to decide if there are API
-incompatibilities. Typically, a check like this is enough:
-
- if (api->major_version != GAWK_API_MAJOR_VERSION
- || api->minor_version < GAWK_API_MINOR_VERSION) {
- fprintf(stderr, "foo_extension: version mismatch with gawk!\n");
- fprintf(stderr, "\tmy version (%d, %d), gawk version (%d, %d)\n",
- GAWK_API_MAJOR_VERSION, GAWK_API_MINOR_VERSION,
- api->major_version, api->minor_version);
- exit(1);
- }
-
- Such code is included in the boilerplate 'dl_load_func()' macro
-provided in 'gawkapi.h' (discussed in *note Extension API
-Boilerplate::).
-
-
-File: gawk.info, Node: Extension API Informational Variables, Prev: Extension Versioning, Up: Extension API Variables
-
-16.4.13.2 Informational Variables
-.................................
-
-The API provides access to several variables that describe whether the
-corresponding command-line options were enabled when 'gawk' was invoked.
-The variables are:
-
-'do_debug'
- This variable is true if 'gawk' was invoked with '--debug' option.
-
-'do_lint'
- This variable is true if 'gawk' was invoked with '--lint' option.
-
-'do_mpfr'
- This variable is true if 'gawk' was invoked with '--bignum' option.
-
-'do_profile'
- This variable is true if 'gawk' was invoked with '--profile'
- option.
-
-'do_sandbox'
- This variable is true if 'gawk' was invoked with '--sandbox'
- option.
-
-'do_traditional'
- This variable is true if 'gawk' was invoked with '--traditional'
- option.
-
- The value of 'do_lint' can change if 'awk' code modifies the 'LINT'
-predefined variable (*note Built-in Variables::). The others should not
-change during execution.
-
-
-File: gawk.info, Node: Extension API Boilerplate, Prev: Extension API Variables, Up: Extension API Description
-
-16.4.14 Boilerplate Code
-------------------------
-
-As mentioned earlier (*note Extension Mechanism Outline::), the function
-definitions as presented are really macros. To use these macros, your
-extension must provide a small amount of boilerplate code (variables and
-functions) toward the top of your source file, using predefined names as
-described here. The boilerplate needed is also provided in comments in
-the 'gawkapi.h' header file:
-
- /* Boilerplate code: */
- int plugin_is_GPL_compatible;
-
- static gawk_api_t *const api;
- static awk_ext_id_t ext_id;
- static const char *ext_version = NULL; /* or ... = "some string" */
-
- static awk_ext_func_t func_table[] = {
- { "name", do_name, 1 },
- /* ... */
- };
-
- /* EITHER: */
-
- static awk_bool_t (*init_func)(void) = NULL;
-
- /* OR: */
-
- static awk_bool_t
- init_my_extension(void)
- {
- ...
- }
-
- static awk_bool_t (*init_func)(void) = init_my_extension;
-
- dl_load_func(func_table, some_name, "name_space_in_quotes")
-
- These variables and functions are as follows:
-
-'int plugin_is_GPL_compatible;'
- This asserts that the extension is compatible with the GNU GPL
- (*note Copying::). If your extension does not have this, 'gawk'
- will not load it (*note Plugin License::).
-
-'static gawk_api_t *const api;'
- This global 'static' variable should be set to point to the
- 'gawk_api_t' pointer that 'gawk' passes to your 'dl_load()'
- function. This variable is used by all of the macros.
-
-'static awk_ext_id_t ext_id;'
- This global static variable should be set to the 'awk_ext_id_t'
- value that 'gawk' passes to your 'dl_load()' function. This
- variable is used by all of the macros.
-
-'static const char *ext_version = NULL; /* or ... = "some string" */'
- This global 'static' variable should be set either to 'NULL', or to
- point to a string giving the name and version of your extension.
-
-'static awk_ext_func_t func_table[] = { ... };'
- This is an array of one or more 'awk_ext_func_t' structures, as
- described earlier (*note Extension Functions::). It can then be
- looped over for multiple calls to 'add_ext_func()'.
-
-'static awk_bool_t (*init_func)(void) = NULL;'
-' OR'
-'static awk_bool_t init_my_extension(void) { ... }'
-'static awk_bool_t (*init_func)(void) = init_my_extension;'
- If you need to do some initialization work, you should define a
- function that does it (creates variables, opens files, etc.) and
- then define the 'init_func' pointer to point to your function. The
- function should return 'awk_false' upon failure, or 'awk_true' if
- everything goes well.
-
- If you don't need to do any initialization, define the pointer and
- initialize it to 'NULL'.
-
-'dl_load_func(func_table, some_name, "name_space_in_quotes")'
- This macro expands to a 'dl_load()' function that performs all the
- necessary initializations.
-
- The point of all the variables and arrays is to let the 'dl_load()'
-function (from the 'dl_load_func()' macro) do all the standard work. It
-does the following:
-
- 1. Check the API versions. If the extension major version does not
- match 'gawk''s, or if the extension minor version is greater than
- 'gawk''s, it prints a fatal error message and exits.
-
- 2. Load the functions defined in 'func_table'. If any of them fails
- to load, it prints a warning message but continues on.
-
- 3. If the 'init_func' pointer is not 'NULL', call the function it
- points to. If it returns 'awk_false', print a warning message.
-
- 4. If 'ext_version' is not 'NULL', register the version string with
- 'gawk'.
-
-
-File: gawk.info, Node: Finding Extensions, Next: Extension Example, Prev: Extension API Description, Up: Dynamic Extensions
-
-16.5 How 'gawk' Finds Extensions
-================================
-
-Compiled extensions have to be installed in a directory where 'gawk' can
-find them. If 'gawk' is configured and built in the default fashion,
-the directory in which to find extensions is '/usr/local/lib/gawk'. You
-can also specify a search path with a list of directories to search for
-compiled extensions. *Note AWKLIBPATH Variable:: for more information.
-
-
-File: gawk.info, Node: Extension Example, Next: Extension Samples, Prev: Finding Extensions, Up: Dynamic Extensions
-
-16.6 Example: Some File Functions
-=================================
-
- No matter where you go, there you are.
- -- _Buckaroo Banzai_
-
- Two useful functions that are not in 'awk' are 'chdir()' (so that an
-'awk' program can change its directory) and 'stat()' (so that an 'awk'
-program can gather information about a file). In order to illustrate
-the API in action, this minor node implements these functions for 'gawk'
-in an extension.
-
-* Menu:
-
-* Internal File Description:: What the new functions will do.
-* Internal File Ops:: The code for internal file operations.
-* Using Internal File Ops:: How to use an external extension.
-
-
-File: gawk.info, Node: Internal File Description, Next: Internal File Ops, Up: Extension Example
-
-16.6.1 Using 'chdir()' and 'stat()'
------------------------------------
-
-This minor node shows how to use the new functions at the 'awk' level
-once they've been integrated into the running 'gawk' interpreter. Using
-'chdir()' is very straightforward. It takes one argument, the new
-directory to change to:
-
- @load "filefuncs"
- ...
- newdir = "/home/arnold/funstuff"
- ret = chdir(newdir)
- if (ret < 0) {
- printf("could not change to %s: %s\n", newdir, ERRNO) > "/dev/stderr"
- exit 1
- }
- ...
-
- The return value is negative if the 'chdir()' failed, and 'ERRNO'
-(*note Built-in Variables::) is set to a string indicating the error.
-
- Using 'stat()' is a bit more complicated. The C 'stat()' function
-fills in a structure that has a fair amount of information. The right
-way to model this in 'awk' is to fill in an associative array with the
-appropriate information:
-
- file = "/home/arnold/.profile"
- ret = stat(file, fdata)
- if (ret < 0) {
- printf("could not stat %s: %s\n",
- file, ERRNO) > "/dev/stderr"
- exit 1
- }
- printf("size of %s is %d bytes\n", file, fdata["size"])
-
- The 'stat()' function always clears the data array, even if the
-'stat()' fails. It fills in the following elements:
-
-'"name"'
- The name of the file that was 'stat()'ed.
-
-'"dev"'
-'"ino"'
- The file's device and inode numbers, respectively.
-
-'"mode"'
- The file's mode, as a numeric value. This includes both the file's
- type and its permissions.
-
-'"nlink"'
- The number of hard links (directory entries) the file has.
-
-'"uid"'
-'"gid"'
- The numeric user and group ID numbers of the file's owner.
-
-'"size"'
- The size in bytes of the file.
-
-'"blocks"'
- The number of disk blocks the file actually occupies. This may not
- be a function of the file's size if the file has holes.
-
-'"atime"'
-'"mtime"'
-'"ctime"'
- The file's last access, modification, and inode update times,
- respectively. These are numeric timestamps, suitable for
- formatting with 'strftime()' (*note Time Functions::).
-
-'"pmode"'
- The file's "printable mode." This is a string representation of
- the file's type and permissions, such as is produced by 'ls
- -l'--for example, '"drwxr-xr-x"'.
-
-'"type"'
- A printable string representation of the file's type. The value is
- one of the following:
-
- '"blockdev"'
- '"chardev"'
- The file is a block or character device ("special file").
-
- '"directory"'
- The file is a directory.
-
- '"fifo"'
- The file is a named pipe (also known as a FIFO).
-
- '"file"'
- The file is just a regular file.
-
- '"socket"'
- The file is an 'AF_UNIX' ("Unix domain") socket in the
- filesystem.
-
- '"symlink"'
- The file is a symbolic link.
-
-'"devbsize"'
- The size of a block for the element indexed by '"blocks"'. This
- information is derived from either the 'DEV_BSIZE' constant defined
- in '<sys/param.h>' on most systems, or the 'S_BLKSIZE' constant in
- '<sys/stat.h>' on BSD systems. For some other systems, "a priori"
- knowledge is used to provide a value. Where no value can be
- determined, it defaults to 512.
-
- Several additional elements may be present, depending upon the
-operating system and the type of the file. You can test for them in
-your 'awk' program by using the 'in' operator (*note Reference to
-Elements::):
-
-'"blksize"'
- The preferred block size for I/O to the file. This field is not
- present on all POSIX-like systems in the C 'stat' structure.
-
-'"linkval"'
- If the file is a symbolic link, this element is the name of the
- file the link points to (i.e., the value of the link).
-
-'"rdev"'
-'"major"'
-'"minor"'
- If the file is a block or character device file, then these values
- represent the numeric device number and the major and minor
- components of that number, respectively.
-
-
-File: gawk.info, Node: Internal File Ops, Next: Using Internal File Ops, Prev: Internal File Description, Up: Extension Example
-
-16.6.2 C Code for 'chdir()' and 'stat()'
-----------------------------------------
-
-Here is the C code for these extensions.(1)
-
- The file includes a number of standard header files, and then
-includes the 'gawkapi.h' header file, which provides the API
-definitions. Those are followed by the necessary variable declarations
-to make use of the API macros and boilerplate code (*note Extension API
-Boilerplate::):
-
- #ifdef HAVE_CONFIG_H
- #include <config.h>
- #endif
-
- #include <stdio.h>
- #include <assert.h>
- #include <errno.h>
- #include <stdlib.h>
- #include <string.h>
- #include <unistd.h>
-
- #include <sys/types.h>
- #include <sys/stat.h>
-
- #include "gawkapi.h"
-
- #include "gettext.h"
- #define _(msgid) gettext(msgid)
- #define N_(msgid) msgid
-
- #include "gawkfts.h"
- #include "stack.h"
-
- static const gawk_api_t *api; /* for convenience macros to work */
- static awk_ext_id_t *ext_id;
- static awk_bool_t init_filefuncs(void);
- static awk_bool_t (*init_func)(void) = init_filefuncs;
- static const char *ext_version = "filefuncs extension: version 1.0";
-
- int plugin_is_GPL_compatible;
-
- By convention, for an 'awk' function 'foo()', the C function that
-implements it is called 'do_foo()'. The function should have two
-arguments. The first is an 'int', usually called 'nargs', that
-represents the number of actual arguments for the function. The second
-is a pointer to an 'awk_value_t' structure, usually named 'result':
-
- /* do_chdir --- provide dynamically loaded chdir() function for gawk */
-
- static awk_value_t *
- do_chdir(int nargs, awk_value_t *result)
- {
- awk_value_t newdir;
- int ret = -1;
-
- assert(result != NULL);
-
- if (do_lint && nargs != 1)
- lintwarn(ext_id,
- _("chdir: called with incorrect number of arguments, "
- "expecting 1"));
-
- The 'newdir' variable represents the new directory to change to,
-which is retrieved with 'get_argument()'. Note that the first argument
-is numbered zero.
-
- If the argument is retrieved successfully, the function calls the
-'chdir()' system call. If the 'chdir()' fails, 'ERRNO' is updated:
-
- if (get_argument(0, AWK_STRING, & newdir)) {
- ret = chdir(newdir.str_value.str);
- if (ret < 0)
- update_ERRNO_int(errno);
- }
-
- Finally, the function returns the return value to the 'awk' level:
-
- return make_number(ret, result);
- }
-
- The 'stat()' extension is more involved. First comes a function that
-turns a numeric mode into a printable representation (e.g., octal '0644'
-becomes '-rw-r--r--'). This is omitted here for brevity:
-
- /* format_mode --- turn a stat mode field into something readable */
-
- static char *
- format_mode(unsigned long fmode)
- {
- ...
- }
-
- Next comes a function for reading symbolic links, which is also
-omitted here for brevity:
-
- /* read_symlink --- read a symbolic link into an allocated buffer.
- ... */
-
- static char *
- read_symlink(const char *fname, size_t bufsize, ssize_t *linksize)
- {
- ...
- }
-
- Two helper functions simplify entering values in the array that will
-contain the result of the 'stat()':
-
- /* array_set --- set an array element */
-
- static void
- array_set(awk_array_t array, const char *sub, awk_value_t *value)
- {
- awk_value_t index;
-
- set_array_element(array,
- make_const_string(sub, strlen(sub), & index),
- value);
-
- }
-
- /* array_set_numeric --- set an array element with a number */
-
- static void
- array_set_numeric(awk_array_t array, const char *sub, double num)
- {
- awk_value_t tmp;
-
- array_set(array, sub, make_number(num, & tmp));
- }
-
- The following function does most of the work to fill in the
-'awk_array_t' result array with values obtained from a valid 'struct
-stat'. This work is done in a separate function to support the 'stat()'
-function for 'gawk' and also to support the 'fts()' extension, which is
-included in the same file but whose code is not shown here (*note
-Extension Sample File Functions::).
-
- The first part of the function is variable declarations, including a
-table to map file types to strings:
-
- /* fill_stat_array --- do the work to fill an array with stat info */
-
- static int
- fill_stat_array(const char *name, awk_array_t array, struct stat *sbuf)
- {
- char *pmode; /* printable mode */
- const char *type = "unknown";
- awk_value_t tmp;
- static struct ftype_map {
- unsigned int mask;
- const char *type;
- } ftype_map[] = {
- { S_IFREG, "file" },
- { S_IFBLK, "blockdev" },
- { S_IFCHR, "chardev" },
- { S_IFDIR, "directory" },
- #ifdef S_IFSOCK
- { S_IFSOCK, "socket" },
- #endif
- #ifdef S_IFIFO
- { S_IFIFO, "fifo" },
- #endif
- #ifdef S_IFLNK
- { S_IFLNK, "symlink" },
- #endif
- #ifdef S_IFDOOR /* Solaris weirdness */
- { S_IFDOOR, "door" },
- #endif /* S_IFDOOR */
- };
- int j, k;
-
- The destination array is cleared, and then code fills in various
-elements based on values in the 'struct stat':
-
- /* empty out the array */
- clear_array(array);
-
- /* fill in the array */
- array_set(array, "name", make_const_string(name, strlen(name),
- & tmp));
- array_set_numeric(array, "dev", sbuf->st_dev);
- array_set_numeric(array, "ino", sbuf->st_ino);
- array_set_numeric(array, "mode", sbuf->st_mode);
- array_set_numeric(array, "nlink", sbuf->st_nlink);
- array_set_numeric(array, "uid", sbuf->st_uid);
- array_set_numeric(array, "gid", sbuf->st_gid);
- array_set_numeric(array, "size", sbuf->st_size);
- array_set_numeric(array, "blocks", sbuf->st_blocks);
- array_set_numeric(array, "atime", sbuf->st_atime);
- array_set_numeric(array, "mtime", sbuf->st_mtime);
- array_set_numeric(array, "ctime", sbuf->st_ctime);
-
- /* for block and character devices, add rdev,
- major and minor numbers */
- if (S_ISBLK(sbuf->st_mode) || S_ISCHR(sbuf->st_mode)) {
- array_set_numeric(array, "rdev", sbuf->st_rdev);
- array_set_numeric(array, "major", major(sbuf->st_rdev));
- array_set_numeric(array, "minor", minor(sbuf->st_rdev));
- }
-
-The latter part of the function makes selective additions to the
-destination array, depending upon the availability of certain members
-and/or the type of the file. It then returns zero, for success:
-
- #ifdef HAVE_STRUCT_STAT_ST_BLKSIZE
- array_set_numeric(array, "blksize", sbuf->st_blksize);
- #endif /* HAVE_STRUCT_STAT_ST_BLKSIZE */
-
- pmode = format_mode(sbuf->st_mode);
- array_set(array, "pmode", make_const_string(pmode, strlen(pmode),
- & tmp));
-
- /* for symbolic links, add a linkval field */
- if (S_ISLNK(sbuf->st_mode)) {
- char *buf;
- ssize_t linksize;
-
- if ((buf = read_symlink(name, sbuf->st_size,
- & linksize)) != NULL)
- array_set(array, "linkval",
- make_malloced_string(buf, linksize, & tmp));
- else
- warning(ext_id, _("stat: unable to read symbolic link `%s'"),
- name);
- }
-
- /* add a type field */
- type = "unknown"; /* shouldn't happen */
- for (j = 0, k = sizeof(ftype_map)/sizeof(ftype_map[0]); j < k; j++) {
- if ((sbuf->st_mode & S_IFMT) == ftype_map[j].mask) {
- type = ftype_map[j].type;
- break;
- }
- }
-
- array_set(array, "type", make_const_string(type, strlen(type), & tmp));
-
- return 0;
- }
-
- The third argument to 'stat()' was not discussed previously. This
-argument is optional. If present, it causes 'do_stat()' to use the
-'stat()' system call instead of the 'lstat()' system call. This is done
-by using a function pointer: 'statfunc'. 'statfunc' is initialized to
-point to 'lstat()' (instead of 'stat()') to get the file information, in
-case the file is a symbolic link. However, if the third argument is
-included, 'statfunc' is set to point to 'stat()', instead.
-
- Here is the 'do_stat()' function, which starts with variable
-declarations and argument checking:
-
- /* do_stat --- provide a stat() function for gawk */
-
- static awk_value_t *
- do_stat(int nargs, awk_value_t *result)
- {
- awk_value_t file_param, array_param;
- char *name;
- awk_array_t array;
- int ret;
- struct stat sbuf;
- /* default is lstat() */
- int (*statfunc)(const char *path, struct stat *sbuf) = lstat;
-
- assert(result != NULL);
-
- if (nargs != 2 && nargs != 3) {
- if (do_lint)
- lintwarn(ext_id,
- _("stat: called with wrong number of arguments"));
- return make_number(-1, result);
- }
-
- Then comes the actual work. First, the function gets the arguments.
-Next, it gets the information for the file. If the called function
-('lstat()' or 'stat()') returns an error, the code sets 'ERRNO' and
-returns:
-
- /* file is first arg, array to hold results is second */
- if ( ! get_argument(0, AWK_STRING, & file_param)
- || ! get_argument(1, AWK_ARRAY, & array_param)) {
- warning(ext_id, _("stat: bad parameters"));
- return make_number(-1, result);
- }
-
- if (nargs == 3) {
- statfunc = stat;
- }
-
- name = file_param.str_value.str;
- array = array_param.array_cookie;
-
- /* always empty out the array */
- clear_array(array);
-
- /* stat the file; if error, set ERRNO and return */
- ret = statfunc(name, & sbuf);
- if (ret < 0) {
- update_ERRNO_int(errno);
- return make_number(ret, result);
- }
-
- The tedious work is done by 'fill_stat_array()', shown earlier. When
-done, the function returns the result from 'fill_stat_array()':
-
- ret = fill_stat_array(name, array, & sbuf);
-
- return make_number(ret, result);
- }
-
- Finally, it's necessary to provide the "glue" that loads the new
-function(s) into 'gawk'.
-
- The 'filefuncs' extension also provides an 'fts()' function, which we
-omit here (*note Extension Sample File Functions::). For its sake,
-there is an initialization function:
-
- /* init_filefuncs --- initialization routine */
-
- static awk_bool_t
- init_filefuncs(void)
- {
- ...
- }
-
- We are almost done. We need an array of 'awk_ext_func_t' structures
-for loading each function into 'gawk':
-
- static awk_ext_func_t func_table[] = {
- { "chdir", do_chdir, 1 },
- { "stat", do_stat, 2 },
- #ifndef __MINGW32__
- { "fts", do_fts, 3 },
- #endif
- };
-
- Each extension must have a routine named 'dl_load()' to load
-everything that needs to be loaded. It is simplest to use the
-'dl_load_func()' macro in 'gawkapi.h':
-
- /* define the dl_load() function using the boilerplate macro */
-
- dl_load_func(func_table, filefuncs, "")
-
- And that's it!
-
- ---------- Footnotes ----------
-
- (1) This version is edited slightly for presentation. See
-'extension/filefuncs.c' in the 'gawk' distribution for the complete
-version.
-
-
-File: gawk.info, Node: Using Internal File Ops, Prev: Internal File Ops, Up: Extension Example
-
-16.6.3 Integrating the Extensions
----------------------------------
-
-Now that the code is written, it must be possible to add it at runtime
-to the running 'gawk' interpreter. First, the code must be compiled.
-Assuming that the functions are in a file named 'filefuncs.c', and IDIR
-is the location of the 'gawkapi.h' header file, the following steps(1)
-create a GNU/Linux shared library:
-
- $ gcc -fPIC -shared -DHAVE_CONFIG_H -c -O -g -IIDIR filefuncs.c
- $ gcc -o filefuncs.so -shared filefuncs.o
-
- Once the library exists, it is loaded by using the '@load' keyword:
-
- # file testff.awk
- @load "filefuncs"
-
- BEGIN {
- "pwd" | getline curdir # save current directory
- close("pwd")
-
- chdir("/tmp")
- system("pwd") # test it
- chdir(curdir) # go back
-
- print "Info for testff.awk"
- ret = stat("testff.awk", data)
- print "ret =", ret
- for (i in data)
- printf "data[\"%s\"] = %s\n", i, data[i]
- print "testff.awk modified:",
- strftime("%m %d %Y %H:%M:%S", data["mtime"])
-
- print "\nInfo for JUNK"
- ret = stat("JUNK", data)
- print "ret =", ret
- for (i in data)
- printf "data[\"%s\"] = %s\n", i, data[i]
- print "JUNK modified:", strftime("%m %d %Y %H:%M:%S", data["mtime"])
- }
-
- The 'AWKLIBPATH' environment variable tells 'gawk' where to find
-extensions (*note Finding Extensions::). We set it to the current
-directory and run the program:
-
- $ AWKLIBPATH=$PWD gawk -f testff.awk
- -| /tmp
- -| Info for testff.awk
- -| ret = 0
- -| data["blksize"] = 4096
- -| data["devbsize"] = 512
- -| data["mtime"] = 1412004710
- -| data["mode"] = 33204
- -| data["type"] = file
- -| data["dev"] = 2053
- -| data["gid"] = 1000
- -| data["ino"] = 10358899
- -| data["ctime"] = 1412004710
- -| data["blocks"] = 8
- -| data["nlink"] = 1
- -| data["name"] = testff.awk
- -| data["atime"] = 1412004716
- -| data["pmode"] = -rw-rw-r--
- -| data["size"] = 666
- -| data["uid"] = 1000
- -| testff.awk modified: 09 29 2014 18:31:50
- -|
- -| Info for JUNK
- -| ret = -1
- -| JUNK modified: 01 01 1970 02:00:00
-
- ---------- Footnotes ----------
-
- (1) In practice, you would probably want to use the GNU Autotools
-(Automake, Autoconf, Libtool, and 'gettext') to configure and build your
-libraries. Instructions for doing so are beyond the scope of this Info
-file. *Note gawkextlib:: for Internet links to the tools.
-
-
-File: gawk.info, Node: Extension Samples, Next: gawkextlib, Prev: Extension Example, Up: Dynamic Extensions
-
-16.7 The Sample Extensions in the 'gawk' Distribution
-=====================================================
-
-This minor node provides a brief overview of the sample extensions that
-come in the 'gawk' distribution. Some of them are intended for
-production use (e.g., the 'filefuncs', 'readdir', and 'inplace'
-extensions). Others mainly provide example code that shows how to use
-the extension API.
-
-* Menu:
-
-* Extension Sample File Functions:: The file functions sample.
-* Extension Sample Fnmatch:: An interface to 'fnmatch()'.
-* Extension Sample Fork:: An interface to 'fork()' and other
- process functions.
-* Extension Sample Inplace:: Enabling in-place file editing.
-* Extension Sample Ord:: Character to value to character
- conversions.
-* Extension Sample Readdir:: An interface to 'readdir()'.
-* Extension Sample Revout:: Reversing output sample output wrapper.
-* Extension Sample Rev2way:: Reversing data sample two-way processor.
-* Extension Sample Read write array:: Serializing an array to a file.
-* Extension Sample Readfile:: Reading an entire file into a string.
-* Extension Sample Time:: An interface to 'gettimeofday()'
- and 'sleep()'.
-* Extension Sample API Tests:: Tests for the API.
-
-
-File: gawk.info, Node: Extension Sample File Functions, Next: Extension Sample Fnmatch, Up: Extension Samples
-
-16.7.1 File-Related Functions
------------------------------
-
-The 'filefuncs' extension provides three different functions, as
-follows. The usage is:
-
-'@load "filefuncs"'
- This is how you load the extension.
-
-'result = chdir("/some/directory")'
- The 'chdir()' function is a direct hook to the 'chdir()' system
- call to change the current directory. It returns zero upon success
- or a value less than zero upon error. In the latter case, it
- updates 'ERRNO'.
-
-'result = stat("/some/path", statdata' [', follow']')'
- The 'stat()' function provides a hook into the 'stat()' system
- call. It returns zero upon success or a value less than zero upon
- error. In the latter case, it updates 'ERRNO'.
-
- By default, it uses the 'lstat()' system call. However, if passed
- a third argument, it uses 'stat()' instead.
-
- In all cases, it clears the 'statdata' array. When the call is
- successful, 'stat()' fills the 'statdata' array with information
- retrieved from the filesystem, as follows:
-
- Subscript Field in 'struct stat' File type
- ----------------------------------------------------------------
- '"name"' The file name All
- '"dev"' 'st_dev' All
- '"ino"' 'st_ino' All
- '"mode"' 'st_mode' All
- '"nlink"' 'st_nlink' All
- '"uid"' 'st_uid' All
- '"gid"' 'st_gid' All
- '"size"' 'st_size' All
- '"atime"' 'st_atime' All
- '"mtime"' 'st_mtime' All
- '"ctime"' 'st_ctime' All
- '"rdev"' 'st_rdev' Device files
- '"major"' 'st_major' Device files
- '"minor"' 'st_minor' Device files
- '"blksize"' 'st_blksize' All
- '"pmode"' A human-readable version of the All
- mode value, like that printed by
- 'ls' (for example, '"-rwxr-xr-x"')
- '"linkval"' The value of the symbolic link Symbolic
- links
- '"type"' The type of the file as a All
- string--one of '"file"',
- '"blockdev"', '"chardev"',
- '"directory"', '"socket"',
- '"fifo"', '"symlink"', '"door"',
- or '"unknown"' (not all systems
- support all file types)
-
-'flags = or(FTS_PHYSICAL, ...)'
-'result = fts(pathlist, flags, filedata)'
- Walk the file trees provided in 'pathlist' and fill in the
- 'filedata' array, as described next. 'flags' is the bitwise OR of
- several predefined values, also described in a moment. Return zero
- if there were no errors, otherwise return -1.
-
- The 'fts()' function provides a hook to the C library 'fts()'
-routines for traversing file hierarchies. Instead of returning data
-about one file at a time in a stream, it fills in a multidimensional
-array with data about each file and directory encountered in the
-requested hierarchies.
-
- The arguments are as follows:
-
-'pathlist'
- An array of file names. The element values are used; the index
- values are ignored.
-
-'flags'
- This should be the bitwise OR of one or more of the following
- predefined constant flag values. At least one of 'FTS_LOGICAL' or
- 'FTS_PHYSICAL' must be provided; otherwise 'fts()' returns an error
- value and sets 'ERRNO'. The flags are:
-
- 'FTS_LOGICAL'
- Do a "logical" file traversal, where the information returned
- for a symbolic link refers to the linked-to file, and not to
- the symbolic link itself. This flag is mutually exclusive
- with 'FTS_PHYSICAL'.
-
- 'FTS_PHYSICAL'
- Do a "physical" file traversal, where the information returned
- for a symbolic link refers to the symbolic link itself. This
- flag is mutually exclusive with 'FTS_LOGICAL'.
-
- 'FTS_NOCHDIR'
- As a performance optimization, the C library 'fts()' routines
- change directory as they traverse a file hierarchy. This flag
- disables that optimization.
-
- 'FTS_COMFOLLOW'
- Immediately follow a symbolic link named in 'pathlist',
- whether or not 'FTS_LOGICAL' is set.
-
- 'FTS_SEEDOT'
- By default, the C library 'fts()' routines do not return
- entries for '.' (dot) and '..' (dot-dot). This option causes
- entries for dot-dot to also be included. (The extension
- always includes an entry for dot; more on this in a moment.)
-
- 'FTS_XDEV'
- During a traversal, do not cross onto a different mounted
- filesystem.
-
-'filedata'
- The 'filedata' array holds the results. 'fts()' first clears it.
- Then it creates an element in 'filedata' for every element in
- 'pathlist'. The index is the name of the directory or file given
- in 'pathlist'. The element for this index is itself an array.
- There are two cases:
-
- _The path is a file_
- In this case, the array contains two or three elements:
-
- '"path"'
- The full path to this file, starting from the "root" that
- was given in the 'pathlist' array.
-
- '"stat"'
- This element is itself an array, containing the same
- information as provided by the 'stat()' function
- described earlier for its 'statdata' argument. The
- element may not be present if the 'stat()' system call
- for the file failed.
-
- '"error"'
- If some kind of error was encountered, the array will
- also contain an element named '"error"', which is a
- string describing the error.
-
- _The path is a directory_
- In this case, the array contains one element for each entry in
- the directory. If an entry is a file, that element is the
- same as for files, just described. If the entry is a
- directory, that element is (recursively) an array describing
- the subdirectory. If 'FTS_SEEDOT' was provided in the flags,
- then there will also be an element named '".."'. This element
- will be an array containing the data as provided by 'stat()'.
-
- In addition, there will be an element whose index is '"."'.
- This element is an array containing the same two or three
- elements as for a file: '"path"', '"stat"', and '"error"'.
-
- The 'fts()' function returns zero if there were no errors.
-Otherwise, it returns -1.
-
- NOTE: The 'fts()' extension does not exactly mimic the interface of
- the C library 'fts()' routines, choosing instead to provide an
- interface that is based on associative arrays, which is more
- comfortable to use from an 'awk' program. This includes the lack
- of a comparison function, because 'gawk' already provides powerful
- array sorting facilities. Although an 'fts_read()'-like interface
- could have been provided, this felt less natural than simply
- creating a multidimensional array to represent the file hierarchy
- and its information.
-
- See 'test/fts.awk' in the 'gawk' distribution for an example use of
-the 'fts()' extension function.
-
-
-File: gawk.info, Node: Extension Sample Fnmatch, Next: Extension Sample Fork, Prev: Extension Sample File Functions, Up: Extension Samples
-
-16.7.2 Interface to 'fnmatch()'
--------------------------------
-
-This extension provides an interface to the C library 'fnmatch()'
-function. The usage is:
-
-'@load "fnmatch"'
- This is how you load the extension.
-
-'result = fnmatch(pattern, string, flags)'
- The return value is zero on success, 'FNM_NOMATCH' if the string
- did not match the pattern, or a different nonzero value if an error
- occurred.
-
- In addition to the 'fnmatch()' function, the 'fnmatch' extension adds
-one constant ('FNM_NOMATCH'), and an array of flag values named 'FNM'.
-
- The arguments to 'fnmatch()' are:
-
-'pattern'
- The file name wildcard to match
-
-'string'
- The file name string
-
-'flag'
- Either zero, or the bitwise OR of one or more of the flags in the
- 'FNM' array
-
- The flags are as follows:
-
-Array element Corresponding flag defined by 'fnmatch()'
---------------------------------------------------------------------------
-'FNM["CASEFOLD"]' 'FNM_CASEFOLD'
-'FNM["FILE_NAME"]' 'FNM_FILE_NAME'
-'FNM["LEADING_DIR"]''FNM_LEADING_DIR'
-'FNM["NOESCAPE"]' 'FNM_NOESCAPE'
-'FNM["PATHNAME"]' 'FNM_PATHNAME'
-'FNM["PERIOD"]' 'FNM_PERIOD'
-
- Here is an example:
-
- @load "fnmatch"
- ...
- flags = or(FNM["PERIOD"], FNM["NOESCAPE"])
- if (fnmatch("*.a", "foo.c", flags) == FNM_NOMATCH)
- print "no match"
-
-
-File: gawk.info, Node: Extension Sample Fork, Next: Extension Sample Inplace, Prev: Extension Sample Fnmatch, Up: Extension Samples
-
-16.7.3 Interface to 'fork()', 'wait()', and 'waitpid()'
--------------------------------------------------------
-
-The 'fork' extension adds three functions, as follows:
-
-'@load "fork"'
- This is how you load the extension.
-
-'pid = fork()'
- This function creates a new process. The return value is zero in
- the child and the process ID number of the child in the parent, or
- -1 upon error. In the latter case, 'ERRNO' indicates the problem.
- In the child, 'PROCINFO["pid"]' and 'PROCINFO["ppid"]' are updated
- to reflect the correct values.
-
-'ret = waitpid(pid)'
- This function takes a numeric argument, which is the process ID to
- wait for. The return value is that of the 'waitpid()' system call.
-
-'ret = wait()'
- This function waits for the first child to die. The return value
- is that of the 'wait()' system call.
-
- There is no corresponding 'exec()' function.
-
- Here is an example:
-
- @load "fork"
- ...
- if ((pid = fork()) == 0)
- print "hello from the child"
- else
- print "hello from the parent"
-
-
-File: gawk.info, Node: Extension Sample Inplace, Next: Extension Sample Ord, Prev: Extension Sample Fork, Up: Extension Samples
-
-16.7.4 Enabling In-Place File Editing
--------------------------------------
-
-The 'inplace' extension emulates GNU 'sed''s '-i' option, which performs
-"in-place" editing of each input file. It uses the bundled
-'inplace.awk' include file to invoke the extension properly:
-
- # inplace --- load and invoke the inplace extension.
-
- @load "inplace"
-
- # Please set INPLACE_SUFFIX to make a backup copy. For example, you may
- # want to set INPLACE_SUFFIX to .bak on the command line or in a BEGIN rule.
-
- # By default, each filename on the command line will be edited inplace.
- # But you can selectively disable this by adding an inplace=0 argument
- # prior to files that you do not want to process this way. You can then
- # reenable it later on the commandline by putting inplace=1 before files
- # that you wish to be subject to inplace editing.
-
- # N.B. We call inplace_end() in the BEGINFILE and END rules so that any
- # actions in an ENDFILE rule will be redirected as expected.
-
- BEGIN {
- inplace = 1 # enabled by default
- }
-
- BEGINFILE {
- if (_inplace_filename != "")
- inplace_end(_inplace_filename, INPLACE_SUFFIX)
- if (inplace)
- inplace_begin(_inplace_filename = FILENAME, INPLACE_SUFFIX)
- else
- _inplace_filename = ""
- }
-
- END {
- if (_inplace_filename != "")
- inplace_end(_inplace_filename, INPLACE_SUFFIX)
- }
-
- For each regular file that is processed, the extension redirects
-standard output to a temporary file configured to have the same owner
-and permissions as the original. After the file has been processed, the
-extension restores standard output to its original destination. If
-'INPLACE_SUFFIX' is not an empty string, the original file is linked to
-a backup file name created by appending that suffix. Finally, the
-temporary file is renamed to the original file name.
-
- Note that the use of this feature can be controlled by placing
-'inplace=0' on the command-line prior to listing files that should not
-be processed this way. You can reenable inplace editing by adding an
-'inplace=1' argument prior to files that should be subject to inplace
-editing.
-
- The '_inplace_filename' variable serves to keep track of the current
-filename so as to not invoke 'inplace_end()' before processing the first
-file.
-
- If any error occurs, the extension issues a fatal error to terminate
-processing immediately without damaging the original file.
-
- Here are some simple examples:
-
- $ gawk -i inplace '{ gsub(/foo/, "bar") }; { print }' file1 file2 file3
-
- To keep a backup copy of the original files, try this:
-
- $ gawk -i inplace -v INPLACE_SUFFIX=.bak '{ gsub(/foo/, "bar") }
- > { print }' file1 file2 file3
-
- Please note that, while the extension does attempt to preserve
-ownership and permissions, it makes no attempt to copy the ACLs from the
-original file.
-
- If the program dies prematurely, as might happen if an unhandled
-signal is received, a temporary file may be left behind.
-
-
-File: gawk.info, Node: Extension Sample Ord, Next: Extension Sample Readdir, Prev: Extension Sample Inplace, Up: Extension Samples
-
-16.7.5 Character and Numeric values: 'ord()' and 'chr()'
---------------------------------------------------------
-
-The 'ordchr' extension adds two functions, named 'ord()' and 'chr()', as
-follows:
-
-'@load "ordchr"'
- This is how you load the extension.
-
-'number = ord(string)'
- Return the numeric value of the first character in 'string'.
-
-'char = chr(number)'
- Return a string whose first character is that represented by
- 'number'.
-
- These functions are inspired by the Pascal language functions of the
-same name. Here is an example:
-
- @load "ordchr"
- ...
- printf("The numeric value of 'A' is %d\n", ord("A"))
- printf("The string value of 65 is %s\n", chr(65))
-
-
-File: gawk.info, Node: Extension Sample Readdir, Next: Extension Sample Revout, Prev: Extension Sample Ord, Up: Extension Samples
-
-16.7.6 Reading Directories
---------------------------
-
-The 'readdir' extension adds an input parser for directories. The usage
-is as follows:
-
- @load "readdir"
-
- When this extension is in use, instead of skipping directories named
-on the command line (or with 'getline'), they are read, with each entry
-returned as a record.
-
- The record consists of three fields. The first two are the inode
-number and the file name, separated by a forward slash character. On
-systems where the directory entry contains the file type, the record has
-a third field (also separated by a slash), which is a single letter
-indicating the type of the file. The letters and their corresponding
-file types are shown in *note Table 16.3: table-readdir-file-types.
-
-Letter File type
---------------------------------------------------------------------------
-'b' Block device
-'c' Character device
-'d' Directory
-'f' Regular file
-'l' Symbolic link
-'p' Named pipe (FIFO)
-'s' Socket
-'u' Anything else (unknown)
-
-Table 16.3: File types returned by the 'readdir' extension
-
- On systems without the file type information, the third field is
-always 'u'.
-
- NOTE: On GNU/Linux systems, there are filesystems that don't
- support the 'd_type' entry (see the readdir(3) manual page), and so
- the file type is always 'u'. You can use the 'filefuncs' extension
- to call 'stat()' in order to get correct type information.
-
- Here is an example:
-
- @load "readdir"
- ...
- BEGIN { FS = "/" }
- { print "file name is", $2 }
-
-
-File: gawk.info, Node: Extension Sample Revout, Next: Extension Sample Rev2way, Prev: Extension Sample Readdir, Up: Extension Samples
-
-16.7.7 Reversing Output
------------------------
-
-The 'revoutput' extension adds a simple output wrapper that reverses the
-characters in each output line. Its main purpose is to show how to
-write an output wrapper, although it may be mildly amusing for the
-unwary. Here is an example:
-
- @load "revoutput"
-
- BEGIN {
- REVOUT = 1
- print "don't panic" > "/dev/stdout"
- }
-
- The output from this program is 'cinap t'nod'.
-
-
-File: gawk.info, Node: Extension Sample Rev2way, Next: Extension Sample Read write array, Prev: Extension Sample Revout, Up: Extension Samples
-
-16.7.8 Two-Way I/O Example
---------------------------
-
-The 'revtwoway' extension adds a simple two-way processor that reverses
-the characters in each line sent to it for reading back by the 'awk'
-program. Its main purpose is to show how to write a two-way processor,
-although it may also be mildly amusing. The following example shows how
-to use it:
-
- @load "revtwoway"
-
- BEGIN {
- cmd = "/magic/mirror"
- print "don't panic" |& cmd
- cmd |& getline result
- print result
- close(cmd)
- }
-
- The output from this program is: 'cinap t'nod'.
-
-
-File: gawk.info, Node: Extension Sample Read write array, Next: Extension Sample Readfile, Prev: Extension Sample Rev2way, Up: Extension Samples
-
-16.7.9 Dumping and Restoring an Array
--------------------------------------
-
-The 'rwarray' extension adds two functions, named 'writea()' and
-'reada()', as follows:
-
-'@load "rwarray"'
- This is how you load the extension.
-
-'ret = writea(file, array)'
- This function takes a string argument, which is the name of the
- file to which to dump the array, and the array itself as the second
- argument. 'writea()' understands arrays of arrays. It returns one
- on success, or zero upon failure.
-
-'ret = reada(file, array)'
- 'reada()' is the inverse of 'writea()'; it reads the file named as
- its first argument, filling in the array named as the second
- argument. It clears the array first. Here too, the return value
- is one on success, or zero upon failure.
-
- The array created by 'reada()' is identical to that written by
-'writea()' in the sense that the contents are the same. However, due to
-implementation issues, the array traversal order of the re-created array
-is likely to be different from that of the original array. As array
-traversal order in 'awk' is by default undefined, this is (technically)
-not a problem. If you need to guarantee a particular traversal order,
-use the array sorting features in 'gawk' to do so (*note Array
-Sorting::).
-
- The file contains binary data. All integral values are written in
-network byte order. However, double-precision floating-point values are
-written as native binary data. Thus, arrays containing only string data
-can theoretically be dumped on systems with one byte order and restored
-on systems with a different one, but this has not been tried.
-
- Here is an example:
-
- @load "rwarray"
- ...
- ret = writea("arraydump.bin", array)
- ...
- ret = reada("arraydump.bin", array)
-
-
-File: gawk.info, Node: Extension Sample Readfile, Next: Extension Sample Time, Prev: Extension Sample Read write array, Up: Extension Samples
-
-16.7.10 Reading an Entire File
-------------------------------
-
-The 'readfile' extension adds a single function named 'readfile()', and
-an input parser:
-
-'@load "readfile"'
- This is how you load the extension.
-
-'result = readfile("/some/path")'
- The argument is the name of the file to read. The return value is
- a string containing the entire contents of the requested file.
- Upon error, the function returns the empty string and sets 'ERRNO'.
-
-'BEGIN { PROCINFO["readfile"] = 1 }'
- In addition, the extension adds an input parser that is activated
- if 'PROCINFO["readfile"]' exists. When activated, each input file
- is returned in its entirety as '$0'. 'RT' is set to the null
- string.
-
- Here is an example:
-
- @load "readfile"
- ...
- contents = readfile("/path/to/file");
- if (contents == "" && ERRNO != "") {
- print("problem reading file", ERRNO) > "/dev/stderr"
- ...
- }
-
-
-File: gawk.info, Node: Extension Sample Time, Next: Extension Sample API Tests, Prev: Extension Sample Readfile, Up: Extension Samples
-
-16.7.11 Extension Time Functions
---------------------------------
-
-The 'time' extension adds two functions, named 'gettimeofday()' and
-'sleep()', as follows:
-
-'@load "time"'
- This is how you load the extension.
-
-'the_time = gettimeofday()'
- Return the time in seconds that has elapsed since 1970-01-01 UTC as
- a floating-point value. If the time is unavailable on this
- platform, return -1 and set 'ERRNO'. The returned time should have
- sub-second precision, but the actual precision may vary based on
- the platform. If the standard C 'gettimeofday()' system call is
- available on this platform, then it simply returns the value.
- Otherwise, if on MS-Windows, it tries to use
- 'GetSystemTimeAsFileTime()'.
-
-'result = sleep(SECONDS)'
- Attempt to sleep for SECONDS seconds. If SECONDS is negative, or
- the attempt to sleep fails, return -1 and set 'ERRNO'. Otherwise,
- return zero after sleeping for the indicated amount of time. Note
- that SECONDS may be a floating-point (nonintegral) value.
- Implementation details: depending on platform availability, this
- function tries to use 'nanosleep()' or 'select()' to implement the
- delay.
-
-
-File: gawk.info, Node: Extension Sample API Tests, Prev: Extension Sample Time, Up: Extension Samples
-
-16.7.12 API Tests
------------------
-
-The 'testext' extension exercises parts of the extension API that are
-not tested by the other samples. The 'extension/testext.c' file
-contains both the C code for the extension and 'awk' test code inside C
-comments that run the tests. The testing framework extracts the 'awk'
-code and runs the tests. See the source file for more information.
-
-
-File: gawk.info, Node: gawkextlib, Next: Extension summary, Prev: Extension Samples, Up: Dynamic Extensions
-
-16.8 The 'gawkextlib' Project
-=============================
-
-The 'gawkextlib' (http://sourceforge.net/projects/gawkextlib/) project
-provides a number of 'gawk' extensions, including one for processing XML
-files. This is the evolution of the original 'xgawk' (XML 'gawk')
-project.
-
- As of this writing, there are seven extensions:
-
- * 'errno' extension
-
- * GD graphics library extension
-
- * MPFR library extension (this provides access to a number of MPFR
- functions that 'gawk''s native MPFR support does not)
-
- * PDF extension
-
- * PostgreSQL extension
-
- * Redis extension
-
- * Select extension
-
- * XML parser extension, using the Expat
- (http://expat.sourceforge.net) XML parsing library
-
- You can check out the code for the 'gawkextlib' project using the Git
-(http://git-scm.com) distributed source code control system. The
-command is as follows:
-
- git clone git://git.code.sf.net/p/gawkextlib/code gawkextlib-code
-
- You will need to have the Expat (http://expat.sourceforge.net) XML
-parser library installed in order to build and use the XML extension.
-
- In addition, you must have the GNU Autotools installed (Autoconf
-(http://www.gnu.org/software/autoconf), Automake
-(http://www.gnu.org/software/automake), Libtool
-(http://www.gnu.org/software/libtool), and GNU 'gettext'
-(http://www.gnu.org/software/gettext)).
-
- The simple recipe for building and testing 'gawkextlib' is as
-follows. First, build and install 'gawk':
-
- cd .../path/to/gawk/code
- ./configure --prefix=/tmp/newgawk Install in /tmp/newgawk for now
- make && make check Build and check that all is OK
- make install Install gawk
-
- Next, go to <http://sourceforge.net/projects/gawkextlib/files> to
-download 'gawkextlib' and any extensions that you would like to build.
-The 'README' file at that site explains how to build the code. If you
-installed 'gawk' in a non-standard location, you will need to specify
-'./configure --with-gawk=/PATH/TO/GAWK' to find it. You may need to use
-the 'sudo' utility to install both 'gawk' and 'gawkextlib', depending
-upon how your system works.
-
- If you write an extension that you wish to share with other 'gawk'
-users, consider doing so through the 'gawkextlib' project. See the
-project's website for more information.
-
-
-File: gawk.info, Node: Extension summary, Next: Extension Exercises, Prev: gawkextlib, Up: Dynamic Extensions
-
-16.9 Summary
-============
-
- * You can write extensions (sometimes called plug-ins) for 'gawk' in
- C or C++ using the application programming interface (API) defined
- by the 'gawk' developers.
-
- * Extensions must have a license compatible with the GNU General
- Public License (GPL), and they must assert that fact by declaring a
- variable named 'plugin_is_GPL_compatible'.
-
- * Communication between 'gawk' and an extension is two-way. 'gawk'
- passes a 'struct' to the extension that contains various data
- fields and function pointers. The extension can then call into
- 'gawk' via the supplied function pointers to accomplish certain
- tasks.
-
- * One of these tasks is to "register" the name and implementation of
- new 'awk'-level functions with 'gawk'. The implementation takes
- the form of a C function pointer with a defined signature. By
- convention, implementation functions are named 'do_XXXX()' for some
- 'awk'-level function 'XXXX()'.
-
- * The API is defined in a header file named 'gawkapi.h'. You must
- include a number of standard header files _before_ including it in
- your source file.
-
- * API function pointers are provided for the following kinds of
- operations:
-
- * Allocating, reallocating, and releasing memory
-
- * Registration functions (you may register extension functions,
- exit callbacks, a version string, input parsers, output
- wrappers, and two-way processors)
-
- * Printing fatal, nonfatal, warning, and "lint" warning messages
-
- * Updating 'ERRNO', or unsetting it
-
- * Accessing parameters, including converting an undefined
- parameter into an array
-
- * Symbol table access (retrieving a global variable, creating
- one, or changing one)
-
- * Creating and releasing cached values; this provides an
- efficient way to use values for multiple variables and can be
- a big performance win
-
- * Manipulating arrays (retrieving, adding, deleting, and
- modifying elements; getting the count of elements in an array;
- creating a new array; clearing an array; and flattening an
- array for easy C-style looping over all its indices and
- elements)
-
- * The API defines a number of standard data types for representing
- 'awk' values, array elements, and arrays.
-
- * The API provides convenience functions for constructing values. It
- also provides memory management functions to ensure compatibility
- between memory allocated by 'gawk' and memory allocated by an
- extension.
-
- * _All_ memory passed from 'gawk' to an extension must be treated as
- read-only by the extension.
-
- * _All_ memory passed from an extension to 'gawk' must come from the
- API's memory allocation functions. 'gawk' takes responsibility for
- the memory and releases it when appropriate.
-
- * The API provides information about the running version of 'gawk' so
- that an extension can make sure it is compatible with the 'gawk'
- that loaded it.
-
- * It is easiest to start a new extension by copying the boilerplate
- code described in this major node. Macros in the 'gawkapi.h'
- header file make this easier to do.
-
- * The 'gawk' distribution includes a number of small but useful
- sample extensions. The 'gawkextlib' project includes several more
- (larger) extensions. If you wish to write an extension and
- contribute it to the community of 'gawk' users, the 'gawkextlib'
- project is the place to do so.
-
-
-File: gawk.info, Node: Extension Exercises, Prev: Extension summary, Up: Dynamic Extensions
-
-16.10 Exercises
-===============
-
- 1. Add functions to implement system calls such as 'chown()',
- 'chmod()', and 'umask()' to the file operations extension presented
- in *note Internal File Ops::.
-
- 2. Write an input parser that prints a prompt if the input is a from a
- "terminal" device. You can use the 'isatty()' function to tell if
- the input file is a terminal. (Hint: this function is usually
- expensive to call; try to call it just once.) The content of the
- prompt should come from a variable settable by 'awk'-level code.
- You can write the prompt to standard error. However, for best
- results, open a new file descriptor (or file pointer) on '/dev/tty'
- and print the prompt there, in case standard error has been
- redirected.
-
- Why is standard error a better choice than standard output for
- writing the prompt? Which reading mechanism should you replace,
- the one to get a record, or the one to read raw bytes?
-
- 3. (Hard.) How would you provide namespaces in 'gawk', so that the
- names of functions in different extensions don't conflict with each
- other? If you come up with a really good scheme, contact the
- 'gawk' maintainer to tell him about it.
-
- 4. Write a wrapper script that provides an interface similar to 'sed
- -i' for the "inplace" extension presented in *note Extension Sample
- Inplace::.
-
-
-File: gawk.info, Node: Language History, Next: Installation, Prev: Dynamic Extensions, Up: Top
-
-Appendix A The Evolution of the 'awk' Language
-**********************************************
-
-This Info file describes the GNU implementation of 'awk', which follows
-the POSIX specification. Many longtime 'awk' users learned 'awk'
-programming with the original 'awk' implementation in Version 7 Unix.
-(This implementation was the basis for 'awk' in Berkeley Unix, through
-4.3-Reno. Subsequent versions of Berkeley Unix, and, for a while, some
-systems derived from 4.4BSD-Lite, used various versions of 'gawk' for
-their 'awk'.) This major node briefly describes the evolution of the
-'awk' language, with cross-references to other parts of the Info file
-where you can find more information.
-
-* Menu:
-
-* V7/SVR3.1:: The major changes between V7 and System V
- Release 3.1.
-* SVR4:: Minor changes between System V Releases 3.1
- and 4.
-* POSIX:: New features from the POSIX standard.
-* BTL:: New features from Brian Kernighan's version of
- 'awk'.
-* POSIX/GNU:: The extensions in 'gawk' not in POSIX
- 'awk'.
-* Feature History:: The history of the features in 'gawk'.
-* Common Extensions:: Common Extensions Summary.
-* Ranges and Locales:: How locales used to affect regexp ranges.
-* Contributors:: The major contributors to 'gawk'.
-* History summary:: History summary.
-
-
-File: gawk.info, Node: V7/SVR3.1, Next: SVR4, Up: Language History
-
-A.1 Major Changes Between V7 and SVR3.1
-=======================================
-
-The 'awk' language evolved considerably between the release of Version 7
-Unix (1978) and the new version that was first made generally available
-in System V Release 3.1 (1987). This minor node summarizes the changes,
-with cross-references to further details:
-
- * The requirement for ';' to separate rules on a line (*note
- Statements/Lines::)
-
- * User-defined functions and the 'return' statement (*note
- User-defined::)
-
- * The 'delete' statement (*note Delete::)
-
- * The 'do'-'while' statement (*note Do Statement::)
-
- * The built-in functions 'atan2()', 'cos()', 'sin()', 'rand()', and
- 'srand()' (*note Numeric Functions::)
-
- * The built-in functions 'gsub()', 'sub()', and 'match()' (*note
- String Functions::)
-
- * The built-in functions 'close()' and 'system()' (*note I/O
- Functions::)
-
- * The 'ARGC', 'ARGV', 'FNR', 'RLENGTH', 'RSTART', and 'SUBSEP'
- predefined variables (*note Built-in Variables::)
-
- * Assignable '$0' (*note Changing Fields::)
-
- * The conditional expression using the ternary operator '?:' (*note
- Conditional Exp::)
-
- * The expression 'INDX in ARRAY' outside of 'for' statements (*note
- Reference to Elements::)
-
- * The exponentiation operator '^' (*note Arithmetic Ops::) and its
- assignment operator form '^=' (*note Assignment Ops::)
-
- * C-compatible operator precedence, which breaks some old 'awk'
- programs (*note Precedence::)
-
- * Regexps as the value of 'FS' (*note Field Separators::) and as the
- third argument to the 'split()' function (*note String
- Functions::), rather than using only the first character of 'FS'
-
- * Dynamic regexps as operands of the '~' and '!~' operators (*note
- Computed Regexps::)
-
- * The escape sequences '\b', '\f', and '\r' (*note Escape
- Sequences::)
-
- * Redirection of input for the 'getline' function (*note Getline::)
-
- * Multiple 'BEGIN' and 'END' rules (*note BEGIN/END::)
-
- * Multidimensional arrays (*note Multidimensional::)
-
-
-File: gawk.info, Node: SVR4, Next: POSIX, Prev: V7/SVR3.1, Up: Language History
-
-A.2 Changes Between SVR3.1 and SVR4
-===================================
-
-The System V Release 4 (1989) version of Unix 'awk' added these features
-(some of which originated in 'gawk'):
-
- * The 'ENVIRON' array (*note Built-in Variables::)
-
- * Multiple '-f' options on the command line (*note Options::)
-
- * The '-v' option for assigning variables before program execution
- begins (*note Options::)
-
- * The '--' signal for terminating command-line options
-
- * The '\a', '\v', and '\x' escape sequences (*note Escape
- Sequences::)
-
- * A defined return value for the 'srand()' built-in function (*note
- Numeric Functions::)
-
- * The 'toupper()' and 'tolower()' built-in string functions for case
- translation (*note String Functions::)
-
- * A cleaner specification for the '%c' format-control letter in the
- 'printf' function (*note Control Letters::)
-
- * The ability to dynamically pass the field width and precision
- ('"%*.*d"') in the argument list of 'printf' and 'sprintf()' (*note
- Control Letters::)
-
- * The use of regexp constants, such as '/foo/', as expressions, where
- they are equivalent to using the matching operator, as in '$0 ~
- /foo/' (*note Using Constant Regexps::)
-
- * Processing of escape sequences inside command-line variable
- assignments (*note Assignment Options::)
-
-
-File: gawk.info, Node: POSIX, Next: BTL, Prev: SVR4, Up: Language History
-
-A.3 Changes Between SVR4 and POSIX 'awk'
-========================================
-
-The POSIX Command Language and Utilities standard for 'awk' (1992)
-introduced the following changes into the language:
-
- * The use of '-W' for implementation-specific options (*note
- Options::)
-
- * The use of 'CONVFMT' for controlling the conversion of numbers to
- strings (*note Conversion::)
-
- * The concept of a numeric string and tighter comparison rules to go
- with it (*note Typing and Comparison::)
-
- * The use of predefined variables as function parameter names is
- forbidden (*note Definition Syntax::)
-
- * More complete documentation of many of the previously undocumented
- features of the language
-
- In 2012, a number of extensions that had been commonly available for
-many years were finally added to POSIX. They are:
-
- * The 'fflush()' built-in function for flushing buffered output
- (*note I/O Functions::)
-
- * The 'nextfile' statement (*note Nextfile Statement::)
-
- * The ability to delete all of an array at once with 'delete ARRAY'
- (*note Delete::)
-
- *Note Common Extensions:: for a list of common extensions not
-permitted by the POSIX standard.
-
- The 2008 POSIX standard can be found online at
-<http://www.opengroup.org/onlinepubs/9699919799/>.
-
-
-File: gawk.info, Node: BTL, Next: POSIX/GNU, Prev: POSIX, Up: Language History
-
-A.4 Extensions in Brian Kernighan's 'awk'
-=========================================
-
-Brian Kernighan has made his version available via his home page (*note
-Other Versions::).
-
- This minor node describes common extensions that originally appeared
-in his version of 'awk':
-
- * The '**' and '**=' operators (*note Arithmetic Ops:: and *note
- Assignment Ops::)
-
- * The use of 'func' as an abbreviation for 'function' (*note
- Definition Syntax::)
-
- * The 'fflush()' built-in function for flushing buffered output
- (*note I/O Functions::)
-
- *Note Common Extensions:: for a full list of the extensions available
-in his 'awk'.
-
-
-File: gawk.info, Node: POSIX/GNU, Next: Feature History, Prev: BTL, Up: Language History
-
-A.5 Extensions in 'gawk' Not in POSIX 'awk'
-===========================================
-
-The GNU implementation, 'gawk', adds a large number of features. They
-can all be disabled with either the '--traditional' or '--posix' options
-(*note Options::).
-
- A number of features have come and gone over the years. This minor
-node summarizes the additional features over POSIX 'awk' that are in the
-current version of 'gawk'.
-
- * Additional predefined variables:
-
- - The 'ARGIND', 'BINMODE', 'ERRNO', 'FIELDWIDTHS', 'FPAT',
- 'IGNORECASE', 'LINT', 'PROCINFO', 'RT', and 'TEXTDOMAIN'
- variables (*note Built-in Variables::)
-
- * Special files in I/O redirections:
-
- - The '/dev/stdin', '/dev/stdout', '/dev/stderr', and
- '/dev/fd/N' special file names (*note Special Files::)
-
- - The '/inet', '/inet4', and '/inet6' special files for TCP/IP
- networking using '|&' to specify which version of the IP
- protocol to use (*note TCP/IP Networking::)
-
- * Changes and/or additions to the language:
-
- - The '\x' escape sequence (*note Escape Sequences::)
-
- - Full support for both POSIX and GNU regexps (*note Regexp::)
-
- - The ability for 'FS' and for the third argument to 'split()'
- to be null strings (*note Single Character Fields::)
-
- - The ability for 'RS' to be a regexp (*note Records::)
-
- - The ability to use octal and hexadecimal constants in 'awk'
- program source code (*note Nondecimal-numbers::)
-
- - The '|&' operator for two-way I/O to a coprocess (*note
- Two-way I/O::)
-
- - Indirect function calls (*note Indirect Calls::)
-
- - Directories on the command line produce a warning and are
- skipped (*note Command-line directories::)
-
- - Output with 'print' and 'printf' need not be fatal (*note
- Nonfatal::)
-
- * New keywords:
-
- - The 'BEGINFILE' and 'ENDFILE' special patterns (*note
- BEGINFILE/ENDFILE::)
-
- - The 'switch' statement (*note Switch Statement::)
-
- * Changes to standard 'awk' functions:
-
- - The optional second argument to 'close()' that allows closing
- one end of a two-way pipe to a coprocess (*note Two-way I/O::)
-
- - POSIX compliance for 'gsub()' and 'sub()' with '--posix'
-
- - The 'length()' function accepts an array argument and returns
- the number of elements in the array (*note String Functions::)
-
- - The optional third argument to the 'match()' function for
- capturing text-matching subexpressions within a regexp (*note
- String Functions::)
-
- - Positional specifiers in 'printf' formats for making
- translations easier (*note Printf Ordering::)
-
- - The 'split()' function's additional optional fourth argument,
- which is an array to hold the text of the field separators
- (*note String Functions::)
-
- * Additional functions only in 'gawk':
-
- - The 'gensub()', 'patsplit()', and 'strtonum()' functions for
- more powerful text manipulation (*note String Functions::)
-
- - The 'asort()' and 'asorti()' functions for sorting arrays
- (*note Array Sorting::)
-
- - The 'mktime()', 'systime()', and 'strftime()' functions for
- working with timestamps (*note Time Functions::)
-
- - The 'and()', 'compl()', 'lshift()', 'or()', 'rshift()', and
- 'xor()' functions for bit manipulation (*note Bitwise
- Functions::)
-
- - The 'isarray()' function to check if a variable is an array or
- not (*note Type Functions::)
-
- - The 'bindtextdomain()', 'dcgettext()', and 'dcngettext()'
- functions for internationalization (*note Programmer i18n::)
-
- - The 'intdiv()' function for doing integer division and
- remainder (*note Numeric Functions::)
-
- * Changes and/or additions in the command-line options:
-
- - The 'AWKPATH' environment variable for specifying a path
- search for the '-f' command-line option (*note Options::)
-
- - The 'AWKLIBPATH' environment variable for specifying a path
- search for the '-l' command-line option (*note Options::)
-
- - The '-b', '-c', '-C', '-d', '-D', '-e', '-E', '-g', '-h',
- '-i', '-l', '-L', '-M', '-n', '-N', '-o', '-O', '-p', '-P',
- '-r', '-s', '-S', '-t', and '-V' short options. Also, the
- ability to use GNU-style long-named options that start with
- '--', and the '--assign', '--bignum', '--characters-as-bytes',
- '--copyright', '--debug', '--dump-variables', '--exec',
- '--field-separator', '--file', '--gen-pot', '--help',
- '--include', '--lint', '--lint-old', '--load',
- '--non-decimal-data', '--optimize', '--no-optimize',
- '--posix', '--pretty-print', '--profile', '--re-interval',
- '--sandbox', '--source', '--traditional', '--use-lc-numeric',
- and '--version' long options (*note Options::).
-
- * Support for the following obsolete systems was removed from the
- code and the documentation for 'gawk' version 4.0:
-
- - Amiga
-
- - Atari
-
- - BeOS
-
- - Cray
-
- - MIPS RiscOS
-
- - MS-DOS with the Microsoft Compiler
-
- - MS-Windows with the Microsoft Compiler
-
- - NeXT
-
- - SunOS 3.x, Sun 386 (Road Runner)
-
- - Tandem (non-POSIX)
-
- - Prestandard VAX C compiler for VAX/VMS
-
- - GCC for VAX and Alpha has not been tested for a while.
-
- * Support for the following obsolete system was removed from the code
- for 'gawk' version 4.1:
-
- - Ultrix
-
- * Support for the following systems was removed from the code for
- 'gawk' version 4.2:
-
- - MirBSD
-
-
-File: gawk.info, Node: Feature History, Next: Common Extensions, Prev: POSIX/GNU, Up: Language History
-
-A.6 History of 'gawk' Features
-==============================
-
-This minor node describes the features in 'gawk' over and above those in
-POSIX 'awk', in the order they were added to 'gawk'.
-
- Version 2.10 of 'gawk' introduced the following features:
-
- * The 'AWKPATH' environment variable for specifying a path search for
- the '-f' command-line option (*note Options::).
-
- * The 'IGNORECASE' variable and its effects (*note
- Case-sensitivity::).
-
- * The '/dev/stdin', '/dev/stdout', '/dev/stderr' and '/dev/fd/N'
- special file names (*note Special Files::).
-
- Version 2.13 of 'gawk' introduced the following features:
-
- * The 'FIELDWIDTHS' variable and its effects (*note Constant Size::).
-
- * The 'systime()' and 'strftime()' built-in functions for obtaining
- and printing timestamps (*note Time Functions::).
-
- * Additional command-line options (*note Options::):
-
- - The '-W lint' option to provide error and portability checking
- for both the source code and at runtime.
-
- - The '-W compat' option to turn off the GNU extensions.
-
- - The '-W posix' option for full POSIX compliance.
-
- Version 2.14 of 'gawk' introduced the following feature:
-
- * The 'next file' statement for skipping to the next data file (*note
- Nextfile Statement::).
-
- Version 2.15 of 'gawk' introduced the following features:
-
- * New variables (*note Built-in Variables::):
-
- - 'ARGIND', which tracks the movement of 'FILENAME' through
- 'ARGV'.
-
- - 'ERRNO', which contains the system error message when
- 'getline' returns -1 or 'close()' fails.
-
- * The '/dev/pid', '/dev/ppid', '/dev/pgrpid', and '/dev/user' special
- file names. These have since been removed.
-
- * The ability to delete all of an array at once with 'delete ARRAY'
- (*note Delete::).
-
- * Command-line option changes (*note Options::):
-
- - The ability to use GNU-style long-named options that start
- with '--'.
-
- - The '--source' option for mixing command-line and library-file
- source code.
-
- Version 3.0 of 'gawk' introduced the following features:
-
- * New or changed variables:
-
- - 'IGNORECASE' changed, now applying to string comparison as
- well as regexp operations (*note Case-sensitivity::).
-
- - 'RT', which contains the input text that matched 'RS' (*note
- Records::).
-
- * Full support for both POSIX and GNU regexps (*note Regexp::).
-
- * The 'gensub()' function for more powerful text manipulation (*note
- String Functions::).
-
- * The 'strftime()' function acquired a default time format, allowing
- it to be called with no arguments (*note Time Functions::).
-
- * The ability for 'FS' and for the third argument to 'split()' to be
- null strings (*note Single Character Fields::).
-
- * The ability for 'RS' to be a regexp (*note Records::).
-
- * The 'next file' statement became 'nextfile' (*note Nextfile
- Statement::).
-
- * The 'fflush()' function from BWK 'awk' (then at Bell Laboratories;
- *note I/O Functions::).
-
- * New command-line options:
-
- - The '--lint-old' option to warn about constructs that are not
- available in the original Version 7 Unix version of 'awk'
- (*note V7/SVR3.1::).
-
- - The '-m' option from BWK 'awk'. (Brian was still at Bell
- Laboratories at the time.) This was later removed from both
- his 'awk' and from 'gawk'.
-
- - The '--re-interval' option to provide interval expressions in
- regexps (*note Regexp Operators::).
-
- - The '--traditional' option was added as a better name for
- '--compat' (*note Options::).
-
- * The use of GNU Autoconf to control the configuration process (*note
- Quick Installation::).
-
- * Amiga support. This has since been removed.
-
- Version 3.1 of 'gawk' introduced the following features:
-
- * New variables (*note Built-in Variables::):
-
- - 'BINMODE', for non-POSIX systems, which allows binary I/O for
- input and/or output files (*note PC Using::).
-
- - 'LINT', which dynamically controls lint warnings.
-
- - 'PROCINFO', an array for providing process-related
- information.
-
- - 'TEXTDOMAIN', for setting an application's
- internationalization text domain (*note
- Internationalization::).
-
- * The ability to use octal and hexadecimal constants in 'awk' program
- source code (*note Nondecimal-numbers::).
-
- * The '|&' operator for two-way I/O to a coprocess (*note Two-way
- I/O::).
-
- * The '/inet' special files for TCP/IP networking using '|&' (*note
- TCP/IP Networking::).
-
- * The optional second argument to 'close()' that allows closing one
- end of a two-way pipe to a coprocess (*note Two-way I/O::).
-
- * The optional third argument to the 'match()' function for capturing
- text-matching subexpressions within a regexp (*note String
- Functions::).
-
- * Positional specifiers in 'printf' formats for making translations
- easier (*note Printf Ordering::).
-
- * A number of new built-in functions:
-
- - The 'asort()' and 'asorti()' functions for sorting arrays
- (*note Array Sorting::).
-
- - The 'bindtextdomain()', 'dcgettext()' and 'dcngettext()'
- functions for internationalization (*note Programmer i18n::).
-
- - The 'extension()' function and the ability to add new built-in
- functions dynamically (*note Dynamic Extensions::).
-
- - The 'mktime()' function for creating timestamps (*note Time
- Functions::).
-
- - The 'and()', 'or()', 'xor()', 'compl()', 'lshift()',
- 'rshift()', and 'strtonum()' functions (*note Bitwise
- Functions::).
-
- * The support for 'next file' as two words was removed completely
- (*note Nextfile Statement::).
-
- * Additional command-line options (*note Options::):
-
- - The '--dump-variables' option to print a list of all global
- variables.
-
- - The '--exec' option, for use in CGI scripts.
-
- - The '--gen-po' command-line option and the use of a leading
- underscore to mark strings that should be translated (*note
- String Extraction::).
-
- - The '--non-decimal-data' option to allow non-decimal input
- data (*note Nondecimal Data::).
-
- - The '--profile' option and 'pgawk', the profiling version of
- 'gawk', for producing execution profiles of 'awk' programs
- (*note Profiling::).
-
- - The '--use-lc-numeric' option to force 'gawk' to use the
- locale's decimal point for parsing input data (*note
- Conversion::).
-
- * The use of GNU Automake to help in standardizing the configuration
- process (*note Quick Installation::).
-
- * The use of GNU 'gettext' for 'gawk''s own message output (*note
- Gawk I18N::).
-
- * BeOS support. This was later removed.
-
- * Tandem support. This was later removed.
-
- * The Atari port became officially unsupported and was later removed
- entirely.
-
- * The source code changed to use ISO C standard-style function
- definitions.
-
- * POSIX compliance for 'sub()' and 'gsub()' (*note Gory Details::).
-
- * The 'length()' function was extended to accept an array argument
- and return the number of elements in the array (*note String
- Functions::).
-
- * The 'strftime()' function acquired a third argument to enable
- printing times as UTC (*note Time Functions::).
-
- Version 4.0 of 'gawk' introduced the following features:
-
- * Variable additions:
-
- - 'FPAT', which allows you to specify a regexp that matches the
- fields, instead of matching the field separator (*note
- Splitting By Content::).
-
- - If 'PROCINFO["sorted_in"]' exists, 'for(iggy in foo)' loops
- sort the indices before looping over them. The value of this
- element provides control over how the indices are sorted
- before the loop traversal starts (*note Controlling
- Scanning::).
-
- - 'PROCINFO["strftime"]', which holds the default format for
- 'strftime()' (*note Time Functions::).
-
- * The special files '/dev/pid', '/dev/ppid', '/dev/pgrpid' and
- '/dev/user' were removed.
-
- * Support for IPv6 was added via the '/inet6' special file. '/inet4'
- forces IPv4 and '/inet' chooses the system default, which is
- probably IPv4 (*note TCP/IP Networking::).
-
- * The use of '\s' and '\S' escape sequences in regular expressions
- (*note GNU Regexp Operators::).
-
- * Interval expressions became part of default regular expressions
- (*note Regexp Operators::).
-
- * POSIX character classes work even with '--traditional' (*note
- Regexp Operators::).
-
- * 'break' and 'continue' became invalid outside a loop, even with
- '--traditional' (*note Break Statement::, and also see *note
- Continue Statement::).
-
- * 'fflush()', 'nextfile', and 'delete ARRAY' are allowed if '--posix'
- or '--traditional', since they are all now part of POSIX.
-
- * An optional third argument to 'asort()' and 'asorti()', specifying
- how to sort (*note String Functions::).
-
- * The behavior of 'fflush()' changed to match BWK 'awk' and for
- POSIX; now both 'fflush()' and 'fflush("")' flush all open output
- redirections (*note I/O Functions::).
-
- * The 'isarray()' function which distinguishes if an item is an array
- or not, to make it possible to traverse arrays of arrays (*note
- Type Functions::).
-
- * The 'patsplit()' function which gives the same capability as
- 'FPAT', for splitting (*note String Functions::).
-
- * An optional fourth argument to the 'split()' function, which is an
- array to hold the values of the separators (*note String
- Functions::).
-
- * Arrays of arrays (*note Arrays of Arrays::).
-
- * The 'BEGINFILE' and 'ENDFILE' special patterns (*note
- BEGINFILE/ENDFILE::).
-
- * Indirect function calls (*note Indirect Calls::).
-
- * 'switch' / 'case' are enabled by default (*note Switch
- Statement::).
-
- * Command-line option changes (*note Options::):
-
- - The '-b' and '--characters-as-bytes' options which prevent
- 'gawk' from treating input as a multibyte string.
-
- - The redundant '--compat', '--copyleft', and '--usage' long
- options were removed.
-
- - The '--gen-po' option was finally renamed to the correct
- '--gen-pot'.
-
- - The '--sandbox' option which disables certain features.
-
- - All long options acquired corresponding short options, for use
- in '#!' scripts.
-
- * Directories named on the command line now produce a warning, not a
- fatal error, unless '--posix' or '--traditional' are used (*note
- Command-line directories::).
-
- * The 'gawk' internals were rewritten, bringing the 'dgawk' debugger
- and possibly improved performance (*note Debugger::).
-
- * Per the GNU Coding Standards, dynamic extensions must now define a
- global symbol indicating that they are GPL-compatible (*note Plugin
- License::).
-
- * In POSIX mode, string comparisons use 'strcoll()' / 'wcscoll()'
- (*note POSIX String Comparison::).
-
- * The option for raw sockets was removed, since it was never
- implemented (*note TCP/IP Networking::).
-
- * Ranges of the form '[d-h]' are treated as if they were in the C
- locale, no matter what kind of regexp is being used, and even if
- '--posix' (*note Ranges and Locales::).
-
- * Support was removed for the following systems:
-
- - Atari
-
- - Amiga
-
- - BeOS
-
- - Cray
-
- - MIPS RiscOS
-
- - MS-DOS with Microsoft Compiler
-
- - MS-Windows with Microsoft Compiler
-
- - NeXT
-
- - SunOS 3.x, Sun 386 (Road Runner)
-
- - Tandem (non-POSIX)
-
- - Prestandard VAX C compiler for VAX/VMS
-
- Version 4.1 of 'gawk' introduced the following features:
-
- * Three new arrays: 'SYMTAB', 'FUNCTAB', and
- 'PROCINFO["identifiers"]' (*note Auto-set::).
-
- * The three executables 'gawk', 'pgawk', and 'dgawk', were merged
- into one, named just 'gawk'. As a result the command-line options
- changed.
-
- * Command-line option changes (*note Options::):
-
- - The '-D' option invokes the debugger.
-
- - The '-i' and '--include' options load 'awk' library files.
-
- - The '-l' and '--load' options load compiled dynamic
- extensions.
-
- - The '-M' and '--bignum' options enable MPFR.
-
- - The '-o' option only does pretty-printing.
-
- - The '-p' option is used for profiling.
-
- - The '-R' option was removed.
-
- * Support for high precision arithmetic with MPFR (*note Arbitrary
- Precision Arithmetic::).
-
- * The 'and()', 'or()' and 'xor()' functions changed to allow any
- number of arguments, with a minimum of two (*note Bitwise
- Functions::).
-
- * The dynamic extension interface was completely redone (*note
- Dynamic Extensions::).
-
- * Redirected 'getline' became allowed inside 'BEGINFILE' and
- 'ENDFILE' (*note BEGINFILE/ENDFILE::).
-
- * The 'where' command was added to the debugger (*note Execution
- Stack::).
-
- * Support for Ultrix was removed.
-
- Version 4.2 introduced the following changes:
-
- * Changes to 'ENVIRON' are reflected into 'gawk''s environment and
- that of programs that it runs. *Note Auto-set::.
-
- * The '--pretty-print' option no longer runs the 'awk' program too.
- *Note Options::.
-
- * The 'igawk' program and its manual page are no longer installed
- when 'gawk' is built. *Note Igawk Program::.
-
- * The 'intdiv()' function. *Note Numeric Functions::.
-
- * The maximum number of hexadecimal digits in '\x' escapes is now
- two. *Note Escape Sequences::.
-
- * Nonfatal output with 'print' and 'printf'. *Note Nonfatal::.
-
- * For many years, POSIX specified that default field splitting only
- allowed spaces and tabs to separate fields, and this was how 'gawk'
- behaved with '--posix'. As of 2013, the standard restored
- historical behavior, and now default field splitting with '--posix'
- also allows newlines to separate fields.
-
- * Support for MirBSD was removed.
-
- * Support for GNU/Linux on Alpha was removed.
-
-
-File: gawk.info, Node: Common Extensions, Next: Ranges and Locales, Prev: Feature History, Up: Language History
-
-A.7 Common Extensions Summary
-=============================
-
-The following table summarizes the common extensions supported by
-'gawk', Brian Kernighan's 'awk', and 'mawk', the three most widely used
-freely available versions of 'awk' (*note Other Versions::).
-
-Feature BWK 'awk' 'mawk' 'gawk' Now standard
---------------------------------------------------------------------------
-'\x' escape sequence X X X
-'FS' as null string X X X
-'/dev/stdin' special file X X X
-'/dev/stdout' special file X X X
-'/dev/stderr' special file X X X
-'delete' without subscript X X X X
-'fflush()' function X X X X
-'length()' of an array X X X
-'nextfile' statement X X X X
-'**' and '**=' operators X X
-'func' keyword X X
-'BINMODE' variable X X
-'RS' as regexp X X
-Time-related functions X X
-
-
-File: gawk.info, Node: Ranges and Locales, Next: Contributors, Prev: Common Extensions, Up: Language History
-
-A.8 Regexp Ranges and Locales: A Long Sad Story
-===============================================
-
-This minor node describes the confusing history of ranges within regular
-expressions and their interactions with locales, and how this affected
-different versions of 'gawk'.
-
- The original Unix tools that worked with regular expressions defined
-character ranges (such as '[a-z]') to match any character between the
-first character in the range and the last character in the range,
-inclusive. Ordering was based on the numeric value of each character in
-the machine's native character set. Thus, on ASCII-based systems,
-'[a-z]' matched all the lowercase letters, and only the lowercase
-letters, as the numeric values for the letters from 'a' through 'z' were
-contiguous. (On an EBCDIC system, the range '[a-z]' includes additional
-nonalphabetic characters as well.)
-
- Almost all introductory Unix literature explained range expressions
-as working in this fashion, and in particular, would teach that the
-"correct" way to match lowercase letters was with '[a-z]', and that
-'[A-Z]' was the "correct" way to match uppercase letters. And indeed,
-this was true.(1)
-
- The 1992 POSIX standard introduced the idea of locales (*note
-Locales::). Because many locales include other letters besides the
-plain 26 letters of the English alphabet, the POSIX standard added
-character classes (*note Bracket Expressions::) as a way to match
-different kinds of characters besides the traditional ones in the ASCII
-character set.
-
- However, the standard _changed_ the interpretation of range
-expressions. In the '"C"' and '"POSIX"' locales, a range expression
-like '[a-dx-z]' is still equivalent to '[abcdxyz]', as in ASCII. But
-outside those locales, the ordering was defined to be based on
-"collation order".
-
- What does that mean? In many locales, 'A' and 'a' are both less than
-'B'. In other words, these locales sort characters in dictionary order,
-and '[a-dx-z]' is typically not equivalent to '[abcdxyz]'; instead, it
-might be equivalent to '[ABCXYabcdxyz]', for example.
-
- This point needs to be emphasized: much literature teaches that you
-should use '[a-z]' to match a lowercase character. But on systems with
-non-ASCII locales, this also matches all of the uppercase characters
-except 'A' or 'Z'! This was a continuous cause of confusion, even well
-into the twenty-first century.
-
- To demonstrate these issues, the following example uses the 'sub()'
-function, which does text replacement (*note String Functions::). Here,
-the intent is to remove trailing uppercase characters:
-
- $ echo something1234abc | gawk-3.1.8 '{ sub("[A-Z]*$", ""); print }'
- -| something1234a
-
-This output is unexpected, as the 'bc' at the end of 'something1234abc'
-should not normally match '[A-Z]*'. This result is due to the locale
-setting (and thus you may not see it on your system).
-
- Similar considerations apply to other ranges. For example, '["-/]'
-is perfectly valid in ASCII, but is not valid in many Unicode locales,
-such as 'en_US.UTF-8'.
-
- Early versions of 'gawk' used regexp matching code that was not
-locale-aware, so ranges had their traditional interpretation.
-
- When 'gawk' switched to using locale-aware regexp matchers, the
-problems began; especially as both GNU/Linux and commercial Unix vendors
-started implementing non-ASCII locales, _and making them the default_.
-Perhaps the most frequently asked question became something like, "Why
-does '[A-Z]' match lowercase letters?!?"
-
- This situation existed for close to 10 years, if not more, and the
-'gawk' maintainer grew weary of trying to explain that 'gawk' was being
-nicely standards-compliant, and that the issue was in the user's locale.
-During the development of version 4.0, he modified 'gawk' to always
-treat ranges in the original, pre-POSIX fashion, unless '--posix' was
-used (*note Options::).(2)
-
- Fortunately, shortly before the final release of 'gawk' 4.0, the
-maintainer learned that the 2008 standard had changed the definition of
-ranges, such that outside the '"C"' and '"POSIX"' locales, the meaning
-of range expressions was _undefined_.(3)
-
- By using this lovely technical term, the standard gives license to
-implementers to implement ranges in whatever way they choose. The
-'gawk' maintainer chose to apply the pre-POSIX meaning both with the
-default regexp matching and when '--traditional' or '--posix' are used.
-In all cases 'gawk' remains POSIX-compliant.
-
- ---------- Footnotes ----------
-
- (1) And Life was good.
-
- (2) And thus was born the Campaign for Rational Range Interpretation
-(or RRI). A number of GNU tools have already implemented this change, or
-will soon. Thanks to Karl Berry for coining the phrase "Rational Range
-Interpretation."
-
- (3) See the standard
-(http://pubs.opengroup.org/onlinepubs/9699919799/basedefs/V1_chap09.html#tag_09_03_05)
-and its rationale
-(http://pubs.opengroup.org/onlinepubs/9699919799/xrat/V4_xbd_chap09.html#tag_21_09_03_05).
-
-
-File: gawk.info, Node: Contributors, Next: History summary, Prev: Ranges and Locales, Up: Language History
-
-A.9 Major Contributors to 'gawk'
-================================
-
- Always give credit where credit is due.
- -- _Anonymous_
-
- This minor node names the major contributors to 'gawk' and/or this
-Info file, in approximate chronological order:
-
- * Dr. Alfred V. Aho, Dr. Peter J. Weinberger, and Dr. Brian W.
- Kernighan, all of Bell Laboratories, designed and implemented Unix
- 'awk', from which 'gawk' gets the majority of its feature set.
-
- * Paul Rubin did the initial design and implementation in 1986, and
- wrote the first draft (around 40 pages) of this Info file.
-
- * Jay Fenlason finished the initial implementation.
-
- * Diane Close revised the first draft of this Info file, bringing it
- to around 90 pages.
-
- * Richard Stallman helped finish the implementation and the initial
- draft of this Info file. He is also the founder of the FSF and the
- GNU Project.
-
- * John Woods contributed parts of the code (mostly fixes) in the
- initial version of 'gawk'.
-
- * In 1988, David Trueman took over primary maintenance of 'gawk',
- making it compatible with "new" 'awk', and greatly improving its
- performance.
-
- * Conrad Kwok, Scott Garfinkle, and Kent Williams did the initial
- ports to MS-DOS with various versions of MSC.
-
- * Pat Rankin provided the VMS port and its documentation.
-
- * Hal Peterson provided help in porting 'gawk' to Cray systems.
- (This is no longer supported.)
-
- * Kai Uwe Rommel provided the initial port to OS/2 and its
- documentation.
-
- * Michal Jaegermann provided the port to Atari systems and its
- documentation. (This port is no longer supported.) He continues
- to provide portability checking, and has done a lot of work to make
- sure 'gawk' works on non-32-bit systems.
-
- * Fred Fish provided the port to Amiga systems and its documentation.
- (With Fred's sad passing, this is no longer supported.)
-
- * Scott Deifik maintained the MS-DOS port using DJGPP.
-
- * Eli Zaretskii currently maintains the MS-Windows port using MinGW.
-
- * Juan Grigera provided a port to Windows32 systems. (This is no
- longer supported.)
-
- * For many years, Dr. Darrel Hankerson acted as coordinator for the
- various ports to different PC platforms and created binary
- distributions for various PC operating systems. He was also
- instrumental in keeping the documentation up to date for the
- various PC platforms.
-
- * Christos Zoulas provided the 'extension()' built-in function for
- dynamically adding new functions. (This was obsoleted at 'gawk'
- 4.1.)
-
- * Ju"rgen Kahrs contributed the initial version of the TCP/IP
- networking code and documentation, and motivated the inclusion of
- the '|&' operator.
-
- * Stephen Davies provided the initial port to Tandem systems and its
- documentation. (However, this is no longer supported.) He was
- also instrumental in the initial work to integrate the byte-code
- internals into the 'gawk' code base.
-
- * Matthew Woehlke provided improvements for Tandem's POSIX-compliant
- systems.
-
- * Martin Brown provided the port to BeOS and its documentation.
- (This is no longer supported.)
-
- * Arno Peters did the initial work to convert 'gawk' to use GNU
- Automake and GNU 'gettext'.
-
- * Alan J. Broder provided the initial version of the 'asort()'
- function as well as the code for the optional third argument to the
- 'match()' function.
-
- * Andreas Buening updated the 'gawk' port for OS/2.
-
- * Isamu Hasegawa, of IBM in Japan, contributed support for multibyte
- characters.
-
- * Michael Benzinger contributed the initial code for 'switch'
- statements.
-
- * Patrick T.J. McPhee contributed the code for dynamic loading in
- Windows32 environments. (This is no longer supported.)
-
- * Anders Wallin helped keep the VMS port going for several years.
-
- * Assaf Gordon contributed the code to implement the '--sandbox'
- option.
-
- * John Haque made the following contributions:
-
- - The modifications to convert 'gawk' into a byte-code
- interpreter, including the debugger
-
- - The addition of true arrays of arrays
-
- - The additional modifications for support of
- arbitrary-precision arithmetic
-
- - The initial text of *note Arbitrary Precision Arithmetic::
-
- - The work to merge the three versions of 'gawk' into one, for
- the 4.1 release
-
- - Improved array internals for arrays indexed by integers
-
- - The improved array sorting features were also driven by John,
- together with Pat Rankin
-
- * Panos Papadopoulos contributed the original text for *note Include
- Files::.
-
- * Efraim Yawitz contributed the original text for *note Debugger::.
-
- * The development of the extension API first released with 'gawk' 4.1
- was driven primarily by Arnold Robbins and Andrew Schorr, with
- notable contributions from the rest of the development team.
-
- * John Malmberg contributed significant improvements to the OpenVMS
- port and the related documentation.
-
- * Antonio Giovanni Colombo rewrote a number of examples in the early
- chapters that were severely dated, for which I am incredibly
- grateful.
-
- * Arnold Robbins has been working on 'gawk' since 1988, at first
- helping David Trueman, and as the primary maintainer since around
- 1994.
-
-
-File: gawk.info, Node: History summary, Prev: Contributors, Up: Language History
-
-A.10 Summary
-============
-
- * The 'awk' language has evolved over time. The first release was
- with V7 Unix, circa 1978. In 1987, for System V Release 3.1, major
- additions, including user-defined functions, were made to the
- language. Additional changes were made for System V Release 4, in
- 1989. Since then, further minor changes have happened under the
- auspices of the POSIX standard.
-
- * Brian Kernighan's 'awk' provides a small number of extensions that
- are implemented in common with other versions of 'awk'.
-
- * 'gawk' provides a large number of extensions over POSIX 'awk'.
- They can be disabled with either the '--traditional' or '--posix'
- options.
-
- * The interaction of POSIX locales and regexp matching in 'gawk' has
- been confusing over the years. Today, 'gawk' implements Rational
- Range Interpretation, where ranges of the form '[a-z]' match _only_
- the characters numerically between 'a' through 'z' in the machine's
- native character set. Usually this is ASCII, but it can be EBCDIC
- on IBM S/390 systems.
-
- * Many people have contributed to 'gawk' development over the years.
- We hope that the list provided in this major node is complete and
- gives the appropriate credit where credit is due.
-
-
-File: gawk.info, Node: Installation, Next: Notes, Prev: Language History, Up: Top
-
-Appendix B Installing 'gawk'
-****************************
-
-This appendix provides instructions for installing 'gawk' on the various
-platforms that are supported by the developers. The primary developer
-supports GNU/Linux (and Unix), whereas the other ports are contributed.
-*Note Bugs:: for the email addresses of the people who maintain the
-respective ports.
-
-* Menu:
-
-* Gawk Distribution:: What is in the 'gawk' distribution.
-* Unix Installation:: Installing 'gawk' under various
- versions of Unix.
-* Non-Unix Installation:: Installation on Other Operating Systems.
-* Bugs:: Reporting Problems and Bugs.
-* Other Versions:: Other freely available 'awk'
- implementations.
-* Installation summary:: Summary of installation.
-
-
-File: gawk.info, Node: Gawk Distribution, Next: Unix Installation, Up: Installation
-
-B.1 The 'gawk' Distribution
-===========================
-
-This minor node describes how to get the 'gawk' distribution, how to
-extract it, and then what is in the various files and subdirectories.
-
-* Menu:
-
-* Getting:: How to get the distribution.
-* Extracting:: How to extract the distribution.
-* Distribution contents:: What is in the distribution.
-
-
-File: gawk.info, Node: Getting, Next: Extracting, Up: Gawk Distribution
-
-B.1.1 Getting the 'gawk' Distribution
--------------------------------------
-
-There are two ways to get GNU software:
-
- * Copy it from someone else who already has it.
-
- * Retrieve 'gawk' from the Internet host 'ftp.gnu.org', in the
- directory '/gnu/gawk'. Both anonymous 'ftp' and 'http' access are
- supported. If you have the 'wget' program, you can use a command
- like the following:
-
- wget http://ftp.gnu.org/gnu/gawk/gawk-4.1.4.tar.gz
-
- The GNU software archive is mirrored around the world. The
-up-to-date list of mirror sites is available from the main FSF website
-(http://www.gnu.org/order/ftp.html). Try to use one of the mirrors;
-they will be less busy, and you can usually find one closer to your
-site.
-
- You may also retrieve the 'gawk' source code from the official Git
-repository; for more information see *note Accessing The Source::.
-
-
-File: gawk.info, Node: Extracting, Next: Distribution contents, Prev: Getting, Up: Gawk Distribution
-
-B.1.2 Extracting the Distribution
----------------------------------
-
-'gawk' is distributed as several 'tar' files compressed with different
-compression programs: 'gzip', 'bzip2', and 'xz'. For simplicity, the
-rest of these instructions assume you are using the one compressed with
-the GNU Gzip program ('gzip').
-
- Once you have the distribution (e.g., 'gawk-4.1.4.tar.gz'), use
-'gzip' to expand the file and then use 'tar' to extract it. You can use
-the following pipeline to produce the 'gawk' distribution:
-
- gzip -d -c gawk-4.1.4.tar.gz | tar -xvpf -
-
- On a system with GNU 'tar', you can let 'tar' do the decompression
-for you:
-
- tar -xvpzf gawk-4.1.4.tar.gz
-
-Extracting the archive creates a directory named 'gawk-4.1.4' in the
-current directory.
-
- The distribution file name is of the form 'gawk-V.R.P.tar.gz'. The V
-represents the major version of 'gawk', the R represents the current
-release of version V, and the P represents a "patch level", meaning that
-minor bugs have been fixed in the release. The current patch level is
-4, but when retrieving distributions, you should get the version with
-the highest version, release, and patch level. (Note, however, that
-patch levels greater than or equal to 70 denote "beta" or nonproduction
-software; you might not want to retrieve such a version unless you don't
-mind experimenting.) If you are not on a Unix or GNU/Linux system, you
-need to make other arrangements for getting and extracting the 'gawk'
-distribution. You should consult a local expert.
-
-
-File: gawk.info, Node: Distribution contents, Prev: Extracting, Up: Gawk Distribution
-
-B.1.3 Contents of the 'gawk' Distribution
------------------------------------------
-
-The 'gawk' distribution has a number of C source files, documentation
-files, subdirectories, and files related to the configuration process
-(*note Unix Installation::), as well as several subdirectories related
-to different non-Unix operating systems:
-
-Various '.c', '.y', and '.h' files
- These files contain the actual 'gawk' source code.
-
-'ABOUT-NLS'
- A file containing information about GNU 'gettext' and translations.
-
-'AUTHORS'
- A file with some information about the authorship of 'gawk'. It
- exists only to satisfy the pedants at the Free Software Foundation.
-
-'README'
-'README_d/README.*'
- Descriptive files: 'README' for 'gawk' under Unix and the rest for
- the various hardware and software combinations.
-
-'INSTALL'
- A file providing an overview of the configuration and installation
- process.
-
-'ChangeLog'
- A detailed list of source code changes as bugs are fixed or
- improvements made.
-
-'ChangeLog.0'
- An older list of source code changes.
-
-'NEWS'
- A list of changes to 'gawk' since the last release or patch.
-
-'NEWS.0'
- An older list of changes to 'gawk'.
-
-'COPYING'
- The GNU General Public License.
-
-'POSIX.STD'
- A description of behaviors in the POSIX standard for 'awk' that are
- left undefined, or where 'gawk' may not comply fully, as well as a
- list of things that the POSIX standard should describe but does
- not.
-
-'doc/awkforai.txt'
- Pointers to the original draft of a short article describing why
- 'gawk' is a good language for artificial intelligence (AI)
- programming.
-
-'doc/bc_notes'
- A brief description of 'gawk''s "byte code" internals.
-
-'doc/README.card'
-'doc/ad.block'
-'doc/awkcard.in'
-'doc/cardfonts'
-'doc/colors'
-'doc/macros'
-'doc/no.colors'
-'doc/setter.outline'
- The 'troff' source for a five-color 'awk' reference card. A modern
- version of 'troff' such as GNU 'troff' ('groff') is needed to
- produce the color version. See the file 'README.card' for
- instructions if you have an older 'troff'.
-
-'doc/gawk.1'
- The 'troff' source for a manual page describing 'gawk'. This is
- distributed for the convenience of Unix users.
-
-'doc/gawktexi.in'
-'doc/sidebar.awk'
- The Texinfo source file for this Info file. It should be processed
- by 'doc/sidebar.awk' before processing with 'texi2dvi' or
- 'texi2pdf' to produce a printed document, and with 'makeinfo' to
- produce an Info or HTML file. The 'Makefile' takes care of this
- processing and produces printable output via 'texi2dvi' or
- 'texi2pdf'.
-
-'doc/gawk.texi'
- The file produced after processing 'gawktexi.in' with
- 'sidebar.awk'.
-
-'doc/gawk.info'
- The generated Info file for this Info file.
-
-'doc/gawkinet.texi'
- The Texinfo source file for *note (General Introduction, gawkinet,
- TCP/IP Internetworking with 'gawk')Top::. It should be processed
- with TeX (via 'texi2dvi' or 'texi2pdf') to produce a printed
- document and with 'makeinfo' to produce an Info or HTML file.
-
-'doc/gawkinet.info'
- The generated Info file for 'TCP/IP Internetworking with 'gawk''.
-
-'doc/igawk.1'
- The 'troff' source for a manual page describing the 'igawk' program
- presented in *note Igawk Program::. (Since 'gawk' can do its own
- '@include' processing, neither 'igawk' nor 'igawk.1' are
- installed.)
-
-'doc/Makefile.in'
- The input file used during the configuration process to generate
- the actual 'Makefile' for creating the documentation.
-
-'Makefile.am'
-'*/Makefile.am'
- Files used by the GNU Automake software for generating the
- 'Makefile.in' files used by Autoconf and 'configure'.
-
-'Makefile.in'
-'aclocal.m4'
-'bisonfix.awk'
-'config.guess'
-'configh.in'
-'configure.ac'
-'configure'
-'custom.h'
-'depcomp'
-'install-sh'
-'missing_d/*'
-'mkinstalldirs'
-'m4/*'
- These files and subdirectories are used when configuring and
- compiling 'gawk' for various Unix systems. Most of them are
- explained in *note Unix Installation::. The rest are there to
- support the main infrastructure.
-
-'po/*'
- The 'po' library contains message translations.
-
-'awklib/extract.awk'
-'awklib/Makefile.am'
-'awklib/Makefile.in'
-'awklib/eg/*'
- The 'awklib' directory contains a copy of 'extract.awk' (*note
- Extract Program::), which can be used to extract the sample
- programs from the Texinfo source file for this Info file. It also
- contains a 'Makefile.in' file, which 'configure' uses to generate a
- 'Makefile'. 'Makefile.am' is used by GNU Automake to create
- 'Makefile.in'. The library functions from *note Library
- Functions::, are included as ready-to-use files in the 'gawk'
- distribution. They are installed as part of the installation
- process. The rest of the programs in this Info file are available
- in appropriate subdirectories of 'awklib/eg'.
-
-'extension/*'
- The source code, manual pages, and infrastructure files for the
- sample extensions included with 'gawk'. *Note Dynamic
- Extensions::, for more information.
-
-'extras/*'
- Additional non-essential files. Currently, this directory contains
- some shell startup files to be installed in '/etc/profile.d' to aid
- in manipulating the 'AWKPATH' and 'AWKLIBPATH' environment
- variables. *Note Shell Startup Files::, for more information.
-
-'posix/*'
- Files needed for building 'gawk' on POSIX-compliant systems.
-
-'pc/*'
- Files needed for building 'gawk' under MS-Windows (*note PC
- Installation:: for details).
-
-'vms/*'
- Files needed for building 'gawk' under Vax/VMS and OpenVMS (*note
- VMS Installation:: for details).
-
-'test/*'
- A test suite for 'gawk'. You can use 'make check' from the
- top-level 'gawk' directory to run your version of 'gawk' against
- the test suite. If 'gawk' successfully passes 'make check', then
- you can be confident of a successful port.
-
-
-File: gawk.info, Node: Unix Installation, Next: Non-Unix Installation, Prev: Gawk Distribution, Up: Installation
-
-B.2 Compiling and Installing 'gawk' on Unix-Like Systems
-========================================================
-
-Usually, you can compile and install 'gawk' by typing only two commands.
-However, if you use an unusual system, you may need to configure 'gawk'
-for your system yourself.
-
-* Menu:
-
-* Quick Installation:: Compiling 'gawk' under Unix.
-* Shell Startup Files:: Shell convenience functions.
-* Additional Configuration Options:: Other compile-time options.
-* Configuration Philosophy:: How it's all supposed to work.
-
-
-File: gawk.info, Node: Quick Installation, Next: Shell Startup Files, Up: Unix Installation
-
-B.2.1 Compiling 'gawk' for Unix-Like Systems
---------------------------------------------
-
-The normal installation steps should work on all modern commercial
-Unix-derived systems, GNU/Linux, BSD-based systems, and the Cygwin
-environment for MS-Windows.
-
- After you have extracted the 'gawk' distribution, 'cd' to
-'gawk-4.1.4'. As with most GNU software, you configure 'gawk' for your
-system by running the 'configure' program. This program is a Bourne
-shell script that is generated automatically using GNU Autoconf. (The
-Autoconf software is described fully starting with *note (Autoconf,
-autoconf,Autoconf---Generating Automatic Configuration Scripts)Top::.)
-
- To configure 'gawk', simply run 'configure':
-
- sh ./configure
-
- This produces a 'Makefile' and 'config.h' tailored to your system.
-The 'config.h' file describes various facts about your system. You
-might want to edit the 'Makefile' to change the 'CFLAGS' variable, which
-controls the command-line options that are passed to the C compiler
-(such as optimization levels or compiling for debugging).
-
- Alternatively, you can add your own values for most 'make' variables
-on the command line, such as 'CC' and 'CFLAGS', when running
-'configure':
-
- CC=cc CFLAGS=-g sh ./configure
-
-See the file 'INSTALL' in the 'gawk' distribution for all the details.
-
- After you have run 'configure' and possibly edited the 'Makefile',
-type:
-
- make
-
-Shortly thereafter, you should have an executable version of 'gawk'.
-That's all there is to it! To verify that 'gawk' is working properly,
-run 'make check'. All of the tests should succeed. If these steps do
-not work, or if any of the tests fail, check the files in the 'README_d'
-directory to see if you've found a known problem. If the failure is not
-described there, send in a bug report (*note Bugs::).
-
- Of course, once you've built 'gawk', it is likely that you will wish
-to install it. To do so, you need to run the command 'make install', as
-a user with the appropriate permissions. How to do this varies by
-system, but on many systems you can use the 'sudo' command to do so.
-The command then becomes 'sudo make install'. It is likely that you
-will be asked for your password, and you will have to have been set up
-previously as a user who is allowed to run the 'sudo' command.
-
-
-File: gawk.info, Node: Shell Startup Files, Next: Additional Configuration Options, Prev: Quick Installation, Up: Unix Installation
-
-B.2.2 Shell Startup Files
--------------------------
-
-The distribution contains shell startup files 'gawk.sh' and 'gawk.csh'
-containing functions to aid in manipulating the 'AWKPATH' and
-'AWKLIBPATH' environment variables. On a Fedora system, these files
-should be installed in '/etc/profile.d'; on other platforms, the
-appropriate location may be different.
-
-'gawkpath_default'
- Reset the 'AWKPATH' environment variable to its default value.
-
-'gawkpath_prepend'
- Add the argument to the front of the 'AWKPATH' environment
- variable.
-
-'gawkpath_append'
- Add the argument to the end of the 'AWKPATH' environment variable.
-
-'gawklibpath_default'
- Reset the 'AWKLIBPATH' environment variable to its default value.
-
-'gawklibpath_prepend'
- Add the argument to the front of the 'AWKLIBPATH' environment
- variable.
-
-'gawklibpath_append'
- Add the argument to the end of the 'AWKLIBPATH' environment
- variable.
-
-
-File: gawk.info, Node: Additional Configuration Options, Next: Configuration Philosophy, Prev: Shell Startup Files, Up: Unix Installation
-
-B.2.3 Additional Configuration Options
---------------------------------------
-
-There are several additional options you may use on the 'configure'
-command line when compiling 'gawk' from scratch, including:
-
-'--disable-extensions'
- Disable configuring and building the sample extensions in the
- 'extension' directory. This is useful for cross-compiling. The
- default action is to dynamically check if the extensions can be
- configured and compiled.
-
-'--disable-lint'
- Disable all lint checking within 'gawk'. The '--lint' and
- '--lint-old' options (*note Options::) are accepted, but silently
- do nothing. Similarly, setting the 'LINT' variable (*note
- User-modified::) has no effect on the running 'awk' program.
-
- When used with the GNU Compiler Collection's (GCC's) automatic
- dead-code-elimination, this option cuts almost 23K bytes off the
- size of the 'gawk' executable on GNU/Linux x86_64 systems. Results
- on other systems and with other compilers are likely to vary.
- Using this option may bring you some slight performance
- improvement.
-
- CAUTION: Using this option will cause some of the tests in the
- test suite to fail. This option may be removed at a later
- date.
-
-'--disable-nls'
- Disable all message-translation facilities. This is usually not
- desirable, but it may bring you some slight performance
- improvement.
-
-'--with-whiny-user-strftime'
- Force use of the included version of the C 'strftime()' function
- for deficient systems.
-
- Use the command './configure --help' to see the full list of options
-supplied by 'configure'.
-
-
-File: gawk.info, Node: Configuration Philosophy, Prev: Additional Configuration Options, Up: Unix Installation
-
-B.2.4 The Configuration Process
--------------------------------
-
-This minor node is of interest only if you know something about using
-the C language and Unix-like operating systems.
-
- The source code for 'gawk' generally attempts to adhere to formal
-standards wherever possible. This means that 'gawk' uses library
-routines that are specified by the ISO C standard and by the POSIX
-operating system interface standard. The 'gawk' source code requires
-using an ISO C compiler (the 1990 standard).
-
- Many Unix systems do not support all of either the ISO or the POSIX
-standards. The 'missing_d' subdirectory in the 'gawk' distribution
-contains replacement versions of those functions that are most likely to
-be missing.
-
- The 'config.h' file that 'configure' creates contains definitions
-that describe features of the particular operating system where you are
-attempting to compile 'gawk'. The three things described by this file
-are: what header files are available, so that they can be correctly
-included, what (supposedly) standard functions are actually available in
-your C libraries, and various miscellaneous facts about your operating
-system. For example, there may not be an 'st_blksize' element in the
-'stat' structure. In this case, 'HAVE_STRUCT_STAT_ST_BLKSIZE' is
-undefined.
-
- It is possible for your C compiler to lie to 'configure'. It may do
-so by not exiting with an error when a library function is not
-available. To get around this, edit the 'custom.h' file. Use an
-'#ifdef' that is appropriate for your system, and either '#define' any
-constants that 'configure' should have defined but didn't, or '#undef'
-any constants that 'configure' defined and should not have. The
-'custom.h' file is automatically included by the 'config.h' file.
-
- It is also possible that the 'configure' program generated by
-Autoconf will not work on your system in some other fashion. If you do
-have a problem, the 'configure.ac' file is the input for Autoconf. You
-may be able to change this file and generate a new version of
-'configure' that works on your system (*note Bugs:: for information on
-how to report problems in configuring 'gawk'). The same mechanism may
-be used to send in updates to 'configure.ac' and/or 'custom.h'.
-
-
-File: gawk.info, Node: Non-Unix Installation, Next: Bugs, Prev: Unix Installation, Up: Installation
-
-B.3 Installation on Other Operating Systems
-===========================================
-
-This minor node describes how to install 'gawk' on various non-Unix
-systems.
-
-* Menu:
-
-* PC Installation:: Installing and Compiling 'gawk' on
- Microsoft Windows.
-* VMS Installation:: Installing 'gawk' on VMS.
-
-
-File: gawk.info, Node: PC Installation, Next: VMS Installation, Up: Non-Unix Installation
-
-B.3.1 Installation on MS-Windows
---------------------------------
-
-This minor node covers installation and usage of 'gawk' on Intel
-architecture machines running any version of MS-Windows. In this minor
-node, the term "Windows32" refers to any of Microsoft Windows
-95/98/ME/NT/2000/XP/Vista/7/8/10.
-
- See also the 'README_d/README.pc' file in the distribution.
-
-* Menu:
-
-* PC Binary Installation:: Installing a prepared distribution.
-* PC Compiling:: Compiling 'gawk' for Windows32.
-* PC Using:: Running 'gawk' on Windows32.
-* Cygwin:: Building and running 'gawk' for
- Cygwin.
-* MSYS:: Using 'gawk' In The MSYS Environment.
-
-
-File: gawk.info, Node: PC Binary Installation, Next: PC Compiling, Up: PC Installation
-
-B.3.1.1 Installing a Prepared Distribution for MS-Windows Systems
-.................................................................
-
-The only supported binary distribution for MS-Windows systems is that
-provided by Eli Zaretskii's "ezwinports"
-(https://sourceforge.net/projects/ezwinports/) project. Install the
-compiled 'gawk' from there.
-
-
-File: gawk.info, Node: PC Compiling, Next: PC Using, Prev: PC Binary Installation, Up: PC Installation
-
-B.3.1.2 Compiling 'gawk' for PC Operating Systems
-.................................................
-
-'gawk' can be compiled for Windows32 using MinGW (Windows32). The file
-'README_d/README.pc' in the 'gawk' distribution contains additional
-notes, and 'pc/Makefile' contains important information on compilation
-options.
-
- To build 'gawk' for Windows32, copy the files in the 'pc' directory
-(_except_ for 'ChangeLog') to the directory with the rest of the 'gawk'
-sources, then invoke 'make' with the appropriate target name as an
-argument to build 'gawk'. The 'Makefile' copied from the 'pc' directory
-contains a configuration section with comments and may need to be edited
-in order to work with your 'make' utility.
-
- The 'Makefile' supports a number of targets for building various
-MS-DOS and Windows32 versions. A list of targets is printed if the
-'make' command is given without a target. As an example, to build a
-native MS-Windows binary of 'gawk' using the MinGW tools, type 'make
-mingw32'.
-
-
-File: gawk.info, Node: PC Using, Next: Cygwin, Prev: PC Compiling, Up: PC Installation
-
-B.3.1.3 Using 'gawk' on PC Operating Systems
-............................................
-
-Under MS-Windows, the Cygwin and MinGW environments support both the
-'|&' operator and TCP/IP networking (*note TCP/IP Networking::).
-
- The MS-Windows version of 'gawk' searches for program files as
-described in *note AWKPATH Variable::. However, semicolons (rather than
-colons) separate elements in the 'AWKPATH' variable. If 'AWKPATH' is
-not set or is empty, then the default search path is
-'.;c:/lib/awk;c:/gnu/lib/awk'.
-
- Under MS-Windows, 'gawk' (and many other text programs) silently
-translates end-of-line '\r\n' to '\n' on input and '\n' to '\r\n' on
-output. A special 'BINMODE' variable (c.e.) allows control over these
-translations and is interpreted as follows:
-
- * If 'BINMODE' is '"r"' or one, then binary mode is set on read
- (i.e., no translations on reads).
-
- * If 'BINMODE' is '"w"' or two, then binary mode is set on write
- (i.e., no translations on writes).
-
- * If 'BINMODE' is '"rw"' or '"wr"' or three, binary mode is set for
- both read and write.
-
- * 'BINMODE=NON-NULL-STRING' is the same as 'BINMODE=3' (i.e., no
- translations on reads or writes). However, 'gawk' issues a warning
- message if the string is not one of '"rw"' or '"wr"'.
-
-The modes for standard input and standard output are set one time only
-(after the command line is read, but before processing any of the 'awk'
-program). Setting 'BINMODE' for standard input or standard output is
-accomplished by using an appropriate '-v BINMODE=N' option on the
-command line. 'BINMODE' is set at the time a file or pipe is opened and
-cannot be changed midstream.
-
- The name 'BINMODE' was chosen to match 'mawk' (*note Other
-Versions::). 'mawk' and 'gawk' handle 'BINMODE' similarly; however,
-'mawk' adds a '-W BINMODE=N' option and an environment variable that can
-set 'BINMODE', 'RS', and 'ORS'. The files 'binmode[1-3].awk' (under
-'gnu/lib/awk' in some of the prepared binary distributions) have been
-chosen to match 'mawk''s '-W BINMODE=N' option. These can be changed or
-discarded; in particular, the setting of 'RS' giving the fewest
-"surprises" is open to debate. 'mawk' uses 'RS = "\r\n"' if binary mode
-is set on read, which is appropriate for files with the MS-DOS-style
-end-of-line.
-
- To illustrate, the following examples set binary mode on writes for
-standard output and other files, and set 'ORS' as the "usual"
-MS-DOS-style end-of-line:
-
- gawk -v BINMODE=2 -v ORS="\r\n" ...
-
-or:
-
- gawk -v BINMODE=w -f binmode2.awk ...
-
-These give the same result as the '-W BINMODE=2' option in 'mawk'. The
-following changes the record separator to '"\r\n"' and sets binary mode
-on reads, but does not affect the mode on standard input:
-
- gawk -v RS="\r\n" -e "BEGIN { BINMODE = 1 }" ...
-
-or:
-
- gawk -f binmode1.awk ...
-
-With proper quoting, in the first example the setting of 'RS' can be
-moved into the 'BEGIN' rule.
-
-
-File: gawk.info, Node: Cygwin, Next: MSYS, Prev: PC Using, Up: PC Installation
-
-B.3.1.4 Using 'gawk' In The Cygwin Environment
-..............................................
-
-'gawk' can be built and used "out of the box" under MS-Windows if you
-are using the Cygwin environment (http://www.cygwin.com). This
-environment provides an excellent simulation of GNU/Linux, using Bash,
-GCC, GNU Make, and other GNU programs. Compilation and installation for
-Cygwin is the same as for a Unix system:
-
- tar -xvpzf gawk-4.1.4.tar.gz
- cd gawk-4.1.4
- ./configure
- make && make check
-
- When compared to GNU/Linux on the same system, the 'configure' step
-on Cygwin takes considerably longer. However, it does finish, and then
-the 'make' proceeds as usual.
-
-
-File: gawk.info, Node: MSYS, Prev: Cygwin, Up: PC Installation
-
-B.3.1.5 Using 'gawk' In The MSYS Environment
-............................................
-
-In the MSYS environment under MS-Windows, 'gawk' automatically uses
-binary mode for reading and writing files. Thus, there is no need to
-use the 'BINMODE' variable.
-
- This can cause problems with other Unix-like components that have
-been ported to MS-Windows that expect 'gawk' to do automatic translation
-of '"\r\n"', because it won't.
-
-
-File: gawk.info, Node: VMS Installation, Prev: PC Installation, Up: Non-Unix Installation
-
-B.3.2 Compiling and Installing 'gawk' on Vax/VMS and OpenVMS
-------------------------------------------------------------
-
-This node describes how to compile and install 'gawk' under VMS. The
-older designation "VMS" is used throughout to refer to OpenVMS.
-
-* Menu:
-
-* VMS Compilation:: How to compile 'gawk' under VMS.
-* VMS Dynamic Extensions:: Compiling 'gawk' dynamic extensions on
- VMS.
-* VMS Installation Details:: How to install 'gawk' under VMS.
-* VMS Running:: How to run 'gawk' under VMS.
-* VMS GNV:: The VMS GNV Project.
-* VMS Old Gawk:: An old version comes with some VMS systems.
-
-
-File: gawk.info, Node: VMS Compilation, Next: VMS Dynamic Extensions, Up: VMS Installation
-
-B.3.2.1 Compiling 'gawk' on VMS
-...............................
-
-To compile 'gawk' under VMS, there is a 'DCL' command procedure that
-issues all the necessary 'CC' and 'LINK' commands. There is also a
-'Makefile' for use with the 'MMS' and 'MMK' utilities. From the source
-directory, use either:
-
- $ @[.vms]vmsbuild.com
-
-or:
-
- $ MMS/DESCRIPTION=[.vms]descrip.mms gawk
-
-or:
-
- $ MMK/DESCRIPTION=[.vms]descrip.mms gawk
-
- 'MMK' is an open source, free, near-clone of 'MMS' and can better
-handle ODS-5 volumes with upper- and lowercase file names. 'MMK' is
-available from <https://github.com/endlesssoftware/mmk>.
-
- With ODS-5 volumes and extended parsing enabled, the case of the
-target parameter may need to be exact.
-
- 'gawk' has been tested under VAX/VMS 7.3 and Alpha/VMS 7.3-1 using
-Compaq C V6.4, and under Alpha/VMS 7.3, Alpha/VMS 7.3-2, and IA64/VMS
-8.3. The most recent builds used HP C V7.3 on Alpha VMS 8.3 and both
-Alpha and IA64 VMS 8.4 used HP C 7.3.(1)
-
- *Note VMS GNV:: for information on building 'gawk' as a PCSI kit that
-is compatible with the GNV product.
-
- ---------- Footnotes ----------
-
- (1) The IA64 architecture is also known as "Itanium."
-
-
-File: gawk.info, Node: VMS Dynamic Extensions, Next: VMS Installation Details, Prev: VMS Compilation, Up: VMS Installation
-
-B.3.2.2 Compiling 'gawk' Dynamic Extensions on VMS
-..................................................
-
-The extensions that have been ported to VMS can be built using one of
-the following commands:
-
- $ MMS/DESCRIPTION=[.vms]descrip.mms extensions
-
-or:
-
- $ MMK/DESCRIPTION=[.vms]descrip.mms extensions
-
- 'gawk' uses 'AWKLIBPATH' as either an environment variable or a
-logical name to find the dynamic extensions.
-
- Dynamic extensions need to be compiled with the same compiler options
-for floating-point, pointer size, and symbol name handling as were used
-to compile 'gawk' itself. Alpha and Itanium should use IEEE floating
-point. The pointer size is 32 bits, and the symbol name handling should
-be exact case with CRC shortening for symbols longer than 32 bits.
-
- For Alpha and Itanium:
-
- /name=(as_is,short)
- /float=ieee/ieee_mode=denorm_results
-
- For VAX:
-
- /name=(as_is,short)
-
- Compile-time macros need to be defined before the first VMS-supplied
-header file is included, as follows:
-
- #if (__CRTL_VER >= 70200000) && !defined (__VAX)
- #define _LARGEFILE 1
- #endif
-
- #ifndef __VAX
- #ifdef __CRTL_VER
- #if __CRTL_VER >= 80200000
- #define _USE_STD_STAT 1
- #endif
- #endif
- #endif
-
- If you are writing your own extensions to run on VMS, you must supply
-these definitions yourself. The 'config.h' file created when building
-'gawk' on VMS does this for you; if instead you use that file or a
-similar one, then you must remember to include it before any
-VMS-supplied header files.
-
-
-File: gawk.info, Node: VMS Installation Details, Next: VMS Running, Prev: VMS Dynamic Extensions, Up: VMS Installation
-
-B.3.2.3 Installing 'gawk' on VMS
-................................
-
-To use 'gawk', all you need is a "foreign" command, which is a 'DCL'
-symbol whose value begins with a dollar sign. For example:
-
- $ GAWK :== $disk1:[gnubin]gawk
-
-Substitute the actual location of 'gawk.exe' for '$disk1:[gnubin]'. The
-symbol should be placed in the 'login.com' of any user who wants to run
-'gawk', so that it is defined every time the user logs on.
-Alternatively, the symbol may be placed in the system-wide 'sylogin.com'
-procedure, which allows all users to run 'gawk'.
-
- If your 'gawk' was installed by a PCSI kit into the 'GNV$GNU:'
-directory tree, the program will be known as 'GNV$GNU:[bin]gnv$gawk.exe'
-and the help file will be 'GNV$GNU:[vms_help]gawk.hlp'.
-
- The PCSI kit also installs a 'GNV$GNU:[vms_bin]gawk_verb.cld' file
-that can be used to add 'gawk' and 'awk' as DCL commands.
-
- For just the current process you can use:
-
- $ set command gnv$gnu:[vms_bin]gawk_verb.cld
-
- Or the system manager can use 'GNV$GNU:[vms_bin]gawk_verb.cld' to add
-the 'gawk' and 'awk' to the system-wide 'DCLTABLES'.
-
- The DCL syntax is documented in the 'gawk.hlp' file.
-
- Optionally, the 'gawk.hlp' entry can be loaded into a VMS help
-library:
-
- $ LIBRARY/HELP sys$help:helplib [.vms]gawk.hlp
-
-(You may want to substitute a site-specific help library rather than the
-standard VMS library 'HELPLIB'.) After loading the help text, the
-command:
-
- $ HELP GAWK
-
-provides information about both the 'gawk' implementation and the 'awk'
-programming language.
-
- The logical name 'AWK_LIBRARY' can designate a default location for
-'awk' program files. For the '-f' option, if the specified file name
-has no device or directory path information in it, 'gawk' looks in the
-current directory first, then in the directory specified by the
-translation of 'AWK_LIBRARY' if the file is not found. If, after
-searching in both directories, the file still is not found, 'gawk'
-appends the suffix '.awk' to the file name and retries the file search.
-If 'AWK_LIBRARY' has no definition, a default value of 'SYS$LIBRARY:' is
-used for it.
-
-
-File: gawk.info, Node: VMS Running, Next: VMS GNV, Prev: VMS Installation Details, Up: VMS Installation
-
-B.3.2.4 Running 'gawk' on VMS
-.............................
-
-Command-line parsing and quoting conventions are significantly different
-on VMS, so examples in this Info file or from other sources often need
-minor changes. They _are_ minor though, and all 'awk' programs should
-run correctly.
-
- Here are a couple of trivial tests:
-
- $ gawk -- "BEGIN {print ""Hello, World!""}"
- $ gawk -"W" version
- ! could also be -"W version" or "-W version"
-
-Note that uppercase and mixed-case text must be quoted.
-
- The VMS port of 'gawk' includes a 'DCL'-style interface in addition
-to the original shell-style interface (see the help entry for details).
-One side effect of dual command-line parsing is that if there is only a
-single parameter (as in the quoted string program), the command becomes
-ambiguous. To work around this, the normally optional '--' flag is
-required to force Unix-style parsing rather than 'DCL' parsing. If any
-other dash-type options (or multiple parameters such as data files to
-process) are present, there is no ambiguity and '--' can be omitted.
-
- The 'exit' value is a Unix-style value and is encoded into a VMS exit
-status value when the program exits.
-
- The VMS severity bits will be set based on the 'exit' value. A
-failure is indicated by 1, and VMS sets the 'ERROR' status. A fatal
-error is indicated by 2, and VMS sets the 'FATAL' status. All other
-values will have the 'SUCCESS' status. The exit value is encoded to
-comply with VMS coding standards and will have the 'C_FACILITY_NO' of
-'0x350000' with the constant '0xA000' added to the number shifted over
-by 3 bits to make room for the severity codes.
-
- To extract the actual 'gawk' exit code from the VMS status, use:
-
- unix_status = (vms_status .and. %x7f8) / 8
-
-A C program that uses 'exec()' to call 'gawk' will get the original
-Unix-style exit value.
-
- Older versions of 'gawk' for VMS treated a Unix exit code 0 as 1, a
-failure as 2, a fatal error as 4, and passed all the other numbers
-through. This violated the VMS exit status coding requirements.
-
- VAX/VMS floating point uses unbiased rounding. *Note Round
-Function::.
-
- VMS reports time values in GMT unless one of the 'SYS$TIMEZONE_RULE'
-or 'TZ' logical names is set. Older versions of VMS, such as VAX/VMS
-7.3, do not set these logical names.
-
- The default search path, when looking for 'awk' program files
-specified by the '-f' option, is '"SYS$DISK:[],AWK_LIBRARY:"'. The
-logical name 'AWKPATH' can be used to override this default. The format
-of 'AWKPATH' is a comma-separated list of directory specifications.
-When defining it, the value should be quoted so that it retains a single
-translation and not a multitranslation 'RMS' searchlist.
-
- This restriction also applies to running 'gawk' under GNV, as
-redirection is always to a DCL command.
-
- If you are redirecting data to a VMS command or utility, the current
-implementation requires that setting up a VMS foreign command that runs
-a command file before invoking 'gawk'. (This restriction may be removed
-in a future release of 'gawk' on VMS.)
-
- Without this command file, the input data will also appear prepended
-to the output data.
-
- This also allows simulating POSIX commands that are not found on VMS
-or the use of GNV utilities.
-
- The example below is for 'gawk' redirecting data to the VMS 'sort'
-command.
-
- $ sort = "@device:[dir]vms_gawk_sort.com"
-
- The command file needs to be of the format in the example below.
-
- The first line inhibits the passed input data from also showing up in
-the output. It must be in the format in the example.
-
- The next line creates a foreign command that overrides the outer
-foreign command which prevents an infinite recursion of command files.
-
- The next to the last command redirects 'sys$input' to be
-'sys$command', in order to pick up the data that is being redirected to
-the command.
-
- The last line runs the actual command. It must be the last command
-as the data redirected from 'gawk' will be read when the command file
-ends.
-
- $!'f$verify(0,0)'
- $ sort := sort
- $ define/user sys$input sys$command:
- $ sort sys$input: sys$output:
-
-
-File: gawk.info, Node: VMS GNV, Next: VMS Old Gawk, Prev: VMS Running, Up: VMS Installation
-
-B.3.2.5 The VMS GNV Project
-...........................
-
-The VMS GNV package provides a build environment similar to POSIX with
-ports of a collection of open source tools. The 'gawk' found in the GNV
-base kit is an older port. Currently, the GNV project is being
-reorganized to supply individual PCSI packages for each component. See
-<https://sourceforge.net/p/gnv/wiki/InstallingGNVPackages/>.
-
- The normal build procedure for 'gawk' produces a program that is
-suitable for use with GNV.
-
- The file 'vms/gawk_build_steps.txt' in the distribution documents the
-procedure for building a VMS PCSI kit that is compatible with GNV.
-
-
-File: gawk.info, Node: VMS Old Gawk, Prev: VMS GNV, Up: VMS Installation
-
-B.3.2.6 Some VMS Systems Have An Old Version of 'gawk'
-......................................................
-
-Some versions of VMS have an old version of 'gawk'. To access it,
-define a symbol, as follows:
-
- $ gawk :== $sys$common:[syshlp.examples.tcpip.snmp]gawk.exe
-
- This is apparently version 2.15.6, which is extremely old. We
-recommend compiling and using the current version.
-
-
-File: gawk.info, Node: Bugs, Next: Other Versions, Prev: Non-Unix Installation, Up: Installation
-
-B.4 Reporting Problems and Bugs
-===============================
-
- There is nothing more dangerous than a bored archaeologist.
- -- _Douglas Adams, 'The Hitchhiker's Guide to the Galaxy'_
-
- If you have problems with 'gawk' or think that you have found a bug,
-report it to the developers; we cannot promise to do anything, but we
-might well want to fix it.
-
-* Menu:
-
-* Bug address:: Where to send reports to.
-* Usenet:: Where not to send reports to.
-* Maintainers:: Maintainers of non-*nix ports.
-
-
-File: gawk.info, Node: Bug address, Next: Usenet, Up: Bugs
-
-B.4.1 Submitting Bug Reports
-----------------------------
-
-Before reporting a bug, make sure you have really found a genuine bug.
-Carefully reread the documentation and see if it says you can do what
-you're trying to do. If it's not clear whether you should be able to do
-something or not, report that too; it's a bug in the documentation!
-
- Before reporting a bug or trying to fix it yourself, try to isolate
-it to the smallest possible 'awk' program and input data file that
-reproduce the problem. Then send us the program and data file, some
-idea of what kind of Unix system you're using, the compiler you used to
-compile 'gawk', and the exact results 'gawk' gave you. Also say what
-you expected to occur; this helps us decide whether the problem is
-really in the documentation.
-
- Make sure to include the version number of 'gawk' you are using. You
-can get this information with the command 'gawk --version'.
-
- Once you have a precise problem description, send email to
-<bug-gawk@gnu.org>.
-
- The 'gawk' maintainers subscribe to this address, and thus they will
-receive your bug report. Although you can send mail to the maintainers
-directly, the bug reporting address is preferred because the email list
-is archived at the GNU Project. _All email must be in English. This is
-the only language understood in common by all the maintainers._ In
-addition, please be sure to send all mail in _plain text_, not (or not
-exclusively) in HTML.
-
- NOTE: Many distributions of GNU/Linux and the various BSD-based
- operating systems have their own bug reporting systems. If you
- report a bug using your distribution's bug reporting system, you
- should also send a copy to <bug-gawk@gnu.org>.
-
- This is for two reasons. First, although some distributions
- forward bug reports "upstream" to the GNU mailing list, many don't,
- so there is a good chance that the 'gawk' maintainers won't even
- see the bug report! Second, mail to the GNU list is archived, and
- having everything at the GNU Project keeps things self-contained
- and not dependent on other organizations.
-
- Non-bug suggestions are always welcome as well. If you have
-questions about things that are unclear in the documentation or are just
-obscure features, ask on the bug list; we will try to help you out if we
-can.
-
-
-File: gawk.info, Node: Usenet, Next: Maintainers, Prev: Bug address, Up: Bugs
-
-B.4.2 Please Don't Post Bug Reports to USENET
----------------------------------------------
-
- I gave up on Usenet a couple of years ago and haven't really looked
- back. It's like sports talk radio--you feel smarter for not having
- read it.
- -- _Chet Ramey_
-
- Please do _not_ try to report bugs in 'gawk' by posting to the
-Usenet/Internet newsgroup 'comp.lang.awk'. Although some of the 'gawk'
-developers occasionally read this newgroup, the primary 'gawk'
-maintainer no longer does. Thus it's virtually guaranteed that he will
-_not_ see your posting. The steps described here are the only
-officially recognized way for reporting bugs. Really.
-
-
-File: gawk.info, Node: Maintainers, Prev: Usenet, Up: Bugs
-
-B.4.3 Reporting Problems with Non-Unix Ports
---------------------------------------------
-
-If you find bugs in one of the non-Unix ports of 'gawk', send an email
-to the bug list, with a copy to the person who maintains that port. The
-maintainers are named in the following list, as well as in the 'README'
-file in the 'gawk' distribution. Information in the 'README' file
-should be considered authoritative if it conflicts with this Info file.
-
- The people maintaining the various 'gawk' ports are:
-
-Unix and POSIX Arnold Robbins, <arnold@skeeve.com>
-systems
-MS-Windows with MinGW Eli Zaretskii, <eliz@gnu.org>
-
-OS/2 Andreas Buening, <andreas.buening@nexgo.de>
-
-VMS John Malmberg, <wb8tyw@qsl.net>
-
-z/OS (OS/390) Daniel Richard G. <skunk@iSKUNK.ORG>
- Dave Pitts (Maintainer Emeritus), <dpitts@cozx.com>
-
- If your bug is also reproducible under Unix, send a copy of your
-report to the <bug-gawk@gnu.org> email list as well.
-
- The DJGPP port is no longer supported; it will remain in the code
-base for a while in case a volunteer wishes to take it over. If this
-does not happen, then eventually code for this port will be removed.
-
-
-File: gawk.info, Node: Other Versions, Next: Installation summary, Prev: Bugs, Up: Installation
-
-B.5 Other Freely Available 'awk' Implementations
-================================================
-
- It's kind of fun to put comments like this in your awk code:
- '// Do C++ comments work? answer: yes! of course'
- -- _Michael Brennan_
-
- There are a number of other freely available 'awk' implementations.
-This minor node briefly describes where to get them:
-
-Unix 'awk'
- Brian Kernighan, one of the original designers of Unix 'awk', has
- made his implementation of 'awk' freely available. You can
- retrieve this version via his home page
- (http://www.cs.princeton.edu/~bwk). It is available in several
- archive formats:
-
- Shell archive
- <http://www.cs.princeton.edu/~bwk/btl.mirror/awk.shar>
-
- Compressed 'tar' file
- <http://www.cs.princeton.edu/~bwk/btl.mirror/awk.tar.gz>
-
- Zip file
- <http://www.cs.princeton.edu/~bwk/btl.mirror/awk.zip>
-
- You can also retrieve it from GitHub:
-
- git clone git://github.com/onetrueawk/awk bwkawk
-
- This command creates a copy of the Git (http://git-scm.com)
- repository in a directory named 'bwkawk'. If you leave that
- argument off the 'git' command line, the repository copy is created
- in a directory named 'awk'.
-
- This version requires an ISO C (1990 standard) compiler; the C
- compiler from GCC (the GNU Compiler Collection) works quite nicely.
-
- *Note Common Extensions:: for a list of extensions in this 'awk'
- that are not in POSIX 'awk'.
-
- As a side note, Dan Bornstein has created a Git repository tracking
- all the versions of BWK 'awk' that he could find. It's available
- at <git://github.com/danfuzz/one-true-awk>.
-
-'mawk'
- Michael Brennan wrote an independent implementation of 'awk',
- called 'mawk'. It is available under the GPL (*note Copying::),
- just as 'gawk' is.
-
- The original distribution site for the 'mawk' source code no longer
- has it. A copy is available at
- <http://www.skeeve.com/gawk/mawk1.3.3.tar.gz>.
-
- In 2009, Thomas Dickey took on 'mawk' maintenance. Basic
- information is available on the project's web page
- (http://www.invisible-island.net/mawk). The download URL is
- <http://invisible-island.net/datafiles/release/mawk.tar.gz>.
-
- Once you have it, 'gunzip' may be used to decompress this file.
- Installation is similar to 'gawk''s (*note Unix Installation::).
-
- *Note Common Extensions:: for a list of extensions in 'mawk' that
- are not in POSIX 'awk'.
-
-'awka'
- Written by Andrew Sumner, 'awka' translates 'awk' programs into C,
- compiles them, and links them with a library of functions that
- provide the core 'awk' functionality. It also has a number of
- extensions.
-
- The 'awk' translator is released under the GPL, and the library is
- under the LGPL.
-
- To get 'awka', go to <http://sourceforge.net/projects/awka>.
-
- The project seems to be frozen; no new code changes have been made
- since approximately 2001.
-
-'pawk'
- Nelson H.F. Beebe at the University of Utah has modified BWK 'awk'
- to provide timing and profiling information. It is different from
- 'gawk' with the '--profile' option (*note Profiling::) in that it
- uses CPU-based profiling, not line-count profiling. You may find
- it at either
- <ftp://ftp.math.utah.edu/pub/pawk/pawk-20030606.tar.gz> or
- <http://www.math.utah.edu/pub/pawk/pawk-20030606.tar.gz>.
-
-BusyBox 'awk'
- BusyBox is a GPL-licensed program providing small versions of many
- applications within a single executable. It is aimed at embedded
- systems. It includes a full implementation of POSIX 'awk'. When
- building it, be careful not to do 'make install' as it will
- overwrite copies of other applications in your '/usr/local/bin'.
- For more information, see the project's home page
- (http://busybox.net).
-
-The OpenSolaris POSIX 'awk'
- The versions of 'awk' in '/usr/xpg4/bin' and '/usr/xpg6/bin' on
- Solaris are more or less POSIX-compliant. They are based on the
- 'awk' from Mortice Kern Systems for PCs. We were able to make this
- code compile and work under GNU/Linux with 1-2 hours of work.
- Making it more generally portable (using GNU Autoconf and/or
- Automake) would take more work, and this has not been done, at
- least to our knowledge.
-
- The source code used to be available from the OpenSolaris website.
- However, that project was ended and the website shut down.
- Fortunately, the Illumos project
- (http://wiki.illumos.org/display/illumos/illumos+Home) makes this
- implementation available. You can view the files one at a time
- from
- <https://github.com/joyent/illumos-joyent/blob/master/usr/src/cmd/awk_xpg4>.
-
-'jawk'
- This is an interpreter for 'awk' written in Java. It claims to be
- a full interpreter, although because it uses Java facilities for
- I/O and for regexp matching, the language it supports is different
- from POSIX 'awk'. More information is available on the project's
- home page (http://jawk.sourceforge.net).
-
-Libmawk
- This is an embeddable 'awk' interpreter derived from 'mawk'. For
- more information, see <http://repo.hu/projects/libmawk/>.
-
-'pawk'
- This is a Python module that claims to bring 'awk'-like features to
- Python. See <https://github.com/alecthomas/pawk> for more
- information. (This is not related to Nelson Beebe's modified
- version of BWK 'awk', described earlier.)
-
-QSE 'awk'
- This is an embeddable 'awk' interpreter. For more information, see
- <http://code.google.com/p/qse/> and <http://awk.info/?tools/qse>.
-
-'QTawk'
- This is an independent implementation of 'awk' distributed under
- the GPL. It has a large number of extensions over standard 'awk'
- and may not be 100% syntactically compatible with it. See
- <http://www.quiktrim.org/QTawk.html> for more information,
- including the manual. The download link there is out of date; see
- <http://www.quiktrim.org/#AdditionalResources> for the latest
- download link.
-
- The project may also be frozen; no new code changes have been made
- since approximately 2014.
-
-Other versions
- See also the "Versions and implementations" section of the
- Wikipedia article
- (http://en.wikipedia.org/wiki/Awk_language#Versions_and_implementations)
- on 'awk' for information on additional versions.
-
-
-File: gawk.info, Node: Installation summary, Prev: Other Versions, Up: Installation
-
-B.6 Summary
-===========
-
- * The 'gawk' distribution is available from the GNU Project's main
- distribution site, 'ftp.gnu.org'. The canonical build recipe is:
-
- wget http://ftp.gnu.org/gnu/gawk/gawk-4.1.4.tar.gz
- tar -xvpzf gawk-4.1.4.tar.gz
- cd gawk-4.1.4
- ./configure && make && make check
-
- * 'gawk' may be built on non-POSIX systems as well. The currently
- supported systems are MS-Windows using MSYS, MinGW, and Cygwin, and
- both Vax/VMS and OpenVMS. Instructions for each system are included
- in this major node.
-
- * Bug reports should be sent via email to <bug-gawk@gnu.org>. Bug
- reports should be in English and should include the version of
- 'gawk', how it was compiled, and a short program and data file that
- demonstrate the problem.
-
- * There are a number of other freely available 'awk' implementations.
- Many are POSIX-compliant; others are less so.
-
-
-File: gawk.info, Node: Notes, Next: Basic Concepts, Prev: Installation, Up: Top
-
-Appendix C Implementation Notes
-*******************************
-
-This appendix contains information mainly of interest to implementers
-and maintainers of 'gawk'. Everything in it applies specifically to
-'gawk' and not to other implementations.
-
-* Menu:
-
-* Compatibility Mode:: How to disable certain 'gawk'
- extensions.
-* Additions:: Making Additions To 'gawk'.
-* Future Extensions:: New features that may be implemented one day.
-* Implementation Limitations:: Some limitations of the implementation.
-* Extension Design:: Design notes about the extension API.
-* Old Extension Mechanism:: Some compatibility for old extensions.
-* Notes summary:: Summary of implementation notes.
-
-
-File: gawk.info, Node: Compatibility Mode, Next: Additions, Up: Notes
-
-C.1 Downward Compatibility and Debugging
-========================================
-
-*Note POSIX/GNU::, for a summary of the GNU extensions to the 'awk'
-language and program. All of these features can be turned off by
-invoking 'gawk' with the '--traditional' option or with the '--posix'
-option.
-
- If 'gawk' is compiled for debugging with '-DDEBUG', then there is one
-more option available on the command line:
-
-'-Y'
-'--parsedebug'
- Print out the parse stack information as the program is being
- parsed.
-
- This option is intended only for serious 'gawk' developers and not
-for the casual user. It probably has not even been compiled into your
-version of 'gawk', since it slows down execution.
-
-
-File: gawk.info, Node: Additions, Next: Future Extensions, Prev: Compatibility Mode, Up: Notes
-
-C.2 Making Additions to 'gawk'
-==============================
-
-If you find that you want to enhance 'gawk' in a significant fashion,
-you are perfectly free to do so. That is the point of having free
-software; the source code is available and you are free to change it as
-you want (*note Copying::).
-
- This minor node discusses the ways you might want to change 'gawk' as
-well as any considerations you should bear in mind.
-
-* Menu:
-
-* Accessing The Source:: Accessing the Git repository.
-* Adding Code:: Adding code to the main body of
- 'gawk'.
-* New Ports:: Porting 'gawk' to a new operating
- system.
-* Derived Files:: Why derived files are kept in the Git
- repository.
-
-
-File: gawk.info, Node: Accessing The Source, Next: Adding Code, Up: Additions
-
-C.2.1 Accessing The 'gawk' Git Repository
------------------------------------------
-
-As 'gawk' is Free Software, the source code is always available. *note
-Gawk Distribution:: describes how to get and build the formal, released
-versions of 'gawk'.
-
- However, if you want to modify 'gawk' and contribute back your
-changes, you will probably wish to work with the development version.
-To do so, you will need to access the 'gawk' source code repository.
-The code is maintained using the Git distributed version control system
-(http://git-scm.com). You will need to install it if your system
-doesn't have it. Once you have done so, use the command:
-
- git clone git://git.savannah.gnu.org/gawk.git
-
-This clones the 'gawk' repository. If you are behind a firewall that
-does not allow you to use the Git native protocol, you can still access
-the repository using:
-
- git clone http://git.savannah.gnu.org/r/gawk.git
-
- Once you have made changes, you can use 'git diff' to produce a
-patch, and send that to the 'gawk' maintainer; see *note Bugs::, for how
-to do that.
-
- Once upon a time there was Git-CVS gateway for use by people who
-could not install Git. However, this gateway no longer works, so you
-may have better luck using a more modern version control system like
-Bazaar, that has a Git plug-in for working with Git repositories.
-
-
-File: gawk.info, Node: Adding Code, Next: New Ports, Prev: Accessing The Source, Up: Additions
-
-C.2.2 Adding New Features
--------------------------
-
-You are free to add any new features you like to 'gawk'. However, if
-you want your changes to be incorporated into the 'gawk' distribution,
-there are several steps that you need to take in order to make it
-possible to include them:
-
- 1. Before building the new feature into 'gawk' itself, consider
- writing it as an extension (*note Dynamic Extensions::). If that's
- not possible, continue with the rest of the steps in this list.
-
- 2. Be prepared to sign the appropriate paperwork. In order for the
- FSF to distribute your changes, you must either place those changes
- in the public domain and submit a signed statement to that effect,
- or assign the copyright in your changes to the FSF. Both of these
- actions are easy to do and _many_ people have done so already. If
- you have questions, please contact me (*note Bugs::), or
- <assign@gnu.org>.
-
- 3. Get the latest version. It is much easier for me to integrate
- changes if they are relative to the most recent distributed version
- of 'gawk', or better yet, relative to the latest code in the Git
- repository. If your version of 'gawk' is very old, I may not be
- able to integrate your changes at all. (*Note Getting::, for
- information on getting the latest version of 'gawk'.)
-
- 4. See *note (Version, standards, GNU Coding Standards)Top::. This
- document describes how GNU software should be written. If you
- haven't read it, please do so, preferably _before_ starting to
- modify 'gawk'. (The 'GNU Coding Standards' are available from the
- GNU Project's website (http://www.gnu.org/prep/standards/).
- Texinfo, Info, and DVI versions are also available.)
-
- 5. Use the 'gawk' coding style. The C code for 'gawk' follows the
- instructions in the 'GNU Coding Standards', with minor exceptions.
- The code is formatted using the traditional "K&R" style,
- particularly as regards to the placement of braces and the use of
- TABs. In brief, the coding rules for 'gawk' are as follows:
-
- * Use ANSI/ISO style (prototype) function headers when defining
- functions.
-
- * Put the name of the function at the beginning of its own line.
-
- * Use '#elif' instead of nesting '#if' inside '#else'.
-
- * Put the return type of the function, even if it is 'int', on
- the line above the line with the name and arguments of the
- function.
-
- * Put spaces around parentheses used in control structures
- ('if', 'while', 'for', 'do', 'switch', and 'return').
-
- * Do not put spaces in front of parentheses used in function
- calls.
-
- * Put spaces around all C operators and after commas in function
- calls.
-
- * Do not use the comma operator to produce multiple side
- effects, except in 'for' loop initialization and increment
- parts, and in macro bodies.
-
- * Use real TABs for indenting, not spaces.
-
- * Use the "K&R" brace layout style.
-
- * Use comparisons against 'NULL' and ''\0'' in the conditions of
- 'if', 'while', and 'for' statements, as well as in the 'case's
- of 'switch' statements, instead of just the plain pointer or
- character value.
-
- * Use 'true' and 'false' for 'bool' values, the 'NULL' symbolic
- constant for pointer values, and the character constant ''\0''
- where appropriate, instead of '1' and '0'.
-
- * Provide one-line descriptive comments for each function.
-
- * Do not use the 'alloca()' function for allocating memory off
- the stack. Its use causes more portability trouble than is
- worth the minor benefit of not having to free the storage.
- Instead, use 'malloc()' and 'free()'.
-
- * Do not use comparisons of the form '! strcmp(a, b)' or
- similar. As Henry Spencer once said, "'strcmp()' is not a
- boolean!" Instead, use 'strcmp(a, b) == 0'.
-
- * If adding new bit flag values, use explicit hexadecimal
- constants ('0x001', '0x002', '0x004', and son on) instead of
- shifting one left by successive amounts ('(1<<0)', '(1<<1)',
- and so on).
-
- NOTE: If I have to reformat your code to follow the coding
- style used in 'gawk', I may not bother to integrate your
- changes at all.
-
- 6. Update the documentation. Along with your new code, please supply
- new sections and/or chapters for this Info file. If at all
- possible, please use real Texinfo, instead of just supplying
- unformatted ASCII text (although even that is better than no
- documentation at all). Conventions to be followed in 'GAWK:
- Effective AWK Programming' are provided after the '@bye' at the end
- of the Texinfo source file. If possible, please update the 'man'
- page as well.
-
- You will also have to sign paperwork for your documentation
- changes.
-
- 7. Submit changes as unified diffs. Use 'diff -u -r -N' to compare
- the original 'gawk' source tree with your version. I recommend
- using the GNU version of 'diff', or best of all, 'git diff' or 'git
- format-patch'. Send the output produced by 'diff' to me when you
- submit your changes. (*Note Bugs::, for the electronic mail
- information.)
-
- Using this format makes it easy for me to apply your changes to the
- master version of the 'gawk' source code (using 'patch'). If I
- have to apply the changes manually, using a text editor, I may not
- do so, particularly if there are lots of changes.
-
- 8. Include an entry for the 'ChangeLog' file with your submission.
- This helps further minimize the amount of work I have to do, making
- it easier for me to accept patches. It is simplest if you just
- make this part of your diff.
-
- Although this sounds like a lot of work, please remember that while
-you may write the new code, I have to maintain it and support it. If it
-isn't possible for me to do that with a minimum of extra work, then I
-probably will not.
-
-
-File: gawk.info, Node: New Ports, Next: Derived Files, Prev: Adding Code, Up: Additions
-
-C.2.3 Porting 'gawk' to a New Operating System
-----------------------------------------------
-
-If you want to port 'gawk' to a new operating system, there are several
-steps:
-
- 1. Follow the guidelines in *note Adding Code::, concerning coding
- style, submission of diffs, and so on.
-
- 2. Be prepared to sign the appropriate paperwork. In order for the
- FSF to distribute your code, you must either place your code in the
- public domain and submit a signed statement to that effect, or
- assign the copyright in your code to the FSF. Both of these actions
- are easy to do and _many_ people have done so already. If you have
- questions, please contact me, or <gnu@gnu.org>.
-
- 3. When doing a port, bear in mind that your code must coexist
- peacefully with the rest of 'gawk' and the other ports. Avoid
- gratuitous changes to the system-independent parts of the code. If
- at all possible, avoid sprinkling '#ifdef's just for your port
- throughout the code.
-
- If the changes needed for a particular system affect too much of
- the code, I probably will not accept them. In such a case, you
- can, of course, distribute your changes on your own, as long as you
- comply with the GPL (*note Copying::).
-
- 4. A number of the files that come with 'gawk' are maintained by other
- people. Thus, you should not change them unless it is for a very
- good reason; i.e., changes are not out of the question, but changes
- to these files are scrutinized extra carefully. The files are
- 'dfa.c', 'dfa.h', 'getopt.c', 'getopt.h', 'getopt1.c',
- 'getopt_int.h', 'gettext.h', 'regcomp.c', 'regex.c', 'regex.h',
- 'regex_internal.c', 'regex_internal.h', and 'regexec.c'.
-
- 5. A number of other files are provided by the GNU Autotools
- (Autoconf, Automake, and GNU 'gettext'). You should not change
- them either, unless it is for a very good reason. The files are
- 'ABOUT-NLS', 'config.guess', 'config.rpath', 'config.sub',
- 'depcomp', 'INSTALL', 'install-sh', 'missing', 'mkinstalldirs',
- 'xalloc.h', and 'ylwrap'.
-
- 6. Be willing to continue to maintain the port. Non-Unix operating
- systems are supported by volunteers who maintain the code needed to
- compile and run 'gawk' on their systems. If no-one volunteers to
- maintain a port, it becomes unsupported and it may be necessary to
- remove it from the distribution.
-
- 7. Supply an appropriate 'gawkmisc.???' file. Each port has its own
- 'gawkmisc.???' that implements certain operating system specific
- functions. This is cleaner than a plethora of '#ifdef's scattered
- throughout the code. The 'gawkmisc.c' in the main source directory
- includes the appropriate 'gawkmisc.???' file from each
- subdirectory. Be sure to update it as well.
-
- Each port's 'gawkmisc.???' file has a suffix reminiscent of the
- machine or operating system for the port--for example,
- 'pc/gawkmisc.pc' and 'vms/gawkmisc.vms'. The use of separate
- suffixes, instead of plain 'gawkmisc.c', makes it possible to move
- files from a port's subdirectory into the main subdirectory,
- without accidentally destroying the real 'gawkmisc.c' file.
- (Currently, this is only an issue for the PC operating system
- ports.)
-
- 8. Supply a 'Makefile' as well as any other C source and header files
- that are necessary for your operating system. All your code should
- be in a separate subdirectory, with a name that is the same as, or
- reminiscent of, either your operating system or the computer
- system. If possible, try to structure things so that it is not
- necessary to move files out of the subdirectory into the main
- source directory. If that is not possible, then be sure to avoid
- using names for your files that duplicate the names of files in the
- main source directory.
-
- 9. Update the documentation. Please write a section (or sections) for
- this Info file describing the installation and compilation steps
- needed to compile and/or install 'gawk' for your system.
-
- Following these steps makes it much easier to integrate your changes
-into 'gawk' and have them coexist happily with other operating systems'
-code that is already there.
-
- In the code that you supply and maintain, feel free to use a coding
-style and brace layout that suits your taste.
-
-
-File: gawk.info, Node: Derived Files, Prev: New Ports, Up: Additions
-
-C.2.4 Why Generated Files Are Kept In Git
------------------------------------------
-
-If you look at the 'gawk' source in the Git repository, you will notice
-that it includes files that are automatically generated by GNU
-infrastructure tools, such as 'Makefile.in' from Automake and even
-'configure' from Autoconf.
-
- This is different from many Free Software projects that do not store
-the derived files, because that keeps the repository less cluttered, and
-it is easier to see the substantive changes when comparing versions and
-trying to understand what changed between commits.
-
- However, there are several reasons why the 'gawk' maintainer likes to
-have everything in the repository.
-
- First, because it is then easy to reproduce any given version
-completely, without relying upon the availability of (older, likely
-obsolete, and maybe even impossible to find) other tools.
-
- As an extreme example, if you ever even think about trying to
-compile, oh, say, the V7 'awk', you will discover that not only do you
-have to bootstrap the V7 'yacc' to do so, but you also need the V7
-'lex'. And the latter is pretty much impossible to bring up on a modern
-GNU/Linux system.(1)
-
- (Or, let's say 'gawk' 1.2 required 'bison' whatever-it-was in 1989
-and that there was no 'awkgram.c' file in the repository. Is there a
-guarantee that we could find that 'bison' version? Or that _it_ would
-build?)
-
- If the repository has all the generated files, then it's easy to just
-check them out and build. (Or _easier_, depending upon how far back we
-go.)
-
- And that brings us to the second (and stronger) reason why all the
-files really need to be in Git. It boils down to who do you cater
-to--the 'gawk' developer(s), or the user who just wants to check out a
-version and try it out?
-
- The 'gawk' maintainer wants it to be possible for any interested
-'awk' user in the world to just clone the repository, check out the
-branch of interest and build it. Without their having to have the
-correct version(s) of the autotools.(2) That is the point of the
-'bootstrap.sh' file. It touches the various other files in the right
-order such that
-
- # The canonical incantation for building GNU software:
- ./bootstrap.sh && ./configure && make
-
-will _just work_.
-
- This is extremely important for the 'master' and 'gawk-X.Y-stable'
-branches.
-
- Further, the 'gawk' maintainer would argue that it's also important
-for the 'gawk' developers. When he tried to check out the 'xgawk'
-branch(3) to build it, he couldn't. (No 'ltmain.sh' file, and he had no
-idea how to create it, and that was not the only problem.)
-
- He felt _extremely_ frustrated. With respect to that branch, the
-maintainer is no different than Jane User who wants to try to build
-'gawk-4.1-stable' or 'master' from the repository.
-
- Thus, the maintainer thinks that it's not just important, but
-critical, that for any given branch, the above incantation _just works_.
-
- A third reason to have all the files is that without them, using 'git
-bisect' to try to find the commit that introduced a bug is exceedingly
-difficult. The maintainer tried to do that on another project that
-requires running bootstrapping scripts just to create 'configure' and so
-on; it was really painful. When the repository is self-contained, using
-'git bisect' in it is very easy.
-
- What are some of the consequences and/or actions to take?
-
- 1. We don't mind that there are differing files in the different
- branches as a result of different versions of the autotools.
-
- A. It's the maintainer's job to merge them and he will deal with
- it.
-
- B. He is really good at 'git diff x y > /tmp/diff1 ; gvim
- /tmp/diff1' to remove the diffs that aren't of interest in
- order to review code.
-
- 2. It would certainly help if everyone used the same versions of the
- GNU tools as he does, which in general are the latest released
- versions of Automake, Autoconf, 'bison', and GNU 'gettext'.
-
- Installing from source is quite easy. It's how the maintainer
- worked for years (and still works). He had '/usr/local/bin' at the
- front of his 'PATH' and just did:
-
- wget http://ftp.gnu.org/gnu/PACKAGE/PACKAGE-X.Y.Z.tar.gz
- tar -xpzvf PACKAGE-X.Y.Z.tar.gz
- cd PACKAGE-X.Y.Z
- ./configure && make && make check
- make install # as root
-
- Most of the above was originally written by the maintainer to other
-'gawk' developers. It raised the objection from one of the developers
-"... that anybody pulling down the source from Git is not an end user."
-
- However, this is not true. There are "power 'awk' users" who can
-build 'gawk' (using the magic incantation shown previously) but who
-can't program in C. Thus, the major branches should be kept buildable
-all the time.
-
- It was then suggested that there be a 'cron' job to create nightly
-tarballs of "the source." Here, the problem is that there are source
-trees, corresponding to the various branches! So, nightly tarballs
-aren't the answer, especially as the repository can go for weeks without
-significant change being introduced.
-
- Fortunately, the Git server can meet this need. For any given branch
-named BRANCHNAME, use:
-
- wget http://git.savannah.gnu.org/cgit/gawk.git/snapshot/gawk-BRANCHNAME.tar.gz
-
-to retrieve a snapshot of the given branch.
-
- ---------- Footnotes ----------
-
- (1) We tried. It was painful.
-
- (2) There is one GNU program that is (in our opinion) severely
-difficult to bootstrap from the Git repository. For example, on the
-author's old (but still working) PowerPC Macintosh with Mac OS X 10.5,
-it was necessary to bootstrap a ton of software, starting with Git
-itself, in order to try to work with the latest code. It's not
-pleasant, and especially on older systems, it's a big waste of time.
-
- Starting with the latest tarball was no picnic either. The
-maintainers had dropped '.gz' and '.bz2' files and only distribute
-'.tar.xz' files. It was necessary to bootstrap 'xz' first!
-
- (3) A branch (since removed) created by one of the other developers
-that did not include the generated files.
-
-
-File: gawk.info, Node: Future Extensions, Next: Implementation Limitations, Prev: Additions, Up: Notes
-
-C.3 Probable Future Extensions
-==============================
-
- AWK is a language similar to PERL, only considerably more elegant.
- -- _Arnold Robbins_
-
- Hey!
- -- _Larry Wall_
-
- The 'TODO' file in the 'master' branch of the 'gawk' Git repository
-lists possible future enhancements. Some of these relate to the source
-code, and others to possible new features. Please see that file for the
-list. *Note Additions::, if you are interested in tackling any of the
-projects listed there.
-
-
-File: gawk.info, Node: Implementation Limitations, Next: Extension Design, Prev: Future Extensions, Up: Notes
-
-C.4 Some Limitations of the Implementation
-==========================================
-
-This following table describes limits of 'gawk' on a Unix-like system
-(although it is variable even then). Other systems may have different
-limits.
-
-Item Limit
---------------------------------------------------------------------------
-Characters in a character 2^(number of bits per byte)
-class
-Length of input record 'MAX_INT'
-Length of output record Unlimited
-Length of source line Unlimited
-Number of fields in a 'MAX_LONG'
-record
-Number of file redirections Unlimited
-Number of input records in 'MAX_LONG'
-one file
-Number of input records 'MAX_LONG'
-total
-Number of pipe redirections min(number of processes per user, number
- of open files)
-Numeric values Double-precision floating point (if not
- using MPFR)
-Size of a field 'MAX_INT'
-Size of a literal string 'MAX_INT'
-Size of a printf string 'MAX_INT'
-
-
-File: gawk.info, Node: Extension Design, Next: Old Extension Mechanism, Prev: Implementation Limitations, Up: Notes
-
-C.5 Extension API Design
-========================
-
-This minor node documents the design of the extension API, including a
-discussion of some of the history and problems that needed to be solved.
-
- The first version of extensions for 'gawk' was developed in the
-mid-1990s and released with 'gawk' 3.1 in the late 1990s. The basic
-mechanisms and design remained unchanged for close to 15 years, until
-2012.
-
- The old extension mechanism used data types and functions from 'gawk'
-itself, with a "clever hack" to install extension functions.
-
- 'gawk' included some sample extensions, of which a few were really
-useful. However, it was clear from the outset that the extension
-mechanism was bolted onto the side and was not really well thought out.
-
-* Menu:
-
-* Old Extension Problems:: Problems with the old mechanism.
-* Extension New Mechanism Goals:: Goals for the new mechanism.
-* Extension Other Design Decisions:: Some other design decisions.
-* Extension Future Growth:: Some room for future growth.
-
-
-File: gawk.info, Node: Old Extension Problems, Next: Extension New Mechanism Goals, Up: Extension Design
-
-C.5.1 Problems With The Old Mechanism
--------------------------------------
-
-The old extension mechanism had several problems:
-
- * It depended heavily upon 'gawk' internals. Any time the 'NODE'
- structure(1) changed, an extension would have to be recompiled.
- Furthermore, to really write extensions required understanding
- something about 'gawk''s internal functions. There was some
- documentation in this Info file, but it was quite minimal.
-
- * Being able to call into 'gawk' from an extension required linker
- facilities that are common on Unix-derived systems but that did not
- work on MS-Windows systems; users wanting extensions on MS-Windows
- had to statically link them into 'gawk', even though MS-Windows
- supports dynamic loading of shared objects.
-
- * The API would change occasionally as 'gawk' changed; no
- compatibility between versions was ever offered or planned for.
-
- Despite the drawbacks, the 'xgawk' project developers forked 'gawk'
-and developed several significant extensions. They also enhanced
-'gawk''s facilities relating to file inclusion and shared object access.
-
- A new API was desired for a long time, but only in 2012 did the
-'gawk' maintainer and the 'xgawk' developers finally start working on it
-together. More information about the 'xgawk' project is provided in
-*note gawkextlib::.
-
- ---------- Footnotes ----------
-
- (1) A critical central data structure inside 'gawk'.
-
-
-File: gawk.info, Node: Extension New Mechanism Goals, Next: Extension Other Design Decisions, Prev: Old Extension Problems, Up: Extension Design
-
-C.5.2 Goals For A New Mechanism
--------------------------------
-
-Some goals for the new API were:
-
- * The API should be independent of 'gawk' internals. Changes in
- 'gawk' internals should not be visible to the writer of an
- extension function.
-
- * The API should provide _binary_ compatibility across 'gawk'
- releases as long as the API itself does not change.
-
- * The API should enable extensions written in C or C++ to have
- roughly the same "appearance" to 'awk'-level code as 'awk'
- functions do. This means that extensions should have:
-
- - The ability to access function parameters.
-
- - The ability to turn an undefined parameter into an array (call
- by reference).
-
- - The ability to create, access and update global variables.
-
- - Easy access to all the elements of an array at once ("array
- flattening") in order to loop over all the element in an easy
- fashion for C code.
-
- - The ability to create arrays (including 'gawk''s true arrays
- of arrays).
-
- Some additional important goals were:
-
- * The API should use only features in ISO C 90, so that extensions
- can be written using the widest range of C and C++ compilers. The
- header should include the appropriate '#ifdef __cplusplus' and
- 'extern "C"' magic so that a C++ compiler could be used. (If using
- C++, the runtime system has to be smart enough to call any
- constructors and destructors, as 'gawk' is a C program. As of this
- writing, this has not been tested.)
-
- * The API mechanism should not require access to 'gawk''s symbols(1)
- by the compile-time or dynamic linker, in order to enable creation
- of extensions that also work on MS-Windows.
-
- During development, it became clear that there were other features
-that should be available to extensions, which were also subsequently
-provided:
-
- * Extensions should have the ability to hook into 'gawk''s I/O
- redirection mechanism. In particular, the 'xgawk' developers
- provided a so-called "open hook" to take over reading records.
- During development, this was generalized to allow extensions to
- hook into input processing, output processing, and two-way I/O.
-
- * An extension should be able to provide a "call back" function to
- perform cleanup actions when 'gawk' exits.
-
- * An extension should be able to provide a version string so that
- 'gawk''s '--version' option can provide information about
- extensions as well.
-
- The requirement to avoid access to 'gawk''s symbols is, at first
-glance, a difficult one to meet.
-
- One design, apparently used by Perl and Ruby and maybe others, would
-be to make the mainline 'gawk' code into a library, with the 'gawk'
-utility a small C 'main()' function linked against the library.
-
- This seemed like the tail wagging the dog, complicating build and
-installation and making a simple copy of the 'gawk' executable from one
-system to another (or one place to another on the same system!) into a
-chancy operation.
-
- Pat Rankin suggested the solution that was adopted. *Note Extension
-Mechanism Outline::, for the details.
-
- ---------- Footnotes ----------
-
- (1) The "symbols" are the variables and functions defined inside
-'gawk'. Access to these symbols by code external to 'gawk' loaded
-dynamically at runtime is problematic on MS-Windows.
-
-
-File: gawk.info, Node: Extension Other Design Decisions, Next: Extension Future Growth, Prev: Extension New Mechanism Goals, Up: Extension Design
-
-C.5.3 Other Design Decisions
-----------------------------
-
-As an arbitrary design decision, extensions can read the values of
-predefined variables and arrays (such as 'ARGV' and 'FS'), but cannot
-change them, with the exception of 'PROCINFO'.
-
- The reason for this is to prevent an extension function from
-affecting the flow of an 'awk' program outside its control. While a
-real 'awk' function can do what it likes, that is at the discretion of
-the programmer. An extension function should provide a service or make
-a C API available for use within 'awk', and not mess with 'FS' or 'ARGC'
-and 'ARGV'.
-
- In addition, it becomes easy to start down a slippery slope. How
-much access to 'gawk' facilities do extensions need? Do they need
-'getline'? What about calling 'gsub()' or compiling regular
-expressions? What about calling into 'awk' functions? (_That_ would be
-messy.)
-
- In order to avoid these issues, the 'gawk' developers chose to start
-with the simplest, most basic features that are still truly useful.
-
- Another decision is that although 'gawk' provides nice things like
-MPFR, and arrays indexed internally by integers, these features are not
-being brought out to the API in order to keep things simple and close to
-traditional 'awk' semantics. (In fact, arrays indexed internally by
-integers are so transparent that they aren't even documented!)
-
- Additionally, all functions in the API check that their pointer input
-parameters are not 'NULL'. If they are, they return an error. (It is a
-good idea for extension code to verify that pointers received from
-'gawk' are not 'NULL'. Such a thing should not happen, but the 'gawk'
-developers are only human, and they have been known to occasionally make
-mistakes.)
-
- With time, the API will undoubtedly evolve; the 'gawk' developers
-expect this to be driven by user needs. For now, the current API seems
-to provide a minimal yet powerful set of features for creating
-extensions.
-
-
-File: gawk.info, Node: Extension Future Growth, Prev: Extension Other Design Decisions, Up: Extension Design
-
-C.5.4 Room For Future Growth
-----------------------------
-
-The API can later be expanded, in two ways:
-
- * 'gawk' passes an "extension id" into the extension when it first
- loads the extension. The extension then passes this id back to
- 'gawk' with each function call. This mechanism allows 'gawk' to
- identify the extension calling into it, should it need to know.
-
- * Similarly, the extension passes a "name space" into 'gawk' when it
- registers each extension function. This accommodates a possible
- future mechanism for grouping extension functions and possibly
- avoiding name conflicts.
-
- Of course, as of this writing, no decisions have been made with
-respect to any of the above.
-
-
-File: gawk.info, Node: Old Extension Mechanism, Next: Notes summary, Prev: Extension Design, Up: Notes
-
-C.6 Compatibility For Old Extensions
-====================================
-
-*note Dynamic Extensions::, describes the supported API and mechanisms
-for writing extensions for 'gawk'. This API was introduced in version
-4.1. However, for many years 'gawk' provided an extension mechanism
-that required knowledge of 'gawk' internals and that was not as well
-designed.
-
- In order to provide a transition period, 'gawk' version 4.1 continues
-to support the original extension mechanism. This will be true for the
-life of exactly one major release. This support will be withdrawn, and
-removed from the source code, at the next major release.
-
- Briefly, original-style extensions should be compiled by including
-the 'awk.h' header file in the extension source code. Additionally, you
-must define the identifier 'GAWK' when building (use '-DGAWK' with
-Unix-style compilers). Otherwise, the definitions in 'gawkapi.h' will
-cause conflicts with those in 'awk.h' and your extension will not
-compile.
-
- Just as in previous versions, you load an old-style extension with
-the 'extension()' built-in function (which is not otherwise documented).
-This function in turn finds and loads the shared object file containing
-the extension and calls its 'dl_load()' C routine.
-
- Because original-style and new-style extensions use different
-initialization routines ('dl_load()' versus 'dlload()'), they may safely
-be installed in the same directory (to be found by 'AWKLIBPATH') without
-conflict.
-
- The 'gawk' development team strongly recommends that you convert any
-old extensions that you may have to use the new API described in *note
-Dynamic Extensions::.
-
-
-File: gawk.info, Node: Notes summary, Prev: Old Extension Mechanism, Up: Notes
-
-C.7 Summary
-===========
-
- * 'gawk''s extensions can be disabled with either the '--traditional'
- option or with the '--posix' option. The '--parsedebug' option is
- available if 'gawk' is compiled with '-DDEBUG'.
-
- * The source code for 'gawk' is maintained in a publicly accessible
- Git repository. Anyone may check it out and view the source.
-
- * Contributions to 'gawk' are welcome. Following the steps outlined
- in this major node will make it easier to integrate your
- contributions into the code base. This applies both to new feature
- contributions and to ports to additional operating systems.
-
- * 'gawk' has some limits--generally those that are imposed by the
- machine architecture.
-
- * The extension API design was intended to solve a number of problems
- with the previous extension mechanism, enable features needed by
- the 'xgawk' project, and provide binary compatibility going
- forward.
-
- * The previous extension mechanism is still supported in version 4.1
- of 'gawk', but it _will_ be removed in the next major release.
-
-
-File: gawk.info, Node: Basic Concepts, Next: Glossary, Prev: Notes, Up: Top
-
-Appendix D Basic Programming Concepts
-*************************************
-
-This major node attempts to define some of the basic concepts and terms
-that are used throughout the rest of this Info file. As this Info file
-is specifically about 'awk', and not about computer programming in
-general, the coverage here is by necessity fairly cursory and
-simplistic. (If you need more background, there are many other
-introductory texts that you should refer to instead.)
-
-* Menu:
-
-* Basic High Level:: The high level view.
-* Basic Data Typing:: A very quick intro to data types.
-
-
-File: gawk.info, Node: Basic High Level, Next: Basic Data Typing, Up: Basic Concepts
-
-D.1 What a Program Does
-=======================
-
-At the most basic level, the job of a program is to process some input
-data and produce results. See *note Figure D.1: figure-general-flow.
-
-
-+------+ / \\ +---------+
-| Data | -----> < Program > -----> | Results |
-+------+ \\_______/ +---------+"
-
-Figure D.1: General Program Flow
-
- The "program" in the figure can be either a compiled program(1) (such
-as 'ls'), or it may be "interpreted". In the latter case, a
-machine-executable program such as 'awk' reads your program, and then
-uses the instructions in your program to process the data.
-
- When you write a program, it usually consists of the following, very
-basic set of steps, as shown in *note Figure D.2: figure-process-flow.:
-
-
-+----------------+ / More \\ No +----------+
-| Initialization | -------> < Data > -------> | Clean Up |
-+----------------+ ^ \\ ? / +----------+
- | +--+-+
- | | Yes
- | |
- | V
- | +---------+
- +-----+ Process |
- +---------+"
-
-Figure D.2: Basic Program Steps
-
-Initialization
- These are the things you do before actually starting to process
- data, such as checking arguments, initializing any data you need to
- work with, and so on. This step corresponds to 'awk''s 'BEGIN'
- rule (*note BEGIN/END::).
-
- If you were baking a cake, this might consist of laying out all the
- mixing bowls and the baking pan, and making sure you have all the
- ingredients that you need.
-
-Processing
- This is where the actual work is done. Your program reads data,
- one logical chunk at a time, and processes it as appropriate.
-
- In most programming languages, you have to manually manage the
- reading of data, checking to see if there is more each time you
- read a chunk. 'awk''s pattern-action paradigm (*note Getting
- Started::) handles the mechanics of this for you.
-
- In baking a cake, the processing corresponds to the actual labor:
- breaking eggs, mixing the flour, water, and other ingredients, and
- then putting the cake into the oven.
-
-Clean Up
- Once you've processed all the data, you may have things you need to
- do before exiting. This step corresponds to 'awk''s 'END' rule
- (*note BEGIN/END::).
-
- After the cake comes out of the oven, you still have to wrap it in
- plastic wrap to keep anyone from tasting it, as well as wash the
- mixing bowls and utensils.
-
- An "algorithm" is a detailed set of instructions necessary to
-accomplish a task, or process data. It is much the same as a recipe for
-baking a cake. Programs implement algorithms. Often, it is up to you
-to design the algorithm and implement it, simultaneously.
-
- The "logical chunks" we talked about previously are called "records",
-similar to the records a company keeps on employees, a school keeps for
-students, or a doctor keeps for patients. Each record has many
-component parts, such as first and last names, date of birth, address,
-and so on. The component parts are referred to as the "fields" of the
-record.
-
- The act of reading data is termed "input", and that of generating
-results, not too surprisingly, is termed "output". They are often
-referred to together as "input/output," and even more often, as "I/O"
-for short. (You will also see "input" and "output" used as verbs.)
-
- 'awk' manages the reading of data for you, as well as the breaking it
-up into records and fields. Your program's job is to tell 'awk' what to
-do with the data. You do this by describing "patterns" in the data to
-look for, and "actions" to execute when those patterns are seen. This
-"data-driven" nature of 'awk' programs usually makes them both easier to
-write and easier to read.
-
- ---------- Footnotes ----------
-
- (1) Compiled programs are typically written in lower-level languages
-such as C, C++, or Ada, and then translated, or "compiled", into a form
-that the computer can execute directly.
-
-
-File: gawk.info, Node: Basic Data Typing, Prev: Basic High Level, Up: Basic Concepts
-
-D.2 Data Values in a Computer
-=============================
-
-In a program, you keep track of information and values in things called
-"variables". A variable is just a name for a given value, such as
-'first_name', 'last_name', 'address', and so on. 'awk' has several
-predefined variables, and it has special names to refer to the current
-input record and the fields of the record. You may also group multiple
-associated values under one name, as an array.
-
- Data, particularly in 'awk', consists of either numeric values, such
-as 42 or 3.1415927, or string values. String values are essentially
-anything that's not a number, such as a name. Strings are sometimes
-referred to as "character data", since they store the individual
-characters that comprise them. Individual variables, as well as numeric
-and string variables, are referred to as "scalar" values. Groups of
-values, such as arrays, are not scalars.
-
- *note Computer Arithmetic::, provided a basic introduction to numeric
-types (integer and floating-point) and how they are used in a computer.
-Please review that information, including a number of caveats that were
-presented.
-
- While you are probably used to the idea of a number without a value
-(i.e., zero), it takes a bit more getting used to the idea of
-zero-length character data. Nevertheless, such a thing exists. It is
-called the "null string". The null string is character data that has no
-value. In other words, it is empty. It is written in 'awk' programs
-like this: '""'.
-
- Humans are used to working in decimal; i.e., base 10. In base 10,
-numbers go from 0 to 9, and then "roll over" into the next column.
-(Remember grade school? 42 = 4 x 10 + 2.)
-
- There are other number bases though. Computers commonly use base 2
-or "binary", base 8 or "octal", and base 16 or "hexadecimal". In
-binary, each column represents two times the value in the column to its
-right. Each column may contain either a 0 or a 1. Thus, binary 1010
-represents (1 x 8) + (0 x 4) + (1 x 2) + (0 x 1), or decimal 10. Octal
-and hexadecimal are discussed more in *note Nondecimal-numbers::.
-
- At the very lowest level, computers store values as groups of binary
-digits, or "bits". Modern computers group bits into groups of eight,
-called "bytes". Advanced applications sometimes have to manipulate bits
-directly, and 'gawk' provides functions for doing so.
-
- Programs are written in programming languages. Hundreds, if not
-thousands, of programming languages exist. One of the most popular is
-the C programming language. The C language had a very strong influence
-on the design of the 'awk' language.
-
- There have been several versions of C. The first is often referred to
-as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie,
-the authors of the first book on C. (Dennis Ritchie created the
-language, and Brian Kernighan was one of the creators of 'awk'.)
-
- In the mid-1980s, an effort began to produce an international
-standard for C. This work culminated in 1989, with the production of the
-ANSI standard for C. This standard became an ISO standard in 1990. In
-1999, a revised ISO C standard was approved and released. Where it
-makes sense, POSIX 'awk' is compatible with 1999 ISO C.
-
-
-File: gawk.info, Node: Glossary, Next: Copying, Prev: Basic Concepts, Up: Top
-
-Glossary
-********
-
-Action
- A series of 'awk' statements attached to a rule. If the rule's
- pattern matches an input record, 'awk' executes the rule's action.
- Actions are always enclosed in braces. (*Note Action Overview::.)
-
-Ada
- A programming language originally defined by the U.S. Department of
- Defense for embedded programming. It was designed to enforce good
- Software Engineering practices.
-
-Amazing 'awk' Assembler
- Henry Spencer at the University of Toronto wrote a retargetable
- assembler completely as 'sed' and 'awk' scripts. It is thousands
- of lines long, including machine descriptions for several eight-bit
- microcomputers. It is a good example of a program that would have
- been better written in another language. You can get it from
- <http://awk.info/?awk100/aaa>.
-
-Amazingly Workable Formatter ('awf')
- Henry Spencer at the University of Toronto wrote a formatter that
- accepts a large subset of the 'nroff -ms' and 'nroff -man'
- formatting commands, using 'awk' and 'sh'. It is available from
- <http://awk.info/?tools/awf>.
-
-Anchor
- The regexp metacharacters '^' and '$', which force the match to the
- beginning or end of the string, respectively.
-
-ANSI
- The American National Standards Institute. This organization
- produces many standards, among them the standards for the C and C++
- programming languages. These standards often become international
- standards as well. See also "ISO."
-
-Argument
- An argument can be two different things. It can be an option or a
- file name passed to a command while invoking it from the command
- line, or it can be something passed to a "function" inside a
- program, e.g. inside 'awk'.
-
- In the latter case, an argument can be passed to a function in two
- ways. Either it is given to the called function by value, i.e., a
- copy of the value of the variable is made available to the called
- function, but the original variable cannot be modified by the
- function itself; or it is given by reference, i.e., a pointer to
- the interested variable is passed to the function, which can then
- directly modify it. In 'awk' scalars are passed by value, and
- arrays are passed by reference. See "Pass By Value/Reference."
-
-Array
- A grouping of multiple values under the same name. Most languages
- just provide sequential arrays. 'awk' provides associative arrays.
-
-Assertion
- A statement in a program that a condition is true at this point in
- the program. Useful for reasoning about how a program is supposed
- to behave.
-
-Assignment
- An 'awk' expression that changes the value of some 'awk' variable
- or data object. An object that you can assign to is called an
- "lvalue". The assigned values are called "rvalues". *Note
- Assignment Ops::.
-
-Associative Array
- Arrays in which the indices may be numbers or strings, not just
- sequential integers in a fixed range.
-
-'awk' Language
- The language in which 'awk' programs are written.
-
-'awk' Program
- An 'awk' program consists of a series of "patterns" and "actions",
- collectively known as "rules". For each input record given to the
- program, the program's rules are all processed in turn. 'awk'
- programs may also contain function definitions.
-
-'awk' Script
- Another name for an 'awk' program.
-
-Bash
- The GNU version of the standard shell (the Bourne-Again SHell).
- See also "Bourne Shell."
-
-Binary
- Base-two notation, where the digits are '0'-'1'. Since electronic
- circuitry works "naturally" in base 2 (just think of Off/On),
- everything inside a computer is calculated using base 2. Each
- digit represents the presence (or absence) of a power of 2 and is
- called a "bit". So, for example, the base-two number '10101' is
- the same as decimal 21, ((1 x 16) + (1 x 4) + (1 x 1)).
-
- Since base-two numbers quickly become very long to read and write,
- they are usually grouped by 3 (i.e., they are read as octal
- numbers), or by 4 (i.e., they are read as hexadecimal numbers).
- There is no direct way to insert base 2 numbers in a C program. If
- need arises, such numbers are usually inserted as octal or
- hexadecimal numbers. The number of base-two digits that fit into
- registers used for representing integer numbers in computers is a
- rough indication of the computing power of the computer itself.
- Most computers nowadays use 64 bits for representing integer
- numbers in their registers, but 32-bit, 16-bit and 8-bit registers
- have been widely used in the past. *Note Nondecimal-numbers::.
-Bit
- Short for "Binary Digit." All values in computer memory ultimately
- reduce to binary digits: values that are either zero or one.
- Groups of bits may be interpreted differently--as integers,
- floating-point numbers, character data, addresses of other memory
- objects, or other data. 'awk' lets you work with floating-point
- numbers and strings. 'gawk' lets you manipulate bit values with
- the built-in functions described in *note Bitwise Functions::.
-
- Computers are often defined by how many bits they use to represent
- integer values. Typical systems are 32-bit systems, but 64-bit
- systems are becoming increasingly popular, and 16-bit systems have
- essentially disappeared.
-
-Boolean Expression
- Named after the English mathematician Boole. See also "Logical
- Expression."
-
-Bourne Shell
- The standard shell ('/bin/sh') on Unix and Unix-like systems,
- originally written by Steven R. Bourne at Bell Laboratories. Many
- shells (Bash, 'ksh', 'pdksh', 'zsh') are generally upwardly
- compatible with the Bourne shell.
-
-Braces
- The characters '{' and '}'. Braces are used in 'awk' for
- delimiting actions, compound statements, and function bodies.
-
-Bracket Expression
- Inside a "regular expression", an expression included in square
- brackets, meant to designate a single character as belonging to a
- specified character class. A bracket expression can contain a list
- of one or more characters, like '[abc]', a range of characters,
- like '[A-Z]', or a name, delimited by ':', that designates a known
- set of characters, like '[:digit:]'. The form of bracket
- expression enclosed between ':' is independent of the underlying
- representation of the character themselves, which could utilize the
- ASCII, ECBDIC, or Unicode codesets, depending on the architecture
- of the computer system, and on localization. See also "Regular
- Expression."
-
-Built-in Function
- The 'awk' language provides built-in functions that perform various
- numerical, I/O-related, and string computations. Examples are
- 'sqrt()' (for the square root of a number) and 'substr()' (for a
- substring of a string). 'gawk' provides functions for timestamp
- management, bit manipulation, array sorting, type checking, and
- runtime string translation. (*Note Built-in::.)
-
-Built-in Variable
- 'ARGC', 'ARGV', 'CONVFMT', 'ENVIRON', 'FILENAME', 'FNR', 'FS',
- 'NF', 'NR', 'OFMT', 'OFS', 'ORS', 'RLENGTH', 'RSTART', 'RS', and
- 'SUBSEP' are the variables that have special meaning to 'awk'. In
- addition, 'ARGIND', 'BINMODE', 'ERRNO', 'FIELDWIDTHS', 'FPAT',
- 'IGNORECASE', 'LINT', 'PROCINFO', 'RT', and 'TEXTDOMAIN' are the
- variables that have special meaning to 'gawk'. Changing some of
- them affects 'awk''s running environment. (*Note Built-in
- Variables::.)
-
-C
- The system programming language that most GNU software is written
- in. The 'awk' programming language has C-like syntax, and this
- Info file points out similarities between 'awk' and C when
- appropriate.
-
- In general, 'gawk' attempts to be as similar to the 1990 version of
- ISO C as makes sense.
-
-C Shell
- The C Shell ('csh' or its improved version, 'tcsh') is a Unix shell
- that was created by Bill Joy in the late 1970s. The C shell was
- differentiated from other shells by its interactive features and
- overall style, which looks more like C. The C Shell is not backward
- compatible with the Bourne Shell, so special attention is required
- when converting scripts written for other Unix shells to the C
- shell, especially with regard to the management of shell variables.
- See also "Bourne Shell."
-
-C++
- A popular object-oriented programming language derived from C.
-
-Character Class
- See "Bracket Expression."
-
-Character List
- See "Bracket Expression."
-
-Character Set
- The set of numeric codes used by a computer system to represent the
- characters (letters, numbers, punctuation, etc.) of a particular
- country or place. The most common character set in use today is
- ASCII (American Standard Code for Information Interchange). Many
- European countries use an extension of ASCII known as ISO-8859-1
- (ISO Latin-1). The Unicode character set (http://www.unicode.org)
- is increasingly popular and standard, and is particularly widely
- used on GNU/Linux systems.
-
-CHEM
- A preprocessor for 'pic' that reads descriptions of molecules and
- produces 'pic' input for drawing them. It was written in 'awk' by
- Brian Kernighan and Jon Bentley, and is available from
- <http://netlib.org/typesetting/chem>.
-
-Comparison Expression
- A relation that is either true or false, such as 'a < b'.
- Comparison expressions are used in 'if', 'while', 'do', and 'for'
- statements, and in patterns to select which input records to
- process. (*Note Typing and Comparison::.)
-
-Compiler
- A program that translates human-readable source code into
- machine-executable object code. The object code is then executed
- directly by the computer. See also "Interpreter."
-
-Complemented Bracket Expression
- The negation of a "bracket expression". All that is _not_
- described by a given bracket expression. The symbol '^' precedes
- the negated bracket expression. E.g.: '[[^:digit:]' designates
- whatever character is not a digit. '[^bad]' designates whatever
- character is not one of the letters 'b', 'a', or 'd'. See "Bracket
- Expression."
-
-Compound Statement
- A series of 'awk' statements, enclosed in curly braces. Compound
- statements may be nested. (*Note Statements::.)
-
-Computed Regexps
- See "Dynamic Regular Expressions."
-
-Concatenation
- Concatenating two strings means sticking them together, one after
- another, producing a new string. For example, the string 'foo'
- concatenated with the string 'bar' gives the string 'foobar'.
- (*Note Concatenation::.)
-
-Conditional Expression
- An expression using the '?:' ternary operator, such as 'EXPR1 ?
- EXPR2 : EXPR3'. The expression EXPR1 is evaluated; if the result
- is true, the value of the whole expression is the value of EXPR2;
- otherwise the value is EXPR3. In either case, only one of EXPR2
- and EXPR3 is evaluated. (*Note Conditional Exp::.)
-
-Control Statement
- A control statement is an instruction to perform a given operation
- or a set of operations inside an 'awk' program, if a given
- condition is true. Control statements are: 'if', 'for', 'while',
- and 'do' (*note Statements::).
-
-Cookie
- A peculiar goodie, token, saying or remembrance produced by or
- presented to a program. (With thanks to Professor Doug McIlroy.)
-
-Coprocess
- A subordinate program with which two-way communications is
- possible.
-
-Curly Braces
- See "Braces."
-
-Dark Corner
- An area in the language where specifications often were (or still
- are) not clear, leading to unexpected or undesirable behavior.
- Such areas are marked in this Info file with "(d.c.)" in the text
- and are indexed under the heading "dark corner."
-
-Data Driven
- A description of 'awk' programs, where you specify the data you are
- interested in processing, and what to do when that data is seen.
-
-Data Objects
- These are numbers and strings of characters. Numbers are converted
- into strings and vice versa, as needed. (*Note Conversion::.)
-
-Deadlock
- The situation in which two communicating processes are each waiting
- for the other to perform an action.
-
-Debugger
- A program used to help developers remove "bugs" from (de-bug) their
- programs.
-
-Double Precision
- An internal representation of numbers that can have fractional
- parts. Double precision numbers keep track of more digits than do
- single precision numbers, but operations on them are sometimes more
- expensive. This is the way 'awk' stores numeric values. It is the
- C type 'double'.
-
-Dynamic Regular Expression
- A dynamic regular expression is a regular expression written as an
- ordinary expression. It could be a string constant, such as
- '"foo"', but it may also be an expression whose value can vary.
- (*Note Computed Regexps::.)
-
-Empty String
- See "Null String."
-
-Environment
- A collection of strings, of the form 'NAME=VAL', that each program
- has available to it. Users generally place values into the
- environment in order to provide information to various programs.
- Typical examples are the environment variables 'HOME' and 'PATH'.
-
-Epoch
- The date used as the "beginning of time" for timestamps. Time
- values in most systems are represented as seconds since the epoch,
- with library functions available for converting these values into
- standard date and time formats.
-
- The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC. See
- also "GMT" and "UTC."
-
-Escape Sequences
- A special sequence of characters used for describing nonprinting
- characters, such as '\n' for newline or '\033' for the ASCII ESC
- (Escape) character. (*Note Escape Sequences::.)
-
-Extension
- An additional feature or change to a programming language or
- utility not defined by that language's or utility's standard.
- 'gawk' has (too) many extensions over POSIX 'awk'.
-
-FDL
- See "Free Documentation License."
-
-Field
- When 'awk' reads an input record, it splits the record into pieces
- separated by whitespace (or by a separator regexp that you can
- change by setting the predefined variable 'FS'). Such pieces are
- called fields. If the pieces are of fixed length, you can use the
- built-in variable 'FIELDWIDTHS' to describe their lengths. If you
- wish to specify the contents of fields instead of the field
- separator, you can use the predefined variable 'FPAT' to do so.
- (*Note Field Separators::, *note Constant Size::, and *note
- Splitting By Content::.)
-
-Flag
- A variable whose truth value indicates the existence or
- nonexistence of some condition.
-
-Floating-Point Number
- Often referred to in mathematical terms as a "rational" or real
- number, this is just a number that can have a fractional part. See
- also "Double Precision" and "Single Precision."
-
-Format
- Format strings control the appearance of output in the 'strftime()'
- and 'sprintf()' functions, and in the 'printf' statement as well.
- Also, data conversions from numbers to strings are controlled by
- the format strings contained in the predefined variables 'CONVFMT'
- and 'OFMT'. (*Note Control Letters::.)
-
-Fortran
- Shorthand for FORmula TRANslator, one of the first programming
- languages available for scientific calculations. It was created by
- John Backus, and has been available since 1957. It is still in use
- today.
-
-Free Documentation License
- This document describes the terms under which this Info file is
- published and may be copied. (*Note GNU Free Documentation
- License::.)
-
-Free Software Foundation
- A nonprofit organization dedicated to the production and
- distribution of freely distributable software. It was founded by
- Richard M. Stallman, the author of the original Emacs editor. GNU
- Emacs is the most widely used version of Emacs today.
-
-FSF
- See "Free Software Foundation."
-
-Function
- A part of an 'awk' program that can be invoked from every point of
- the program, to perform a task. 'awk' has several built-in
- functions. Users can define their own functions in every part of
- the program. Function can be recursive, i.e., they may invoke
- themselves. *Note Functions::. In 'gawk' it is also possible to
- have functions shared among different programs, and included where
- required using the '@include' directive (*note Include Files::).
- In 'gawk' the name of the function that should be invoked can be
- generated at run time, i.e., dynamically. The 'gawk' extension API
- provides constructor functions (*note Constructor Functions::).
-
-'gawk'
- The GNU implementation of 'awk'.
-
-General Public License
- This document describes the terms under which 'gawk' and its source
- code may be distributed. (*Note Copying::.)
-
-GMT
- "Greenwich Mean Time." This is the old term for UTC. It is the
- time of day used internally for Unix and POSIX systems. See also
- "Epoch" and "UTC."
-
-GNU
- "GNU's not Unix". An on-going project of the Free Software
- Foundation to create a complete, freely distributable,
- POSIX-compliant computing environment.
-
-GNU/Linux
- A variant of the GNU system using the Linux kernel, instead of the
- Free Software Foundation's Hurd kernel. The Linux kernel is a
- stable, efficient, full-featured clone of Unix that has been ported
- to a variety of architectures. It is most popular on PC-class
- systems, but runs well on a variety of other systems too. The
- Linux kernel source code is available under the terms of the GNU
- General Public License, which is perhaps its most important aspect.
-
-GPL
- See "General Public License."
-
-Hexadecimal
- Base 16 notation, where the digits are '0'-'9' and 'A'-'F', with
- 'A' representing 10, 'B' representing 11, and so on, up to 'F' for
- 15. Hexadecimal numbers are written in C using a leading '0x', to
- indicate their base. Thus, '0x12' is 18 ((1 x 16) + 2). *Note
- Nondecimal-numbers::.
-
-I/O
- Abbreviation for "Input/Output," the act of moving data into and/or
- out of a running program.
-
-Input Record
- A single chunk of data that is read in by 'awk'. Usually, an 'awk'
- input record consists of one line of text. (*Note Records::.)
-
-Integer
- A whole number, i.e., a number that does not have a fractional
- part.
-
-Internationalization
- The process of writing or modifying a program so that it can use
- multiple languages without requiring further source code changes.
-
-Interpreter
- A program that reads human-readable source code directly, and uses
- the instructions in it to process data and produce results. 'awk'
- is typically (but not always) implemented as an interpreter. See
- also "Compiler."
-
-Interval Expression
- A component of a regular expression that lets you specify repeated
- matches of some part of the regexp. Interval expressions were not
- originally available in 'awk' programs.
-
-ISO
- The International Organization for Standardization. This
- organization produces international standards for many things,
- including programming languages, such as C and C++. In the
- computer arena, important standards like those for C, C++, and
- POSIX become both American national and ISO international standards
- simultaneously. This Info file refers to Standard C as "ISO C"
- throughout. See the ISO website
- (http://www.iso.org/iso/home/about.htm) for more information about
- the name of the organization and its language-independent
- three-letter acronym.
-
-Java
- A modern programming language originally developed by Sun
- Microsystems (now Oracle) supporting Object-Oriented programming.
- Although usually implemented by compiling to the instructions for a
- standard virtual machine (the JVM), the language can be compiled to
- native code.
-
-Keyword
- In the 'awk' language, a keyword is a word that has special
- meaning. Keywords are reserved and may not be used as variable
- names.
-
- 'gawk''s keywords are: 'BEGIN', 'BEGINFILE', 'END', 'ENDFILE',
- 'break', 'case', 'continue', 'default' 'delete', 'do...while',
- 'else', 'exit', 'for...in', 'for', 'function', 'func', 'if',
- 'next', 'nextfile', 'switch', and 'while'.
-
-Korn Shell
- The Korn Shell ('ksh') is a Unix shell which was developed by David
- Korn at Bell Laboratories in the early 1980s. The Korn Shell is
- backward-compatible with the Bourne shell and includes many
- features of the C shell. See also "Bourne Shell."
-
-Lesser General Public License
- This document describes the terms under which binary library
- archives or shared objects, and their source code may be
- distributed.
-
-LGPL
- See "Lesser General Public License."
-
-Linux
- See "GNU/Linux."
-
-Localization
- The process of providing the data necessary for an
- internationalized program to work in a particular language.
-
-Logical Expression
- An expression using the operators for logic, AND, OR, and NOT,
- written '&&', '||', and '!' in 'awk'. Often called Boolean
- expressions, after the mathematician who pioneered this kind of
- mathematical logic.
-
-Lvalue
- An expression that can appear on the left side of an assignment
- operator. In most languages, lvalues can be variables or array
- elements. In 'awk', a field designator can also be used as an
- lvalue.
-
-Matching
- The act of testing a string against a regular expression. If the
- regexp describes the contents of the string, it is said to "match"
- it.
-
-Metacharacters
- Characters used within a regexp that do not stand for themselves.
- Instead, they denote regular expression operations, such as
- repetition, grouping, or alternation.
-
-Nesting
- Nesting is where information is organized in layers, or where
- objects contain other similar objects. In 'gawk' the '@include'
- directive can be nested. The "natural" nesting of arithmetic and
- logical operations can be changed using parentheses (*note
- Precedence::).
-
-No-op
- An operation that does nothing.
-
-Null String
- A string with no characters in it. It is represented explicitly in
- 'awk' programs by placing two double quote characters next to each
- other ('""'). It can appear in input data by having two successive
- occurrences of the field separator appear next to each other.
-
-Number
- A numeric-valued data object. Modern 'awk' implementations use
- double precision floating-point to represent numbers. Ancient
- 'awk' implementations used single precision floating-point.
-
-Octal
- Base-eight notation, where the digits are '0'-'7'. Octal numbers
- are written in C using a leading '0', to indicate their base.
- Thus, '013' is 11 ((1 x 8) + 3). *Note Nondecimal-numbers::.
-
-Output Record
- A single chunk of data that is written out by 'awk'. Usually, an
- 'awk' output record consists of one or more lines of text. *Note
- Records::.
-
-Pattern
- Patterns tell 'awk' which input records are interesting to which
- rules.
-
- A pattern is an arbitrary conditional expression against which
- input is tested. If the condition is satisfied, the pattern is
- said to "match" the input record. A typical pattern might compare
- the input record against a regular expression. (*Note Pattern
- Overview::.)
-
-PEBKAC
- An acronym describing what is possibly the most frequent source of
- computer usage problems. (Problem Exists Between Keyboard And
- Chair.)
-
-Plug-in
- See "Extensions."
-
-POSIX
- The name for a series of standards that specify a Portable
- Operating System interface. The "IX" denotes the Unix heritage of
- these standards. The main standard of interest for 'awk' users is
- 'IEEE Standard for Information Technology, Standard 1003.1-2008'.
- The 2008 POSIX standard can be found online at
- <http://www.opengroup.org/onlinepubs/9699919799/>.
-
-Precedence
- The order in which operations are performed when operators are used
- without explicit parentheses.
-
-Private
- Variables and/or functions that are meant for use exclusively by
- library functions and not for the main 'awk' program. Special care
- must be taken when naming such variables and functions. (*Note
- Library Names::.)
-
-Range (of input lines)
- A sequence of consecutive lines from the input file(s). A pattern
- can specify ranges of input lines for 'awk' to process or it can
- specify single lines. (*Note Pattern Overview::.)
-
-Record
- See "Input record" and "Output record."
-
-Recursion
- When a function calls itself, either directly or indirectly. If
- this is clear, stop, and proceed to the next entry. Otherwise,
- refer to the entry for "recursion."
-
-Redirection
- Redirection means performing input from something other than the
- standard input stream, or performing output to something other than
- the standard output stream.
-
- You can redirect input to the 'getline' statement using the '<',
- '|', and '|&' operators. You can redirect the output of the
- 'print' and 'printf' statements to a file or a system command,
- using the '>', '>>', '|', and '|&' operators. (*Note Getline::,
- and *note Redirection::.)
-
-Reference Counts
- An internal mechanism in 'gawk' to minimize the amount of memory
- needed to store the value of string variables. If the value
- assumed by a variable is used in more than one place, only one copy
- of the value itself is kept, and the associated reference count is
- increased when the same value is used by an additional variable,
- and decreased when the related variable is no longer in use. When
- the reference count goes to zero, the memory space used to store
- the value of the variable is freed.
-
-Regexp
- See "Regular Expression."
-
-Regular Expression
- A regular expression ("regexp" for short) is a pattern that denotes
- a set of strings, possibly an infinite set. For example, the
- regular expression 'R.*xp' matches any string starting with the
- letter 'R' and ending with the letters 'xp'. In 'awk', regular
- expressions are used in patterns and in conditional expressions.
- Regular expressions may contain escape sequences. (*Note
- Regexp::.)
-
-Regular Expression Constant
- A regular expression constant is a regular expression written
- within slashes, such as '/foo/'. This regular expression is chosen
- when you write the 'awk' program and cannot be changed during its
- execution. (*Note Regexp Usage::.)
-
-Regular Expression Operators
- See "Metacharacters."
-
-Rounding
- Rounding the result of an arithmetic operation can be tricky. More
- than one way of rounding exists, and in 'gawk' it is possible to
- choose which method should be used in a program. *Note Setting the
- rounding mode::.
-
-Rule
- A segment of an 'awk' program that specifies how to process single
- input records. A rule consists of a "pattern" and an "action".
- 'awk' reads an input record; then, for each rule, if the input
- record satisfies the rule's pattern, 'awk' executes the rule's
- action. Otherwise, the rule does nothing for that input record.
-
-Rvalue
- A value that can appear on the right side of an assignment
- operator. In 'awk', essentially every expression has a value.
- These values are rvalues.
-
-Scalar
- A single value, be it a number or a string. Regular variables are
- scalars; arrays and functions are not.
-
-Search Path
- In 'gawk', a list of directories to search for 'awk' program source
- files. In the shell, a list of directories to search for
- executable programs.
-
-'sed'
- See "Stream Editor."
-
-Seed
- The initial value, or starting point, for a sequence of random
- numbers.
-
-Shell
- The command interpreter for Unix and POSIX-compliant systems. The
- shell works both interactively, and as a programming language for
- batch files, or shell scripts.
-
-Short-Circuit
- The nature of the 'awk' logical operators '&&' and '||'. If the
- value of the entire expression is determinable from evaluating just
- the lefthand side of these operators, the righthand side is not
- evaluated. (*Note Boolean Ops::.)
-
-Side Effect
- A side effect occurs when an expression has an effect aside from
- merely producing a value. Assignment expressions, increment and
- decrement expressions, and function calls have side effects.
- (*Note Assignment Ops::.)
-
-Single Precision
- An internal representation of numbers that can have fractional
- parts. Single precision numbers keep track of fewer digits than do
- double precision numbers, but operations on them are sometimes less
- expensive in terms of CPU time. This is the type used by some
- ancient versions of 'awk' to store numeric values. It is the C
- type 'float'.
-
-Space
- The character generated by hitting the space bar on the keyboard.
-
-Special File
- A file name interpreted internally by 'gawk', instead of being
- handed directly to the underlying operating system--for example,
- '/dev/stderr'. (*Note Special Files::.)
-
-Statement
- An expression inside an 'awk' program in the action part of a
- pattern-action rule, or inside an 'awk' function. A statement can
- be a variable assignment, an array operation, a loop, etc.
-
-Stream Editor
- A program that reads records from an input stream and processes
- them one or more at a time. This is in contrast with batch
- programs, which may expect to read their input files in entirety
- before starting to do anything, as well as with interactive
- programs which require input from the user.
-
-String
- A datum consisting of a sequence of characters, such as 'I am a
- string'. Constant strings are written with double quotes in the
- 'awk' language and may contain escape sequences. (*Note Escape
- Sequences::.)
-
-Tab
- The character generated by hitting the 'TAB' key on the keyboard.
- It usually expands to up to eight spaces upon output.
-
-Text Domain
- A unique name that identifies an application. Used for grouping
- messages that are translated at runtime into the local language.
-
-Timestamp
- A value in the "seconds since the epoch" format used by Unix and
- POSIX systems. Used for the 'gawk' functions 'mktime()',
- 'strftime()', and 'systime()'. See also "Epoch," "GMT," and "UTC."
-
-Unix
- A computer operating system originally developed in the early
- 1970's at AT&T Bell Laboratories. It initially became popular in
- universities around the world and later moved into commercial
- environments as a software development system and network server
- system. There are many commercial versions of Unix, as well as
- several work-alike systems whose source code is freely available
- (such as GNU/Linux, NetBSD (http://www.netbsd.org), FreeBSD
- (http://www.freebsd.org), and OpenBSD (http://www.openbsd.org)).
-
-UTC
- The accepted abbreviation for "Universal Coordinated Time." This
- is standard time in Greenwich, England, which is used as a
- reference time for day and date calculations. See also "Epoch" and
- "GMT."
-
-Variable
- A name for a value. In 'awk', variables may be either scalars or
- arrays.
-
-Whitespace
- A sequence of space, TAB, or newline characters occurring inside an
- input record or a string.
-
-
-File: gawk.info, Node: Copying, Next: GNU Free Documentation License, Prev: Glossary, Up: Top
-
-GNU General Public License
-**************************
-
- Version 3, 29 June 2007
-
- Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>
-
- Everyone is permitted to copy and distribute verbatim copies of this
- license document, but changing it is not allowed.
-
-Preamble
-========
-
-The GNU General Public License is a free, copyleft license for software
-and other kinds of works.
-
- The licenses for most software and other practical works are designed
-to take away your freedom to share and change the works. By contrast,
-the GNU General Public License is intended to guarantee your freedom to
-share and change all versions of a program--to make sure it remains free
-software for all its users. We, the Free Software Foundation, use the
-GNU General Public License for most of our software; it applies also to
-any other work released this way by its authors. You can apply it to
-your programs, too.
-
- When we speak of free software, we are referring to freedom, not
-price. Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-them if you wish), that you receive source code or can get it if you
-want it, that you can change the software or use pieces of it in new
-free programs, and that you know you can do these things.
-
- To protect your rights, we need to prevent others from denying you
-these rights or asking you to surrender the rights. Therefore, you have
-certain responsibilities if you distribute copies of the software, or if
-you modify it: responsibilities to respect the freedom of others.
-
- For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must pass on to the recipients the same
-freedoms that you received. You must make sure that they, too, receive
-or can get the source code. And you must show them these terms so they
-know their rights.
-
- Developers that use the GNU GPL protect your rights with two steps:
-(1) assert copyright on the software, and (2) offer you this License
-giving you legal permission to copy, distribute and/or modify it.
-
- For the developers' and authors' protection, the GPL clearly explains
-that there is no warranty for this free software. For both users' and
-authors' sake, the GPL requires that modified versions be marked as
-changed, so that their problems will not be attributed erroneously to
-authors of previous versions.
-
- Some devices are designed to deny users access to install or run
-modified versions of the software inside them, although the manufacturer
-can do so. This is fundamentally incompatible with the aim of
-protecting users' freedom to change the software. The systematic
-pattern of such abuse occurs in the area of products for individuals to
-use, which is precisely where it is most unacceptable. Therefore, we
-have designed this version of the GPL to prohibit the practice for those
-products. If such problems arise substantially in other domains, we
-stand ready to extend this provision to those domains in future versions
-of the GPL, as needed to protect the freedom of users.
-
- Finally, every program is threatened constantly by software patents.
-States should not allow patents to restrict development and use of
-software on general-purpose computers, but in those that do, we wish to
-avoid the special danger that patents applied to a free program could
-make it effectively proprietary. To prevent this, the GPL assures that
-patents cannot be used to render the program non-free.
-
- The precise terms and conditions for copying, distribution and
-modification follow.
-
-TERMS AND CONDITIONS
-====================
-
- 0. Definitions.
-
- "This License" refers to version 3 of the GNU General Public
- License.
-
- "Copyright" also means copyright-like laws that apply to other
- kinds of works, such as semiconductor masks.
-
- "The Program" refers to any copyrightable work licensed under this
- License. Each licensee is addressed as "you". "Licensees" and
- "recipients" may be individuals or organizations.
-
- To "modify" a work means to copy from or adapt all or part of the
- work in a fashion requiring copyright permission, other than the
- making of an exact copy. The resulting work is called a "modified
- version" of the earlier work or a work "based on" the earlier work.
-
- A "covered work" means either the unmodified Program or a work
- based on the Program.
-
- To "propagate" a work means to do anything with it that, without
- permission, would make you directly or secondarily liable for
- infringement under applicable copyright law, except executing it on
- a computer or modifying a private copy. Propagation includes
- copying, distribution (with or without modification), making
- available to the public, and in some countries other activities as
- well.
-
- To "convey" a work means any kind of propagation that enables other
- parties to make or receive copies. Mere interaction with a user
- through a computer network, with no transfer of a copy, is not
- conveying.
-
- An interactive user interface displays "Appropriate Legal Notices"
- to the extent that it includes a convenient and prominently visible
- feature that (1) displays an appropriate copyright notice, and (2)
- tells the user that there is no warranty for the work (except to
- the extent that warranties are provided), that licensees may convey
- the work under this License, and how to view a copy of this
- License. If the interface presents a list of user commands or
- options, such as a menu, a prominent item in the list meets this
- criterion.
-
- 1. Source Code.
-
- The "source code" for a work means the preferred form of the work
- for making modifications to it. "Object code" means any non-source
- form of a work.
-
- A "Standard Interface" means an interface that either is an
- official standard defined by a recognized standards body, or, in
- the case of interfaces specified for a particular programming
- language, one that is widely used among developers working in that
- language.
-
- The "System Libraries" of an executable work include anything,
- other than the work as a whole, that (a) is included in the normal
- form of packaging a Major Component, but which is not part of that
- Major Component, and (b) serves only to enable use of the work with
- that Major Component, or to implement a Standard Interface for
- which an implementation is available to the public in source code
- form. A "Major Component", in this context, means a major
- essential component (kernel, window system, and so on) of the
- specific operating system (if any) on which the executable work
- runs, or a compiler used to produce the work, or an object code
- interpreter used to run it.
-
- The "Corresponding Source" for a work in object code form means all
- the source code needed to generate, install, and (for an executable
- work) run the object code and to modify the work, including scripts
- to control those activities. However, it does not include the
- work's System Libraries, or general-purpose tools or generally
- available free programs which are used unmodified in performing
- those activities but which are not part of the work. For example,
- Corresponding Source includes interface definition files associated
- with source files for the work, and the source code for shared
- libraries and dynamically linked subprograms that the work is
- specifically designed to require, such as by intimate data
- communication or control flow between those subprograms and other
- parts of the work.
-
- The Corresponding Source need not include anything that users can
- regenerate automatically from other parts of the Corresponding
- Source.
-
- The Corresponding Source for a work in source code form is that
- same work.
-
- 2. Basic Permissions.
-
- All rights granted under this License are granted for the term of
- copyright on the Program, and are irrevocable provided the stated
- conditions are met. This License explicitly affirms your unlimited
- permission to run the unmodified Program. The output from running
- a covered work is covered by this License only if the output, given
- its content, constitutes a covered work. This License acknowledges
- your rights of fair use or other equivalent, as provided by
- copyright law.
-
- You may make, run and propagate covered works that you do not
- convey, without conditions so long as your license otherwise
- remains in force. You may convey covered works to others for the
- sole purpose of having them make modifications exclusively for you,
- or provide you with facilities for running those works, provided
- that you comply with the terms of this License in conveying all
- material for which you do not control copyright. Those thus making
- or running the covered works for you must do so exclusively on your
- behalf, under your direction and control, on terms that prohibit
- them from making any copies of your copyrighted material outside
- their relationship with you.
-
- Conveying under any other circumstances is permitted solely under
- the conditions stated below. Sublicensing is not allowed; section
- 10 makes it unnecessary.
-
- 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
-
- No covered work shall be deemed part of an effective technological
- measure under any applicable law fulfilling obligations under
- article 11 of the WIPO copyright treaty adopted on 20 December
- 1996, or similar laws prohibiting or restricting circumvention of
- such measures.
-
- When you convey a covered work, you waive any legal power to forbid
- circumvention of technological measures to the extent such
- circumvention is effected by exercising rights under this License
- with respect to the covered work, and you disclaim any intention to
- limit operation or modification of the work as a means of
- enforcing, against the work's users, your or third parties' legal
- rights to forbid circumvention of technological measures.
-
- 4. Conveying Verbatim Copies.
-
- You may convey verbatim copies of the Program's source code as you
- receive it, in any medium, provided that you conspicuously and
- appropriately publish on each copy an appropriate copyright notice;
- keep intact all notices stating that this License and any
- non-permissive terms added in accord with section 7 apply to the
- code; keep intact all notices of the absence of any warranty; and
- give all recipients a copy of this License along with the Program.
-
- You may charge any price or no price for each copy that you convey,
- and you may offer support or warranty protection for a fee.
-
- 5. Conveying Modified Source Versions.
-
- You may convey a work based on the Program, or the modifications to
- produce it from the Program, in the form of source code under the
- terms of section 4, provided that you also meet all of these
- conditions:
-
- a. The work must carry prominent notices stating that you
- modified it, and giving a relevant date.
-
- b. The work must carry prominent notices stating that it is
- released under this License and any conditions added under
- section 7. This requirement modifies the requirement in
- section 4 to "keep intact all notices".
-
- c. You must license the entire work, as a whole, under this
- License to anyone who comes into possession of a copy. This
- License will therefore apply, along with any applicable
- section 7 additional terms, to the whole of the work, and all
- its parts, regardless of how they are packaged. This License
- gives no permission to license the work in any other way, but
- it does not invalidate such permission if you have separately
- received it.
-
- d. If the work has interactive user interfaces, each must display
- Appropriate Legal Notices; however, if the Program has
- interactive interfaces that do not display Appropriate Legal
- Notices, your work need not make them do so.
-
- A compilation of a covered work with other separate and independent
- works, which are not by their nature extensions of the covered
- work, and which are not combined with it such as to form a larger
- program, in or on a volume of a storage or distribution medium, is
- called an "aggregate" if the compilation and its resulting
- copyright are not used to limit the access or legal rights of the
- compilation's users beyond what the individual works permit.
- Inclusion of a covered work in an aggregate does not cause this
- License to apply to the other parts of the aggregate.
-
- 6. Conveying Non-Source Forms.
-
- You may convey a covered work in object code form under the terms
- of sections 4 and 5, provided that you also convey the
- machine-readable Corresponding Source under the terms of this
- License, in one of these ways:
-
- a. Convey the object code in, or embodied in, a physical product
- (including a physical distribution medium), accompanied by the
- Corresponding Source fixed on a durable physical medium
- customarily used for software interchange.
-
- b. Convey the object code in, or embodied in, a physical product
- (including a physical distribution medium), accompanied by a
- written offer, valid for at least three years and valid for as
- long as you offer spare parts or customer support for that
- product model, to give anyone who possesses the object code
- either (1) a copy of the Corresponding Source for all the
- software in the product that is covered by this License, on a
- durable physical medium customarily used for software
- interchange, for a price no more than your reasonable cost of
- physically performing this conveying of source, or (2) access
- to copy the Corresponding Source from a network server at no
- charge.
-
- c. Convey individual copies of the object code with a copy of the
- written offer to provide the Corresponding Source. This
- alternative is allowed only occasionally and noncommercially,
- and only if you received the object code with such an offer,
- in accord with subsection 6b.
-
- d. Convey the object code by offering access from a designated
- place (gratis or for a charge), and offer equivalent access to
- the Corresponding Source in the same way through the same
- place at no further charge. You need not require recipients
- to copy the Corresponding Source along with the object code.
- If the place to copy the object code is a network server, the
- Corresponding Source may be on a different server (operated by
- you or a third party) that supports equivalent copying
- facilities, provided you maintain clear directions next to the
- object code saying where to find the Corresponding Source.
- Regardless of what server hosts the Corresponding Source, you
- remain obligated to ensure that it is available for as long as
- needed to satisfy these requirements.
-
- e. Convey the object code using peer-to-peer transmission,
- provided you inform other peers where the object code and
- Corresponding Source of the work are being offered to the
- general public at no charge under subsection 6d.
-
- A separable portion of the object code, whose source code is
- excluded from the Corresponding Source as a System Library, need
- not be included in conveying the object code work.
-
- A "User Product" is either (1) a "consumer product", which means
- any tangible personal property which is normally used for personal,
- family, or household purposes, or (2) anything designed or sold for
- incorporation into a dwelling. In determining whether a product is
- a consumer product, doubtful cases shall be resolved in favor of
- coverage. For a particular product received by a particular user,
- "normally used" refers to a typical or common use of that class of
- product, regardless of the status of the particular user or of the
- way in which the particular user actually uses, or expects or is
- expected to use, the product. A product is a consumer product
- regardless of whether the product has substantial commercial,
- industrial or non-consumer uses, unless such uses represent the
- only significant mode of use of the product.
-
- "Installation Information" for a User Product means any methods,
- procedures, authorization keys, or other information required to
- install and execute modified versions of a covered work in that
- User Product from a modified version of its Corresponding Source.
- The information must suffice to ensure that the continued
- functioning of the modified object code is in no case prevented or
- interfered with solely because modification has been made.
-
- If you convey an object code work under this section in, or with,
- or specifically for use in, a User Product, and the conveying
- occurs as part of a transaction in which the right of possession
- and use of the User Product is transferred to the recipient in
- perpetuity or for a fixed term (regardless of how the transaction
- is characterized), the Corresponding Source conveyed under this
- section must be accompanied by the Installation Information. But
- this requirement does not apply if neither you nor any third party
- retains the ability to install modified object code on the User
- Product (for example, the work has been installed in ROM).
-
- The requirement to provide Installation Information does not
- include a requirement to continue to provide support service,
- warranty, or updates for a work that has been modified or installed
- by the recipient, or for the User Product in which it has been
- modified or installed. Access to a network may be denied when the
- modification itself materially and adversely affects the operation
- of the network or violates the rules and protocols for
- communication across the network.
-
- Corresponding Source conveyed, and Installation Information
- provided, in accord with this section must be in a format that is
- publicly documented (and with an implementation available to the
- public in source code form), and must require no special password
- or key for unpacking, reading or copying.
-
- 7. Additional Terms.
-
- "Additional permissions" are terms that supplement the terms of
- this License by making exceptions from one or more of its
- conditions. Additional permissions that are applicable to the
- entire Program shall be treated as though they were included in
- this License, to the extent that they are valid under applicable
- law. If additional permissions apply only to part of the Program,
- that part may be used separately under those permissions, but the
- entire Program remains governed by this License without regard to
- the additional permissions.
-
- When you convey a copy of a covered work, you may at your option
- remove any additional permissions from that copy, or from any part
- of it. (Additional permissions may be written to require their own
- removal in certain cases when you modify the work.) You may place
- additional permissions on material, added by you to a covered work,
- for which you have or can give appropriate copyright permission.
-
- Notwithstanding any other provision of this License, for material
- you add to a covered work, you may (if authorized by the copyright
- holders of that material) supplement the terms of this License with
- terms:
-
- a. Disclaiming warranty or limiting liability differently from
- the terms of sections 15 and 16 of this License; or
-
- b. Requiring preservation of specified reasonable legal notices
- or author attributions in that material or in the Appropriate
- Legal Notices displayed by works containing it; or
-
- c. Prohibiting misrepresentation of the origin of that material,
- or requiring that modified versions of such material be marked
- in reasonable ways as different from the original version; or
-
- d. Limiting the use for publicity purposes of names of licensors
- or authors of the material; or
-
- e. Declining to grant rights under trademark law for use of some
- trade names, trademarks, or service marks; or
-
- f. Requiring indemnification of licensors and authors of that
- material by anyone who conveys the material (or modified
- versions of it) with contractual assumptions of liability to
- the recipient, for any liability that these contractual
- assumptions directly impose on those licensors and authors.
-
- All other non-permissive additional terms are considered "further
- restrictions" within the meaning of section 10. If the Program as
- you received it, or any part of it, contains a notice stating that
- it is governed by this License along with a term that is a further
- restriction, you may remove that term. If a license document
- contains a further restriction but permits relicensing or conveying
- under this License, you may add to a covered work material governed
- by the terms of that license document, provided that the further
- restriction does not survive such relicensing or conveying.
-
- If you add terms to a covered work in accord with this section, you
- must place, in the relevant source files, a statement of the
- additional terms that apply to those files, or a notice indicating
- where to find the applicable terms.
-
- Additional terms, permissive or non-permissive, may be stated in
- the form of a separately written license, or stated as exceptions;
- the above requirements apply either way.
-
- 8. Termination.
-
- You may not propagate or modify a covered work except as expressly
- provided under this License. Any attempt otherwise to propagate or
- modify it is void, and will automatically terminate your rights
- under this License (including any patent licenses granted under the
- third paragraph of section 11).
-
- However, if you cease all violation of this License, then your
- license from a particular copyright holder is reinstated (a)
- provisionally, unless and until the copyright holder explicitly and
- finally terminates your license, and (b) permanently, if the
- copyright holder fails to notify you of the violation by some
- reasonable means prior to 60 days after the cessation.
-
- Moreover, your license from a particular copyright holder is
- reinstated permanently if the copyright holder notifies you of the
- violation by some reasonable means, this is the first time you have
- received notice of violation of this License (for any work) from
- that copyright holder, and you cure the violation prior to 30 days
- after your receipt of the notice.
-
- Termination of your rights under this section does not terminate
- the licenses of parties who have received copies or rights from you
- under this License. If your rights have been terminated and not
- permanently reinstated, you do not qualify to receive new licenses
- for the same material under section 10.
-
- 9. Acceptance Not Required for Having Copies.
-
- You are not required to accept this License in order to receive or
- run a copy of the Program. Ancillary propagation of a covered work
- occurring solely as a consequence of using peer-to-peer
- transmission to receive a copy likewise does not require
- acceptance. However, nothing other than this License grants you
- permission to propagate or modify any covered work. These actions
- infringe copyright if you do not accept this License. Therefore,
- by modifying or propagating a covered work, you indicate your
- acceptance of this License to do so.
-
- 10. Automatic Licensing of Downstream Recipients.
-
- Each time you convey a covered work, the recipient automatically
- receives a license from the original licensors, to run, modify and
- propagate that work, subject to this License. You are not
- responsible for enforcing compliance by third parties with this
- License.
-
- An "entity transaction" is a transaction transferring control of an
- organization, or substantially all assets of one, or subdividing an
- organization, or merging organizations. If propagation of a
- covered work results from an entity transaction, each party to that
- transaction who receives a copy of the work also receives whatever
- licenses to the work the party's predecessor in interest had or
- could give under the previous paragraph, plus a right to possession
- of the Corresponding Source of the work from the predecessor in
- interest, if the predecessor has it or can get it with reasonable
- efforts.
-
- You may not impose any further restrictions on the exercise of the
- rights granted or affirmed under this License. For example, you
- may not impose a license fee, royalty, or other charge for exercise
- of rights granted under this License, and you may not initiate
- litigation (including a cross-claim or counterclaim in a lawsuit)
- alleging that any patent claim is infringed by making, using,
- selling, offering for sale, or importing the Program or any portion
- of it.
-
- 11. Patents.
-
- A "contributor" is a copyright holder who authorizes use under this
- License of the Program or a work on which the Program is based.
- The work thus licensed is called the contributor's "contributor
- version".
-
- A contributor's "essential patent claims" are all patent claims
- owned or controlled by the contributor, whether already acquired or
- hereafter acquired, that would be infringed by some manner,
- permitted by this License, of making, using, or selling its
- contributor version, but do not include claims that would be
- infringed only as a consequence of further modification of the
- contributor version. For purposes of this definition, "control"
- includes the right to grant patent sublicenses in a manner
- consistent with the requirements of this License.
-
- Each contributor grants you a non-exclusive, worldwide,
- royalty-free patent license under the contributor's essential
- patent claims, to make, use, sell, offer for sale, import and
- otherwise run, modify and propagate the contents of its contributor
- version.
-
- In the following three paragraphs, a "patent license" is any
- express agreement or commitment, however denominated, not to
- enforce a patent (such as an express permission to practice a
- patent or covenant not to sue for patent infringement). To "grant"
- such a patent license to a party means to make such an agreement or
- commitment not to enforce a patent against the party.
-
- If you convey a covered work, knowingly relying on a patent
- license, and the Corresponding Source of the work is not available
- for anyone to copy, free of charge and under the terms of this
- License, through a publicly available network server or other
- readily accessible means, then you must either (1) cause the
- Corresponding Source to be so available, or (2) arrange to deprive
- yourself of the benefit of the patent license for this particular
- work, or (3) arrange, in a manner consistent with the requirements
- of this License, to extend the patent license to downstream
- recipients. "Knowingly relying" means you have actual knowledge
- that, but for the patent license, your conveying the covered work
- in a country, or your recipient's use of the covered work in a
- country, would infringe one or more identifiable patents in that
- country that you have reason to believe are valid.
-
- If, pursuant to or in connection with a single transaction or
- arrangement, you convey, or propagate by procuring conveyance of, a
- covered work, and grant a patent license to some of the parties
- receiving the covered work authorizing them to use, propagate,
- modify or convey a specific copy of the covered work, then the
- patent license you grant is automatically extended to all
- recipients of the covered work and works based on it.
-
- A patent license is "discriminatory" if it does not include within
- the scope of its coverage, prohibits the exercise of, or is
- conditioned on the non-exercise of one or more of the rights that
- are specifically granted under this License. You may not convey a
- covered work if you are a party to an arrangement with a third
- party that is in the business of distributing software, under which
- you make payment to the third party based on the extent of your
- activity of conveying the work, and under which the third party
- grants, to any of the parties who would receive the covered work
- from you, a discriminatory patent license (a) in connection with
- copies of the covered work conveyed by you (or copies made from
- those copies), or (b) primarily for and in connection with specific
- products or compilations that contain the covered work, unless you
- entered into that arrangement, or that patent license was granted,
- prior to 28 March 2007.
-
- Nothing in this License shall be construed as excluding or limiting
- any implied license or other defenses to infringement that may
- otherwise be available to you under applicable patent law.
-
- 12. No Surrender of Others' Freedom.
-
- If conditions are imposed on you (whether by court order, agreement
- or otherwise) that contradict the conditions of this License, they
- do not excuse you from the conditions of this License. If you
- cannot convey a covered work so as to satisfy simultaneously your
- obligations under this License and any other pertinent obligations,
- then as a consequence you may not convey it at all. For example,
- if you agree to terms that obligate you to collect a royalty for
- further conveying from those to whom you convey the Program, the
- only way you could satisfy both those terms and this License would
- be to refrain entirely from conveying the Program.
-
- 13. Use with the GNU Affero General Public License.
-
- Notwithstanding any other provision of this License, you have
- permission to link or combine any covered work with a work licensed
- under version 3 of the GNU Affero General Public License into a
- single combined work, and to convey the resulting work. The terms
- of this License will continue to apply to the part which is the
- covered work, but the special requirements of the GNU Affero
- General Public License, section 13, concerning interaction through
- a network will apply to the combination as such.
-
- 14. Revised Versions of this License.
-
- The Free Software Foundation may publish revised and/or new
- versions of the GNU General Public License from time to time. Such
- new versions will be similar in spirit to the present version, but
- may differ in detail to address new problems or concerns.
-
- Each version is given a distinguishing version number. If the
- Program specifies that a certain numbered version of the GNU
- General Public License "or any later version" applies to it, you
- have the option of following the terms and conditions either of
- that numbered version or of any later version published by the Free
- Software Foundation. If the Program does not specify a version
- number of the GNU General Public License, you may choose any
- version ever published by the Free Software Foundation.
-
- If the Program specifies that a proxy can decide which future
- versions of the GNU General Public License can be used, that
- proxy's public statement of acceptance of a version permanently
- authorizes you to choose that version for the Program.
-
- Later license versions may give you additional or different
- permissions. However, no additional obligations are imposed on any
- author or copyright holder as a result of your choosing to follow a
- later version.
-
- 15. Disclaimer of Warranty.
-
- THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
- APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE
- COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS"
- WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED,
- INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
- MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE
- RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.
- SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL
- NECESSARY SERVICING, REPAIR OR CORRECTION.
-
- 16. Limitation of Liability.
-
- IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
- WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES
- AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR
- DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
- CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE
- THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA
- BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
- PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
- PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF
- THE POSSIBILITY OF SUCH DAMAGES.
-
- 17. Interpretation of Sections 15 and 16.
-
- If the disclaimer of warranty and limitation of liability provided
- above cannot be given local legal effect according to their terms,
- reviewing courts shall apply local law that most closely
- approximates an absolute waiver of all civil liability in
- connection with the Program, unless a warranty or assumption of
- liability accompanies a copy of the Program in return for a fee.
-
-END OF TERMS AND CONDITIONS
-===========================
-
-How to Apply These Terms to Your New Programs
-=============================================
-
-If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these
-terms.
-
- To do so, attach the following notices to the program. It is safest
-to attach them to the start of each source file to most effectively
-state the exclusion of warranty; and each file should have at least the
-"copyright" line and a pointer to where the full notice is found.
-
- ONE LINE TO GIVE THE PROGRAM'S NAME AND A BRIEF IDEA OF WHAT IT DOES.
- Copyright (C) YEAR NAME OF AUTHOR
-
- This program is free software: you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation, either version 3 of the License, or (at
- your option) any later version.
-
- This program is distributed in the hope that it will be useful, but
- WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
- General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program. If not, see <http://www.gnu.org/licenses/>.
-
- Also add information on how to contact you by electronic and paper
-mail.
-
- If the program does terminal interaction, make it output a short
-notice like this when it starts in an interactive mode:
-
- PROGRAM Copyright (C) YEAR NAME OF AUTHOR
- This program comes with ABSOLUTELY NO WARRANTY; for details type 'show w'.
- This is free software, and you are welcome to redistribute it
- under certain conditions; type 'show c' for details.
-
- The hypothetical commands 'show w' and 'show c' should show the
-appropriate parts of the General Public License. Of course, your
-program's commands might be different; for a GUI interface, you would
-use an "about box".
-
- You should also get your employer (if you work as a programmer) or
-school, if any, to sign a "copyright disclaimer" for the program, if
-necessary. For more information on this, and how to apply and follow
-the GNU GPL, see <http://www.gnu.org/licenses/>.
-
- The GNU General Public License does not permit incorporating your
-program into proprietary programs. If your program is a subroutine
-library, you may consider it more useful to permit linking proprietary
-applications with the library. If this is what you want to do, use the
-GNU Lesser General Public License instead of this License. But first,
-please read <http://www.gnu.org/philosophy/why-not-lgpl.html>.
-
-
-File: gawk.info, Node: GNU Free Documentation License, Next: Index, Prev: Copying, Up: Top
-
-GNU Free Documentation License
-******************************
-
- Version 1.3, 3 November 2008
-
- Copyright (C) 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc.
- <http://fsf.org/>
-
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
- 0. PREAMBLE
-
- The purpose of this License is to make a manual, textbook, or other
- functional and useful document "free" in the sense of freedom: to
- assure everyone the effective freedom to copy and redistribute it,
- with or without modifying it, either commercially or
- noncommercially. Secondarily, this License preserves for the
- author and publisher a way to get credit for their work, while not
- being considered responsible for modifications made by others.
-
- This License is a kind of "copyleft", which means that derivative
- works of the document must themselves be free in the same sense.
- It complements the GNU General Public License, which is a copyleft
- license designed for free software.
-
- We have designed this License in order to use it for manuals for
- free software, because free software needs free documentation: a
- free program should come with manuals providing the same freedoms
- that the software does. But this License is not limited to
- software manuals; it can be used for any textual work, regardless
- of subject matter or whether it is published as a printed book. We
- recommend this License principally for works whose purpose is
- instruction or reference.
-
- 1. APPLICABILITY AND DEFINITIONS
-
- This License applies to any manual or other work, in any medium,
- that contains a notice placed by the copyright holder saying it can
- be distributed under the terms of this License. Such a notice
- grants a world-wide, royalty-free license, unlimited in duration,
- to use that work under the conditions stated herein. The
- "Document", below, refers to any such manual or work. Any member
- of the public is a licensee, and is addressed as "you". You accept
- the license if you copy, modify or distribute the work in a way
- requiring permission under copyright law.
-
- A "Modified Version" of the Document means any work containing the
- Document or a portion of it, either copied verbatim, or with
- modifications and/or translated into another language.
-
- A "Secondary Section" is a named appendix or a front-matter section
- of the Document that deals exclusively with the relationship of the
- publishers or authors of the Document to the Document's overall
- subject (or to related matters) and contains nothing that could
- fall directly within that overall subject. (Thus, if the Document
- is in part a textbook of mathematics, a Secondary Section may not
- explain any mathematics.) The relationship could be a matter of
- historical connection with the subject or with related matters, or
- of legal, commercial, philosophical, ethical or political position
- regarding them.
-
- The "Invariant Sections" are certain Secondary Sections whose
- titles are designated, as being those of Invariant Sections, in the
- notice that says that the Document is released under this License.
- If a section does not fit the above definition of Secondary then it
- is not allowed to be designated as Invariant. The Document may
- contain zero Invariant Sections. If the Document does not identify
- any Invariant Sections then there are none.
-
- The "Cover Texts" are certain short passages of text that are
- listed, as Front-Cover Texts or Back-Cover Texts, in the notice
- that says that the Document is released under this License. A
- Front-Cover Text may be at most 5 words, and a Back-Cover Text may
- be at most 25 words.
-
- A "Transparent" copy of the Document means a machine-readable copy,
- represented in a format whose specification is available to the
- general public, that is suitable for revising the document
- straightforwardly with generic text editors or (for images composed
- of pixels) generic paint programs or (for drawings) some widely
- available drawing editor, and that is suitable for input to text
- formatters or for automatic translation to a variety of formats
- suitable for input to text formatters. A copy made in an otherwise
- Transparent file format whose markup, or absence of markup, has
- been arranged to thwart or discourage subsequent modification by
- readers is not Transparent. An image format is not Transparent if
- used for any substantial amount of text. A copy that is not
- "Transparent" is called "Opaque".
-
- Examples of suitable formats for Transparent copies include plain
- ASCII without markup, Texinfo input format, LaTeX input format,
- SGML or XML using a publicly available DTD, and standard-conforming
- simple HTML, PostScript or PDF designed for human modification.
- Examples of transparent image formats include PNG, XCF and JPG.
- Opaque formats include proprietary formats that can be read and
- edited only by proprietary word processors, SGML or XML for which
- the DTD and/or processing tools are not generally available, and
- the machine-generated HTML, PostScript or PDF produced by some word
- processors for output purposes only.
-
- The "Title Page" means, for a printed book, the title page itself,
- plus such following pages as are needed to hold, legibly, the
- material this License requires to appear in the title page. For
- works in formats which do not have any title page as such, "Title
- Page" means the text near the most prominent appearance of the
- work's title, preceding the beginning of the body of the text.
-
- The "publisher" means any person or entity that distributes copies
- of the Document to the public.
-
- A section "Entitled XYZ" means a named subunit of the Document
- whose title either is precisely XYZ or contains XYZ in parentheses
- following text that translates XYZ in another language. (Here XYZ
- stands for a specific section name mentioned below, such as
- "Acknowledgements", "Dedications", "Endorsements", or "History".)
- To "Preserve the Title" of such a section when you modify the
- Document means that it remains a section "Entitled XYZ" according
- to this definition.
-
- The Document may include Warranty Disclaimers next to the notice
- which states that this License applies to the Document. These
- Warranty Disclaimers are considered to be included by reference in
- this License, but only as regards disclaiming warranties: any other
- implication that these Warranty Disclaimers may have is void and
- has no effect on the meaning of this License.
-
- 2. VERBATIM COPYING
-
- You may copy and distribute the Document in any medium, either
- commercially or noncommercially, provided that this License, the
- copyright notices, and the license notice saying this License
- applies to the Document are reproduced in all copies, and that you
- add no other conditions whatsoever to those of this License. You
- may not use technical measures to obstruct or control the reading
- or further copying of the copies you make or distribute. However,
- you may accept compensation in exchange for copies. If you
- distribute a large enough number of copies you must also follow the
- conditions in section 3.
-
- You may also lend copies, under the same conditions stated above,
- and you may publicly display copies.
-
- 3. COPYING IN QUANTITY
-
- If you publish printed copies (or copies in media that commonly
- have printed covers) of the Document, numbering more than 100, and
- the Document's license notice requires Cover Texts, you must
- enclose the copies in covers that carry, clearly and legibly, all
- these Cover Texts: Front-Cover Texts on the front cover, and
- Back-Cover Texts on the back cover. Both covers must also clearly
- and legibly identify you as the publisher of these copies. The
- front cover must present the full title with all words of the title
- equally prominent and visible. You may add other material on the
- covers in addition. Copying with changes limited to the covers, as
- long as they preserve the title of the Document and satisfy these
- conditions, can be treated as verbatim copying in other respects.
-
- If the required texts for either cover are too voluminous to fit
- legibly, you should put the first ones listed (as many as fit
- reasonably) on the actual cover, and continue the rest onto
- adjacent pages.
-
- If you publish or distribute Opaque copies of the Document
- numbering more than 100, you must either include a machine-readable
- Transparent copy along with each Opaque copy, or state in or with
- each Opaque copy a computer-network location from which the general
- network-using public has access to download using public-standard
- network protocols a complete Transparent copy of the Document, free
- of added material. If you use the latter option, you must take
- reasonably prudent steps, when you begin distribution of Opaque
- copies in quantity, to ensure that this Transparent copy will
- remain thus accessible at the stated location until at least one
- year after the last time you distribute an Opaque copy (directly or
- through your agents or retailers) of that edition to the public.
-
- It is requested, but not required, that you contact the authors of
- the Document well before redistributing any large number of copies,
- to give them a chance to provide you with an updated version of the
- Document.
-
- 4. MODIFICATIONS
-
- You may copy and distribute a Modified Version of the Document
- under the conditions of sections 2 and 3 above, provided that you
- release the Modified Version under precisely this License, with the
- Modified Version filling the role of the Document, thus licensing
- distribution and modification of the Modified Version to whoever
- possesses a copy of it. In addition, you must do these things in
- the Modified Version:
-
- A. Use in the Title Page (and on the covers, if any) a title
- distinct from that of the Document, and from those of previous
- versions (which should, if there were any, be listed in the
- History section of the Document). You may use the same title
- as a previous version if the original publisher of that
- version gives permission.
-
- B. List on the Title Page, as authors, one or more persons or
- entities responsible for authorship of the modifications in
- the Modified Version, together with at least five of the
- principal authors of the Document (all of its principal
- authors, if it has fewer than five), unless they release you
- from this requirement.
-
- C. State on the Title page the name of the publisher of the
- Modified Version, as the publisher.
-
- D. Preserve all the copyright notices of the Document.
-
- E. Add an appropriate copyright notice for your modifications
- adjacent to the other copyright notices.
-
- F. Include, immediately after the copyright notices, a license
- notice giving the public permission to use the Modified
- Version under the terms of this License, in the form shown in
- the Addendum below.
-
- G. Preserve in that license notice the full lists of Invariant
- Sections and required Cover Texts given in the Document's
- license notice.
-
- H. Include an unaltered copy of this License.
-
- I. Preserve the section Entitled "History", Preserve its Title,
- and add to it an item stating at least the title, year, new
- authors, and publisher of the Modified Version as given on the
- Title Page. If there is no section Entitled "History" in the
- Document, create one stating the title, year, authors, and
- publisher of the Document as given on its Title Page, then add
- an item describing the Modified Version as stated in the
- previous sentence.
-
- J. Preserve the network location, if any, given in the Document
- for public access to a Transparent copy of the Document, and
- likewise the network locations given in the Document for
- previous versions it was based on. These may be placed in the
- "History" section. You may omit a network location for a work
- that was published at least four years before the Document
- itself, or if the original publisher of the version it refers
- to gives permission.
-
- K. For any section Entitled "Acknowledgements" or "Dedications",
- Preserve the Title of the section, and preserve in the section
- all the substance and tone of each of the contributor
- acknowledgements and/or dedications given therein.
-
- L. Preserve all the Invariant Sections of the Document, unaltered
- in their text and in their titles. Section numbers or the
- equivalent are not considered part of the section titles.
-
- M. Delete any section Entitled "Endorsements". Such a section
- may not be included in the Modified Version.
-
- N. Do not retitle any existing section to be Entitled
- "Endorsements" or to conflict in title with any Invariant
- Section.
-
- O. Preserve any Warranty Disclaimers.
-
- If the Modified Version includes new front-matter sections or
- appendices that qualify as Secondary Sections and contain no
- material copied from the Document, you may at your option designate
- some or all of these sections as invariant. To do this, add their
- titles to the list of Invariant Sections in the Modified Version's
- license notice. These titles must be distinct from any other
- section titles.
-
- You may add a section Entitled "Endorsements", provided it contains
- nothing but endorsements of your Modified Version by various
- parties--for example, statements of peer review or that the text
- has been approved by an organization as the authoritative
- definition of a standard.
-
- You may add a passage of up to five words as a Front-Cover Text,
- and a passage of up to 25 words as a Back-Cover Text, to the end of
- the list of Cover Texts in the Modified Version. Only one passage
- of Front-Cover Text and one of Back-Cover Text may be added by (or
- through arrangements made by) any one entity. If the Document
- already includes a cover text for the same cover, previously added
- by you or by arrangement made by the same entity you are acting on
- behalf of, you may not add another; but you may replace the old
- one, on explicit permission from the previous publisher that added
- the old one.
-
- The author(s) and publisher(s) of the Document do not by this
- License give permission to use their names for publicity for or to
- assert or imply endorsement of any Modified Version.
-
- 5. COMBINING DOCUMENTS
-
- You may combine the Document with other documents released under
- this License, under the terms defined in section 4 above for
- modified versions, provided that you include in the combination all
- of the Invariant Sections of all of the original documents,
- unmodified, and list them all as Invariant Sections of your
- combined work in its license notice, and that you preserve all
- their Warranty Disclaimers.
-
- The combined work need only contain one copy of this License, and
- multiple identical Invariant Sections may be replaced with a single
- copy. If there are multiple Invariant Sections with the same name
- but different contents, make the title of each such section unique
- by adding at the end of it, in parentheses, the name of the
- original author or publisher of that section if known, or else a
- unique number. Make the same adjustment to the section titles in
- the list of Invariant Sections in the license notice of the
- combined work.
-
- In the combination, you must combine any sections Entitled
- "History" in the various original documents, forming one section
- Entitled "History"; likewise combine any sections Entitled
- "Acknowledgements", and any sections Entitled "Dedications". You
- must delete all sections Entitled "Endorsements."
-
- 6. COLLECTIONS OF DOCUMENTS
-
- You may make a collection consisting of the Document and other
- documents released under this License, and replace the individual
- copies of this License in the various documents with a single copy
- that is included in the collection, provided that you follow the
- rules of this License for verbatim copying of each of the documents
- in all other respects.
-
- You may extract a single document from such a collection, and
- distribute it individually under this License, provided you insert
- a copy of this License into the extracted document, and follow this
- License in all other respects regarding verbatim copying of that
- document.
-
- 7. AGGREGATION WITH INDEPENDENT WORKS
-
- A compilation of the Document or its derivatives with other
- separate and independent documents or works, in or on a volume of a
- storage or distribution medium, is called an "aggregate" if the
- copyright resulting from the compilation is not used to limit the
- legal rights of the compilation's users beyond what the individual
- works permit. When the Document is included in an aggregate, this
- License does not apply to the other works in the aggregate which
- are not themselves derivative works of the Document.
-
- If the Cover Text requirement of section 3 is applicable to these
- copies of the Document, then if the Document is less than one half
- of the entire aggregate, the Document's Cover Texts may be placed
- on covers that bracket the Document within the aggregate, or the
- electronic equivalent of covers if the Document is in electronic
- form. Otherwise they must appear on printed covers that bracket
- the whole aggregate.
-
- 8. TRANSLATION
-
- Translation is considered a kind of modification, so you may
- distribute translations of the Document under the terms of section
- 4. Replacing Invariant Sections with translations requires special
- permission from their copyright holders, but you may include
- translations of some or all Invariant Sections in addition to the
- original versions of these Invariant Sections. You may include a
- translation of this License, and all the license notices in the
- Document, and any Warranty Disclaimers, provided that you also
- include the original English version of this License and the
- original versions of those notices and disclaimers. In case of a
- disagreement between the translation and the original version of
- this License or a notice or disclaimer, the original version will
- prevail.
-
- If a section in the Document is Entitled "Acknowledgements",
- "Dedications", or "History", the requirement (section 4) to
- Preserve its Title (section 1) will typically require changing the
- actual title.
-
- 9. TERMINATION
-
- You may not copy, modify, sublicense, or distribute the Document
- except as expressly provided under this License. Any attempt
- otherwise to copy, modify, sublicense, or distribute it is void,
- and will automatically terminate your rights under this License.
-
- However, if you cease all violation of this License, then your
- license from a particular copyright holder is reinstated (a)
- provisionally, unless and until the copyright holder explicitly and
- finally terminates your license, and (b) permanently, if the
- copyright holder fails to notify you of the violation by some
- reasonable means prior to 60 days after the cessation.
-
- Moreover, your license from a particular copyright holder is
- reinstated permanently if the copyright holder notifies you of the
- violation by some reasonable means, this is the first time you have
- received notice of violation of this License (for any work) from
- that copyright holder, and you cure the violation prior to 30 days
- after your receipt of the notice.
-
- Termination of your rights under this section does not terminate
- the licenses of parties who have received copies or rights from you
- under this License. If your rights have been terminated and not
- permanently reinstated, receipt of a copy of some or all of the
- same material does not give you any rights to use it.
-
- 10. FUTURE REVISIONS OF THIS LICENSE
-
- The Free Software Foundation may publish new, revised versions of
- the GNU Free Documentation License from time to time. Such new
- versions will be similar in spirit to the present version, but may
- differ in detail to address new problems or concerns. See
- <http://www.gnu.org/copyleft/>.
-
- Each version of the License is given a distinguishing version
- number. If the Document specifies that a particular numbered
- version of this License "or any later version" applies to it, you
- have the option of following the terms and conditions either of
- that specified version or of any later version that has been
- published (not as a draft) by the Free Software Foundation. If the
- Document does not specify a version number of this License, you may
- choose any version ever published (not as a draft) by the Free
- Software Foundation. If the Document specifies that a proxy can
- decide which future versions of this License can be used, that
- proxy's public statement of acceptance of a version permanently
- authorizes you to choose that version for the Document.
-
- 11. RELICENSING
-
- "Massive Multiauthor Collaboration Site" (or "MMC Site") means any
- World Wide Web server that publishes copyrightable works and also
- provides prominent facilities for anybody to edit those works. A
- public wiki that anybody can edit is an example of such a server.
- A "Massive Multiauthor Collaboration" (or "MMC") contained in the
- site means any set of copyrightable works thus published on the MMC
- site.
-
- "CC-BY-SA" means the Creative Commons Attribution-Share Alike 3.0
- license published by Creative Commons Corporation, a not-for-profit
- corporation with a principal place of business in San Francisco,
- California, as well as future copyleft versions of that license
- published by that same organization.
-
- "Incorporate" means to publish or republish a Document, in whole or
- in part, as part of another Document.
-
- An MMC is "eligible for relicensing" if it is licensed under this
- License, and if all works that were first published under this
- License somewhere other than this MMC, and subsequently
- incorporated in whole or in part into the MMC, (1) had no cover
- texts or invariant sections, and (2) were thus incorporated prior
- to November 1, 2008.
-
- The operator of an MMC Site may republish an MMC contained in the
- site under CC-BY-SA on the same site at any time before August 1,
- 2009, provided the MMC is eligible for relicensing.
-
-ADDENDUM: How to use this License for your documents
-====================================================
-
-To use this License in a document you have written, include a copy of
-the License in the document and put the following copyright and license
-notices just after the title page:
-
- Copyright (C) YEAR YOUR NAME.
- Permission is granted to copy, distribute and/or modify this document
- under the terms of the GNU Free Documentation License, Version 1.3
- or any later version published by the Free Software Foundation;
- with no Invariant Sections, no Front-Cover Texts, and no Back-Cover
- Texts. A copy of the license is included in the section entitled ``GNU
- Free Documentation License''.
-
- If you have Invariant Sections, Front-Cover Texts and Back-Cover
-Texts, replace the "with...Texts." line with this:
-
- with the Invariant Sections being LIST THEIR TITLES, with
- the Front-Cover Texts being LIST, and with the Back-Cover Texts
- being LIST.
-
- If you have Invariant Sections without Cover Texts, or some other
-combination of the three, merge those two alternatives to suit the
-situation.
-
- If your document contains nontrivial examples of program code, we
-recommend releasing these examples in parallel under your choice of free
-software license, such as the GNU General Public License, to permit
-their use in free software.
-
-
-File: gawk.info, Node: Index, Prev: GNU Free Documentation License, Up: Top
-
-Index
-*****
-
-
-* Menu:
-
-* ! (exclamation point), ! operator: Boolean Ops. (line 69)
-* ! (exclamation point), ! operator <1>: Precedence. (line 51)
-* ! (exclamation point), ! operator <2>: Ranges. (line 47)
-* ! (exclamation point), ! operator <3>: Egrep Program. (line 174)
-* ! (exclamation point), != operator: Comparison Operators.
- (line 11)
-* ! (exclamation point), != operator <1>: Precedence. (line 64)
-* ! (exclamation point), !~ operator: Regexp Usage. (line 19)
-* ! (exclamation point), !~ operator <1>: Computed Regexps. (line 6)
-* ! (exclamation point), !~ operator <2>: Case-sensitivity. (line 26)
-* ! (exclamation point), !~ operator <3>: Regexp Constants. (line 6)
-* ! (exclamation point), !~ operator <4>: Comparison Operators.
- (line 11)
-* ! (exclamation point), !~ operator <5>: Comparison Operators.
- (line 98)
-* ! (exclamation point), !~ operator <6>: Precedence. (line 79)
-* ! (exclamation point), !~ operator <7>: Expression Patterns.
- (line 24)
-* " (double quote), in regexp constants: Computed Regexps. (line 30)
-* " (double quote), in shell commands: Quoting. (line 54)
-* # (number sign), #! (executable scripts): Executable Scripts.
- (line 6)
-* # (number sign), commenting: Comments. (line 6)
-* $ (dollar sign), $ field operator: Fields. (line 19)
-* $ (dollar sign), $ field operator <1>: Precedence. (line 42)
-* $ (dollar sign), incrementing fields and arrays: Increment Ops.
- (line 30)
-* $ (dollar sign), regexp operator: Regexp Operators. (line 35)
-* % (percent sign), % operator: Precedence. (line 54)
-* % (percent sign), %= operator: Assignment Ops. (line 129)
-* % (percent sign), %= operator <1>: Precedence. (line 94)
-* & (ampersand), && operator: Boolean Ops. (line 59)
-* & (ampersand), && operator <1>: Precedence. (line 85)
-* & (ampersand), gsub()/gensub()/sub() functions and: Gory Details.
- (line 6)
-* ' (single quote): One-shot. (line 15)
-* ' (single quote) in gawk command lines: Long. (line 35)
-* ' (single quote), in shell commands: Quoting. (line 48)
-* ' (single quote), vs. apostrophe: Comments. (line 27)
-* ' (single quote), with double quotes: Quoting. (line 73)
-* () (parentheses), in a profile: Profiling. (line 146)
-* () (parentheses), regexp operator: Regexp Operators. (line 81)
-* * (asterisk), * operator, as multiplication operator: Precedence.
- (line 54)
-* * (asterisk), * operator, as regexp operator: Regexp Operators.
- (line 89)
-* * (asterisk), * operator, null strings, matching: String Functions.
- (line 537)
-* * (asterisk), ** operator: Arithmetic Ops. (line 81)
-* * (asterisk), ** operator <1>: Precedence. (line 48)
-* * (asterisk), **= operator: Assignment Ops. (line 129)
-* * (asterisk), **= operator <1>: Precedence. (line 94)
-* * (asterisk), *= operator: Assignment Ops. (line 129)
-* * (asterisk), *= operator <1>: Precedence. (line 94)
-* + (plus sign), + operator: Precedence. (line 51)
-* + (plus sign), + operator <1>: Precedence. (line 57)
-* + (plus sign), ++ operator: Increment Ops. (line 11)
-* + (plus sign), ++ operator <1>: Increment Ops. (line 40)
-* + (plus sign), ++ operator <2>: Precedence. (line 45)
-* + (plus sign), += operator: Assignment Ops. (line 81)
-* + (plus sign), += operator <1>: Precedence. (line 94)
-* + (plus sign), regexp operator: Regexp Operators. (line 105)
-* , (comma), in range patterns: Ranges. (line 6)
-* - (hyphen), - operator: Precedence. (line 51)
-* - (hyphen), - operator <1>: Precedence. (line 57)
-* - (hyphen), -- operator: Increment Ops. (line 48)
-* - (hyphen), -- operator <1>: Precedence. (line 45)
-* - (hyphen), -= operator: Assignment Ops. (line 129)
-* - (hyphen), -= operator <1>: Precedence. (line 94)
-* - (hyphen), filenames beginning with: Options. (line 60)
-* - (hyphen), in bracket expressions: Bracket Expressions. (line 25)
-* --assign option: Options. (line 32)
-* --bignum option: Options. (line 203)
-* --characters-as-bytes option: Options. (line 69)
-* --copyright option: Options. (line 89)
-* --debug option: Options. (line 108)
-* --disable-extensions configuration option: Additional Configuration Options.
- (line 9)
-* --disable-lint configuration option: Additional Configuration Options.
- (line 15)
-* --disable-nls configuration option: Additional Configuration Options.
- (line 32)
-* --dump-variables option: Options. (line 94)
-* --dump-variables option, using for library functions: Library Names.
- (line 45)
-* --exec option: Options. (line 125)
-* --field-separator option: Options. (line 21)
-* --file option: Options. (line 25)
-* --gen-pot option: Options. (line 147)
-* --gen-pot option <1>: String Extraction. (line 6)
-* --gen-pot option <2>: String Extraction. (line 6)
-* --help option: Options. (line 154)
-* --include option: Options. (line 159)
-* --lint option: Command Line. (line 20)
-* --lint option <1>: Options. (line 184)
-* --lint-old option: Options. (line 299)
-* --load option: Options. (line 172)
-* --no-optimize option: Options. (line 285)
-* --non-decimal-data option: Options. (line 209)
-* --non-decimal-data option <1>: Nondecimal Data. (line 6)
-* --non-decimal-data option, strtonum() function and: Nondecimal Data.
- (line 35)
-* --optimize option: Options. (line 234)
-* --posix option: Options. (line 257)
-* --posix option, --traditional option and: Options. (line 272)
-* --pretty-print option: Options. (line 223)
-* --profile option: Options. (line 245)
-* --profile option <1>: Profiling. (line 12)
-* --re-interval option: Options. (line 278)
-* --sandbox option: Options. (line 290)
-* --sandbox option, disabling system() function: I/O Functions.
- (line 129)
-* --sandbox option, input redirection with getline: Getline. (line 19)
-* --sandbox option, output redirection with print, printf: Redirection.
- (line 6)
-* --source option: Options. (line 117)
-* --traditional option: Options. (line 82)
-* --traditional option, --posix option and: Options. (line 272)
-* --use-lc-numeric option: Options. (line 218)
-* --version option: Options. (line 304)
-* --with-whiny-user-strftime configuration option: Additional Configuration Options.
- (line 37)
-* -b option: Options. (line 69)
-* -c option: Options. (line 82)
-* -C option: Options. (line 89)
-* -d option: Options. (line 94)
-* -D option: Options. (line 108)
-* -e option: Options. (line 117)
-* -E option: Options. (line 125)
-* -e option <1>: Options. (line 340)
-* -f option: Long. (line 12)
-* -F option: Options. (line 21)
-* -f option <1>: Options. (line 25)
-* -F option, -Ft sets FS to TAB: Options. (line 312)
-* -F option, command-line: Command Line Field Separator.
- (line 6)
-* -f option, multiple uses: Options. (line 317)
-* -g option: Options. (line 147)
-* -h option: Options. (line 154)
-* -i option: Options. (line 159)
-* -l option: Options. (line 172)
-* -l option <1>: Options. (line 184)
-* -L option: Options. (line 299)
-* -M option: Options. (line 203)
-* -n option: Options. (line 209)
-* -N option: Options. (line 218)
-* -o option: Options. (line 223)
-* -O option: Options. (line 234)
-* -p option: Options. (line 245)
-* -P option: Options. (line 257)
-* -r option: Options. (line 278)
-* -s option: Options. (line 285)
-* -S option: Options. (line 290)
-* -v option: Options. (line 32)
-* -V option: Options. (line 304)
-* -v option <1>: Assignment Options. (line 12)
-* -W option: Options. (line 47)
-* . (period), regexp operator: Regexp Operators. (line 44)
-* .gmo files: Explaining gettext. (line 42)
-* .gmo files, specifying directory of: Explaining gettext. (line 54)
-* .gmo files, specifying directory of <1>: Programmer i18n. (line 48)
-* .mo files, converting from .po: I18N Example. (line 66)
-* .po files: Explaining gettext. (line 37)
-* .po files <1>: Translator i18n. (line 6)
-* .po files, converting to .mo: I18N Example. (line 66)
-* .pot files: Explaining gettext. (line 31)
-* / (forward slash) to enclose regular expressions: Regexp. (line 10)
-* / (forward slash), / operator: Precedence. (line 54)
-* / (forward slash), /= operator: Assignment Ops. (line 129)
-* / (forward slash), /= operator <1>: Precedence. (line 94)
-* / (forward slash), /= operator, vs. /=.../ regexp constant: Assignment Ops.
- (line 149)
-* / (forward slash), patterns and: Expression Patterns. (line 24)
-* /= operator vs. /=.../ regexp constant: Assignment Ops. (line 149)
-* /dev/... special files: Special FD. (line 48)
-* /dev/fd/N special files (gawk): Special FD. (line 48)
-* /inet/... special files (gawk): TCP/IP Networking. (line 6)
-* /inet4/... special files (gawk): TCP/IP Networking. (line 6)
-* /inet6/... special files (gawk): TCP/IP Networking. (line 6)
-* ; (semicolon), AWKPATH variable and: PC Using. (line 9)
-* ; (semicolon), separating statements in actions: Statements/Lines.
- (line 90)
-* ; (semicolon), separating statements in actions <1>: Action Overview.
- (line 19)
-* ; (semicolon), separating statements in actions <2>: Statements.
- (line 10)
-* < (left angle bracket), < operator: Comparison Operators.
- (line 11)
-* < (left angle bracket), < operator <1>: Precedence. (line 64)
-* < (left angle bracket), < operator (I/O): Getline/File. (line 6)
-* < (left angle bracket), <= operator: Comparison Operators.
- (line 11)
-* < (left angle bracket), <= operator <1>: Precedence. (line 64)
-* = (equals sign), = operator: Assignment Ops. (line 6)
-* = (equals sign), == operator: Comparison Operators.
- (line 11)
-* = (equals sign), == operator <1>: Precedence. (line 64)
-* > (right angle bracket), > operator: Comparison Operators.
- (line 11)
-* > (right angle bracket), > operator <1>: Precedence. (line 64)
-* > (right angle bracket), > operator (I/O): Redirection. (line 22)
-* > (right angle bracket), >= operator: Comparison Operators.
- (line 11)
-* > (right angle bracket), >= operator <1>: Precedence. (line 64)
-* > (right angle bracket), >> operator (I/O): Redirection. (line 50)
-* > (right angle bracket), >> operator (I/O) <1>: Precedence. (line 64)
-* ? (question mark), ?: operator: Precedence. (line 91)
-* ? (question mark), regexp operator: Regexp Operators. (line 111)
-* ? (question mark), regexp operator <1>: GNU Regexp Operators.
- (line 62)
-* @-notation for indirect function calls: Indirect Calls. (line 47)
-* @include directive: Include Files. (line 8)
-* @load directive: Loading Shared Libraries.
- (line 8)
-* [] (square brackets), regexp operator: Regexp Operators. (line 56)
-* \ (backslash): Comments. (line 50)
-* \ (backslash), as field separator: Command Line Field Separator.
- (line 24)
-* \ (backslash), continuing lines and: Statements/Lines. (line 19)
-* \ (backslash), continuing lines and, comments and: Statements/Lines.
- (line 75)
-* \ (backslash), continuing lines and, in csh: Statements/Lines.
- (line 43)
-* \ (backslash), gsub()/gensub()/sub() functions and: Gory Details.
- (line 6)
-* \ (backslash), in bracket expressions: Bracket Expressions. (line 25)
-* \ (backslash), in escape sequences: Escape Sequences. (line 6)
-* \ (backslash), in escape sequences <1>: Escape Sequences. (line 103)
-* \ (backslash), in escape sequences, POSIX and: Escape Sequences.
- (line 108)
-* \ (backslash), in regexp constants: Computed Regexps. (line 30)
-* \ (backslash), in shell commands: Quoting. (line 48)
-* \ (backslash), regexp operator: Regexp Operators. (line 18)
-* \ (backslash), \" escape sequence: Escape Sequences. (line 85)
-* \ (backslash), \' operator (gawk): GNU Regexp Operators.
- (line 59)
-* \ (backslash), \/ escape sequence: Escape Sequences. (line 76)
-* \ (backslash), \< operator (gawk): GNU Regexp Operators.
- (line 33)
-* \ (backslash), \> operator (gawk): GNU Regexp Operators.
- (line 37)
-* \ (backslash), \a escape sequence: Escape Sequences. (line 34)
-* \ (backslash), \b escape sequence: Escape Sequences. (line 38)
-* \ (backslash), \B operator (gawk): GNU Regexp Operators.
- (line 46)
-* \ (backslash), \f escape sequence: Escape Sequences. (line 41)
-* \ (backslash), \n escape sequence: Escape Sequences. (line 44)
-* \ (backslash), \NNN escape sequence: Escape Sequences. (line 56)
-* \ (backslash), \r escape sequence: Escape Sequences. (line 47)
-* \ (backslash), \s operator (gawk): GNU Regexp Operators.
- (line 13)
-* \ (backslash), \S operator (gawk): GNU Regexp Operators.
- (line 17)
-* \ (backslash), \t escape sequence: Escape Sequences. (line 50)
-* \ (backslash), \v escape sequence: Escape Sequences. (line 53)
-* \ (backslash), \w operator (gawk): GNU Regexp Operators.
- (line 22)
-* \ (backslash), \W operator (gawk): GNU Regexp Operators.
- (line 28)
-* \ (backslash), \x escape sequence: Escape Sequences. (line 61)
-* \ (backslash), \y operator (gawk): GNU Regexp Operators.
- (line 41)
-* \ (backslash), \` operator (gawk): GNU Regexp Operators.
- (line 57)
-* ^ (caret), in bracket expressions: Bracket Expressions. (line 25)
-* ^ (caret), in FS: Regexp Field Splitting.
- (line 59)
-* ^ (caret), regexp operator: Regexp Operators. (line 22)
-* ^ (caret), regexp operator <1>: GNU Regexp Operators.
- (line 62)
-* ^ (caret), ^ operator: Precedence. (line 48)
-* ^ (caret), ^= operator: Assignment Ops. (line 129)
-* ^ (caret), ^= operator <1>: Precedence. (line 94)
-* _ (underscore), C macro: Explaining gettext. (line 71)
-* _ (underscore), in names of private variables: Library Names.
- (line 29)
-* _ (underscore), translatable string: Programmer i18n. (line 69)
-* _gr_init() user-defined function: Group Functions. (line 83)
-* _ord_init() user-defined function: Ordinal Functions. (line 16)
-* _pw_init() user-defined function: Passwd Functions. (line 105)
-* {} (braces): Profiling. (line 142)
-* {} (braces), actions and: Action Overview. (line 19)
-* {} (braces), statements, grouping: Statements. (line 10)
-* | (vertical bar): Regexp Operators. (line 70)
-* | (vertical bar), | operator (I/O): Getline/Pipe. (line 10)
-* | (vertical bar), | operator (I/O) <1>: Redirection. (line 57)
-* | (vertical bar), | operator (I/O) <2>: Precedence. (line 64)
-* | (vertical bar), |& operator (I/O): Getline/Coprocess. (line 6)
-* | (vertical bar), |& operator (I/O) <1>: Redirection. (line 96)
-* | (vertical bar), |& operator (I/O) <2>: Precedence. (line 64)
-* | (vertical bar), |& operator (I/O) <3>: Two-way I/O. (line 27)
-* | (vertical bar), |& operator (I/O), pipes, closing: Close Files And Pipes.
- (line 120)
-* | (vertical bar), || operator: Boolean Ops. (line 59)
-* | (vertical bar), || operator <1>: Precedence. (line 88)
-* ~ (tilde), ~ operator: Regexp Usage. (line 19)
-* ~ (tilde), ~ operator <1>: Computed Regexps. (line 6)
-* ~ (tilde), ~ operator <2>: Case-sensitivity. (line 26)
-* ~ (tilde), ~ operator <3>: Regexp Constants. (line 6)
-* ~ (tilde), ~ operator <4>: Comparison Operators.
- (line 11)
-* ~ (tilde), ~ operator <5>: Comparison Operators.
- (line 98)
-* ~ (tilde), ~ operator <6>: Precedence. (line 79)
-* ~ (tilde), ~ operator <7>: Expression Patterns. (line 24)
-* accessing fields: Fields. (line 6)
-* accessing global variables from extensions: Symbol Table Access.
- (line 6)
-* account information: Passwd Functions. (line 16)
-* account information <1>: Group Functions. (line 6)
-* actions: Action Overview. (line 6)
-* actions, control statements in: Statements. (line 6)
-* actions, default: Very Simple. (line 35)
-* actions, empty: Very Simple. (line 40)
-* Ada programming language: Glossary. (line 11)
-* adding, features to gawk: Adding Code. (line 6)
-* adding, fields: Changing Fields. (line 53)
-* advanced features, fixed-width data: Constant Size. (line 6)
-* advanced features, gawk: Advanced Features. (line 6)
-* advanced features, network programming: TCP/IP Networking. (line 6)
-* advanced features, nondecimal input data: Nondecimal Data. (line 6)
-* advanced features, processes, communicating with: Two-way I/O.
- (line 6)
-* advanced features, specifying field content: Splitting By Content.
- (line 9)
-* Aho, Alfred: History. (line 17)
-* Aho, Alfred <1>: Contributors. (line 12)
-* alarm clock example program: Alarm Program. (line 11)
-* alarm.awk program: Alarm Program. (line 31)
-* algorithms: Basic High Level. (line 57)
-* allocating memory for extensions: Memory Allocation Functions.
- (line 6)
-* amazing awk assembler (aaa): Glossary. (line 16)
-* amazingly workable formatter (awf): Glossary. (line 24)
-* ambiguity, syntactic: /= operator vs. /=.../ regexp constant: Assignment Ops.
- (line 149)
-* ampersand (&), && operator: Boolean Ops. (line 59)
-* ampersand (&), && operator <1>: Precedence. (line 85)
-* ampersand (&), gsub()/gensub()/sub() functions and: Gory Details.
- (line 6)
-* anagram.awk program: Anagram Program. (line 21)
-* anagrams, finding: Anagram Program. (line 6)
-* and: Bitwise Functions. (line 40)
-* AND bitwise operation: Bitwise Functions. (line 6)
-* and Boolean-logic operator: Boolean Ops. (line 6)
-* ANSI: Glossary. (line 34)
-* API informational variables: Extension API Informational Variables.
- (line 6)
-* API version: Extension Versioning.
- (line 6)
-* arbitrary precision: Arbitrary Precision Arithmetic.
- (line 6)
-* arbitrary precision integers: Arbitrary Precision Integers.
- (line 6)
-* archaeologists: Bugs. (line 6)
-* arctangent: Numeric Functions. (line 12)
-* ARGC/ARGV variables: Auto-set. (line 15)
-* ARGC/ARGV variables, command-line arguments: Other Arguments.
- (line 15)
-* ARGC/ARGV variables, how to use: ARGC and ARGV. (line 6)
-* ARGC/ARGV variables, portability and: Executable Scripts. (line 59)
-* ARGIND variable: Auto-set. (line 44)
-* ARGIND variable, command-line arguments: Other Arguments. (line 15)
-* arguments, command-line: Other Arguments. (line 6)
-* arguments, command-line <1>: Auto-set. (line 15)
-* arguments, command-line <2>: ARGC and ARGV. (line 6)
-* arguments, command-line, invoking awk: Command Line. (line 6)
-* arguments, in function calls: Function Calls. (line 18)
-* arguments, processing: Getopt Function. (line 6)
-* ARGV array, indexing into: Other Arguments. (line 15)
-* arithmetic operators: Arithmetic Ops. (line 6)
-* array manipulation in extensions: Array Manipulation. (line 6)
-* array members: Reference to Elements.
- (line 6)
-* array scanning order, controlling: Controlling Scanning.
- (line 14)
-* array, number of elements: String Functions. (line 200)
-* arrays: Arrays. (line 6)
-* arrays of arrays: Arrays of Arrays. (line 6)
-* arrays, an example of using: Array Example. (line 6)
-* arrays, and IGNORECASE variable: Array Intro. (line 100)
-* arrays, as parameters to functions: Pass By Value/Reference.
- (line 44)
-* arrays, associative: Array Intro. (line 48)
-* arrays, associative, library functions and: Library Names. (line 58)
-* arrays, deleting entire contents: Delete. (line 39)
-* arrays, elements that don't exist: Reference to Elements.
- (line 23)
-* arrays, elements, assigning values: Assigning Elements. (line 6)
-* arrays, elements, deleting: Delete. (line 6)
-* arrays, elements, order of access by in operator: Scanning an Array.
- (line 48)
-* arrays, elements, retrieving number of: String Functions. (line 42)
-* arrays, for statement and: Scanning an Array. (line 20)
-* arrays, indexing: Array Intro. (line 48)
-* arrays, merging into strings: Join Function. (line 6)
-* arrays, multidimensional: Multidimensional. (line 10)
-* arrays, multidimensional, scanning: Multiscanning. (line 11)
-* arrays, numeric subscripts: Numeric Array Subscripts.
- (line 6)
-* arrays, referencing elements: Reference to Elements.
- (line 6)
-* arrays, scanning: Scanning an Array. (line 6)
-* arrays, sorting: Array Sorting Functions.
- (line 6)
-* arrays, sorting, and IGNORECASE variable: Array Sorting Functions.
- (line 83)
-* arrays, sparse: Array Intro. (line 76)
-* arrays, subscripts, uninitialized variables as: Uninitialized Subscripts.
- (line 6)
-* arrays, unassigned elements: Reference to Elements.
- (line 18)
-* artificial intelligence, gawk and: Distribution contents.
- (line 52)
-* ASCII: Ordinal Functions. (line 45)
-* ASCII <1>: Glossary. (line 196)
-* asort: String Functions. (line 42)
-* asort <1>: Array Sorting Functions.
- (line 6)
-* asort() function (gawk), arrays, sorting: Array Sorting Functions.
- (line 6)
-* asorti: String Functions. (line 42)
-* asorti <1>: Array Sorting Functions.
- (line 6)
-* asorti() function (gawk), arrays, sorting: Array Sorting Functions.
- (line 6)
-* assert() function (C library): Assert Function. (line 6)
-* assert() user-defined function: Assert Function. (line 28)
-* assertions: Assert Function. (line 6)
-* assign values to variables, in debugger: Viewing And Changing Data.
- (line 58)
-* assignment operators: Assignment Ops. (line 6)
-* assignment operators, evaluation order: Assignment Ops. (line 110)
-* assignment operators, lvalues/rvalues: Assignment Ops. (line 31)
-* assignments as filenames: Ignoring Assigns. (line 6)
-* associative arrays: Array Intro. (line 48)
-* asterisk (*), * operator, as multiplication operator: Precedence.
- (line 54)
-* asterisk (*), * operator, as regexp operator: Regexp Operators.
- (line 89)
-* asterisk (*), * operator, null strings, matching: String Functions.
- (line 537)
-* asterisk (*), ** operator: Arithmetic Ops. (line 81)
-* asterisk (*), ** operator <1>: Precedence. (line 48)
-* asterisk (*), **= operator: Assignment Ops. (line 129)
-* asterisk (*), **= operator <1>: Precedence. (line 94)
-* asterisk (*), *= operator: Assignment Ops. (line 129)
-* asterisk (*), *= operator <1>: Precedence. (line 94)
-* atan2: Numeric Functions. (line 12)
-* automatic displays, in debugger: Debugger Info. (line 24)
-* awf (amazingly workable formatter) program: Glossary. (line 24)
-* awk debugging, enabling: Options. (line 108)
-* awk language, POSIX version: Assignment Ops. (line 138)
-* awk profiling, enabling: Options. (line 245)
-* awk programs: Getting Started. (line 12)
-* awk programs <1>: Executable Scripts. (line 6)
-* awk programs <2>: Two Rules. (line 6)
-* awk programs, complex: When. (line 27)
-* awk programs, documenting: Comments. (line 6)
-* awk programs, documenting <1>: Library Names. (line 6)
-* awk programs, examples of: Sample Programs. (line 6)
-* awk programs, execution of: Next Statement. (line 16)
-* awk programs, internationalizing: I18N Functions. (line 6)
-* awk programs, internationalizing <1>: Programmer i18n. (line 6)
-* awk programs, lengthy: Long. (line 6)
-* awk programs, lengthy, assertions: Assert Function. (line 6)
-* awk programs, location of: Options. (line 25)
-* awk programs, location of <1>: Options. (line 125)
-* awk programs, location of <2>: Options. (line 159)
-* awk programs, one-line examples: Very Simple. (line 46)
-* awk programs, profiling: Profiling. (line 6)
-* awk programs, running: Running gawk. (line 6)
-* awk programs, running <1>: Long. (line 6)
-* awk programs, running, from shell scripts: One-shot. (line 22)
-* awk programs, running, without input files: Read Terminal. (line 16)
-* awk programs, shell variables in: Using Shell Variables.
- (line 6)
-* awk, function of: Getting Started. (line 6)
-* awk, gawk and: Preface. (line 21)
-* awk, gawk and <1>: This Manual. (line 14)
-* awk, history of: History. (line 17)
-* awk, implementation issues, pipes: Redirection. (line 129)
-* awk, implementations: Other Versions. (line 6)
-* awk, implementations, limits: Getline Notes. (line 14)
-* awk, invoking: Command Line. (line 6)
-* awk, new vs. old: Names. (line 6)
-* awk, new vs. old, OFMT variable: Strings And Numbers. (line 56)
-* awk, POSIX and: Preface. (line 21)
-* awk, POSIX and, See Also POSIX awk: Preface. (line 21)
-* awk, regexp constants and: Comparison Operators.
- (line 103)
-* awk, See Also gawk: Preface. (line 34)
-* awk, terms describing: This Manual. (line 6)
-* awk, uses for: Preface. (line 21)
-* awk, uses for <1>: Getting Started. (line 12)
-* awk, uses for <2>: When. (line 6)
-* awk, versions of: V7/SVR3.1. (line 6)
-* awk, versions of, changes between SVR3.1 and SVR4: SVR4. (line 6)
-* awk, versions of, changes between SVR4 and POSIX awk: POSIX.
- (line 6)
-* awk, versions of, changes between V7 and SVR3.1: V7/SVR3.1. (line 6)
-* awk, versions of, See Also Brian Kernighan's awk: BTL. (line 6)
-* awk, versions of, See Also Brian Kernighan's awk <1>: Other Versions.
- (line 13)
-* awka compiler for awk: Other Versions. (line 68)
-* AWKLIBPATH environment variable: AWKLIBPATH Variable. (line 6)
-* AWKPATH environment variable: AWKPATH Variable. (line 6)
-* AWKPATH environment variable <1>: PC Using. (line 9)
-* awkprof.out file: Profiling. (line 6)
-* awksed.awk program: Simple Sed. (line 25)
-* awkvars.out file: Options. (line 94)
-* b debugger command (alias for break): Breakpoint Control. (line 11)
-* backslash (\): Comments. (line 50)
-* backslash (\), as field separator: Command Line Field Separator.
- (line 24)
-* backslash (\), continuing lines and: Statements/Lines. (line 19)
-* backslash (\), continuing lines and, comments and: Statements/Lines.
- (line 75)
-* backslash (\), continuing lines and, in csh: Statements/Lines.
- (line 43)
-* backslash (\), gsub()/gensub()/sub() functions and: Gory Details.
- (line 6)
-* backslash (\), in bracket expressions: Bracket Expressions. (line 25)
-* backslash (\), in escape sequences: Escape Sequences. (line 6)
-* backslash (\), in escape sequences <1>: Escape Sequences. (line 103)
-* backslash (\), in escape sequences, POSIX and: Escape Sequences.
- (line 108)
-* backslash (\), in regexp constants: Computed Regexps. (line 30)
-* backslash (\), in shell commands: Quoting. (line 48)
-* backslash (\), regexp operator: Regexp Operators. (line 18)
-* backslash (\), \" escape sequence: Escape Sequences. (line 85)
-* backslash (\), \' operator (gawk): GNU Regexp Operators.
- (line 59)
-* backslash (\), \/ escape sequence: Escape Sequences. (line 76)
-* backslash (\), \< operator (gawk): GNU Regexp Operators.
- (line 33)
-* backslash (\), \> operator (gawk): GNU Regexp Operators.
- (line 37)
-* backslash (\), \a escape sequence: Escape Sequences. (line 34)
-* backslash (\), \b escape sequence: Escape Sequences. (line 38)
-* backslash (\), \B operator (gawk): GNU Regexp Operators.
- (line 46)
-* backslash (\), \f escape sequence: Escape Sequences. (line 41)
-* backslash (\), \n escape sequence: Escape Sequences. (line 44)
-* backslash (\), \NNN escape sequence: Escape Sequences. (line 56)
-* backslash (\), \r escape sequence: Escape Sequences. (line 47)
-* backslash (\), \s operator (gawk): GNU Regexp Operators.
- (line 13)
-* backslash (\), \S operator (gawk): GNU Regexp Operators.
- (line 17)
-* backslash (\), \t escape sequence: Escape Sequences. (line 50)
-* backslash (\), \v escape sequence: Escape Sequences. (line 53)
-* backslash (\), \w operator (gawk): GNU Regexp Operators.
- (line 22)
-* backslash (\), \W operator (gawk): GNU Regexp Operators.
- (line 28)
-* backslash (\), \x escape sequence: Escape Sequences. (line 61)
-* backslash (\), \y operator (gawk): GNU Regexp Operators.
- (line 41)
-* backslash (\), \` operator (gawk): GNU Regexp Operators.
- (line 57)
-* backtrace debugger command: Execution Stack. (line 13)
-* Beebe, Nelson H.F.: Acknowledgments. (line 60)
-* Beebe, Nelson H.F. <1>: Other Versions. (line 82)
-* BEGIN pattern: Field Separators. (line 44)
-* BEGIN pattern <1>: BEGIN/END. (line 6)
-* BEGIN pattern <2>: Using BEGIN/END. (line 6)
-* BEGIN pattern, and profiling: Profiling. (line 62)
-* BEGIN pattern, assert() user-defined function and: Assert Function.
- (line 83)
-* BEGIN pattern, Boolean patterns and: Expression Patterns. (line 70)
-* BEGIN pattern, exit statement and: Exit Statement. (line 12)
-* BEGIN pattern, getline and: Getline Notes. (line 19)
-* BEGIN pattern, headings, adding: Print Examples. (line 42)
-* BEGIN pattern, next/nextfile statements and: I/O And BEGIN/END.
- (line 36)
-* BEGIN pattern, next/nextfile statements and <1>: Next Statement.
- (line 44)
-* BEGIN pattern, OFS/ORS variables, assigning values to: Output Separators.
- (line 20)
-* BEGIN pattern, operators and: Using BEGIN/END. (line 17)
-* BEGIN pattern, print statement and: I/O And BEGIN/END. (line 15)
-* BEGIN pattern, pwcat program: Passwd Functions. (line 143)
-* BEGIN pattern, running awk programs and: Cut Program. (line 63)
-* BEGIN pattern, TEXTDOMAIN variable and: Programmer i18n. (line 60)
-* BEGINFILE pattern: BEGINFILE/ENDFILE. (line 6)
-* BEGINFILE pattern, Boolean patterns and: Expression Patterns.
- (line 70)
-* beginfile() user-defined function: Filetrans Function. (line 62)
-* Bentley, Jon: Glossary. (line 206)
-* Benzinger, Michael: Contributors. (line 98)
-* Berry, Karl: Acknowledgments. (line 33)
-* Berry, Karl <1>: Acknowledgments. (line 75)
-* Berry, Karl <2>: Ranges and Locales. (line 74)
-* binary input/output: User-modified. (line 15)
-* bindtextdomain: I18N Functions. (line 11)
-* bindtextdomain <1>: Programmer i18n. (line 48)
-* bindtextdomain() function (C library): Explaining gettext. (line 50)
-* bindtextdomain() function (gawk), portability and: I18N Portability.
- (line 33)
-* BINMODE variable: User-modified. (line 15)
-* BINMODE variable <1>: PC Using. (line 16)
-* bit-manipulation functions: Bitwise Functions. (line 6)
-* bits2str() user-defined function: Bitwise Functions. (line 72)
-* bitwise AND: Bitwise Functions. (line 40)
-* bitwise complement: Bitwise Functions. (line 44)
-* bitwise OR: Bitwise Functions. (line 50)
-* bitwise XOR: Bitwise Functions. (line 57)
-* bitwise, complement: Bitwise Functions. (line 25)
-* bitwise, operations: Bitwise Functions. (line 6)
-* bitwise, shift: Bitwise Functions. (line 32)
-* body, in actions: Statements. (line 10)
-* body, in loops: While Statement. (line 14)
-* Boolean expressions: Boolean Ops. (line 6)
-* Boolean expressions, as patterns: Expression Patterns. (line 39)
-* Boolean operators, See Boolean expressions: Boolean Ops. (line 6)
-* Bourne shell, quoting rules for: Quoting. (line 18)
-* braces ({}): Profiling. (line 142)
-* braces ({}), actions and: Action Overview. (line 19)
-* braces ({}), statements, grouping: Statements. (line 10)
-* bracket expressions: Regexp Operators. (line 56)
-* bracket expressions <1>: Bracket Expressions. (line 6)
-* bracket expressions, character classes: Bracket Expressions.
- (line 40)
-* bracket expressions, collating elements: Bracket Expressions.
- (line 86)
-* bracket expressions, collating symbols: Bracket Expressions.
- (line 93)
-* bracket expressions, complemented: Regexp Operators. (line 64)
-* bracket expressions, equivalence classes: Bracket Expressions.
- (line 99)
-* bracket expressions, non-ASCII: Bracket Expressions. (line 86)
-* bracket expressions, range expressions: Bracket Expressions.
- (line 6)
-* break debugger command: Breakpoint Control. (line 11)
-* break statement: Break Statement. (line 6)
-* breakpoint: Debugging Terms. (line 33)
-* breakpoint at location, how to delete: Breakpoint Control. (line 36)
-* breakpoint commands: Debugger Execution Control.
- (line 10)
-* breakpoint condition: Breakpoint Control. (line 54)
-* breakpoint, delete by number: Breakpoint Control. (line 64)
-* breakpoint, how to disable or enable: Breakpoint Control. (line 69)
-* breakpoint, setting: Breakpoint Control. (line 11)
-* Brennan, Michael: Foreword3. (line 84)
-* Brennan, Michael <1>: Foreword4. (line 33)
-* Brennan, Michael <2>: Acknowledgments. (line 79)
-* Brennan, Michael <3>: Delete. (line 56)
-* Brennan, Michael <4>: Simple Sed. (line 25)
-* Brennan, Michael <5>: Other Versions. (line 6)
-* Brennan, Michael <6>: Other Versions. (line 48)
-* Brian Kernighan's awk: When. (line 21)
-* Brian Kernighan's awk <1>: Escape Sequences. (line 112)
-* Brian Kernighan's awk <2>: GNU Regexp Operators.
- (line 85)
-* Brian Kernighan's awk <3>: Regexp Field Splitting.
- (line 67)
-* Brian Kernighan's awk <4>: Getline/Pipe. (line 62)
-* Brian Kernighan's awk <5>: Concatenation. (line 36)
-* Brian Kernighan's awk <6>: I/O And BEGIN/END. (line 15)
-* Brian Kernighan's awk <7>: Break Statement. (line 51)
-* Brian Kernighan's awk <8>: Continue Statement. (line 44)
-* Brian Kernighan's awk <9>: Nextfile Statement. (line 47)
-* Brian Kernighan's awk <10>: Delete. (line 51)
-* Brian Kernighan's awk <11>: String Functions. (line 493)
-* Brian Kernighan's awk <12>: Gory Details. (line 19)
-* Brian Kernighan's awk <13>: I/O Functions. (line 43)
-* Brian Kernighan's awk, extensions: BTL. (line 6)
-* Brian Kernighan's awk, source code: Other Versions. (line 13)
-* Brini, Davide: Signature Program. (line 6)
-* Brink, Jeroen: DOS Quoting. (line 10)
-* Broder, Alan J.: Contributors. (line 89)
-* Brown, Martin: Contributors. (line 83)
-* BSD-based operating systems: Glossary. (line 748)
-* bt debugger command (alias for backtrace): Execution Stack. (line 13)
-* Buening, Andreas: Acknowledgments. (line 60)
-* Buening, Andreas <1>: Contributors. (line 93)
-* Buening, Andreas <2>: Maintainers. (line 14)
-* buffering, input/output: I/O Functions. (line 166)
-* buffering, input/output <1>: Two-way I/O. (line 53)
-* buffering, interactive vs. noninteractive: I/O Functions. (line 76)
-* buffers, flushing: I/O Functions. (line 32)
-* buffers, flushing <1>: I/O Functions. (line 166)
-* buffers, operators for: GNU Regexp Operators.
- (line 51)
-* bug reports, email address, bug-gawk@gnu.org: Bug address. (line 22)
-* bug-gawk@gnu.org bug reporting address: Bug address. (line 22)
-* built-in functions: Functions. (line 6)
-* built-in functions, evaluation order: Calling Built-in. (line 30)
-* BusyBox Awk: Other Versions. (line 92)
-* c.e., See common extensions: Conventions. (line 51)
-* call by reference: Pass By Value/Reference.
- (line 44)
-* call by value: Pass By Value/Reference.
- (line 15)
-* call stack, display in debugger: Execution Stack. (line 13)
-* caret (^), in bracket expressions: Bracket Expressions. (line 25)
-* caret (^), regexp operator: Regexp Operators. (line 22)
-* caret (^), regexp operator <1>: GNU Regexp Operators.
- (line 62)
-* caret (^), ^ operator: Precedence. (line 48)
-* caret (^), ^= operator: Assignment Ops. (line 129)
-* caret (^), ^= operator <1>: Precedence. (line 94)
-* case keyword: Switch Statement. (line 6)
-* case sensitivity, and regexps: User-modified. (line 76)
-* case sensitivity, and string comparisons: User-modified. (line 76)
-* case sensitivity, array indices and: Array Intro. (line 100)
-* case sensitivity, converting case: String Functions. (line 523)
-* case sensitivity, example programs: Library Functions. (line 53)
-* case sensitivity, gawk: Case-sensitivity. (line 26)
-* case sensitivity, regexps and: Case-sensitivity. (line 6)
-* CGI, awk scripts for: Options. (line 125)
-* character classes, See bracket expressions: Regexp Operators.
- (line 56)
-* character lists in regular expression: Bracket Expressions. (line 6)
-* character lists, See bracket expressions: Regexp Operators. (line 56)
-* character sets (machine character encodings): Ordinal Functions.
- (line 45)
-* character sets (machine character encodings) <1>: Glossary. (line 196)
-* character sets, See Also bracket expressions: Regexp Operators.
- (line 56)
-* characters, counting: Wc Program. (line 6)
-* characters, transliterating: Translate Program. (line 6)
-* characters, values of as numbers: Ordinal Functions. (line 6)
-* Chassell, Robert J.: Acknowledgments. (line 33)
-* chdir() extension function: Extension Sample File Functions.
- (line 12)
-* chem utility: Glossary. (line 206)
-* chr() extension function: Extension Sample Ord.
- (line 15)
-* chr() user-defined function: Ordinal Functions. (line 16)
-* clear debugger command: Breakpoint Control. (line 36)
-* Cliff random numbers: Cliff Random Function.
- (line 6)
-* cliff_rand() user-defined function: Cliff Random Function.
- (line 12)
-* close: Close Files And Pipes.
- (line 18)
-* close <1>: I/O Functions. (line 10)
-* close file or coprocess: I/O Functions. (line 10)
-* close() function, portability: Close Files And Pipes.
- (line 81)
-* close() function, return value: Close Files And Pipes.
- (line 132)
-* close() function, two-way pipes and: Two-way I/O. (line 60)
-* Close, Diane: Manual History. (line 34)
-* Close, Diane <1>: Contributors. (line 21)
-* Collado, Manuel: Acknowledgments. (line 60)
-* collating elements: Bracket Expressions. (line 86)
-* collating symbols: Bracket Expressions. (line 93)
-* Colombo, Antonio: Acknowledgments. (line 60)
-* Colombo, Antonio <1>: Contributors. (line 141)
-* columns, aligning: Print Examples. (line 69)
-* columns, cutting: Cut Program. (line 6)
-* comma (,), in range patterns: Ranges. (line 6)
-* command completion, in debugger: Readline Support. (line 6)
-* command line, arguments: Other Arguments. (line 6)
-* command line, arguments <1>: Auto-set. (line 15)
-* command line, arguments <2>: ARGC and ARGV. (line 6)
-* command line, directories on: Command-line directories.
- (line 6)
-* command line, formats: Running gawk. (line 12)
-* command line, FS on, setting: Command Line Field Separator.
- (line 6)
-* command line, invoking awk from: Command Line. (line 6)
-* command line, option -f: Long. (line 12)
-* command line, options: Options. (line 6)
-* command line, options, end of: Options. (line 55)
-* command line, variables, assigning on: Assignment Options. (line 6)
-* command-line options, processing: Getopt Function. (line 6)
-* command-line options, string extraction: String Extraction. (line 6)
-* commands debugger command: Debugger Execution Control.
- (line 10)
-* commands to execute at breakpoint: Debugger Execution Control.
- (line 10)
-* commenting: Comments. (line 6)
-* commenting, backslash continuation and: Statements/Lines. (line 75)
-* common extensions, ** operator: Arithmetic Ops. (line 30)
-* common extensions, **= operator: Assignment Ops. (line 138)
-* common extensions, /dev/stderr special file: Special FD. (line 48)
-* common extensions, /dev/stdin special file: Special FD. (line 48)
-* common extensions, /dev/stdout special file: Special FD. (line 48)
-* common extensions, BINMODE variable: PC Using. (line 16)
-* common extensions, delete to delete entire arrays: Delete. (line 39)
-* common extensions, func keyword: Definition Syntax. (line 99)
-* common extensions, length() applied to an array: String Functions.
- (line 200)
-* common extensions, RS as a regexp: gawk split records. (line 6)
-* common extensions, single character fields: Single Character Fields.
- (line 6)
-* common extensions, \x escape sequence: Escape Sequences. (line 61)
-* comp.lang.awk newsgroup: Usenet. (line 11)
-* comparison expressions: Typing and Comparison.
- (line 9)
-* comparison expressions, as patterns: Expression Patterns. (line 14)
-* comparison expressions, string vs. regexp: Comparison Operators.
- (line 79)
-* compatibility mode (gawk), extensions: POSIX/GNU. (line 6)
-* compatibility mode (gawk), file names: Special Caveats. (line 9)
-* compatibility mode (gawk), hexadecimal numbers: Nondecimal-numbers.
- (line 59)
-* compatibility mode (gawk), octal numbers: Nondecimal-numbers.
- (line 59)
-* compatibility mode (gawk), specifying: Options. (line 82)
-* compiled programs: Basic High Level. (line 13)
-* compiled programs <1>: Glossary. (line 218)
-* compiling gawk for Cygwin: Cygwin. (line 6)
-* compiling gawk for MS-Windows: PC Compiling. (line 11)
-* compiling gawk for VMS: VMS Compilation. (line 6)
-* compl: Bitwise Functions. (line 44)
-* complement, bitwise: Bitwise Functions. (line 25)
-* compound statements, control statements and: Statements. (line 10)
-* concatenating: Concatenation. (line 9)
-* condition debugger command: Breakpoint Control. (line 54)
-* conditional expressions: Conditional Exp. (line 6)
-* configuration option, --disable-extensions: Additional Configuration Options.
- (line 9)
-* configuration option, --disable-lint: Additional Configuration Options.
- (line 15)
-* configuration option, --disable-nls: Additional Configuration Options.
- (line 32)
-* configuration option, --with-whiny-user-strftime: Additional Configuration Options.
- (line 37)
-* configuration options, gawk: Additional Configuration Options.
- (line 6)
-* constant regexps: Regexp Usage. (line 57)
-* constants, nondecimal: Nondecimal Data. (line 6)
-* constants, numeric: Scalar Constants. (line 6)
-* constants, types of: Constants. (line 6)
-* continue program, in debugger: Debugger Execution Control.
- (line 33)
-* continue statement: Continue Statement. (line 6)
-* control statements: Statements. (line 6)
-* controlling array scanning order: Controlling Scanning.
- (line 14)
-* convert string to lower case: String Functions. (line 524)
-* convert string to number: String Functions. (line 391)
-* convert string to upper case: String Functions. (line 530)
-* converting integer array subscripts: Numeric Array Subscripts.
- (line 31)
-* converting, dates to timestamps: Time Functions. (line 76)
-* converting, numbers to strings: Strings And Numbers. (line 6)
-* converting, numbers to strings <1>: Bitwise Functions. (line 111)
-* converting, strings to numbers: Strings And Numbers. (line 6)
-* converting, strings to numbers <1>: Bitwise Functions. (line 111)
-* CONVFMT variable: Strings And Numbers. (line 29)
-* CONVFMT variable <1>: User-modified. (line 30)
-* CONVFMT variable, and array subscripts: Numeric Array Subscripts.
- (line 6)
-* cookie: Glossary. (line 257)
-* coprocesses: Redirection. (line 96)
-* coprocesses <1>: Two-way I/O. (line 27)
-* coprocesses, closing: Close Files And Pipes.
- (line 6)
-* coprocesses, getline from: Getline/Coprocess. (line 6)
-* cos: Numeric Functions. (line 16)
-* cosine: Numeric Functions. (line 16)
-* counting: Wc Program. (line 6)
-* csh utility: Statements/Lines. (line 43)
-* csh utility, POSIXLY_CORRECT environment variable: Options. (line 358)
-* csh utility, |& operator, comparison with: Two-way I/O. (line 27)
-* ctime() user-defined function: Function Example. (line 74)
-* currency symbols, localization: Explaining gettext. (line 104)
-* current system time: Time Functions. (line 66)
-* custom.h file: Configuration Philosophy.
- (line 30)
-* customized input parser: Input Parsers. (line 6)
-* customized output wrapper: Output Wrappers. (line 6)
-* customized two-way processor: Two-way processors. (line 6)
-* cut utility: Cut Program. (line 6)
-* cut utility <1>: Cut Program. (line 6)
-* cut.awk program: Cut Program. (line 45)
-* d debugger command (alias for delete): Breakpoint Control. (line 64)
-* d.c., See dark corner: Conventions. (line 42)
-* dark corner: Conventions. (line 42)
-* dark corner <1>: Glossary. (line 268)
-* dark corner, "0" is actually true: Truth Values. (line 24)
-* dark corner, /= operator vs. /=.../ regexp constant: Assignment Ops.
- (line 149)
-* dark corner, array subscripts: Uninitialized Subscripts.
- (line 43)
-* dark corner, break statement: Break Statement. (line 51)
-* dark corner, close() function: Close Files And Pipes.
- (line 132)
-* dark corner, command-line arguments: Assignment Options. (line 43)
-* dark corner, continue statement: Continue Statement. (line 44)
-* dark corner, CONVFMT variable: Strings And Numbers. (line 39)
-* dark corner, escape sequences: Other Arguments. (line 38)
-* dark corner, escape sequences, for metacharacters: Escape Sequences.
- (line 144)
-* dark corner, exit statement: Exit Statement. (line 30)
-* dark corner, field separators: Full Line Fields. (line 22)
-* dark corner, FILENAME variable: Getline Notes. (line 19)
-* dark corner, FILENAME variable <1>: Auto-set. (line 108)
-* dark corner, FNR/NR variables: Auto-set. (line 357)
-* dark corner, format-control characters: Control Letters. (line 18)
-* dark corner, format-control characters <1>: Control Letters.
- (line 93)
-* dark corner, FS as null string: Single Character Fields.
- (line 20)
-* dark corner, input files: awk split records. (line 110)
-* dark corner, invoking awk: Command Line. (line 16)
-* dark corner, length() function: String Functions. (line 186)
-* dark corner, locale's decimal point character: Locale influences conversions.
- (line 17)
-* dark corner, multiline records: Multiple Line. (line 35)
-* dark corner, NF variable, decrementing: Changing Fields. (line 107)
-* dark corner, OFMT variable: OFMT. (line 27)
-* dark corner, regexp as second argument to index(): String Functions.
- (line 164)
-* dark corner, regexp constants: Using Constant Regexps.
- (line 6)
-* dark corner, regexp constants, /= operator and: Assignment Ops.
- (line 149)
-* dark corner, regexp constants, as arguments to user-defined functions: Using Constant Regexps.
- (line 43)
-* dark corner, split() function: String Functions. (line 361)
-* dark corner, strings, storing: gawk split records. (line 82)
-* dark corner, value of ARGV[0]: Auto-set. (line 39)
-* dark corner, ^, in FS: Regexp Field Splitting.
- (line 59)
-* data, fixed-width: Constant Size. (line 6)
-* data-driven languages: Basic High Level. (line 74)
-* database, group, reading: Group Functions. (line 6)
-* database, users, reading: Passwd Functions. (line 6)
-* date utility, GNU: Time Functions. (line 17)
-* date utility, POSIX: Time Functions. (line 253)
-* dates, converting to timestamps: Time Functions. (line 76)
-* dates, information related to, localization: Explaining gettext.
- (line 112)
-* Davies, Stephen: Acknowledgments. (line 60)
-* Davies, Stephen <1>: Contributors. (line 75)
-* Day, Robert P.J.: Acknowledgments. (line 79)
-* dcgettext: I18N Functions. (line 21)
-* dcgettext <1>: Programmer i18n. (line 20)
-* dcgettext() function (gawk), portability and: I18N Portability.
- (line 33)
-* dcngettext: I18N Functions. (line 27)
-* dcngettext <1>: Programmer i18n. (line 37)
-* dcngettext() function (gawk), portability and: I18N Portability.
- (line 33)
-* deadlocks: Two-way I/O. (line 53)
-* debugger commands, b (break): Breakpoint Control. (line 11)
-* debugger commands, backtrace: Execution Stack. (line 13)
-* debugger commands, break: Breakpoint Control. (line 11)
-* debugger commands, bt (backtrace): Execution Stack. (line 13)
-* debugger commands, c (continue): Debugger Execution Control.
- (line 33)
-* debugger commands, clear: Breakpoint Control. (line 36)
-* debugger commands, commands: Debugger Execution Control.
- (line 10)
-* debugger commands, condition: Breakpoint Control. (line 54)
-* debugger commands, continue: Debugger Execution Control.
- (line 33)
-* debugger commands, d (delete): Breakpoint Control. (line 64)
-* debugger commands, delete: Breakpoint Control. (line 64)
-* debugger commands, disable: Breakpoint Control. (line 69)
-* debugger commands, display: Viewing And Changing Data.
- (line 8)
-* debugger commands, down: Execution Stack. (line 23)
-* debugger commands, dump: Miscellaneous Debugger Commands.
- (line 9)
-* debugger commands, e (enable): Breakpoint Control. (line 73)
-* debugger commands, enable: Breakpoint Control. (line 73)
-* debugger commands, end: Debugger Execution Control.
- (line 10)
-* debugger commands, eval: Viewing And Changing Data.
- (line 23)
-* debugger commands, f (frame): Execution Stack. (line 27)
-* debugger commands, finish: Debugger Execution Control.
- (line 39)
-* debugger commands, frame: Execution Stack. (line 27)
-* debugger commands, h (help): Miscellaneous Debugger Commands.
- (line 69)
-* debugger commands, help: Miscellaneous Debugger Commands.
- (line 69)
-* debugger commands, i (info): Debugger Info. (line 13)
-* debugger commands, ignore: Breakpoint Control. (line 87)
-* debugger commands, info: Debugger Info. (line 13)
-* debugger commands, l (list): Miscellaneous Debugger Commands.
- (line 75)
-* debugger commands, list: Miscellaneous Debugger Commands.
- (line 75)
-* debugger commands, n (next): Debugger Execution Control.
- (line 43)
-* debugger commands, next: Debugger Execution Control.
- (line 43)
-* debugger commands, nexti: Debugger Execution Control.
- (line 49)
-* debugger commands, ni (nexti): Debugger Execution Control.
- (line 49)
-* debugger commands, o (option): Debugger Info. (line 57)
-* debugger commands, option: Debugger Info. (line 57)
-* debugger commands, p (print): Viewing And Changing Data.
- (line 35)
-* debugger commands, print: Viewing And Changing Data.
- (line 35)
-* debugger commands, printf: Viewing And Changing Data.
- (line 53)
-* debugger commands, q (quit): Miscellaneous Debugger Commands.
- (line 102)
-* debugger commands, quit: Miscellaneous Debugger Commands.
- (line 102)
-* debugger commands, r (run): Debugger Execution Control.
- (line 62)
-* debugger commands, return: Debugger Execution Control.
- (line 54)
-* debugger commands, run: Debugger Execution Control.
- (line 62)
-* debugger commands, s (step): Debugger Execution Control.
- (line 68)
-* debugger commands, set: Viewing And Changing Data.
- (line 58)
-* debugger commands, si (stepi): Debugger Execution Control.
- (line 75)
-* debugger commands, silent: Debugger Execution Control.
- (line 10)
-* debugger commands, step: Debugger Execution Control.
- (line 68)
-* debugger commands, stepi: Debugger Execution Control.
- (line 75)
-* debugger commands, t (tbreak): Breakpoint Control. (line 90)
-* debugger commands, tbreak: Breakpoint Control. (line 90)
-* debugger commands, trace: Miscellaneous Debugger Commands.
- (line 110)
-* debugger commands, u (until): Debugger Execution Control.
- (line 82)
-* debugger commands, undisplay: Viewing And Changing Data.
- (line 79)
-* debugger commands, until: Debugger Execution Control.
- (line 82)
-* debugger commands, unwatch: Viewing And Changing Data.
- (line 83)
-* debugger commands, up: Execution Stack. (line 36)
-* debugger commands, w (watch): Viewing And Changing Data.
- (line 66)
-* debugger commands, watch: Viewing And Changing Data.
- (line 66)
-* debugger commands, where (backtrace): Execution Stack. (line 13)
-* debugger default list amount: Debugger Info. (line 69)
-* debugger history file: Debugger Info. (line 81)
-* debugger history size: Debugger Info. (line 65)
-* debugger options: Debugger Info. (line 57)
-* debugger prompt: Debugger Info. (line 78)
-* debugger, how to start: Debugger Invocation. (line 6)
-* debugger, read commands from a file: Debugger Info. (line 97)
-* debugging awk programs: Debugger. (line 6)
-* debugging gawk, bug reports: Bugs. (line 9)
-* decimal point character, locale specific: Options. (line 269)
-* decrement operators: Increment Ops. (line 35)
-* default keyword: Switch Statement. (line 6)
-* Deifik, Scott: Acknowledgments. (line 60)
-* Deifik, Scott <1>: Contributors. (line 54)
-* Deifik, Scott <2>: Maintainers. (line 14)
-* delete ARRAY: Delete. (line 39)
-* delete breakpoint at location: Breakpoint Control. (line 36)
-* delete breakpoint by number: Breakpoint Control. (line 64)
-* delete debugger command: Breakpoint Control. (line 64)
-* delete statement: Delete. (line 6)
-* delete watchpoint: Viewing And Changing Data.
- (line 83)
-* deleting elements in arrays: Delete. (line 6)
-* deleting entire arrays: Delete. (line 39)
-* Demaille, Akim: Acknowledgments. (line 60)
-* describe call stack frame, in debugger: Debugger Info. (line 27)
-* differences between gawk and awk: String Functions. (line 200)
-* differences in awk and gawk, ARGC/ARGV variables: ARGC and ARGV.
- (line 89)
-* differences in awk and gawk, ARGIND variable: Auto-set. (line 44)
-* differences in awk and gawk, array elements, deleting: Delete.
- (line 39)
-* differences in awk and gawk, AWKLIBPATH environment variable: AWKLIBPATH Variable.
- (line 6)
-* differences in awk and gawk, AWKPATH environment variable: AWKPATH Variable.
- (line 6)
-* differences in awk and gawk, BEGIN/END patterns: I/O And BEGIN/END.
- (line 15)
-* differences in awk and gawk, BEGINFILE/ENDFILE patterns: BEGINFILE/ENDFILE.
- (line 6)
-* differences in awk and gawk, BINMODE variable: User-modified.
- (line 15)
-* differences in awk and gawk, BINMODE variable <1>: PC Using.
- (line 16)
-* differences in awk and gawk, close() function: Close Files And Pipes.
- (line 81)
-* differences in awk and gawk, close() function <1>: Close Files And Pipes.
- (line 132)
-* differences in awk and gawk, command-line directories: Command-line directories.
- (line 6)
-* differences in awk and gawk, ERRNO variable: Auto-set. (line 87)
-* differences in awk and gawk, error messages: Special FD. (line 19)
-* differences in awk and gawk, FIELDWIDTHS variable: User-modified.
- (line 37)
-* differences in awk and gawk, FPAT variable: User-modified. (line 43)
-* differences in awk and gawk, FUNCTAB variable: Auto-set. (line 134)
-* differences in awk and gawk, function arguments (gawk): Calling Built-in.
- (line 16)
-* differences in awk and gawk, getline command: Getline. (line 19)
-* differences in awk and gawk, IGNORECASE variable: User-modified.
- (line 76)
-* differences in awk and gawk, implementation limitations: Getline Notes.
- (line 14)
-* differences in awk and gawk, implementation limitations <1>: Redirection.
- (line 129)
-* differences in awk and gawk, indirect function calls: Indirect Calls.
- (line 6)
-* differences in awk and gawk, input/output operators: Getline/Coprocess.
- (line 6)
-* differences in awk and gawk, input/output operators <1>: Redirection.
- (line 96)
-* differences in awk and gawk, line continuations: Conditional Exp.
- (line 34)
-* differences in awk and gawk, LINT variable: User-modified. (line 87)
-* differences in awk and gawk, match() function: String Functions.
- (line 262)
-* differences in awk and gawk, print/printf statements: Format Modifiers.
- (line 13)
-* differences in awk and gawk, PROCINFO array: Auto-set. (line 148)
-* differences in awk and gawk, read timeouts: Read Timeout. (line 6)
-* differences in awk and gawk, record separators: awk split records.
- (line 124)
-* differences in awk and gawk, regexp constants: Using Constant Regexps.
- (line 43)
-* differences in awk and gawk, regular expressions: Case-sensitivity.
- (line 26)
-* differences in awk and gawk, retrying input: Retrying Input.
- (line 6)
-* differences in awk and gawk, RS/RT variables: gawk split records.
- (line 58)
-* differences in awk and gawk, RT variable: Auto-set. (line 295)
-* differences in awk and gawk, single-character fields: Single Character Fields.
- (line 6)
-* differences in awk and gawk, split() function: String Functions.
- (line 348)
-* differences in awk and gawk, strings: Scalar Constants. (line 20)
-* differences in awk and gawk, strings, storing: gawk split records.
- (line 76)
-* differences in awk and gawk, SYMTAB variable: Auto-set. (line 299)
-* differences in awk and gawk, TEXTDOMAIN variable: User-modified.
- (line 152)
-* differences in awk and gawk, trunc-mod operation: Arithmetic Ops.
- (line 66)
-* directories, command-line: Command-line directories.
- (line 6)
-* directories, searching: Programs Exercises. (line 70)
-* directories, searching for loadable extensions: AWKLIBPATH Variable.
- (line 6)
-* directories, searching for source files: AWKPATH Variable. (line 6)
-* disable breakpoint: Breakpoint Control. (line 69)
-* disable debugger command: Breakpoint Control. (line 69)
-* display debugger command: Viewing And Changing Data.
- (line 8)
-* display debugger options: Debugger Info. (line 57)
-* division: Arithmetic Ops. (line 44)
-* do-while statement: Do Statement. (line 6)
-* do-while statement, use of regexps in: Regexp Usage. (line 19)
-* documentation, of awk programs: Library Names. (line 6)
-* documentation, online: Manual History. (line 11)
-* documents, searching: Dupword Program. (line 6)
-* dollar sign ($), $ field operator: Fields. (line 19)
-* dollar sign ($), $ field operator <1>: Precedence. (line 42)
-* dollar sign ($), incrementing fields and arrays: Increment Ops.
- (line 30)
-* dollar sign ($), regexp operator: Regexp Operators. (line 35)
-* double quote ("), in regexp constants: Computed Regexps. (line 30)
-* double quote ("), in shell commands: Quoting. (line 54)
-* down debugger command: Execution Stack. (line 23)
-* Drepper, Ulrich: Acknowledgments. (line 52)
-* Duman, Patrice: Acknowledgments. (line 75)
-* dump all variables of a program: Options. (line 94)
-* dump debugger command: Miscellaneous Debugger Commands.
- (line 9)
-* dupword.awk program: Dupword Program. (line 31)
-* dynamic profiling: Profiling. (line 177)
-* dynamically loaded extensions: Dynamic Extensions. (line 6)
-* e debugger command (alias for enable): Breakpoint Control. (line 73)
-* EBCDIC: Ordinal Functions. (line 45)
-* effective group ID of gawk user: Auto-set. (line 153)
-* effective user ID of gawk user: Auto-set. (line 161)
-* egrep utility: Bracket Expressions. (line 34)
-* egrep utility <1>: Egrep Program. (line 6)
-* egrep.awk program: Egrep Program. (line 53)
-* elements in arrays, assigning values: Assigning Elements. (line 6)
-* elements in arrays, deleting: Delete. (line 6)
-* elements in arrays, order of access by in operator: Scanning an Array.
- (line 48)
-* elements in arrays, scanning: Scanning an Array. (line 6)
-* elements of arrays: Reference to Elements.
- (line 6)
-* email address for bug reports, bug-gawk@gnu.org: Bug address.
- (line 22)
-* empty array elements: Reference to Elements.
- (line 18)
-* empty pattern: Empty. (line 6)
-* empty strings: awk split records. (line 114)
-* empty strings, See null strings: Regexp Field Splitting.
- (line 43)
-* EMRED: TCP/IP Networking. (line 6)
-* enable breakpoint: Breakpoint Control. (line 73)
-* enable debugger command: Breakpoint Control. (line 73)
-* end debugger command: Debugger Execution Control.
- (line 10)
-* END pattern: BEGIN/END. (line 6)
-* END pattern <1>: Using BEGIN/END. (line 6)
-* END pattern, and profiling: Profiling. (line 62)
-* END pattern, assert() user-defined function and: Assert Function.
- (line 75)
-* END pattern, Boolean patterns and: Expression Patterns. (line 70)
-* END pattern, exit statement and: Exit Statement. (line 12)
-* END pattern, next/nextfile statements and: I/O And BEGIN/END.
- (line 36)
-* END pattern, next/nextfile statements and <1>: Next Statement.
- (line 44)
-* END pattern, operators and: Using BEGIN/END. (line 17)
-* END pattern, print statement and: I/O And BEGIN/END. (line 15)
-* ENDFILE pattern: BEGINFILE/ENDFILE. (line 6)
-* ENDFILE pattern, Boolean patterns and: Expression Patterns. (line 70)
-* endfile() user-defined function: Filetrans Function. (line 62)
-* endgrent() function (C library): Group Functions. (line 213)
-* endgrent() user-defined function: Group Functions. (line 216)
-* endpwent() function (C library): Passwd Functions. (line 208)
-* endpwent() user-defined function: Passwd Functions. (line 211)
-* English, Steve: Advanced Features. (line 6)
-* ENVIRON array: Auto-set. (line 59)
-* environment variables used by gawk: Environment Variables.
- (line 6)
-* environment variables, in ENVIRON array: Auto-set. (line 59)
-* epoch, definition of: Glossary. (line 312)
-* equals sign (=), = operator: Assignment Ops. (line 6)
-* equals sign (=), == operator: Comparison Operators.
- (line 11)
-* equals sign (=), == operator <1>: Precedence. (line 64)
-* EREs (Extended Regular Expressions): Bracket Expressions. (line 34)
-* ERRNO variable: Auto-set. (line 87)
-* ERRNO variable <1>: TCP/IP Networking. (line 54)
-* ERRNO variable, with BEGINFILE pattern: BEGINFILE/ENDFILE. (line 26)
-* ERRNO variable, with close() function: Close Files And Pipes.
- (line 140)
-* ERRNO variable, with getline command: Getline. (line 19)
-* error handling: Special FD. (line 19)
-* error handling, ERRNO variable and: Auto-set. (line 87)
-* error output: Special FD. (line 6)
-* escape processing, gsub()/gensub()/sub() functions: Gory Details.
- (line 6)
-* escape sequences, in strings: Escape Sequences. (line 6)
-* eval debugger command: Viewing And Changing Data.
- (line 23)
-* evaluate expressions, in debugger: Viewing And Changing Data.
- (line 23)
-* evaluation order: Increment Ops. (line 60)
-* evaluation order, concatenation: Concatenation. (line 41)
-* evaluation order, functions: Calling Built-in. (line 30)
-* examining fields: Fields. (line 6)
-* exclamation point (!), ! operator: Boolean Ops. (line 69)
-* exclamation point (!), ! operator <1>: Precedence. (line 51)
-* exclamation point (!), ! operator <2>: Egrep Program. (line 174)
-* exclamation point (!), != operator: Comparison Operators.
- (line 11)
-* exclamation point (!), != operator <1>: Precedence. (line 64)
-* exclamation point (!), !~ operator: Regexp Usage. (line 19)
-* exclamation point (!), !~ operator <1>: Computed Regexps. (line 6)
-* exclamation point (!), !~ operator <2>: Case-sensitivity. (line 26)
-* exclamation point (!), !~ operator <3>: Regexp Constants. (line 6)
-* exclamation point (!), !~ operator <4>: Comparison Operators.
- (line 11)
-* exclamation point (!), !~ operator <5>: Comparison Operators.
- (line 98)
-* exclamation point (!), !~ operator <6>: Precedence. (line 79)
-* exclamation point (!), !~ operator <7>: Expression Patterns.
- (line 24)
-* exit debugger command: Miscellaneous Debugger Commands.
- (line 66)
-* exit statement: Exit Statement. (line 6)
-* exit status, of gawk: Exit Status. (line 6)
-* exit status, of VMS: VMS Running. (line 28)
-* exit the debugger: Miscellaneous Debugger Commands.
- (line 66)
-* exit the debugger <1>: Miscellaneous Debugger Commands.
- (line 102)
-* exp: Numeric Functions. (line 19)
-* expand utility: Very Simple. (line 73)
-* Expat XML parser library: gawkextlib. (line 37)
-* exponent: Numeric Functions. (line 19)
-* expressions: Expressions. (line 6)
-* expressions, as patterns: Expression Patterns. (line 6)
-* expressions, assignment: Assignment Ops. (line 6)
-* expressions, Boolean: Boolean Ops. (line 6)
-* expressions, comparison: Typing and Comparison.
- (line 9)
-* expressions, conditional: Conditional Exp. (line 6)
-* expressions, matching, See comparison expressions: Typing and Comparison.
- (line 9)
-* expressions, selecting: Conditional Exp. (line 6)
-* Extended Regular Expressions (EREs): Bracket Expressions. (line 34)
-* extension API: Extension API Description.
- (line 6)
-* extension API informational variables: Extension API Informational Variables.
- (line 6)
-* extension API version: Extension Versioning.
- (line 6)
-* extension API, version number: Auto-set. (line 246)
-* extension example: Extension Example. (line 6)
-* extension registration: Registration Functions.
- (line 6)
-* extension search path: Finding Extensions. (line 6)
-* extensions distributed with gawk: Extension Samples. (line 6)
-* extensions, allocating memory: Memory Allocation Functions.
- (line 6)
-* extensions, Brian Kernighan's awk: BTL. (line 6)
-* extensions, Brian Kernighan's awk <1>: Common Extensions. (line 6)
-* extensions, common, ** operator: Arithmetic Ops. (line 30)
-* extensions, common, **= operator: Assignment Ops. (line 138)
-* extensions, common, /dev/stderr special file: Special FD. (line 48)
-* extensions, common, /dev/stdin special file: Special FD. (line 48)
-* extensions, common, /dev/stdout special file: Special FD. (line 48)
-* extensions, common, BINMODE variable: PC Using. (line 16)
-* extensions, common, delete to delete entire arrays: Delete. (line 39)
-* extensions, common, fflush() function: I/O Functions. (line 43)
-* extensions, common, func keyword: Definition Syntax. (line 99)
-* extensions, common, length() applied to an array: String Functions.
- (line 200)
-* extensions, common, RS as a regexp: gawk split records. (line 6)
-* extensions, common, single character fields: Single Character Fields.
- (line 6)
-* extensions, common, \x escape sequence: Escape Sequences. (line 61)
-* extensions, in gawk, not in POSIX awk: POSIX/GNU. (line 6)
-* extensions, loading, @load directive: Loading Shared Libraries.
- (line 8)
-* extensions, mawk: Common Extensions. (line 6)
-* extensions, where to find: gawkextlib. (line 6)
-* extract.awk program: Extract Program. (line 79)
-* extraction, of marked strings (internationalization): String Extraction.
- (line 6)
-* f debugger command (alias for frame): Execution Stack. (line 27)
-* false, logical: Truth Values. (line 6)
-* FDL (Free Documentation License): GNU Free Documentation License.
- (line 8)
-* features, adding to gawk: Adding Code. (line 6)
-* features, deprecated: Obsolete. (line 6)
-* features, undocumented: Undocumented. (line 6)
-* Fenlason, Jay: History. (line 30)
-* Fenlason, Jay <1>: Contributors. (line 19)
-* fflush: I/O Functions. (line 28)
-* field numbers: Nonconstant Fields. (line 6)
-* field operator $: Fields. (line 19)
-* field operators, dollar sign as: Fields. (line 19)
-* field separator, in multiline records: Multiple Line. (line 41)
-* field separator, on command line: Command Line Field Separator.
- (line 6)
-* field separator, POSIX and: Full Line Fields. (line 16)
-* field separators: Field Separators. (line 15)
-* field separators <1>: User-modified. (line 50)
-* field separators <2>: User-modified. (line 113)
-* field separators, choice of: Field Separators. (line 50)
-* field separators, FIELDWIDTHS variable and: User-modified. (line 37)
-* field separators, FPAT variable and: User-modified. (line 43)
-* field separators, regular expressions as: Field Separators. (line 50)
-* field separators, regular expressions as <1>: Regexp Field Splitting.
- (line 6)
-* field separators, See Also OFS: Changing Fields. (line 64)
-* field separators, spaces as: Cut Program. (line 103)
-* fields: Reading Files. (line 14)
-* fields <1>: Fields. (line 6)
-* fields <2>: Basic High Level. (line 62)
-* fields, adding: Changing Fields. (line 53)
-* fields, changing contents of: Changing Fields. (line 6)
-* fields, cutting: Cut Program. (line 6)
-* fields, examining: Fields. (line 6)
-* fields, number of: Fields. (line 33)
-* fields, numbers: Nonconstant Fields. (line 6)
-* fields, printing: Print Examples. (line 20)
-* fields, separating: Field Separators. (line 15)
-* fields, separating <1>: Field Separators. (line 15)
-* fields, single-character: Single Character Fields.
- (line 6)
-* FIELDWIDTHS variable: Constant Size. (line 22)
-* FIELDWIDTHS variable <1>: User-modified. (line 37)
-* file descriptors: Special FD. (line 6)
-* file inclusion, @include directive: Include Files. (line 8)
-* file names, distinguishing: Auto-set. (line 55)
-* file names, in compatibility mode: Special Caveats. (line 9)
-* file names, standard streams in gawk: Special FD. (line 48)
-* FILENAME variable: Reading Files. (line 6)
-* FILENAME variable <1>: Auto-set. (line 108)
-* FILENAME variable, getline, setting with: Getline Notes. (line 19)
-* filenames, assignments as: Ignoring Assigns. (line 6)
-* files, .gmo: Explaining gettext. (line 42)
-* files, .gmo, specifying directory of: Explaining gettext. (line 54)
-* files, .gmo, specifying directory of <1>: Programmer i18n. (line 48)
-* files, .mo, converting from .po: I18N Example. (line 66)
-* files, .po: Explaining gettext. (line 37)
-* files, .po <1>: Translator i18n. (line 6)
-* files, .po, converting to .mo: I18N Example. (line 66)
-* files, .pot: Explaining gettext. (line 31)
-* files, /dev/... special files: Special FD. (line 48)
-* files, /inet/... (gawk): TCP/IP Networking. (line 6)
-* files, /inet4/... (gawk): TCP/IP Networking. (line 6)
-* files, /inet6/... (gawk): TCP/IP Networking. (line 6)
-* files, awk programs in: Long. (line 6)
-* files, awkprof.out: Profiling. (line 6)
-* files, awkvars.out: Options. (line 94)
-* files, closing: I/O Functions. (line 10)
-* files, descriptors, See file descriptors: Special FD. (line 6)
-* files, group: Group Functions. (line 6)
-* files, initialization and cleanup: Filetrans Function. (line 6)
-* files, input, See input files: Read Terminal. (line 16)
-* files, log, timestamps in: Time Functions. (line 6)
-* files, managing: Data File Management.
- (line 6)
-* files, managing, data file boundaries: Filetrans Function. (line 6)
-* files, message object: Explaining gettext. (line 42)
-* files, message object, converting from portable object files: I18N Example.
- (line 66)
-* files, message object, specifying directory of: Explaining gettext.
- (line 54)
-* files, message object, specifying directory of <1>: Programmer i18n.
- (line 48)
-* files, multiple passes over: Other Arguments. (line 56)
-* files, multiple, duplicating output into: Tee Program. (line 6)
-* files, output, See output files: Close Files And Pipes.
- (line 6)
-* files, password: Passwd Functions. (line 16)
-* files, portable object: Explaining gettext. (line 37)
-* files, portable object <1>: Translator i18n. (line 6)
-* files, portable object template: Explaining gettext. (line 31)
-* files, portable object, converting to message object files: I18N Example.
- (line 66)
-* files, portable object, generating: Options. (line 147)
-* files, processing, ARGIND variable and: Auto-set. (line 50)
-* files, reading: Rewind Function. (line 6)
-* files, reading, multiline records: Multiple Line. (line 6)
-* files, searching for regular expressions: Egrep Program. (line 6)
-* files, skipping: File Checking. (line 6)
-* files, source, search path for: Programs Exercises. (line 70)
-* files, splitting: Split Program. (line 6)
-* files, Texinfo, extracting programs from: Extract Program. (line 6)
-* find substring in string: String Functions. (line 155)
-* finding extensions: Finding Extensions. (line 6)
-* finish debugger command: Debugger Execution Control.
- (line 39)
-* Fish, Fred: Contributors. (line 51)
-* fixed-width data: Constant Size. (line 6)
-* flag variables: Boolean Ops. (line 69)
-* flag variables <1>: Tee Program. (line 20)
-* floating-point, numbers, arbitrary precision: Arbitrary Precision Arithmetic.
- (line 6)
-* floating-point, VAX/VMS: VMS Running. (line 50)
-* flush buffered output: I/O Functions. (line 28)
-* fnmatch() extension function: Extension Sample Fnmatch.
- (line 12)
-* FNR variable: Records. (line 6)
-* FNR variable <1>: Auto-set. (line 118)
-* FNR variable, changing: Auto-set. (line 357)
-* for statement: For Statement. (line 6)
-* for statement, looping over arrays: Scanning an Array. (line 20)
-* fork() extension function: Extension Sample Fork.
- (line 11)
-* format specifiers: Basic Printf. (line 15)
-* format specifiers, mixing regular with positional specifiers: Printf Ordering.
- (line 57)
-* format specifiers, printf statement: Control Letters. (line 6)
-* format specifiers, strftime() function (gawk): Time Functions.
- (line 89)
-* format time string: Time Functions. (line 48)
-* formats, numeric output: OFMT. (line 6)
-* formatting output: Printf. (line 6)
-* formatting strings: String Functions. (line 384)
-* forward slash (/) to enclose regular expressions: Regexp. (line 10)
-* forward slash (/), / operator: Precedence. (line 54)
-* forward slash (/), /= operator: Assignment Ops. (line 129)
-* forward slash (/), /= operator <1>: Precedence. (line 94)
-* forward slash (/), /= operator, vs. /=.../ regexp constant: Assignment Ops.
- (line 149)
-* forward slash (/), patterns and: Expression Patterns. (line 24)
-* FPAT variable: Splitting By Content.
- (line 25)
-* FPAT variable <1>: User-modified. (line 43)
-* frame debugger command: Execution Stack. (line 27)
-* Free Documentation License (FDL): GNU Free Documentation License.
- (line 8)
-* Free Software Foundation (FSF): Manual History. (line 6)
-* Free Software Foundation (FSF) <1>: Getting. (line 10)
-* Free Software Foundation (FSF) <2>: Glossary. (line 372)
-* Free Software Foundation (FSF) <3>: Glossary. (line 405)
-* FreeBSD: Glossary. (line 748)
-* FS variable: Field Separators. (line 15)
-* FS variable <1>: User-modified. (line 50)
-* FS variable, --field-separator option and: Options. (line 21)
-* FS variable, as null string: Single Character Fields.
- (line 20)
-* FS variable, as TAB character: Options. (line 266)
-* FS variable, changing value of: Field Separators. (line 34)
-* FS variable, running awk programs and: Cut Program. (line 63)
-* FS variable, setting from command line: Command Line Field Separator.
- (line 6)
-* FS, containing ^: Regexp Field Splitting.
- (line 59)
-* FS, in multiline records: Multiple Line. (line 41)
-* FSF (Free Software Foundation): Manual History. (line 6)
-* FSF (Free Software Foundation) <1>: Getting. (line 10)
-* FSF (Free Software Foundation) <2>: Glossary. (line 372)
-* FSF (Free Software Foundation) <3>: Glossary. (line 405)
-* fts() extension function: Extension Sample File Functions.
- (line 60)
-* FUNCTAB array: Auto-set. (line 134)
-* function calls: Function Calls. (line 6)
-* function calls, indirect: Indirect Calls. (line 6)
-* function calls, indirect, @-notation for: Indirect Calls. (line 47)
-* function definition example: Function Example. (line 6)
-* function pointers: Indirect Calls. (line 6)
-* functions, arrays as parameters to: Pass By Value/Reference.
- (line 44)
-* functions, built-in: Function Calls. (line 10)
-* functions, built-in <1>: Functions. (line 6)
-* functions, built-in, evaluation order: Calling Built-in. (line 30)
-* functions, defining: Definition Syntax. (line 10)
-* functions, library: Library Functions. (line 6)
-* functions, library, assertions: Assert Function. (line 6)
-* functions, library, associative arrays and: Library Names. (line 58)
-* functions, library, C library: Getopt Function. (line 6)
-* functions, library, character values as numbers: Ordinal Functions.
- (line 6)
-* functions, library, Cliff random numbers: Cliff Random Function.
- (line 6)
-* functions, library, command-line options: Getopt Function. (line 6)
-* functions, library, example program for using: Igawk Program.
- (line 6)
-* functions, library, group database, reading: Group Functions.
- (line 6)
-* functions, library, managing data files: Data File Management.
- (line 6)
-* functions, library, managing time: Getlocaltime Function.
- (line 6)
-* functions, library, merging arrays into strings: Join Function.
- (line 6)
-* functions, library, rounding numbers: Round Function. (line 6)
-* functions, library, user database, reading: Passwd Functions.
- (line 6)
-* functions, names of: Definition Syntax. (line 24)
-* functions, recursive: Definition Syntax. (line 89)
-* functions, string-translation: I18N Functions. (line 6)
-* functions, undefined: Pass By Value/Reference.
- (line 68)
-* functions, user-defined: User-defined. (line 6)
-* functions, user-defined, calling: Function Caveats. (line 6)
-* functions, user-defined, counts, in a profile: Profiling. (line 137)
-* functions, user-defined, library of: Library Functions. (line 6)
-* functions, user-defined, next/nextfile statements and: Next Statement.
- (line 44)
-* functions, user-defined, next/nextfile statements and <1>: Nextfile Statement.
- (line 47)
-* G-d: Acknowledgments. (line 94)
-* G., Daniel Richard: Acknowledgments. (line 60)
-* G., Daniel Richard <1>: Maintainers. (line 14)
-* Garfinkle, Scott: Contributors. (line 35)
-* gawk program, dynamic profiling: Profiling. (line 177)
-* gawk version: Auto-set. (line 221)
-* gawk, ARGIND variable in: Other Arguments. (line 15)
-* gawk, awk and: Preface. (line 21)
-* gawk, awk and <1>: This Manual. (line 14)
-* gawk, bitwise operations in: Bitwise Functions. (line 40)
-* gawk, break statement in: Break Statement. (line 51)
-* gawk, character classes and: Bracket Expressions. (line 108)
-* gawk, coding style in: Adding Code. (line 37)
-* gawk, command-line options, and regular expressions: GNU Regexp Operators.
- (line 73)
-* gawk, configuring: Configuration Philosophy.
- (line 6)
-* gawk, configuring, options: Additional Configuration Options.
- (line 6)
-* gawk, continue statement in: Continue Statement. (line 44)
-* gawk, distribution: Distribution contents.
- (line 6)
-* gawk, ERRNO variable in: Getline. (line 19)
-* gawk, ERRNO variable in <1>: Close Files And Pipes.
- (line 140)
-* gawk, ERRNO variable in <2>: BEGINFILE/ENDFILE. (line 26)
-* gawk, ERRNO variable in <3>: Auto-set. (line 87)
-* gawk, ERRNO variable in <4>: TCP/IP Networking. (line 54)
-* gawk, escape sequences: Escape Sequences. (line 121)
-* gawk, extensions, disabling: Options. (line 257)
-* gawk, features, adding: Adding Code. (line 6)
-* gawk, features, advanced: Advanced Features. (line 6)
-* gawk, field separators and: User-modified. (line 71)
-* gawk, FIELDWIDTHS variable in: Constant Size. (line 22)
-* gawk, FIELDWIDTHS variable in <1>: User-modified. (line 37)
-* gawk, file names in: Special Files. (line 6)
-* gawk, format-control characters: Control Letters. (line 18)
-* gawk, format-control characters <1>: Control Letters. (line 93)
-* gawk, FPAT variable in: Splitting By Content.
- (line 25)
-* gawk, FPAT variable in <1>: User-modified. (line 43)
-* gawk, FUNCTAB array in: Auto-set. (line 134)
-* gawk, function arguments and: Calling Built-in. (line 16)
-* gawk, hexadecimal numbers and: Nondecimal-numbers. (line 41)
-* gawk, IGNORECASE variable in: Case-sensitivity. (line 26)
-* gawk, IGNORECASE variable in <1>: User-modified. (line 76)
-* gawk, IGNORECASE variable in <2>: Array Intro. (line 100)
-* gawk, IGNORECASE variable in <3>: String Functions. (line 58)
-* gawk, IGNORECASE variable in <4>: Array Sorting Functions.
- (line 83)
-* gawk, implementation issues: Notes. (line 6)
-* gawk, implementation issues, debugging: Compatibility Mode. (line 6)
-* gawk, implementation issues, downward compatibility: Compatibility Mode.
- (line 6)
-* gawk, implementation issues, limits: Getline Notes. (line 14)
-* gawk, implementation issues, pipes: Redirection. (line 129)
-* gawk, installing: Installation. (line 6)
-* gawk, internationalization and, See internationalization: Internationalization.
- (line 13)
-* gawk, interpreter, adding code to: Using Internal File Ops.
- (line 6)
-* gawk, interval expressions and: Regexp Operators. (line 139)
-* gawk, line continuation in: Conditional Exp. (line 34)
-* gawk, LINT variable in: User-modified. (line 87)
-* gawk, list of contributors to: Contributors. (line 6)
-* gawk, MS-Windows version of: PC Using. (line 9)
-* gawk, newlines in: Statements/Lines. (line 12)
-* gawk, octal numbers and: Nondecimal-numbers. (line 41)
-* gawk, predefined variables and: Built-in Variables. (line 14)
-* gawk, PROCINFO array in: Auto-set. (line 148)
-* gawk, PROCINFO array in <1>: Time Functions. (line 47)
-* gawk, PROCINFO array in <2>: Two-way I/O. (line 114)
-* gawk, regexp constants and: Using Constant Regexps.
- (line 28)
-* gawk, regular expressions, case sensitivity: Case-sensitivity.
- (line 26)
-* gawk, regular expressions, operators: GNU Regexp Operators.
- (line 6)
-* gawk, regular expressions, precedence: Regexp Operators. (line 161)
-* gawk, RT variable in: awk split records. (line 124)
-* gawk, RT variable in <1>: Multiple Line. (line 130)
-* gawk, RT variable in <2>: Auto-set. (line 295)
-* gawk, See Also awk: Preface. (line 34)
-* gawk, source code, obtaining: Getting. (line 6)
-* gawk, splitting fields and: Constant Size. (line 86)
-* gawk, string-translation functions: I18N Functions. (line 6)
-* gawk, SYMTAB array in: Auto-set. (line 299)
-* gawk, TEXTDOMAIN variable in: User-modified. (line 152)
-* gawk, timestamps: Time Functions. (line 6)
-* gawk, uses for: Preface. (line 34)
-* gawk, versions of, information about, printing: Options. (line 304)
-* gawk, VMS version of: VMS Installation. (line 6)
-* gawk, word-boundary operator: GNU Regexp Operators.
- (line 66)
-* gawkextlib: gawkextlib. (line 6)
-* gawkextlib project: gawkextlib. (line 6)
-* gawklibpath_append shell function: Shell Startup Files. (line 29)
-* gawklibpath_default shell function: Shell Startup Files. (line 22)
-* gawklibpath_prepend shell function: Shell Startup Files. (line 25)
-* gawkpath_append shell function: Shell Startup Files. (line 19)
-* gawkpath_default shell function: Shell Startup Files. (line 12)
-* gawkpath_prepend shell function: Shell Startup Files. (line 15)
-* General Public License (GPL): Glossary. (line 396)
-* General Public License, See GPL: Manual History. (line 11)
-* generate time values: Time Functions. (line 25)
-* gensub: Using Constant Regexps.
- (line 43)
-* gensub <1>: String Functions. (line 89)
-* gensub() function (gawk), escape processing: Gory Details. (line 6)
-* getaddrinfo() function (C library): TCP/IP Networking. (line 39)
-* getgrent() function (C library): Group Functions. (line 6)
-* getgrent() function (C library) <1>: Group Functions. (line 202)
-* getgrent() user-defined function: Group Functions. (line 6)
-* getgrent() user-defined function <1>: Group Functions. (line 205)
-* getgrgid() function (C library): Group Functions. (line 184)
-* getgrgid() user-defined function: Group Functions. (line 187)
-* getgrnam() function (C library): Group Functions. (line 173)
-* getgrnam() user-defined function: Group Functions. (line 178)
-* getgruser() function (C library): Group Functions. (line 193)
-* getgruser() function, user-defined: Group Functions. (line 196)
-* getline command: Reading Files. (line 20)
-* getline command, coprocesses, using from: Getline/Coprocess.
- (line 6)
-* getline command, coprocesses, using from <1>: Close Files And Pipes.
- (line 6)
-* getline command, deadlock and: Two-way I/O. (line 53)
-* getline command, explicit input with: Getline. (line 6)
-* getline command, FILENAME variable and: Getline Notes. (line 19)
-* getline command, return values: Getline. (line 19)
-* getline command, variants: Getline Summary. (line 6)
-* getline command, _gr_init() user-defined function: Group Functions.
- (line 83)
-* getline command, _pw_init() function: Passwd Functions. (line 154)
-* getline from a file: Getline/File. (line 6)
-* getline into a variable: Getline/Variable. (line 6)
-* getline statement, BEGINFILE/ENDFILE patterns and: BEGINFILE/ENDFILE.
- (line 53)
-* getlocaltime() user-defined function: Getlocaltime Function.
- (line 16)
-* getopt() function (C library): Getopt Function. (line 15)
-* getopt() user-defined function: Getopt Function. (line 108)
-* getopt() user-defined function <1>: Getopt Function. (line 134)
-* getpwent() function (C library): Passwd Functions. (line 16)
-* getpwent() function (C library) <1>: Passwd Functions. (line 196)
-* getpwent() user-defined function: Passwd Functions. (line 16)
-* getpwent() user-defined function <1>: Passwd Functions. (line 200)
-* getpwnam() function (C library): Passwd Functions. (line 175)
-* getpwnam() user-defined function: Passwd Functions. (line 180)
-* getpwuid() function (C library): Passwd Functions. (line 186)
-* getpwuid() user-defined function: Passwd Functions. (line 190)
-* gettext library: Explaining gettext. (line 6)
-* gettext library, locale categories: Explaining gettext. (line 81)
-* gettext() function (C library): Explaining gettext. (line 63)
-* gettimeofday() extension function: Extension Sample Time.
- (line 12)
-* git utility: gawkextlib. (line 31)
-* git utility <1>: Other Versions. (line 29)
-* git utility <2>: Accessing The Source.
- (line 10)
-* git utility <3>: Adding Code. (line 112)
-* Git, use of for gawk source code: Derived Files. (line 6)
-* GNITS mailing list: Acknowledgments. (line 52)
-* GNU awk, See gawk: Preface. (line 51)
-* GNU Free Documentation License: GNU Free Documentation License.
- (line 8)
-* GNU General Public License: Glossary. (line 396)
-* GNU Lesser General Public License: Glossary. (line 491)
-* GNU long options: Command Line. (line 13)
-* GNU long options <1>: Options. (line 6)
-* GNU long options, printing list of: Options. (line 154)
-* GNU Project: Manual History. (line 11)
-* GNU Project <1>: Glossary. (line 405)
-* GNU/Linux: Manual History. (line 28)
-* GNU/Linux <1>: I18N Example. (line 57)
-* GNU/Linux <2>: Glossary. (line 748)
-* Gordon, Assaf: Contributors. (line 106)
-* GPL (General Public License): Manual History. (line 11)
-* GPL (General Public License) <1>: Glossary. (line 396)
-* GPL (General Public License), printing: Options. (line 89)
-* grcat program: Group Functions. (line 16)
-* Grigera, Juan: Contributors. (line 58)
-* group database, reading: Group Functions. (line 6)
-* group file: Group Functions. (line 6)
-* group ID of gawk user: Auto-set. (line 170)
-* groups, information about: Group Functions. (line 6)
-* gsub: Using Constant Regexps.
- (line 43)
-* gsub <1>: String Functions. (line 139)
-* gsub() function, arguments of: String Functions. (line 463)
-* gsub() function, escape processing: Gory Details. (line 6)
-* h debugger command (alias for help): Miscellaneous Debugger Commands.
- (line 69)
-* Hankerson, Darrel: Acknowledgments. (line 60)
-* Hankerson, Darrel <1>: Contributors. (line 61)
-* Haque, John: Contributors. (line 109)
-* Hartholz, Elaine: Acknowledgments. (line 38)
-* Hartholz, Marshall: Acknowledgments. (line 38)
-* Hasegawa, Isamu: Contributors. (line 95)
-* help debugger command: Miscellaneous Debugger Commands.
- (line 69)
-* hexadecimal numbers: Nondecimal-numbers. (line 6)
-* hexadecimal values, enabling interpretation of: Options. (line 209)
-* history expansion, in debugger: Readline Support. (line 6)
-* histsort.awk program: History Sorting. (line 25)
-* Hughes, Phil: Acknowledgments. (line 43)
-* HUP signal, for dynamic profiling: Profiling. (line 209)
-* hyphen (-), - operator: Precedence. (line 51)
-* hyphen (-), - operator <1>: Precedence. (line 57)
-* hyphen (-), -- operator: Increment Ops. (line 48)
-* hyphen (-), -- operator <1>: Precedence. (line 45)
-* hyphen (-), -= operator: Assignment Ops. (line 129)
-* hyphen (-), -= operator <1>: Precedence. (line 94)
-* hyphen (-), filenames beginning with: Options. (line 60)
-* hyphen (-), in bracket expressions: Bracket Expressions. (line 25)
-* i debugger command (alias for info): Debugger Info. (line 13)
-* id utility: Id Program. (line 6)
-* id.awk program: Id Program. (line 31)
-* if statement: If Statement. (line 6)
-* if statement, actions, changing: Ranges. (line 25)
-* if statement, use of regexps in: Regexp Usage. (line 19)
-* igawk.sh program: Igawk Program. (line 124)
-* ignore breakpoint: Breakpoint Control. (line 87)
-* ignore debugger command: Breakpoint Control. (line 87)
-* IGNORECASE variable: User-modified. (line 76)
-* IGNORECASE variable, and array indices: Array Intro. (line 100)
-* IGNORECASE variable, and array sorting functions: Array Sorting Functions.
- (line 83)
-* IGNORECASE variable, in example programs: Library Functions.
- (line 53)
-* IGNORECASE variable, with ~ and !~ operators: Case-sensitivity.
- (line 26)
-* Illumos: Other Versions. (line 109)
-* Illumos, POSIX-compliant awk: Other Versions. (line 109)
-* implementation issues, gawk: Notes. (line 6)
-* implementation issues, gawk, debugging: Compatibility Mode. (line 6)
-* implementation issues, gawk, limits: Getline Notes. (line 14)
-* implementation issues, gawk, limits <1>: Redirection. (line 129)
-* in operator: Comparison Operators.
- (line 11)
-* in operator <1>: Precedence. (line 82)
-* in operator <2>: For Statement. (line 75)
-* in operator, index existence in multidimensional arrays: Multidimensional.
- (line 41)
-* in operator, order of array access: Scanning an Array. (line 48)
-* in operator, testing if array element exists: Reference to Elements.
- (line 38)
-* in operator, use in loops: Scanning an Array. (line 17)
-* including files, @include directive: Include Files. (line 8)
-* increment operators: Increment Ops. (line 6)
-* index: String Functions. (line 155)
-* indexing arrays: Array Intro. (line 48)
-* indirect function calls: Indirect Calls. (line 6)
-* indirect function calls, @-notation: Indirect Calls. (line 47)
-* infinite precision: Arbitrary Precision Arithmetic.
- (line 6)
-* info debugger command: Debugger Info. (line 13)
-* initialization, automatic: More Complex. (line 39)
-* inplace extension: Extension Sample Inplace.
- (line 6)
-* input files: Reading Files. (line 6)
-* input files, closing: Close Files And Pipes.
- (line 6)
-* input files, counting elements in: Wc Program. (line 6)
-* input files, examples: Sample Data Files. (line 6)
-* input files, reading: Reading Files. (line 6)
-* input files, running awk without: Read Terminal. (line 6)
-* input files, running awk without <1>: Read Terminal. (line 16)
-* input files, variable assignments and: Other Arguments. (line 26)
-* input pipeline: Getline/Pipe. (line 10)
-* input record, length of: String Functions. (line 177)
-* input redirection: Getline/File. (line 6)
-* input, data, nondecimal: Nondecimal Data. (line 6)
-* input, explicit: Getline. (line 6)
-* input, files, See input files: Multiple Line. (line 6)
-* input, multiline records: Multiple Line. (line 6)
-* input, splitting into records: Records. (line 6)
-* input, standard: Read Terminal. (line 6)
-* input, standard <1>: Special FD. (line 6)
-* input/output functions: I/O Functions. (line 6)
-* input/output, binary: User-modified. (line 15)
-* input/output, from BEGIN and END: I/O And BEGIN/END. (line 6)
-* input/output, two-way: Two-way I/O. (line 27)
-* insomnia, cure for: Alarm Program. (line 6)
-* installation, VMS: VMS Installation. (line 6)
-* installing gawk: Installation. (line 6)
-* instruction tracing, in debugger: Debugger Info. (line 90)
-* int: Numeric Functions. (line 24)
-* INT signal (MS-Windows): Profiling. (line 212)
-* intdiv: Numeric Functions. (line 29)
-* intdiv <1>: Numeric Functions. (line 29)
-* integer array indices: Numeric Array Subscripts.
- (line 31)
-* integers, arbitrary precision: Arbitrary Precision Integers.
- (line 6)
-* integers, unsigned: Computer Arithmetic. (line 41)
-* interacting with other programs: I/O Functions. (line 107)
-* internationalization: I18N Functions. (line 6)
-* internationalization <1>: I18N and L10N. (line 6)
-* internationalization, localization: User-modified. (line 152)
-* internationalization, localization <1>: Internationalization.
- (line 13)
-* internationalization, localization, character classes: Bracket Expressions.
- (line 108)
-* internationalization, localization, gawk and: Internationalization.
- (line 13)
-* internationalization, localization, locale categories: Explaining gettext.
- (line 81)
-* internationalization, localization, marked strings: Programmer i18n.
- (line 13)
-* internationalization, localization, portability and: I18N Portability.
- (line 6)
-* internationalizing a program: Explaining gettext. (line 6)
-* interpreted programs: Basic High Level. (line 13)
-* interpreted programs <1>: Glossary. (line 445)
-* interval expressions, regexp operator: Regexp Operators. (line 116)
-* inventory-shipped file: Sample Data Files. (line 32)
-* invoke shell command: I/O Functions. (line 107)
-* isarray: Type Functions. (line 11)
-* ISO: Glossary. (line 456)
-* ISO 8859-1: Glossary. (line 196)
-* ISO Latin-1: Glossary. (line 196)
-* Jacobs, Andrew: Passwd Functions. (line 90)
-* Jaegermann, Michal: Acknowledgments. (line 60)
-* Jaegermann, Michal <1>: Contributors. (line 46)
-* Java implementation of awk: Other Versions. (line 117)
-* Java programming language: Glossary. (line 468)
-* jawk: Other Versions. (line 117)
-* Jedi knights: Undocumented. (line 6)
-* Johansen, Chris: Signature Program. (line 25)
-* join() user-defined function: Join Function. (line 18)
-* Kahrs, Ju"rgen: Acknowledgments. (line 60)
-* Kahrs, Ju"rgen <1>: Contributors. (line 71)
-* Kasal, Stepan: Acknowledgments. (line 60)
-* Kenobi, Obi-Wan: Undocumented. (line 6)
-* Kernighan, Brian: History. (line 17)
-* Kernighan, Brian <1>: Conventions. (line 38)
-* Kernighan, Brian <2>: Acknowledgments. (line 79)
-* Kernighan, Brian <3>: Getline/Pipe. (line 6)
-* Kernighan, Brian <4>: Concatenation. (line 6)
-* Kernighan, Brian <5>: Library Functions. (line 12)
-* Kernighan, Brian <6>: BTL. (line 6)
-* Kernighan, Brian <7>: Contributors. (line 12)
-* Kernighan, Brian <8>: Other Versions. (line 13)
-* Kernighan, Brian <9>: Basic Data Typing. (line 54)
-* Kernighan, Brian <10>: Glossary. (line 206)
-* kill command, dynamic profiling: Profiling. (line 186)
-* Knights, jedi: Undocumented. (line 6)
-* Kwok, Conrad: Contributors. (line 35)
-* l debugger command (alias for list): Miscellaneous Debugger Commands.
- (line 75)
-* labels.awk program: Labels Program. (line 51)
-* Langston, Peter: Advanced Features. (line 6)
-* LANGUAGE environment variable: Explaining gettext. (line 120)
-* languages, data-driven: Basic High Level. (line 74)
-* LC_ALL locale category: Explaining gettext. (line 117)
-* LC_COLLATE locale category: Explaining gettext. (line 94)
-* LC_CTYPE locale category: Explaining gettext. (line 98)
-* LC_MESSAGES locale category: Explaining gettext. (line 88)
-* LC_MESSAGES locale category, bindtextdomain() function (gawk): Programmer i18n.
- (line 101)
-* LC_MONETARY locale category: Explaining gettext. (line 104)
-* LC_NUMERIC locale category: Explaining gettext. (line 108)
-* LC_TIME locale category: Explaining gettext. (line 112)
-* left angle bracket (<), < operator: Comparison Operators.
- (line 11)
-* left angle bracket (<), < operator <1>: Precedence. (line 64)
-* left angle bracket (<), < operator (I/O): Getline/File. (line 6)
-* left angle bracket (<), <= operator: Comparison Operators.
- (line 11)
-* left angle bracket (<), <= operator <1>: Precedence. (line 64)
-* left shift: Bitwise Functions. (line 47)
-* left shift, bitwise: Bitwise Functions. (line 32)
-* leftmost longest match: Multiple Line. (line 26)
-* length: String Functions. (line 170)
-* length of input record: String Functions. (line 177)
-* length of string: String Functions. (line 170)
-* Lesser General Public License (LGPL): Glossary. (line 491)
-* LGPL (Lesser General Public License): Glossary. (line 491)
-* libmawk: Other Versions. (line 125)
-* libraries of awk functions: Library Functions. (line 6)
-* libraries of awk functions, assertions: Assert Function. (line 6)
-* libraries of awk functions, associative arrays and: Library Names.
- (line 58)
-* libraries of awk functions, character values as numbers: Ordinal Functions.
- (line 6)
-* libraries of awk functions, command-line options: Getopt Function.
- (line 6)
-* libraries of awk functions, example program for using: Igawk Program.
- (line 6)
-* libraries of awk functions, group database, reading: Group Functions.
- (line 6)
-* libraries of awk functions, managing, data files: Data File Management.
- (line 6)
-* libraries of awk functions, managing, time: Getlocaltime Function.
- (line 6)
-* libraries of awk functions, merging arrays into strings: Join Function.
- (line 6)
-* libraries of awk functions, rounding numbers: Round Function.
- (line 6)
-* libraries of awk functions, user database, reading: Passwd Functions.
- (line 6)
-* line breaks: Statements/Lines. (line 6)
-* line continuations: Boolean Ops. (line 64)
-* line continuations, gawk: Conditional Exp. (line 34)
-* line continuations, in print statement: Print Examples. (line 75)
-* line continuations, with C shell: More Complex. (line 31)
-* lines, blank, printing: Print. (line 22)
-* lines, counting: Wc Program. (line 6)
-* lines, duplicate, removing: History Sorting. (line 6)
-* lines, matching ranges of: Ranges. (line 6)
-* lines, skipping between markers: Ranges. (line 43)
-* lint checking: User-modified. (line 87)
-* lint checking, array elements: Delete. (line 34)
-* lint checking, array subscripts: Uninitialized Subscripts.
- (line 43)
-* lint checking, empty programs: Command Line. (line 16)
-* lint checking, issuing warnings: Options. (line 184)
-* lint checking, POSIXLY_CORRECT environment variable: Options.
- (line 343)
-* lint checking, undefined functions: Pass By Value/Reference.
- (line 85)
-* LINT variable: User-modified. (line 87)
-* Linux: Manual History. (line 28)
-* Linux <1>: I18N Example. (line 57)
-* Linux <2>: Glossary. (line 748)
-* list all global variables, in debugger: Debugger Info. (line 48)
-* list debugger command: Miscellaneous Debugger Commands.
- (line 75)
-* list function definitions, in debugger: Debugger Info. (line 30)
-* loading extensions, @load directive: Loading Shared Libraries.
- (line 8)
-* loading, extensions: Options. (line 172)
-* local variables, in a function: Variable Scope. (line 6)
-* locale categories: Explaining gettext. (line 81)
-* locale decimal point character: Options. (line 269)
-* locale, definition of: Locales. (line 6)
-* localization: I18N and L10N. (line 6)
-* localization, See internationalization, localization: I18N and L10N.
- (line 6)
-* log: Numeric Functions. (line 44)
-* log files, timestamps in: Time Functions. (line 6)
-* logarithm: Numeric Functions. (line 44)
-* logical false/true: Truth Values. (line 6)
-* logical operators, See Boolean expressions: Boolean Ops. (line 6)
-* login information: Passwd Functions. (line 16)
-* long options: Command Line. (line 13)
-* loops: While Statement. (line 6)
-* loops, break statement and: Break Statement. (line 6)
-* loops, continue statements and: For Statement. (line 64)
-* loops, count for header, in a profile: Profiling. (line 131)
-* loops, do-while: Do Statement. (line 6)
-* loops, exiting: Break Statement. (line 6)
-* loops, for, array scanning: Scanning an Array. (line 6)
-* loops, for, iterative: For Statement. (line 6)
-* loops, See Also while statement: While Statement. (line 6)
-* loops, while: While Statement. (line 6)
-* ls utility: More Complex. (line 15)
-* lshift: Bitwise Functions. (line 47)
-* lvalues/rvalues: Assignment Ops. (line 31)
-* mail-list file: Sample Data Files. (line 6)
-* mailing labels, printing: Labels Program. (line 6)
-* mailing list, GNITS: Acknowledgments. (line 52)
-* Malmberg, John: Acknowledgments. (line 60)
-* Malmberg, John <1>: Maintainers. (line 14)
-* Malmberg, John E.: Contributors. (line 138)
-* mark parity: Ordinal Functions. (line 45)
-* marked string extraction (internationalization): String Extraction.
- (line 6)
-* marked strings, extracting: String Extraction. (line 6)
-* Marx, Groucho: Increment Ops. (line 60)
-* match: String Functions. (line 210)
-* match regexp in string: String Functions. (line 210)
-* match() function, RSTART/RLENGTH variables: String Functions.
- (line 227)
-* matching, expressions, See comparison expressions: Typing and Comparison.
- (line 9)
-* matching, leftmost longest: Multiple Line. (line 26)
-* matching, null strings: String Functions. (line 537)
-* mawk utility: Escape Sequences. (line 121)
-* mawk utility <1>: Getline/Pipe. (line 62)
-* mawk utility <2>: Concatenation. (line 36)
-* mawk utility <3>: Nextfile Statement. (line 47)
-* mawk utility <4>: Other Versions. (line 48)
-* maximum precision supported by MPFR library: Auto-set. (line 235)
-* McIlroy, Doug: Glossary. (line 257)
-* McPhee, Patrick: Contributors. (line 101)
-* message object files: Explaining gettext. (line 42)
-* message object files, converting from portable object files: I18N Example.
- (line 66)
-* message object files, specifying directory of: Explaining gettext.
- (line 54)
-* message object files, specifying directory of <1>: Programmer i18n.
- (line 48)
-* messages from extensions: Printing Messages. (line 6)
-* metacharacters in regular expressions: Regexp Operators. (line 6)
-* metacharacters, escape sequences for: Escape Sequences. (line 140)
-* minimum precision required by MPFR library: Auto-set. (line 238)
-* mktime: Time Functions. (line 25)
-* modifiers, in format specifiers: Format Modifiers. (line 6)
-* monetary information, localization: Explaining gettext. (line 104)
-* Moore, Duncan: Getline Notes. (line 40)
-* msgfmt utility: I18N Example. (line 66)
-* multiple precision: Arbitrary Precision Arithmetic.
- (line 6)
-* multiple-line records: Multiple Line. (line 6)
-* n debugger command (alias for next): Debugger Execution Control.
- (line 43)
-* names, arrays/variables: Library Names. (line 6)
-* names, functions: Definition Syntax. (line 24)
-* names, functions <1>: Library Names. (line 6)
-* namespace issues: Library Names. (line 6)
-* namespace issues, functions: Definition Syntax. (line 24)
-* NetBSD: Glossary. (line 748)
-* networks, programming: TCP/IP Networking. (line 6)
-* networks, support for: Special Network. (line 6)
-* newlines: Statements/Lines. (line 6)
-* newlines <1>: Options. (line 263)
-* newlines <2>: Boolean Ops. (line 69)
-* newlines, as record separators: awk split records. (line 12)
-* newlines, in dynamic regexps: Computed Regexps. (line 60)
-* newlines, in regexp constants: Computed Regexps. (line 70)
-* newlines, printing: Print Examples. (line 11)
-* newlines, separating statements in actions: Action Overview.
- (line 19)
-* newlines, separating statements in actions <1>: Statements. (line 10)
-* next debugger command: Debugger Execution Control.
- (line 43)
-* next file statement: Feature History. (line 168)
-* next statement: Boolean Ops. (line 95)
-* next statement <1>: Next Statement. (line 6)
-* next statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 36)
-* next statement, BEGINFILE/ENDFILE patterns and: BEGINFILE/ENDFILE.
- (line 49)
-* next statement, user-defined functions and: Next Statement. (line 44)
-* nextfile statement: Nextfile Statement. (line 6)
-* nextfile statement, BEGIN/END patterns and: I/O And BEGIN/END.
- (line 36)
-* nextfile statement, BEGINFILE/ENDFILE patterns and: BEGINFILE/ENDFILE.
- (line 26)
-* nextfile statement, user-defined functions and: Nextfile Statement.
- (line 47)
-* nexti debugger command: Debugger Execution Control.
- (line 49)
-* NF variable: Fields. (line 33)
-* NF variable <1>: Auto-set. (line 123)
-* NF variable, decrementing: Changing Fields. (line 107)
-* ni debugger command (alias for nexti): Debugger Execution Control.
- (line 49)
-* noassign.awk program: Ignoring Assigns. (line 15)
-* non-existent array elements: Reference to Elements.
- (line 23)
-* not Boolean-logic operator: Boolean Ops. (line 6)
-* NR variable: Records. (line 6)
-* NR variable <1>: Auto-set. (line 143)
-* NR variable, changing: Auto-set. (line 357)
-* null strings: awk split records. (line 114)
-* null strings <1>: Regexp Field Splitting.
- (line 43)
-* null strings <2>: Truth Values. (line 6)
-* null strings <3>: Basic Data Typing. (line 26)
-* null strings in gawk arguments, quoting and: Quoting. (line 82)
-* null strings, and deleting array elements: Delete. (line 27)
-* null strings, as array subscripts: Uninitialized Subscripts.
- (line 43)
-* null strings, converting numbers to strings: Strings And Numbers.
- (line 21)
-* null strings, matching: String Functions. (line 537)
-* number as string of bits: Bitwise Functions. (line 111)
-* number of array elements: String Functions. (line 200)
-* number sign (#), #! (executable scripts): Executable Scripts.
- (line 6)
-* number sign (#), commenting: Comments. (line 6)
-* numbers, as array subscripts: Numeric Array Subscripts.
- (line 6)
-* numbers, as values of characters: Ordinal Functions. (line 6)
-* numbers, Cliff random: Cliff Random Function.
- (line 6)
-* numbers, converting: Strings And Numbers. (line 6)
-* numbers, converting <1>: Bitwise Functions. (line 111)
-* numbers, converting, to strings: User-modified. (line 30)
-* numbers, converting, to strings <1>: User-modified. (line 104)
-* numbers, hexadecimal: Nondecimal-numbers. (line 6)
-* numbers, octal: Nondecimal-numbers. (line 6)
-* numbers, rounding: Round Function. (line 6)
-* numeric constants: Scalar Constants. (line 6)
-* numeric functions: Numeric Functions. (line 6)
-* numeric, output format: OFMT. (line 6)
-* numeric, strings: Variable Typing. (line 6)
-* o debugger command (alias for option): Debugger Info. (line 57)
-* obsolete features: Obsolete. (line 6)
-* octal numbers: Nondecimal-numbers. (line 6)
-* octal values, enabling interpretation of: Options. (line 209)
-* OFMT variable: OFMT. (line 15)
-* OFMT variable <1>: Strings And Numbers. (line 56)
-* OFMT variable <2>: User-modified. (line 104)
-* OFMT variable, POSIX awk and: OFMT. (line 27)
-* OFS variable: Changing Fields. (line 64)
-* OFS variable <1>: Output Separators. (line 6)
-* OFS variable <2>: User-modified. (line 113)
-* OpenBSD: Glossary. (line 748)
-* OpenSolaris: Other Versions. (line 100)
-* operating systems, BSD-based: Manual History. (line 28)
-* operating systems, PC, gawk on: PC Using. (line 6)
-* operating systems, PC, gawk on, installing: PC Installation.
- (line 6)
-* operating systems, porting gawk to: New Ports. (line 6)
-* operating systems, See Also GNU/Linux, PC operating systems, Unix: Installation.
- (line 6)
-* operations, bitwise: Bitwise Functions. (line 6)
-* operators, arithmetic: Arithmetic Ops. (line 6)
-* operators, assignment: Assignment Ops. (line 6)
-* operators, assignment <1>: Assignment Ops. (line 31)
-* operators, assignment, evaluation order: Assignment Ops. (line 110)
-* operators, Boolean, See Boolean expressions: Boolean Ops. (line 6)
-* operators, decrement/increment: Increment Ops. (line 6)
-* operators, GNU-specific: GNU Regexp Operators.
- (line 6)
-* operators, input/output: Getline/File. (line 6)
-* operators, input/output <1>: Getline/Pipe. (line 10)
-* operators, input/output <2>: Getline/Coprocess. (line 6)
-* operators, input/output <3>: Redirection. (line 22)
-* operators, input/output <4>: Redirection. (line 96)
-* operators, input/output <5>: Precedence. (line 64)
-* operators, input/output <6>: Precedence. (line 64)
-* operators, input/output <7>: Precedence. (line 64)
-* operators, logical, See Boolean expressions: Boolean Ops. (line 6)
-* operators, precedence: Increment Ops. (line 60)
-* operators, precedence <1>: Precedence. (line 6)
-* operators, relational, See operators, comparison: Typing and Comparison.
- (line 9)
-* operators, short-circuit: Boolean Ops. (line 59)
-* operators, string: Concatenation. (line 9)
-* operators, string-matching: Regexp Usage. (line 19)
-* operators, string-matching, for buffers: GNU Regexp Operators.
- (line 51)
-* operators, word-boundary (gawk): GNU Regexp Operators.
- (line 66)
-* option debugger command: Debugger Info. (line 57)
-* options, command-line: Options. (line 6)
-* options, command-line, end of: Options. (line 55)
-* options, command-line, invoking awk: Command Line. (line 6)
-* options, command-line, processing: Getopt Function. (line 6)
-* options, deprecated: Obsolete. (line 6)
-* options, long: Command Line. (line 13)
-* options, long <1>: Options. (line 6)
-* options, printing list of: Options. (line 154)
-* or: Bitwise Functions. (line 50)
-* OR bitwise operation: Bitwise Functions. (line 6)
-* or Boolean-logic operator: Boolean Ops. (line 6)
-* ord() extension function: Extension Sample Ord.
- (line 12)
-* ord() user-defined function: Ordinal Functions. (line 16)
-* order of evaluation, concatenation: Concatenation. (line 41)
-* ORS variable: Output Separators. (line 20)
-* ORS variable <1>: User-modified. (line 119)
-* output field separator, See OFS variable: Changing Fields. (line 64)
-* output record separator, See ORS variable: Output Separators.
- (line 20)
-* output redirection: Redirection. (line 6)
-* output wrapper: Output Wrappers. (line 6)
-* output, buffering: I/O Functions. (line 32)
-* output, buffering <1>: I/O Functions. (line 166)
-* output, duplicating into files: Tee Program. (line 6)
-* output, files, closing: Close Files And Pipes.
- (line 6)
-* output, format specifier, OFMT: OFMT. (line 15)
-* output, formatted: Printf. (line 6)
-* output, pipes: Redirection. (line 57)
-* output, printing, See printing: Printing. (line 6)
-* output, records: Output Separators. (line 20)
-* output, standard: Special FD. (line 6)
-* p debugger command (alias for print): Viewing And Changing Data.
- (line 35)
-* Papadopoulos, Panos: Contributors. (line 129)
-* parent process ID of gawk process: Auto-set. (line 210)
-* parentheses (), in a profile: Profiling. (line 146)
-* parentheses (), regexp operator: Regexp Operators. (line 81)
-* password file: Passwd Functions. (line 16)
-* patsplit: String Functions. (line 296)
-* patterns: Patterns and Actions.
- (line 6)
-* patterns, comparison expressions as: Expression Patterns. (line 14)
-* patterns, counts, in a profile: Profiling. (line 118)
-* patterns, default: Very Simple. (line 35)
-* patterns, empty: Empty. (line 6)
-* patterns, expressions as: Regexp Patterns. (line 6)
-* patterns, ranges in: Ranges. (line 6)
-* patterns, regexp constants as: Expression Patterns. (line 34)
-* patterns, types of: Pattern Overview. (line 15)
-* pawk (profiling version of Brian Kernighan's awk): Other Versions.
- (line 82)
-* pawk, awk-like facilities for Python: Other Versions. (line 129)
-* PC operating systems, gawk on: PC Using. (line 6)
-* PC operating systems, gawk on, installing: PC Installation. (line 6)
-* percent sign (%), % operator: Precedence. (line 54)
-* percent sign (%), %= operator: Assignment Ops. (line 129)
-* percent sign (%), %= operator <1>: Precedence. (line 94)
-* period (.), regexp operator: Regexp Operators. (line 44)
-* Perl: Future Extensions. (line 6)
-* Peters, Arno: Contributors. (line 86)
-* Peterson, Hal: Contributors. (line 40)
-* pipe, closing: Close Files And Pipes.
- (line 6)
-* pipe, input: Getline/Pipe. (line 10)
-* pipe, output: Redirection. (line 57)
-* Pitts, Dave: Acknowledgments. (line 60)
-* Pitts, Dave <1>: Maintainers. (line 14)
-* Plauger, P.J.: Library Functions. (line 12)
-* plug-in: Extension Intro. (line 6)
-* plus sign (+), + operator: Precedence. (line 51)
-* plus sign (+), + operator <1>: Precedence. (line 57)
-* plus sign (+), ++ operator: Increment Ops. (line 11)
-* plus sign (+), ++ operator <1>: Increment Ops. (line 40)
-* plus sign (+), ++ operator <2>: Precedence. (line 45)
-* plus sign (+), += operator: Assignment Ops. (line 81)
-* plus sign (+), += operator <1>: Precedence. (line 94)
-* plus sign (+), regexp operator: Regexp Operators. (line 105)
-* pointers to functions: Indirect Calls. (line 6)
-* portability: Escape Sequences. (line 103)
-* portability, #! (executable scripts): Executable Scripts. (line 33)
-* portability, ** operator and: Arithmetic Ops. (line 81)
-* portability, **= operator and: Assignment Ops. (line 144)
-* portability, ARGV variable: Executable Scripts. (line 59)
-* portability, backslash continuation and: Statements/Lines. (line 30)
-* portability, backslash in escape sequences: Escape Sequences.
- (line 108)
-* portability, close() function and: Close Files And Pipes.
- (line 81)
-* portability, data files as single record: gawk split records.
- (line 65)
-* portability, deleting array elements: Delete. (line 56)
-* portability, example programs: Library Functions. (line 42)
-* portability, functions, defining: Definition Syntax. (line 114)
-* portability, gawk: New Ports. (line 6)
-* portability, gettext library and: Explaining gettext. (line 11)
-* portability, internationalization and: I18N Portability. (line 6)
-* portability, length() function: String Functions. (line 179)
-* portability, new awk vs. old awk: Strings And Numbers. (line 56)
-* portability, next statement in user-defined functions: Pass By Value/Reference.
- (line 88)
-* portability, NF variable, decrementing: Changing Fields. (line 115)
-* portability, operators: Increment Ops. (line 60)
-* portability, operators, not in POSIX awk: Precedence. (line 97)
-* portability, POSIXLY_CORRECT environment variable: Options. (line 363)
-* portability, substr() function: String Functions. (line 513)
-* portable object files: Explaining gettext. (line 37)
-* portable object files <1>: Translator i18n. (line 6)
-* portable object files, converting to message object files: I18N Example.
- (line 66)
-* portable object files, generating: Options. (line 147)
-* portable object template files: Explaining gettext. (line 31)
-* porting gawk: New Ports. (line 6)
-* positional specifiers, printf statement: Format Modifiers. (line 13)
-* positional specifiers, printf statement <1>: Printf Ordering.
- (line 6)
-* positional specifiers, printf statement, mixing with regular formats: Printf Ordering.
- (line 57)
-* POSIX awk: This Manual. (line 14)
-* POSIX awk <1>: Assignment Ops. (line 138)
-* POSIX awk, ** operator and: Precedence. (line 97)
-* POSIX awk, **= operator and: Assignment Ops. (line 144)
-* POSIX awk, < operator and: Getline/File. (line 26)
-* POSIX awk, arithmetic operators and: Arithmetic Ops. (line 30)
-* POSIX awk, backslashes in string constants: Escape Sequences.
- (line 108)
-* POSIX awk, BEGIN/END patterns: I/O And BEGIN/END. (line 15)
-* POSIX awk, bracket expressions and: Bracket Expressions. (line 34)
-* POSIX awk, bracket expressions and, character classes: Bracket Expressions.
- (line 40)
-* POSIX awk, bracket expressions and, character classes <1>: Bracket Expressions.
- (line 108)
-* POSIX awk, break statement and: Break Statement. (line 51)
-* POSIX awk, changes in awk versions: POSIX. (line 6)
-* POSIX awk, continue statement and: Continue Statement. (line 44)
-* POSIX awk, CONVFMT variable and: User-modified. (line 30)
-* POSIX awk, date utility and: Time Functions. (line 253)
-* POSIX awk, field separators and: Full Line Fields. (line 16)
-* POSIX awk, function keyword in: Definition Syntax. (line 99)
-* POSIX awk, functions and, gsub()/sub(): Gory Details. (line 90)
-* POSIX awk, functions and, length(): String Functions. (line 179)
-* POSIX awk, GNU long options and: Options. (line 15)
-* POSIX awk, interval expressions in: Regexp Operators. (line 135)
-* POSIX awk, next/nextfile statements and: Next Statement. (line 44)
-* POSIX awk, numeric strings and: Variable Typing. (line 6)
-* POSIX awk, OFMT variable and: OFMT. (line 27)
-* POSIX awk, OFMT variable and <1>: Strings And Numbers. (line 56)
-* POSIX awk, period (.), using: Regexp Operators. (line 51)
-* POSIX awk, printf format strings and: Format Modifiers. (line 157)
-* POSIX awk, regular expressions and: Regexp Operators. (line 161)
-* POSIX awk, timestamps and: Time Functions. (line 6)
-* POSIX awk, | I/O operator and: Getline/Pipe. (line 56)
-* POSIX mode: Options. (line 257)
-* POSIX mode <1>: Options. (line 343)
-* POSIX, awk and: Preface. (line 21)
-* POSIX, gawk extensions not included in: POSIX/GNU. (line 6)
-* POSIX, programs, implementing in awk: Clones. (line 6)
-* POSIXLY_CORRECT environment variable: Options. (line 343)
-* PREC variable: User-modified. (line 124)
-* precedence: Increment Ops. (line 60)
-* precedence <1>: Precedence. (line 6)
-* precedence, regexp operators: Regexp Operators. (line 156)
-* predefined variables: Built-in Variables. (line 6)
-* predefined variables, -v option, setting with: Options. (line 41)
-* predefined variables, conveying information: Auto-set. (line 6)
-* predefined variables, user-modifiable: User-modified. (line 6)
-* print debugger command: Viewing And Changing Data.
- (line 35)
-* print statement: Printing. (line 16)
-* print statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 15)
-* print statement, commas, omitting: Print Examples. (line 30)
-* print statement, I/O operators in: Precedence. (line 70)
-* print statement, line continuations and: Print Examples. (line 75)
-* print statement, OFMT variable and: User-modified. (line 113)
-* print statement, See Also redirection, of output: Redirection.
- (line 17)
-* print statement, sprintf() function and: Round Function. (line 6)
-* print variables, in debugger: Viewing And Changing Data.
- (line 35)
-* printf debugger command: Viewing And Changing Data.
- (line 53)
-* printf statement: Printing. (line 16)
-* printf statement <1>: Printf. (line 6)
-* printf statement, columns, aligning: Print Examples. (line 69)
-* printf statement, format-control characters: Control Letters.
- (line 6)
-* printf statement, I/O operators in: Precedence. (line 70)
-* printf statement, modifiers: Format Modifiers. (line 6)
-* printf statement, positional specifiers: Format Modifiers. (line 13)
-* printf statement, positional specifiers <1>: Printf Ordering.
- (line 6)
-* printf statement, positional specifiers, mixing with regular formats: Printf Ordering.
- (line 57)
-* printf statement, See Also redirection, of output: Redirection.
- (line 17)
-* printf statement, sprintf() function and: Round Function. (line 6)
-* printf statement, syntax of: Basic Printf. (line 6)
-* printing: Printing. (line 6)
-* printing messages from extensions: Printing Messages. (line 6)
-* printing, list of options: Options. (line 154)
-* printing, mailing labels: Labels Program. (line 6)
-* printing, unduplicated lines of text: Uniq Program. (line 6)
-* printing, user information: Id Program. (line 6)
-* private variables: Library Names. (line 11)
-* process group ID of gawk process: Auto-set. (line 204)
-* process ID of gawk process: Auto-set. (line 207)
-* processes, two-way communications with: Two-way I/O. (line 6)
-* processing data: Basic High Level. (line 6)
-* PROCINFO array: Auto-set. (line 148)
-* PROCINFO array <1>: Time Functions. (line 47)
-* PROCINFO array <2>: Passwd Functions. (line 6)
-* PROCINFO array, and communications via ptys: Two-way I/O. (line 114)
-* PROCINFO array, and group membership: Group Functions. (line 6)
-* PROCINFO array, and user and group ID numbers: Id Program. (line 15)
-* PROCINFO array, testing the field splitting: Passwd Functions.
- (line 154)
-* PROCINFO, values of sorted_in: Controlling Scanning.
- (line 26)
-* profiling awk programs: Profiling. (line 6)
-* profiling awk programs, dynamically: Profiling. (line 177)
-* program identifiers: Auto-set. (line 173)
-* program, definition of: Getting Started. (line 21)
-* programming conventions, --non-decimal-data option: Nondecimal Data.
- (line 35)
-* programming conventions, ARGC/ARGV variables: Auto-set. (line 35)
-* programming conventions, exit statement: Exit Statement. (line 38)
-* programming conventions, function parameters: Return Statement.
- (line 44)
-* programming conventions, functions, calling: Calling Built-in.
- (line 10)
-* programming conventions, functions, writing: Definition Syntax.
- (line 71)
-* programming conventions, gawk extensions: Internal File Ops.
- (line 45)
-* programming conventions, private variable names: Library Names.
- (line 23)
-* programming language, recipe for: History. (line 6)
-* programming languages, Ada: Glossary. (line 11)
-* programming languages, data-driven vs. procedural: Getting Started.
- (line 12)
-* programming languages, Java: Glossary. (line 468)
-* programming, basic steps: Basic High Level. (line 18)
-* programming, concepts: Basic Concepts. (line 6)
-* programming, concepts <1>: Basic Concepts. (line 6)
-* pwcat program: Passwd Functions. (line 23)
-* q debugger command (alias for quit): Miscellaneous Debugger Commands.
- (line 102)
-* QSE awk: Other Versions. (line 135)
-* Quanstrom, Erik: Alarm Program. (line 8)
-* question mark (?), ?: operator: Precedence. (line 91)
-* question mark (?), regexp operator: Regexp Operators. (line 111)
-* question mark (?), regexp operator <1>: GNU Regexp Operators.
- (line 62)
-* QuikTrim Awk: Other Versions. (line 139)
-* quit debugger command: Miscellaneous Debugger Commands.
- (line 102)
-* QUIT signal (MS-Windows): Profiling. (line 212)
-* quoting in gawk command lines: Long. (line 26)
-* quoting in gawk command lines, tricks for: Quoting. (line 91)
-* quoting, for small awk programs: Comments. (line 27)
-* r debugger command (alias for run): Debugger Execution Control.
- (line 62)
-* Rakitzis, Byron: History Sorting. (line 25)
-* Ramey, Chet: Acknowledgments. (line 60)
-* Ramey, Chet <1>: General Data Types. (line 6)
-* rand: Numeric Functions. (line 49)
-* random numbers, Cliff: Cliff Random Function.
- (line 6)
-* random numbers, rand()/srand() functions: Numeric Functions.
- (line 49)
-* random numbers, seed of: Numeric Functions. (line 79)
-* range expressions (regexps): Bracket Expressions. (line 6)
-* range patterns: Ranges. (line 6)
-* range patterns, line continuation and: Ranges. (line 64)
-* Rankin, Pat: Acknowledgments. (line 60)
-* Rankin, Pat <1>: Assignment Ops. (line 99)
-* Rankin, Pat <2>: Contributors. (line 38)
-* reada() extension function: Extension Sample Read write array.
- (line 18)
-* readable data files, checking: File Checking. (line 6)
-* readable.awk program: File Checking. (line 11)
-* readdir extension: Extension Sample Readdir.
- (line 9)
-* readfile() extension function: Extension Sample Readfile.
- (line 12)
-* readfile() user-defined function: Readfile Function. (line 30)
-* reading input files: Reading Files. (line 6)
-* recipe for a programming language: History. (line 6)
-* record separators: awk split records. (line 6)
-* record separators <1>: User-modified. (line 133)
-* record separators, changing: awk split records. (line 85)
-* record separators, regular expressions as: awk split records.
- (line 124)
-* record separators, with multiline records: Multiple Line. (line 10)
-* records: Reading Files. (line 14)
-* records <1>: Basic High Level. (line 62)
-* records, multiline: Multiple Line. (line 6)
-* records, printing: Print. (line 22)
-* records, splitting input into: Records. (line 6)
-* records, terminating: awk split records. (line 124)
-* records, treating files as: gawk split records. (line 92)
-* recursive functions: Definition Syntax. (line 89)
-* redirect gawk output, in debugger: Debugger Info. (line 73)
-* redirection of input: Getline/File. (line 6)
-* redirection of output: Redirection. (line 6)
-* redirection on VMS: VMS Running. (line 64)
-* reference counting, sorting arrays: Array Sorting Functions.
- (line 77)
-* regexp: Regexp. (line 6)
-* regexp constants: Regexp Usage. (line 57)
-* regexp constants <1>: Regexp Constants. (line 6)
-* regexp constants <2>: Comparison Operators.
- (line 103)
-* regexp constants, /=.../, /= operator and: Assignment Ops. (line 149)
-* regexp constants, as patterns: Expression Patterns. (line 34)
-* regexp constants, in gawk: Using Constant Regexps.
- (line 28)
-* regexp constants, slashes vs. quotes: Computed Regexps. (line 30)
-* regexp constants, vs. string constants: Computed Regexps. (line 40)
-* register extension: Registration Functions.
- (line 6)
-* regular expressions: Regexp. (line 6)
-* regular expressions as field separators: Field Separators. (line 50)
-* regular expressions, anchors in: Regexp Operators. (line 22)
-* regular expressions, as field separators: Regexp Field Splitting.
- (line 6)
-* regular expressions, as patterns: Regexp Usage. (line 6)
-* regular expressions, as patterns <1>: Regexp Patterns. (line 6)
-* regular expressions, as record separators: awk split records.
- (line 124)
-* regular expressions, case sensitivity: Case-sensitivity. (line 6)
-* regular expressions, case sensitivity <1>: User-modified. (line 76)
-* regular expressions, computed: Computed Regexps. (line 6)
-* regular expressions, constants, See regexp constants: Regexp Usage.
- (line 57)
-* regular expressions, dynamic: Computed Regexps. (line 6)
-* regular expressions, dynamic, with embedded newlines: Computed Regexps.
- (line 60)
-* regular expressions, gawk, command-line options: GNU Regexp Operators.
- (line 73)
-* regular expressions, interval expressions and: Options. (line 278)
-* regular expressions, leftmost longest match: Leftmost Longest.
- (line 6)
-* regular expressions, operators: Regexp Usage. (line 19)
-* regular expressions, operators <1>: Regexp Operators. (line 6)
-* regular expressions, operators, for buffers: GNU Regexp Operators.
- (line 51)
-* regular expressions, operators, for words: GNU Regexp Operators.
- (line 6)
-* regular expressions, operators, gawk: GNU Regexp Operators.
- (line 6)
-* regular expressions, operators, precedence of: Regexp Operators.
- (line 156)
-* regular expressions, searching for: Egrep Program. (line 6)
-* relational operators, See comparison operators: Typing and Comparison.
- (line 9)
-* replace in string: String Functions. (line 409)
-* retrying input: Retrying Input. (line 6)
-* return debugger command: Debugger Execution Control.
- (line 54)
-* return statement, user-defined functions: Return Statement. (line 6)
-* return value, close() function: Close Files And Pipes.
- (line 132)
-* rev() user-defined function: Function Example. (line 54)
-* revoutput extension: Extension Sample Revout.
- (line 11)
-* revtwoway extension: Extension Sample Rev2way.
- (line 12)
-* rewind() user-defined function: Rewind Function. (line 15)
-* right angle bracket (>), > operator: Comparison Operators.
- (line 11)
-* right angle bracket (>), > operator <1>: Precedence. (line 64)
-* right angle bracket (>), > operator (I/O): Redirection. (line 22)
-* right angle bracket (>), >= operator: Comparison Operators.
- (line 11)
-* right angle bracket (>), >= operator <1>: Precedence. (line 64)
-* right angle bracket (>), >> operator (I/O): Redirection. (line 50)
-* right angle bracket (>), >> operator (I/O) <1>: Precedence. (line 64)
-* right shift: Bitwise Functions. (line 54)
-* right shift, bitwise: Bitwise Functions. (line 32)
-* Ritchie, Dennis: Basic Data Typing. (line 54)
-* RLENGTH variable: Auto-set. (line 282)
-* RLENGTH variable, match() function and: String Functions. (line 227)
-* Robbins, Arnold: Command Line Field Separator.
- (line 71)
-* Robbins, Arnold <1>: Getline/Pipe. (line 40)
-* Robbins, Arnold <2>: Passwd Functions. (line 90)
-* Robbins, Arnold <3>: Alarm Program. (line 6)
-* Robbins, Arnold <4>: General Data Types. (line 6)
-* Robbins, Arnold <5>: Contributors. (line 145)
-* Robbins, Arnold <6>: Maintainers. (line 14)
-* Robbins, Arnold <7>: Future Extensions. (line 6)
-* Robbins, Bill: Getline/Pipe. (line 40)
-* Robbins, Harry: Acknowledgments. (line 94)
-* Robbins, Jean: Acknowledgments. (line 94)
-* Robbins, Miriam: Acknowledgments. (line 94)
-* Robbins, Miriam <1>: Getline/Pipe. (line 40)
-* Robbins, Miriam <2>: Passwd Functions. (line 90)
-* Rommel, Kai Uwe: Contributors. (line 43)
-* round to nearest integer: Numeric Functions. (line 24)
-* round() user-defined function: Round Function. (line 16)
-* rounding numbers: Round Function. (line 6)
-* ROUNDMODE variable: User-modified. (line 128)
-* RS variable: awk split records. (line 12)
-* RS variable <1>: User-modified. (line 133)
-* RS variable, multiline records and: Multiple Line. (line 17)
-* rshift: Bitwise Functions. (line 54)
-* RSTART variable: Auto-set. (line 288)
-* RSTART variable, match() function and: String Functions. (line 227)
-* RT variable: awk split records. (line 124)
-* RT variable <1>: Multiple Line. (line 130)
-* RT variable <2>: Auto-set. (line 295)
-* Rubin, Paul: History. (line 30)
-* Rubin, Paul <1>: Contributors. (line 16)
-* rule, definition of: Getting Started. (line 21)
-* run debugger command: Debugger Execution Control.
- (line 62)
-* rvalues/lvalues: Assignment Ops. (line 31)
-* s debugger command (alias for step): Debugger Execution Control.
- (line 68)
-* sample debugging session: Sample Debugging Session.
- (line 6)
-* sandbox mode: Options. (line 290)
-* save debugger options: Debugger Info. (line 85)
-* scalar or array: Type Functions. (line 11)
-* scalar values: Basic Data Typing. (line 13)
-* scanning arrays: Scanning an Array. (line 6)
-* scanning multidimensional arrays: Multiscanning. (line 11)
-* Schorr, Andrew: Acknowledgments. (line 60)
-* Schorr, Andrew <1>: Auto-set. (line 327)
-* Schorr, Andrew <2>: Contributors. (line 134)
-* Schreiber, Bert: Acknowledgments. (line 38)
-* Schreiber, Rita: Acknowledgments. (line 38)
-* search and replace in strings: String Functions. (line 89)
-* search in string: String Functions. (line 155)
-* search paths: Programs Exercises. (line 70)
-* search paths <1>: PC Using. (line 9)
-* search paths <2>: VMS Running. (line 57)
-* search paths, for loadable extensions: AWKLIBPATH Variable. (line 6)
-* search paths, for source files: AWKPATH Variable. (line 6)
-* search paths, for source files <1>: Programs Exercises. (line 70)
-* search paths, for source files <2>: PC Using. (line 9)
-* search paths, for source files <3>: VMS Running. (line 57)
-* searching, files for regular expressions: Egrep Program. (line 6)
-* searching, for words: Dupword Program. (line 6)
-* sed utility: Full Line Fields. (line 22)
-* sed utility <1>: Simple Sed. (line 6)
-* sed utility <2>: Glossary. (line 16)
-* seeding random number generator: Numeric Functions. (line 79)
-* semicolon (;), AWKPATH variable and: PC Using. (line 9)
-* semicolon (;), separating statements in actions: Statements/Lines.
- (line 90)
-* semicolon (;), separating statements in actions <1>: Action Overview.
- (line 19)
-* semicolon (;), separating statements in actions <2>: Statements.
- (line 10)
-* separators, field: User-modified. (line 50)
-* separators, field <1>: User-modified. (line 113)
-* separators, field, FIELDWIDTHS variable and: User-modified. (line 37)
-* separators, field, FPAT variable and: User-modified. (line 43)
-* separators, for records: awk split records. (line 6)
-* separators, for records <1>: awk split records. (line 85)
-* separators, for records <2>: User-modified. (line 133)
-* separators, for records, regular expressions as: awk split records.
- (line 124)
-* separators, for statements in actions: Action Overview. (line 19)
-* separators, subscript: User-modified. (line 146)
-* set breakpoint: Breakpoint Control. (line 11)
-* set debugger command: Viewing And Changing Data.
- (line 58)
-* set directory of message catalogs: I18N Functions. (line 11)
-* set watchpoint: Viewing And Changing Data.
- (line 66)
-* shadowing of variable values: Definition Syntax. (line 77)
-* shell quoting, rules for: Quoting. (line 6)
-* shells, piping commands into: Redirection. (line 136)
-* shells, quoting: Using Shell Variables.
- (line 12)
-* shells, quoting, rules for: Quoting. (line 18)
-* shells, scripts: One-shot. (line 22)
-* shells, sea: Undocumented. (line 9)
-* shells, variables: Using Shell Variables.
- (line 6)
-* shift, bitwise: Bitwise Functions. (line 32)
-* short-circuit operators: Boolean Ops. (line 59)
-* show all source files, in debugger: Debugger Info. (line 45)
-* show breakpoints: Debugger Info. (line 21)
-* show function arguments, in debugger: Debugger Info. (line 18)
-* show local variables, in debugger: Debugger Info. (line 34)
-* show name of current source file, in debugger: Debugger Info.
- (line 37)
-* show watchpoints: Debugger Info. (line 51)
-* si debugger command (alias for stepi): Debugger Execution Control.
- (line 75)
-* side effects: Concatenation. (line 41)
-* side effects <1>: Increment Ops. (line 11)
-* side effects <2>: Increment Ops. (line 75)
-* side effects, array indexing: Reference to Elements.
- (line 43)
-* side effects, asort() function: Array Sorting Functions.
- (line 24)
-* side effects, assignment expressions: Assignment Ops. (line 22)
-* side effects, Boolean operators: Boolean Ops. (line 30)
-* side effects, conditional expressions: Conditional Exp. (line 22)
-* side effects, decrement/increment operators: Increment Ops. (line 11)
-* side effects, FILENAME variable: Getline Notes. (line 19)
-* side effects, function calls: Function Calls. (line 57)
-* side effects, statements: Action Overview. (line 32)
-* sidebar, A Constant's Base Does Not Affect Its Value: Nondecimal-numbers.
- (line 63)
-* sidebar, Backslash Before Regular Characters: Escape Sequences.
- (line 106)
-* sidebar, Changing FS Does Not Affect the Fields: Full Line Fields.
- (line 14)
-* sidebar, Changing NR and FNR: Auto-set. (line 355)
-* sidebar, Controlling Output Buffering with system(): I/O Functions.
- (line 164)
-* sidebar, Escape Sequences for Metacharacters: Escape Sequences.
- (line 138)
-* sidebar, FS and IGNORECASE: Field Splitting Summary.
- (line 37)
-* sidebar, Interactive Versus Noninteractive Buffering: I/O Functions.
- (line 74)
-* sidebar, Matching the Null String: String Functions. (line 535)
-* sidebar, Operator Evaluation Order: Increment Ops. (line 58)
-* sidebar, Piping into sh: Redirection. (line 134)
-* sidebar, Pre-POSIX awk Used OFMT for String Conversion: Strings And Numbers.
- (line 54)
-* sidebar, Recipe for a Programming Language: History. (line 6)
-* sidebar, RS = "\0" Is Not Portable: gawk split records. (line 63)
-* sidebar, So Why Does gawk Have BEGINFILE and ENDFILE?: Filetrans Function.
- (line 83)
-* sidebar, Syntactic Ambiguities Between /= and Regular Expressions: Assignment Ops.
- (line 147)
-* sidebar, Understanding #!: Executable Scripts. (line 31)
-* sidebar, Understanding $0: Changing Fields. (line 134)
-* sidebar, Using close()'s Return Value: Close Files And Pipes.
- (line 130)
-* sidebar, Using \n in Bracket Expressions of Dynamic Regexps: Computed Regexps.
- (line 58)
-* SIGHUP signal, for dynamic profiling: Profiling. (line 209)
-* SIGINT signal (MS-Windows): Profiling. (line 212)
-* signals, HUP/SIGHUP, for profiling: Profiling. (line 209)
-* signals, INT/SIGINT (MS-Windows): Profiling. (line 212)
-* signals, QUIT/SIGQUIT (MS-Windows): Profiling. (line 212)
-* signals, USR1/SIGUSR1, for profiling: Profiling. (line 186)
-* signature program: Signature Program. (line 6)
-* SIGQUIT signal (MS-Windows): Profiling. (line 212)
-* SIGUSR1 signal, for dynamic profiling: Profiling. (line 186)
-* silent debugger command: Debugger Execution Control.
- (line 10)
-* sin: Numeric Functions. (line 90)
-* sine: Numeric Functions. (line 90)
-* single quote ('): One-shot. (line 15)
-* single quote (') in gawk command lines: Long. (line 35)
-* single quote ('), in shell commands: Quoting. (line 48)
-* single quote ('), vs. apostrophe: Comments. (line 27)
-* single quote ('), with double quotes: Quoting. (line 73)
-* single-character fields: Single Character Fields.
- (line 6)
-* single-step execution, in the debugger: Debugger Execution Control.
- (line 43)
-* Skywalker, Luke: Undocumented. (line 6)
-* sleep utility: Alarm Program. (line 109)
-* sleep() extension function: Extension Sample Time.
- (line 22)
-* Solaris, POSIX-compliant awk: Other Versions. (line 100)
-* sort array: String Functions. (line 42)
-* sort array indices: String Functions. (line 42)
-* sort function, arrays, sorting: Array Sorting Functions.
- (line 6)
-* sort utility: Word Sorting. (line 50)
-* sort utility, coprocesses and: Two-way I/O. (line 66)
-* sorting characters in different languages: Explaining gettext.
- (line 94)
-* source code, awka: Other Versions. (line 68)
-* source code, Brian Kernighan's awk: Other Versions. (line 13)
-* source code, BusyBox Awk: Other Versions. (line 92)
-* source code, gawk: Gawk Distribution. (line 6)
-* source code, Illumos awk: Other Versions. (line 109)
-* source code, jawk: Other Versions. (line 117)
-* source code, libmawk: Other Versions. (line 125)
-* source code, mawk: Other Versions. (line 48)
-* source code, mixing: Options. (line 117)
-* source code, pawk: Other Versions. (line 82)
-* source code, pawk (Python version): Other Versions. (line 129)
-* source code, QSE awk: Other Versions. (line 135)
-* source code, QuikTrim Awk: Other Versions. (line 139)
-* source code, Solaris awk: Other Versions. (line 100)
-* source files, search path for: Programs Exercises. (line 70)
-* sparse arrays: Array Intro. (line 76)
-* Spencer, Henry: Glossary. (line 16)
-* split: String Functions. (line 315)
-* split string into array: String Functions. (line 296)
-* split utility: Split Program. (line 6)
-* split() function, array elements, deleting: Delete. (line 61)
-* split.awk program: Split Program. (line 30)
-* sprintf: OFMT. (line 15)
-* sprintf <1>: String Functions. (line 384)
-* sprintf() function, OFMT variable and: User-modified. (line 113)
-* sprintf() function, print/printf statements and: Round Function.
- (line 6)
-* sqrt: Numeric Functions. (line 93)
-* square brackets ([]), regexp operator: Regexp Operators. (line 56)
-* square root: Numeric Functions. (line 93)
-* srand: Numeric Functions. (line 97)
-* stack frame: Debugging Terms. (line 10)
-* Stallman, Richard: Manual History. (line 6)
-* Stallman, Richard <1>: Acknowledgments. (line 18)
-* Stallman, Richard <2>: Contributors. (line 24)
-* Stallman, Richard <3>: Glossary. (line 372)
-* standard error: Special FD. (line 6)
-* standard input: Read Terminal. (line 6)
-* standard input <1>: Special FD. (line 6)
-* standard output: Special FD. (line 6)
-* starting the debugger: Debugger Invocation. (line 6)
-* stat() extension function: Extension Sample File Functions.
- (line 18)
-* statements, compound, control statements and: Statements. (line 10)
-* statements, control, in actions: Statements. (line 6)
-* statements, multiple: Statements/Lines. (line 90)
-* step debugger command: Debugger Execution Control.
- (line 68)
-* stepi debugger command: Debugger Execution Control.
- (line 75)
-* stop automatic display, in debugger: Viewing And Changing Data.
- (line 79)
-* stream editors: Full Line Fields. (line 22)
-* stream editors <1>: Simple Sed. (line 6)
-* strftime: Time Functions. (line 48)
-* string constants: Scalar Constants. (line 15)
-* string constants, vs. regexp constants: Computed Regexps. (line 40)
-* string extraction (internationalization): String Extraction.
- (line 6)
-* string length: String Functions. (line 170)
-* string operators: Concatenation. (line 9)
-* string, regular expression match: String Functions. (line 210)
-* string-manipulation functions: String Functions. (line 6)
-* string-matching operators: Regexp Usage. (line 19)
-* string-translation functions: I18N Functions. (line 6)
-* strings splitting, example: String Functions. (line 334)
-* strings, converting: Strings And Numbers. (line 6)
-* strings, converting <1>: Bitwise Functions. (line 111)
-* strings, converting letter case: String Functions. (line 523)
-* strings, converting, numbers to: User-modified. (line 30)
-* strings, converting, numbers to <1>: User-modified. (line 104)
-* strings, empty, See null strings: awk split records. (line 114)
-* strings, extracting: String Extraction. (line 6)
-* strings, for localization: Programmer i18n. (line 13)
-* strings, length limitations: Scalar Constants. (line 20)
-* strings, merging arrays into: Join Function. (line 6)
-* strings, null: Regexp Field Splitting.
- (line 43)
-* strings, numeric: Variable Typing. (line 6)
-* strtonum: String Functions. (line 391)
-* strtonum() function (gawk), --non-decimal-data option and: Nondecimal Data.
- (line 35)
-* sub: Using Constant Regexps.
- (line 43)
-* sub <1>: String Functions. (line 409)
-* sub() function, arguments of: String Functions. (line 463)
-* sub() function, escape processing: Gory Details. (line 6)
-* subscript separators: User-modified. (line 146)
-* subscripts in arrays, multidimensional: Multidimensional. (line 10)
-* subscripts in arrays, multidimensional, scanning: Multiscanning.
- (line 11)
-* subscripts in arrays, numbers as: Numeric Array Subscripts.
- (line 6)
-* subscripts in arrays, uninitialized variables as: Uninitialized Subscripts.
- (line 6)
-* SUBSEP variable: User-modified. (line 146)
-* SUBSEP variable, and multidimensional arrays: Multidimensional.
- (line 16)
-* substitute in string: String Functions. (line 89)
-* substr: String Functions. (line 482)
-* substring: String Functions. (line 482)
-* Sumner, Andrew: Other Versions. (line 68)
-* supplementary groups of gawk process: Auto-set. (line 251)
-* switch statement: Switch Statement. (line 6)
-* SYMTAB array: Auto-set. (line 299)
-* syntactic ambiguity: /= operator vs. /=.../ regexp constant: Assignment Ops.
- (line 149)
-* system: I/O Functions. (line 107)
-* systime: Time Functions. (line 66)
-* t debugger command (alias for tbreak): Breakpoint Control. (line 90)
-* tbreak debugger command: Breakpoint Control. (line 90)
-* Tcl: Library Names. (line 58)
-* TCP/IP: TCP/IP Networking. (line 6)
-* TCP/IP, support for: Special Network. (line 6)
-* tee utility: Tee Program. (line 6)
-* tee.awk program: Tee Program. (line 26)
-* temporary breakpoint: Breakpoint Control. (line 90)
-* terminating records: awk split records. (line 124)
-* testbits.awk program: Bitwise Functions. (line 72)
-* testext extension: Extension Sample API Tests.
- (line 6)
-* Texinfo: Conventions. (line 6)
-* Texinfo <1>: Library Functions. (line 33)
-* Texinfo <2>: Dupword Program. (line 17)
-* Texinfo <3>: Extract Program. (line 12)
-* Texinfo <4>: Distribution contents.
- (line 77)
-* Texinfo <5>: Adding Code. (line 100)
-* Texinfo, chapter beginnings in files: Regexp Operators. (line 22)
-* Texinfo, extracting programs from source files: Extract Program.
- (line 6)
-* text, printing: Print. (line 22)
-* text, printing, unduplicated lines of: Uniq Program. (line 6)
-* TEXTDOMAIN variable: User-modified. (line 152)
-* TEXTDOMAIN variable <1>: Programmer i18n. (line 8)
-* TEXTDOMAIN variable, BEGIN pattern and: Programmer i18n. (line 60)
-* TEXTDOMAIN variable, portability and: I18N Portability. (line 20)
-* textdomain() function (C library): Explaining gettext. (line 28)
-* tilde (~), ~ operator: Regexp Usage. (line 19)
-* tilde (~), ~ operator <1>: Computed Regexps. (line 6)
-* tilde (~), ~ operator <2>: Case-sensitivity. (line 26)
-* tilde (~), ~ operator <3>: Regexp Constants. (line 6)
-* tilde (~), ~ operator <4>: Comparison Operators.
- (line 11)
-* tilde (~), ~ operator <5>: Comparison Operators.
- (line 98)
-* tilde (~), ~ operator <6>: Precedence. (line 79)
-* tilde (~), ~ operator <7>: Expression Patterns. (line 24)
-* time functions: Time Functions. (line 6)
-* time, alarm clock example program: Alarm Program. (line 11)
-* time, localization and: Explaining gettext. (line 112)
-* time, managing: Getlocaltime Function.
- (line 6)
-* time, retrieving: Time Functions. (line 17)
-* timeout, reading input: Read Timeout. (line 6)
-* timestamps: Time Functions. (line 6)
-* timestamps <1>: Time Functions. (line 66)
-* timestamps, converting dates to: Time Functions. (line 76)
-* timestamps, formatted: Getlocaltime Function.
- (line 6)
-* tolower: String Functions. (line 524)
-* toupper: String Functions. (line 530)
-* tr utility: Translate Program. (line 6)
-* trace debugger command: Miscellaneous Debugger Commands.
- (line 110)
-* traceback, display in debugger: Execution Stack. (line 13)
-* translate string: I18N Functions. (line 21)
-* translate.awk program: Translate Program. (line 55)
-* treating files, as single records: gawk split records. (line 92)
-* troubleshooting, --non-decimal-data option: Options. (line 209)
-* troubleshooting, == operator: Comparison Operators.
- (line 37)
-* troubleshooting, awk uses FS not IFS: Field Separators. (line 29)
-* troubleshooting, backslash before nonspecial character: Escape Sequences.
- (line 108)
-* troubleshooting, division: Arithmetic Ops. (line 44)
-* troubleshooting, fatal errors, field widths, specifying: Constant Size.
- (line 22)
-* troubleshooting, fatal errors, printf format strings: Format Modifiers.
- (line 157)
-* troubleshooting, fflush() function: I/O Functions. (line 63)
-* troubleshooting, function call syntax: Function Calls. (line 30)
-* troubleshooting, gawk: Compatibility Mode. (line 6)
-* troubleshooting, gawk, bug reports: Bugs. (line 9)
-* troubleshooting, gawk, fatal errors, function arguments: Calling Built-in.
- (line 16)
-* troubleshooting, getline function: File Checking. (line 25)
-* troubleshooting, gsub()/sub() functions: String Functions. (line 473)
-* troubleshooting, match() function: String Functions. (line 291)
-* troubleshooting, print statement, omitting commas: Print Examples.
- (line 30)
-* troubleshooting, printing: Redirection. (line 112)
-* troubleshooting, quotes with file names: Special FD. (line 62)
-* troubleshooting, readable data files: File Checking. (line 6)
-* troubleshooting, regexp constants vs. string constants: Computed Regexps.
- (line 40)
-* troubleshooting, string concatenation: Concatenation. (line 27)
-* troubleshooting, substr() function: String Functions. (line 500)
-* troubleshooting, system() function: I/O Functions. (line 129)
-* troubleshooting, typographical errors, global variables: Options.
- (line 99)
-* true, logical: Truth Values. (line 6)
-* Trueman, David: History. (line 30)
-* Trueman, David <1>: Acknowledgments. (line 47)
-* Trueman, David <2>: Contributors. (line 31)
-* trunc-mod operation: Arithmetic Ops. (line 66)
-* truth values: Truth Values. (line 6)
-* type conversion: Strings And Numbers. (line 21)
-* type, of variable: Type Functions. (line 14)
-* typeof: Type Functions. (line 14)
-* u debugger command (alias for until): Debugger Execution Control.
- (line 82)
-* unassigned array elements: Reference to Elements.
- (line 18)
-* undefined functions: Pass By Value/Reference.
- (line 68)
-* underscore (_), C macro: Explaining gettext. (line 71)
-* underscore (_), in names of private variables: Library Names.
- (line 29)
-* underscore (_), translatable string: Programmer i18n. (line 69)
-* undisplay debugger command: Viewing And Changing Data.
- (line 79)
-* undocumented features: Undocumented. (line 6)
-* Unicode: Ordinal Functions. (line 45)
-* Unicode <1>: Ranges and Locales. (line 61)
-* Unicode <2>: Glossary. (line 196)
-* uninitialized variables, as array subscripts: Uninitialized Subscripts.
- (line 6)
-* uniq utility: Uniq Program. (line 6)
-* uniq.awk program: Uniq Program. (line 65)
-* Unix: Glossary. (line 748)
-* Unix awk, backslashes in escape sequences: Escape Sequences.
- (line 121)
-* Unix awk, close() function and: Close Files And Pipes.
- (line 132)
-* Unix awk, password files, field separators and: Command Line Field Separator.
- (line 62)
-* Unix, awk scripts and: Executable Scripts. (line 6)
-* unsigned integers: Computer Arithmetic. (line 41)
-* until debugger command: Debugger Execution Control.
- (line 82)
-* unwatch debugger command: Viewing And Changing Data.
- (line 83)
-* up debugger command: Execution Stack. (line 36)
-* user database, reading: Passwd Functions. (line 6)
-* user-defined functions: User-defined. (line 6)
-* user-defined, functions, counts, in a profile: Profiling. (line 137)
-* user-defined, variables: Variables. (line 6)
-* user-modifiable variables: User-modified. (line 6)
-* users, information about, printing: Id Program. (line 6)
-* users, information about, retrieving: Passwd Functions. (line 16)
-* USR1 signal, for dynamic profiling: Profiling. (line 186)
-* values, numeric: Basic Data Typing. (line 13)
-* values, string: Basic Data Typing. (line 13)
-* variable assignments and input files: Other Arguments. (line 26)
-* variable type: Type Functions. (line 14)
-* variable typing: Typing and Comparison.
- (line 9)
-* variables: Other Features. (line 6)
-* variables <1>: Basic Data Typing. (line 6)
-* variables, assigning on command line: Assignment Options. (line 6)
-* variables, built-in: Using Variables. (line 23)
-* variables, flag: Boolean Ops. (line 69)
-* variables, getline command into, using: Getline/Variable. (line 6)
-* variables, getline command into, using <1>: Getline/Variable/File.
- (line 6)
-* variables, getline command into, using <2>: Getline/Variable/Pipe.
- (line 6)
-* variables, getline command into, using <3>: Getline/Variable/Coprocess.
- (line 6)
-* variables, global, for library functions: Library Names. (line 11)
-* variables, global, printing list of: Options. (line 94)
-* variables, initializing: Using Variables. (line 23)
-* variables, local to a function: Variable Scope. (line 6)
-* variables, predefined: Built-in Variables. (line 6)
-* variables, predefined -v option, setting with: Options. (line 41)
-* variables, predefined conveying information: Auto-set. (line 6)
-* variables, private: Library Names. (line 11)
-* variables, setting: Options. (line 32)
-* variables, shadowing: Definition Syntax. (line 77)
-* variables, types of: Assignment Ops. (line 39)
-* variables, types of, comparison expressions and: Typing and Comparison.
- (line 9)
-* variables, uninitialized, as array subscripts: Uninitialized Subscripts.
- (line 6)
-* variables, user-defined: Variables. (line 6)
-* version of gawk: Auto-set. (line 221)
-* version of gawk extension API: Auto-set. (line 246)
-* version of GNU MP library: Auto-set. (line 229)
-* version of GNU MPFR library: Auto-set. (line 231)
-* vertical bar (|): Regexp Operators. (line 70)
-* vertical bar (|), | operator (I/O): Getline/Pipe. (line 10)
-* vertical bar (|), | operator (I/O) <1>: Precedence. (line 64)
-* vertical bar (|), |& operator (I/O): Getline/Coprocess. (line 6)
-* vertical bar (|), |& operator (I/O) <1>: Precedence. (line 64)
-* vertical bar (|), |& operator (I/O) <2>: Two-way I/O. (line 27)
-* vertical bar (|), || operator: Boolean Ops. (line 59)
-* vertical bar (|), || operator <1>: Precedence. (line 88)
-* Vinschen, Corinna: Acknowledgments. (line 60)
-* w debugger command (alias for watch): Viewing And Changing Data.
- (line 66)
-* w utility: Constant Size. (line 22)
-* wait() extension function: Extension Sample Fork.
- (line 22)
-* waitpid() extension function: Extension Sample Fork.
- (line 18)
-* walk_array() user-defined function: Walking Arrays. (line 14)
-* Wall, Larry: Array Intro. (line 6)
-* Wall, Larry <1>: Future Extensions. (line 6)
-* Wallin, Anders: Contributors. (line 104)
-* warnings, issuing: Options. (line 184)
-* watch debugger command: Viewing And Changing Data.
- (line 66)
-* watchpoint: Debugging Terms. (line 42)
-* wc utility: Wc Program. (line 6)
-* wc.awk program: Wc Program. (line 46)
-* Weinberger, Peter: History. (line 17)
-* Weinberger, Peter <1>: Contributors. (line 12)
-* where debugger command: Execution Stack. (line 13)
-* where debugger command (alias for backtrace): Execution Stack.
- (line 13)
-* while statement: While Statement. (line 6)
-* while statement, use of regexps in: Regexp Usage. (line 19)
-* whitespace, as field separators: Default Field Splitting.
- (line 6)
-* whitespace, functions, calling: Calling Built-in. (line 10)
-* whitespace, newlines as: Options. (line 263)
-* Williams, Kent: Contributors. (line 35)
-* Woehlke, Matthew: Contributors. (line 80)
-* Woods, John: Contributors. (line 28)
-* word boundaries, matching: GNU Regexp Operators.
- (line 41)
-* word, regexp definition of: GNU Regexp Operators.
- (line 6)
-* word-boundary operator (gawk): GNU Regexp Operators.
- (line 66)
-* wordfreq.awk program: Word Sorting. (line 56)
-* words, counting: Wc Program. (line 6)
-* words, duplicate, searching for: Dupword Program. (line 6)
-* words, usage counts, generating: Word Sorting. (line 6)
-* writea() extension function: Extension Sample Read write array.
- (line 12)
-* xgettext utility: String Extraction. (line 13)
-* xor: Bitwise Functions. (line 57)
-* XOR bitwise operation: Bitwise Functions. (line 6)
-* Yawitz, Efraim: Contributors. (line 132)
-* Zaretskii, Eli: Acknowledgments. (line 60)
-* Zaretskii, Eli <1>: Contributors. (line 56)
-* Zaretskii, Eli <2>: Maintainers. (line 14)
-* zerofile.awk program: Empty Files. (line 20)
-* Zoulas, Christos: Contributors. (line 67)
-
-
-
-Tag Table:
-Node: Top1200
-Node: Foreword342530
-Node: Foreword446972
-Node: Preface48504
-Ref: Preface-Footnote-151363
-Ref: Preface-Footnote-251470
-Ref: Preface-Footnote-351704
-Node: History51846
-Node: Names54198
-Ref: Names-Footnote-155292
-Node: This Manual55439
-Ref: This Manual-Footnote-161924
-Node: Conventions62024
-Node: Manual History64378
-Ref: Manual History-Footnote-167373
-Ref: Manual History-Footnote-267414
-Node: How To Contribute67488
-Node: Acknowledgments68617
-Node: Getting Started73503
-Node: Running gawk75942
-Node: One-shot77132
-Node: Read Terminal78395
-Node: Long80388
-Node: Executable Scripts81901
-Ref: Executable Scripts-Footnote-184696
-Node: Comments84799
-Node: Quoting87283
-Node: DOS Quoting92800
-Node: Sample Data Files93475
-Node: Very Simple96070
-Node: Two Rules100972
-Node: More Complex102857
-Node: Statements/Lines105723
-Ref: Statements/Lines-Footnote-1110182
-Node: Other Features110447
-Node: When111383
-Ref: When-Footnote-1113137
-Node: Intro Summary113202
-Node: Invoking Gawk114086
-Node: Command Line115600
-Node: Options116398
-Ref: Options-Footnote-1132497
-Ref: Options-Footnote-2132727
-Node: Other Arguments132752
-Node: Naming Standard Input135699
-Node: Environment Variables136792
-Node: AWKPATH Variable137350
-Ref: AWKPATH Variable-Footnote-1140761
-Ref: AWKPATH Variable-Footnote-2140795
-Node: AWKLIBPATH Variable141056
-Node: Other Environment Variables142313
-Node: Exit Status146134
-Node: Include Files146811
-Node: Loading Shared Libraries150406
-Node: Obsolete151834
-Node: Undocumented152526
-Node: Invoking Summary152823
-Node: Regexp154483
-Node: Regexp Usage156002
-Node: Escape Sequences158039
-Node: Regexp Operators164271
-Ref: Regexp Operators-Footnote-1171687
-Ref: Regexp Operators-Footnote-2171834
-Node: Bracket Expressions171932
-Ref: table-char-classes174408
-Node: Leftmost Longest177545
-Node: Computed Regexps178848
-Node: GNU Regexp Operators182275
-Node: Case-sensitivity185954
-Ref: Case-sensitivity-Footnote-1188850
-Ref: Case-sensitivity-Footnote-2189085
-Node: Strong Regexp Constants189193
-Node: Regexp Summary189982
-Node: Reading Files191457
-Node: Records193620
-Node: awk split records194353
-Node: gawk split records199284
-Ref: gawk split records-Footnote-1203824
-Node: Fields203861
-Node: Nonconstant Fields206602
-Ref: Nonconstant Fields-Footnote-1208838
-Node: Changing Fields209042
-Node: Field Separators214970
-Node: Default Field Splitting217668
-Node: Regexp Field Splitting218786
-Node: Single Character Fields222139
-Node: Command Line Field Separator223199
-Node: Full Line Fields226417
-Ref: Full Line Fields-Footnote-1227939
-Ref: Full Line Fields-Footnote-2227985
-Node: Field Splitting Summary228086
-Node: Constant Size230160
-Node: Splitting By Content234738
-Ref: Splitting By Content-Footnote-1238709
-Node: Multiple Line238872
-Ref: Multiple Line-Footnote-1244754
-Node: Getline244933
-Node: Plain Getline247400
-Node: Getline/Variable250039
-Node: Getline/File251188
-Node: Getline/Variable/File252574
-Ref: Getline/Variable/File-Footnote-1254177
-Node: Getline/Pipe254265
-Node: Getline/Variable/Pipe256970
-Node: Getline/Coprocess258103
-Node: Getline/Variable/Coprocess259368
-Node: Getline Notes260108
-Node: Getline Summary262903
-Ref: table-getline-variants263325
-Node: Read Timeout264073
-Ref: Read Timeout-Footnote-1267979
-Node: Retrying Input268037
-Node: Command-line directories269236
-Node: Input Summary270142
-Node: Input Exercises273314
-Node: Printing274042
-Node: Print275876
-Node: Print Examples277333
-Node: Output Separators280113
-Node: OFMT282130
-Node: Printf283486
-Node: Basic Printf284271
-Node: Control Letters285845
-Node: Format Modifiers289833
-Node: Printf Examples295848
-Node: Redirection298334
-Node: Special FD305175
-Ref: Special FD-Footnote-1308343
-Node: Special Files308417
-Node: Other Inherited Files309034
-Node: Special Network310035
-Node: Special Caveats310895
-Node: Close Files And Pipes311844
-Ref: table-close-pipe-return-values318751
-Ref: Close Files And Pipes-Footnote-1319534
-Ref: Close Files And Pipes-Footnote-2319682
-Node: Nonfatal319834
-Node: Output Summary322159
-Node: Output Exercises323381
-Node: Expressions324060
-Node: Values325248
-Node: Constants325926
-Node: Scalar Constants326617
-Ref: Scalar Constants-Footnote-1327481
-Node: Nondecimal-numbers327731
-Node: Regexp Constants330744
-Node: Using Constant Regexps331270
-Node: Variables334433
-Node: Using Variables335090
-Node: Assignment Options337000
-Node: Conversion338873
-Node: Strings And Numbers339397
-Ref: Strings And Numbers-Footnote-1342460
-Node: Locale influences conversions342569
-Ref: table-locale-affects345327
-Node: All Operators345945
-Node: Arithmetic Ops346574
-Node: Concatenation349080
-Ref: Concatenation-Footnote-1351927
-Node: Assignment Ops352034
-Ref: table-assign-ops357025
-Node: Increment Ops358338
-Node: Truth Values and Conditions361798
-Node: Truth Values362872
-Node: Typing and Comparison363920
-Node: Variable Typing364740
-Node: Comparison Operators368364
-Ref: table-relational-ops368783
-Node: POSIX String Comparison372278
-Ref: POSIX String Comparison-Footnote-1373973
-Ref: POSIX String Comparison-Footnote-2374112
-Node: Boolean Ops374196
-Ref: Boolean Ops-Footnote-1378678
-Node: Conditional Exp378770
-Node: Function Calls380506
-Node: Precedence384383
-Node: Locales388042
-Node: Expressions Summary389674
-Node: Patterns and Actions392247
-Node: Pattern Overview393367
-Node: Regexp Patterns395044
-Node: Expression Patterns395586
-Node: Ranges399367
-Node: BEGIN/END402475
-Node: Using BEGIN/END403236
-Ref: Using BEGIN/END-Footnote-1405972
-Node: I/O And BEGIN/END406078
-Node: BEGINFILE/ENDFILE408392
-Node: Empty411299
-Node: Using Shell Variables411616
-Node: Action Overview413890
-Node: Statements416215
-Node: If Statement418063
-Node: While Statement419558
-Node: Do Statement421586
-Node: For Statement422734
-Node: Switch Statement425892
-Node: Break Statement428278
-Node: Continue Statement430370
-Node: Next Statement432197
-Node: Nextfile Statement434580
-Node: Exit Statement437232
-Node: Built-in Variables439635
-Node: User-modified440768
-Node: Auto-set448354
-Ref: Auto-set-Footnote-1463007
-Ref: Auto-set-Footnote-2463213
-Node: ARGC and ARGV463269
-Node: Pattern Action Summary467482
-Node: Arrays469912
-Node: Array Basics471241
-Node: Array Intro472085
-Ref: figure-array-elements474060
-Ref: Array Intro-Footnote-1476764
-Node: Reference to Elements476892
-Node: Assigning Elements479356
-Node: Array Example479847
-Node: Scanning an Array481606
-Node: Controlling Scanning484628
-Ref: Controlling Scanning-Footnote-1490027
-Node: Numeric Array Subscripts490343
-Node: Uninitialized Subscripts492527
-Node: Delete494146
-Ref: Delete-Footnote-1496898
-Node: Multidimensional496955
-Node: Multiscanning500050
-Node: Arrays of Arrays501641
-Node: Arrays Summary506408
-Node: Functions508501
-Node: Built-in509539
-Node: Calling Built-in510620
-Node: Numeric Functions512616
-Ref: Numeric Functions-Footnote-1517449
-Ref: Numeric Functions-Footnote-2517806
-Ref: Numeric Functions-Footnote-3517854
-Node: String Functions518126
-Ref: String Functions-Footnote-1541630
-Ref: String Functions-Footnote-2541758
-Ref: String Functions-Footnote-3542006
-Node: Gory Details542093
-Ref: table-sub-escapes543884
-Ref: table-sub-proposed545403
-Ref: table-posix-sub546766
-Ref: table-gensub-escapes548307
-Ref: Gory Details-Footnote-1549130
-Node: I/O Functions549284
-Ref: table-system-return-values555866
-Ref: I/O Functions-Footnote-1557846
-Ref: I/O Functions-Footnote-2557994
-Node: Time Functions558114
-Ref: Time Functions-Footnote-1568636
-Ref: Time Functions-Footnote-2568704
-Ref: Time Functions-Footnote-3568862
-Ref: Time Functions-Footnote-4568973
-Ref: Time Functions-Footnote-5569085
-Ref: Time Functions-Footnote-6569312
-Node: Bitwise Functions569578
-Ref: table-bitwise-ops570172
-Ref: Bitwise Functions-Footnote-1574510
-Node: Type Functions574683
-Node: I18N Functions577215
-Node: User-defined578866
-Node: Definition Syntax579671
-Ref: Definition Syntax-Footnote-1585358
-Node: Function Example585429
-Ref: Function Example-Footnote-1588351
-Node: Function Caveats588373
-Node: Calling A Function588891
-Node: Variable Scope589849
-Node: Pass By Value/Reference592843
-Node: Return Statement596342
-Node: Dynamic Typing599321
-Node: Indirect Calls600251
-Ref: Indirect Calls-Footnote-1610502
-Node: Functions Summary610630
-Node: Library Functions613335
-Ref: Library Functions-Footnote-1616942
-Ref: Library Functions-Footnote-2617085
-Node: Library Names617256
-Ref: Library Names-Footnote-1620716
-Ref: Library Names-Footnote-2620939
-Node: General Functions621025
-Node: Strtonum Function622128
-Node: Assert Function625150
-Node: Round Function628476
-Node: Cliff Random Function630017
-Node: Ordinal Functions631033
-Ref: Ordinal Functions-Footnote-1634096
-Ref: Ordinal Functions-Footnote-2634348
-Node: Join Function634558
-Ref: Join Function-Footnote-1636328
-Node: Getlocaltime Function636528
-Node: Readfile Function640270
-Node: Shell Quoting642242
-Node: Data File Management643643
-Node: Filetrans Function644275
-Node: Rewind Function648371
-Node: File Checking650277
-Ref: File Checking-Footnote-1651611
-Node: Empty Files651812
-Node: Ignoring Assigns653791
-Node: Getopt Function655341
-Ref: Getopt Function-Footnote-1666810
-Node: Passwd Functions667010
-Ref: Passwd Functions-Footnote-1675849
-Node: Group Functions675937
-Ref: Group Functions-Footnote-1683835
-Node: Walking Arrays684042
-Node: Library Functions Summary687050
-Node: Library Exercises688456
-Node: Sample Programs688921
-Node: Running Examples689691
-Node: Clones690419
-Node: Cut Program691643
-Node: Egrep Program701572
-Ref: Egrep Program-Footnote-1709084
-Node: Id Program709194
-Node: Split Program712874
-Ref: Split Program-Footnote-1716333
-Node: Tee Program716462
-Node: Uniq Program719252
-Node: Wc Program726678
-Ref: Wc Program-Footnote-1730933
-Node: Miscellaneous Programs731027
-Node: Dupword Program732240
-Node: Alarm Program734270
-Node: Translate Program739125
-Ref: Translate Program-Footnote-1743690
-Node: Labels Program743960
-Ref: Labels Program-Footnote-1747311
-Node: Word Sorting747395
-Node: History Sorting751467
-Node: Extract Program753302
-Node: Simple Sed760831
-Node: Igawk Program763905
-Ref: Igawk Program-Footnote-1778236
-Ref: Igawk Program-Footnote-2778438
-Ref: Igawk Program-Footnote-3778560
-Node: Anagram Program778675
-Node: Signature Program781737
-Node: Programs Summary782984
-Node: Programs Exercises784198
-Ref: Programs Exercises-Footnote-1788327
-Node: Advanced Features788418
-Node: Nondecimal Data790408
-Node: Array Sorting791999
-Node: Controlling Array Traversal792699
-Ref: Controlling Array Traversal-Footnote-1801066
-Node: Array Sorting Functions801184
-Ref: Array Sorting Functions-Footnote-1806275
-Node: Two-way I/O806471
-Ref: Two-way I/O-Footnote-1813021
-Ref: Two-way I/O-Footnote-2813208
-Node: TCP/IP Networking813290
-Node: Profiling816408
-Ref: Profiling-Footnote-1824901
-Node: Advanced Features Summary825224
-Node: Internationalization827068
-Node: I18N and L10N828548
-Node: Explaining gettext829235
-Ref: Explaining gettext-Footnote-1835127
-Ref: Explaining gettext-Footnote-2835312
-Node: Programmer i18n835477
-Ref: Programmer i18n-Footnote-1840332
-Node: Translator i18n840381
-Node: String Extraction841175
-Ref: String Extraction-Footnote-1842307
-Node: Printf Ordering842393
-Ref: Printf Ordering-Footnote-1845179
-Node: I18N Portability845243
-Ref: I18N Portability-Footnote-1847699
-Node: I18N Example847762
-Ref: I18N Example-Footnote-1850568
-Node: Gawk I18N850641
-Node: I18N Summary851286
-Node: Debugger852627
-Node: Debugging853649
-Node: Debugging Concepts854090
-Node: Debugging Terms855899
-Node: Awk Debugging858474
-Node: Sample Debugging Session859380
-Node: Debugger Invocation859914
-Node: Finding The Bug861300
-Node: List of Debugger Commands867778
-Node: Breakpoint Control869111
-Node: Debugger Execution Control872805
-Node: Viewing And Changing Data876167
-Node: Execution Stack879541
-Node: Debugger Info881178
-Node: Miscellaneous Debugger Commands885249
-Node: Readline Support890337
-Node: Limitations891233
-Ref: Limitations-Footnote-1895464
-Node: Debugging Summary895515
-Node: Arbitrary Precision Arithmetic896794
-Node: Computer Arithmetic898210
-Ref: table-numeric-ranges901801
-Ref: Computer Arithmetic-Footnote-1902523
-Node: Math Definitions902580
-Ref: table-ieee-formats905894
-Ref: Math Definitions-Footnote-1906497
-Node: MPFR features906602
-Node: FP Math Caution908319
-Ref: FP Math Caution-Footnote-1909391
-Node: Inexactness of computations909760
-Node: Inexact representation910720
-Node: Comparing FP Values912080
-Node: Errors accumulate913162
-Node: Getting Accuracy914595
-Node: Try To Round917305
-Node: Setting precision918204
-Ref: table-predefined-precision-strings918901
-Node: Setting the rounding mode920731
-Ref: table-gawk-rounding-modes921105
-Ref: Setting the rounding mode-Footnote-1924513
-Node: Arbitrary Precision Integers924692
-Ref: Arbitrary Precision Integers-Footnote-1929609
-Node: POSIX Floating Point Problems929758
-Ref: POSIX Floating Point Problems-Footnote-1933640
-Node: Floating point summary933678
-Node: Dynamic Extensions935868
-Node: Extension Intro937421
-Node: Plugin License938687
-Node: Extension Mechanism Outline939484
-Ref: figure-load-extension939923
-Ref: figure-register-new-function941488
-Ref: figure-call-new-function942580
-Node: Extension API Description944642
-Node: Extension API Functions Introduction946174
-Node: General Data Types951033
-Ref: General Data Types-Footnote-1956988
-Node: Memory Allocation Functions957287
-Ref: Memory Allocation Functions-Footnote-1960132
-Node: Constructor Functions960231
-Node: Registration Functions961976
-Node: Extension Functions962661
-Node: Exit Callback Functions965284
-Node: Extension Version String966534
-Node: Input Parsers967197
-Node: Output Wrappers977079
-Node: Two-way processors981591
-Node: Printing Messages983856
-Ref: Printing Messages-Footnote-1985027
-Node: Updating ERRNO985180
-Node: Requesting Values985919
-Ref: table-value-types-returned986656
-Node: Accessing Parameters987539
-Node: Symbol Table Access988774
-Node: Symbol table by name989286
-Node: Symbol table by cookie991307
-Ref: Symbol table by cookie-Footnote-1995459
-Node: Cached values995523
-Ref: Cached values-Footnote-1999030
-Node: Array Manipulation999121
-Ref: Array Manipulation-Footnote-11000212
-Node: Array Data Types1000249
-Ref: Array Data Types-Footnote-11002907
-Node: Array Functions1002999
-Node: Flattening Arrays1006857
-Node: Creating Arrays1013765
-Node: Redirection API1018534
-Node: Extension API Variables1021365
-Node: Extension Versioning1021998
-Ref: gawk-api-version1022435
-Node: Extension API Informational Variables1024191
-Node: Extension API Boilerplate1025255
-Node: Finding Extensions1029069
-Node: Extension Example1029628
-Node: Internal File Description1030426
-Node: Internal File Ops1034506
-Ref: Internal File Ops-Footnote-11046268
-Node: Using Internal File Ops1046408
-Ref: Using Internal File Ops-Footnote-11048791
-Node: Extension Samples1049065
-Node: Extension Sample File Functions1050594
-Node: Extension Sample Fnmatch1058243
-Node: Extension Sample Fork1059730
-Node: Extension Sample Inplace1060948
-Node: Extension Sample Ord1064158
-Node: Extension Sample Readdir1064994
-Ref: table-readdir-file-types1065883
-Node: Extension Sample Revout1066688
-Node: Extension Sample Rev2way1067277
-Node: Extension Sample Read write array1068017
-Node: Extension Sample Readfile1069959
-Node: Extension Sample Time1071054
-Node: Extension Sample API Tests1072402
-Node: gawkextlib1072894
-Node: Extension summary1075341
-Node: Extension Exercises1079043
-Node: Language History1080541
-Node: V7/SVR3.11082197
-Node: SVR41084349
-Node: POSIX1085783
-Node: BTL1087162
-Node: POSIX/GNU1087891
-Node: Feature History1093753
-Node: Common Extensions1108123
-Node: Ranges and Locales1109406
-Ref: Ranges and Locales-Footnote-11114022
-Ref: Ranges and Locales-Footnote-21114049
-Ref: Ranges and Locales-Footnote-31114284
-Node: Contributors1114505
-Node: History summary1120065
-Node: Installation1121445
-Node: Gawk Distribution1122389
-Node: Getting1122873
-Node: Extracting1123834
-Node: Distribution contents1125472
-Node: Unix Installation1131557
-Node: Quick Installation1132239
-Node: Shell Startup Files1134653
-Node: Additional Configuration Options1135731
-Node: Configuration Philosophy1137536
-Node: Non-Unix Installation1139905
-Node: PC Installation1140365
-Node: PC Binary Installation1141203
-Node: PC Compiling1141638
-Node: PC Using1142755
-Node: Cygwin1145800
-Node: MSYS1146570
-Node: VMS Installation1147071
-Node: VMS Compilation1147862
-Ref: VMS Compilation-Footnote-11149091
-Node: VMS Dynamic Extensions1149149
-Node: VMS Installation Details1150834
-Node: VMS Running1153087
-Node: VMS GNV1157366
-Node: VMS Old Gawk1158101
-Node: Bugs1158572
-Node: Bug address1159235
-Node: Usenet1161632
-Node: Maintainers1162407
-Node: Other Versions1163783
-Node: Installation summary1170367
-Node: Notes1171402
-Node: Compatibility Mode1172267
-Node: Additions1173049
-Node: Accessing The Source1173974
-Node: Adding Code1175409
-Node: New Ports1181628
-Node: Derived Files1186116
-Ref: Derived Files-Footnote-11191601
-Ref: Derived Files-Footnote-21191636
-Ref: Derived Files-Footnote-31192234
-Node: Future Extensions1192348
-Node: Implementation Limitations1193006
-Node: Extension Design1194189
-Node: Old Extension Problems1195343
-Ref: Old Extension Problems-Footnote-11196861
-Node: Extension New Mechanism Goals1196918
-Ref: Extension New Mechanism Goals-Footnote-11200282
-Node: Extension Other Design Decisions1200471
-Node: Extension Future Growth1202584
-Node: Old Extension Mechanism1203420
-Node: Notes summary1205183
-Node: Basic Concepts1206365
-Node: Basic High Level1207046
-Ref: figure-general-flow1207328
-Ref: figure-process-flow1208013
-Ref: Basic High Level-Footnote-11211314
-Node: Basic Data Typing1211499
-Node: Glossary1214827
-Node: Copying1246774
-Node: GNU Free Documentation License1284313
-Node: Index1309431
-
-End Tag Table
diff --git a/doc/gawk.texi b/doc/gawk.texi
index adc5c917..3c31cef5 100644
--- a/doc/gawk.texi
+++ b/doc/gawk.texi
@@ -19379,12 +19379,12 @@ Return the value of @var{val}, shifted right by @var{count} bits.
Return the bitwise XOR of the arguments. There must be at least two.
@end table
-For all of these functions, first the double-precision floating-point value is
-converted to the widest C unsigned integer type, then the bitwise operation is
-performed. If the result cannot be represented exactly as a C @code{double},
-leading nonzero bits are removed one by one until it can be represented
-exactly. The result is then converted back into a C @code{double}. (If
-you don't understand this paragraph, don't worry about it.)
+@quotation CAUTION
+Beginning with @command{gawk} @value{VERSION} 4.2, negative
+operands are not allowed for any of these functions. A negative
+operand produces a fatal error. See the sidebar
+``Beware The Smoke and Mirrors!'' for more information as to why.
+@end quotation
Here is a user-defined function (@pxref{User-defined})
that illustrates the use of these functions:
@@ -19489,6 +19489,128 @@ decimal and octal values for the same numbers
and then demonstrates the
results of the @code{compl()}, @code{lshift()}, and @code{rshift()} functions.
+@cindex sidebar, Beware The Smoke and Mirrors!
+@ifdocbook
+@docbook
+<sidebar><title>Beware The Smoke and Mirrors!</title>
+@end docbook
+
+
+It other languages, bitwise operations are performed on integer values,
+not floating-point values. As a general statement, such operations work
+best when performed on unsigned integers.
+
+@command{gawk} attempts to treat the arguments to the bitwise functions
+as unsigned integers. For this reason, negative arguments produce a
+fatal error.
+
+In normal operation, for all of these functions, first the
+double-precision floating-point value is converted to the widest C
+unsigned integer type, then the bitwise operation is performed. If the
+result cannot be represented exactly as a C @code{double}, leading
+nonzero bits are removed one by one until it can be represented exactly.
+The result is then converted back into a C @code{double}.@footnote{If you don't
+understand this paragraph, the upshot is that @command{gawk} can only
+store a particular range of integer values; numbers outside that range
+are reduced to fit within the range.}
+
+However, when using arbitrary precision arithmetic with the @option{-M}
+option (@pxref{Arbitrary Precision Arithmetic}), the results may differ.
+This is particularly noticable with the @code{compl()} function:
+
+@example
+$ @kbd{gawk 'BEGIN @{ print compl(42) @}'}
+@print{} 9007199254740949
+$ @kbd{gawk -M 'BEGIN @{ print compl(42) @}'}
+@print{} -43
+@end example
+
+What's going on becomes clear when printing the results
+in hexadecimal:
+
+@example
+$ @kbd{gawk 'BEGIN @{ printf "%#x\n", compl(42) @}'}
+@print{} 0x1fffffffffffd5
+$ @kbd{gawk -M 'BEGIN @{ printf "%#x\n", compl(42) @}'}
+@print{} 0xffffffffffffffd5
+@end example
+
+When using the @option{-M} option, under the hood, @command{gawk} uses
+GNU MP arbitrary precision integers which have at least 64 bits of precision.
+When not using @option{-M}, @command{gawk} stores integral values in
+regular double-precision floating point, which only maintain 53 bits of
+precision. Furthermore, the GNU MP library treats (or least seems to treat)
+the leading bit as a sign bit; thus the result with @option{-M} in this case is
+a negative number.
+
+In short, using @command{gawk} for any but the simplest kind of bitwise
+operations is probably a bad idea; caveat emptor!
+
+
+@docbook
+</sidebar>
+@end docbook
+@end ifdocbook
+
+@ifnotdocbook
+@cartouche
+@center @b{Beware The Smoke and Mirrors!}
+
+
+
+It other languages, bitwise operations are performed on integer values,
+not floating-point values. As a general statement, such operations work
+best when performed on unsigned integers.
+
+@command{gawk} attempts to treat the arguments to the bitwise functions
+as unsigned integers. For this reason, negative arguments produce a
+fatal error.
+
+In normal operation, for all of these functions, first the
+double-precision floating-point value is converted to the widest C
+unsigned integer type, then the bitwise operation is performed. If the
+result cannot be represented exactly as a C @code{double}, leading
+nonzero bits are removed one by one until it can be represented exactly.
+The result is then converted back into a C @code{double}.@footnote{If you don't
+understand this paragraph, the upshot is that @command{gawk} can only
+store a particular range of integer values; numbers outside that range
+are reduced to fit within the range.}
+
+However, when using arbitrary precision arithmetic with the @option{-M}
+option (@pxref{Arbitrary Precision Arithmetic}), the results may differ.
+This is particularly noticable with the @code{compl()} function:
+
+@example
+$ @kbd{gawk 'BEGIN @{ print compl(42) @}'}
+@print{} 9007199254740949
+$ @kbd{gawk -M 'BEGIN @{ print compl(42) @}'}
+@print{} -43
+@end example
+
+What's going on becomes clear when printing the results
+in hexadecimal:
+
+@example
+$ @kbd{gawk 'BEGIN @{ printf "%#x\n", compl(42) @}'}
+@print{} 0x1fffffffffffd5
+$ @kbd{gawk -M 'BEGIN @{ printf "%#x\n", compl(42) @}'}
+@print{} 0xffffffffffffffd5
+@end example
+
+When using the @option{-M} option, under the hood, @command{gawk} uses
+GNU MP arbitrary precision integers which have at least 64 bits of precision.
+When not using @option{-M}, @command{gawk} stores integral values in
+regular double-precision floating point, which only maintain 53 bits of
+precision. Furthermore, the GNU MP library treats (or least seems to treat)
+the leading bit as a sign bit; thus the result with @option{-M} in this case is
+a negative number.
+
+In short, using @command{gawk} for any but the simplest kind of bitwise
+operations is probably a bad idea; caveat emptor!
+
+@end cartouche
+@end ifnotdocbook
+
@node Type Functions
@subsection Getting Type Information
diff --git a/doc/gawkinet.info b/doc/gawkinet.info
deleted file mode 100644
index d5a7abf8..00000000
--- a/doc/gawkinet.info
+++ /dev/null
@@ -1,4406 +0,0 @@
-This is gawkinet.info, produced by makeinfo version 6.1 from
-gawkinet.texi.
-
-This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the
-4.1.4 (or later) version of the GNU implementation of AWK.
-
-
- Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software
-Foundation, Inc.
-
-
- Permission is granted to copy, distribute and/or modify this document
-under the terms of the GNU Free Documentation License, Version 1.3 or
-any later version published by the Free Software Foundation; with the
-Invariant Sections being "GNU General Public License", the Front-Cover
-texts being (a) (see below), and with the Back-Cover Texts being (b)
-(see below). A copy of the license is included in the section entitled
-"GNU Free Documentation License".
-
- a. "A GNU Manual"
-
- b. "You have the freedom to copy and modify this GNU manual. Buying
- copies from the FSF supports it in developing GNU and promoting
- software freedom."
-INFO-DIR-SECTION Network applications
-START-INFO-DIR-ENTRY
-* Gawkinet: (gawkinet). TCP/IP Internetworking With 'gawk'.
-END-INFO-DIR-ENTRY
-
- This file documents the networking features in GNU 'awk'.
-
- This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the
-4.1.4 (or later) version of the GNU implementation of AWK.
-
-
- Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software
-Foundation, Inc.
-
-
- Permission is granted to copy, distribute and/or modify this document
-under the terms of the GNU Free Documentation License, Version 1.3 or
-any later version published by the Free Software Foundation; with the
-Invariant Sections being "GNU General Public License", the Front-Cover
-texts being (a) (see below), and with the Back-Cover Texts being (b)
-(see below). A copy of the license is included in the section entitled
-"GNU Free Documentation License".
-
- a. "A GNU Manual"
-
- b. "You have the freedom to copy and modify this GNU manual. Buying
- copies from the FSF supports it in developing GNU and promoting
- software freedom."
-
-
-File: gawkinet.info, Node: Top, Next: Preface, Prev: (dir), Up: (dir)
-
-General Introduction
-********************
-
-This file documents the networking features in GNU Awk ('gawk') version
-4.0 and later.
-
- This is Edition 1.4 of 'TCP/IP Internetworking with 'gawk'', for the
-4.1.4 (or later) version of the GNU implementation of AWK.
-
-
- Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016 Free Software
-Foundation, Inc.
-
-
- Permission is granted to copy, distribute and/or modify this document
-under the terms of the GNU Free Documentation License, Version 1.3 or
-any later version published by the Free Software Foundation; with the
-Invariant Sections being "GNU General Public License", the Front-Cover
-texts being (a) (see below), and with the Back-Cover Texts being (b)
-(see below). A copy of the license is included in the section entitled
-"GNU Free Documentation License".
-
- a. "A GNU Manual"
-
- b. "You have the freedom to copy and modify this GNU manual. Buying
- copies from the FSF supports it in developing GNU and promoting
- software freedom."
-
-* Menu:
-
-* Preface:: About this document.
-* Introduction:: About networking.
-* Using Networking:: Some examples.
-* Some Applications and Techniques:: More extended examples.
-* Links:: Where to find the stuff mentioned in this
- document.
-* GNU Free Documentation License:: The license for this document.
-* Index:: The index.
-
-* Stream Communications:: Sending data streams.
-* Datagram Communications:: Sending self-contained messages.
-* The TCP/IP Protocols:: How these models work in the Internet.
-* Basic Protocols:: The basic protocols.
-* Ports:: The idea behind ports.
-* Making Connections:: Making TCP/IP connections.
-* Gawk Special Files:: How to do 'gawk' networking.
-* Special File Fields:: The fields in the special file name.
-* Comparing Protocols:: Differences between the protocols.
-* File /inet/tcp:: The TCP special file.
-* File /inet/udp:: The UDP special file.
-* TCP Connecting:: Making a TCP connection.
-* Troubleshooting:: Troubleshooting TCP/IP connections.
-* Interacting:: Interacting with a service.
-* Setting Up:: Setting up a service.
-* Email:: Reading email.
-* Web page:: Reading a Web page.
-* Primitive Service:: A primitive Web service.
-* Interacting Service:: A Web service with interaction.
-* CGI Lib:: A simple CGI library.
-* Simple Server:: A simple Web server.
-* Caveats:: Network programming caveats.
-* Challenges:: Where to go from here.
-* PANIC:: An Emergency Web Server.
-* GETURL:: Retrieving Web Pages.
-* REMCONF:: Remote Configuration Of Embedded Systems.
-* URLCHK:: Look For Changed Web Pages.
-* WEBGRAB:: Extract Links From A Page.
-* STATIST:: Graphing A Statistical Distribution.
-* MAZE:: Walking Through A Maze In Virtual Reality.
-* MOBAGWHO:: A Simple Mobile Agent.
-* STOXPRED:: Stock Market Prediction As A Service.
-* PROTBASE:: Searching Through A Protein Database.
-
-
-File: gawkinet.info, Node: Preface, Next: Introduction, Prev: Top, Up: Top
-
-Preface
-*******
-
-In May of 1997, Ju"rgen Kahrs felt the need for network access from
-'awk', and, with a little help from me, set about adding features to do
-this for 'gawk'. At that time, he wrote the bulk of this Info file.
-
- The code and documentation were added to the 'gawk' 3.1 development
-tree, and languished somewhat until I could finally get down to some
-serious work on that version of 'gawk'. This finally happened in the
-middle of 2000.
-
- Meantime, Ju"rgen wrote an article about the Internet special files
-and '|&' operator for 'Linux Journal', and made a networking patch for
-the production versions of 'gawk' available from his home page. In
-August of 2000 (for 'gawk' 3.0.6), this patch also made it to the main
-GNU 'ftp' distribution site.
-
- For release with 'gawk', I edited Ju"rgen's prose for English grammar
-and style, as he is not a native English speaker. I also rearranged the
-material somewhat for what I felt was a better order of presentation,
-and (re)wrote some of the introductory material.
-
- The majority of this document and the code are his work, and the high
-quality and interesting ideas speak for themselves. It is my hope that
-these features will be of significant value to the 'awk' community.
-
-
-Arnold Robbins
-Nof Ayalon, ISRAEL
-March, 2001
-
-
-File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Preface, Up: Top
-
-1 Networking Concepts
-*********************
-
-This major node provides a (necessarily) brief introduction to computer
-networking concepts. For many applications of 'gawk' to TCP/IP
-networking, we hope that this is enough. For more advanced tasks, you
-will need deeper background, and it may be necessary to switch to
-lower-level programming in C or C++.
-
- There are two real-life models for the way computers send messages to
-each other over a network. While the analogies are not perfect, they
-are close enough to convey the major concepts. These two models are the
-phone system (reliable byte-stream communications), and the postal
-system (best-effort datagrams).
-
-* Menu:
-
-* Stream Communications:: Sending data streams.
-* Datagram Communications:: Sending self-contained messages.
-* The TCP/IP Protocols:: How these models work in the Internet.
-* Making Connections:: Making TCP/IP connections.
-
-
-File: gawkinet.info, Node: Stream Communications, Next: Datagram Communications, Prev: Introduction, Up: Introduction
-
-1.1 Reliable Byte-streams (Phone Calls)
-=======================================
-
-When you make a phone call, the following steps occur:
-
- 1. You dial a number.
-
- 2. The phone system connects to the called party, telling them there
- is an incoming call. (Their phone rings.)
-
- 3. The other party answers the call, or, in the case of a computer
- network, refuses to answer the call.
-
- 4. Assuming the other party answers, the connection between you is now
- a "duplex" (two-way), "reliable" (no data lost), sequenced (data
- comes out in the order sent) data stream.
-
- 5. You and your friend may now talk freely, with the phone system
- moving the data (your voices) from one end to the other. From your
- point of view, you have a direct end-to-end connection with the
- person on the other end.
-
- The same steps occur in a duplex reliable computer networking
-connection. There is considerably more overhead in setting up the
-communications, but once it's done, data moves in both directions,
-reliably, in sequence.
-
-
-File: gawkinet.info, Node: Datagram Communications, Next: The TCP/IP Protocols, Prev: Stream Communications, Up: Introduction
-
-1.2 Best-effort Datagrams (Mailed Letters)
-==========================================
-
-Suppose you mail three different documents to your office on the other
-side of the country on two different days. Doing so entails the
-following.
-
- 1. Each document travels in its own envelope.
-
- 2. Each envelope contains both the sender and the recipient address.
-
- 3. Each envelope may travel a different route to its destination.
-
- 4. The envelopes may arrive in a different order from the one in which
- they were sent.
-
- 5. One or more may get lost in the mail. (Although, fortunately, this
- does not occur very often.)
-
- 6. In a computer network, one or more "packets" may also arrive
- multiple times. (This doesn't happen with the postal system!)
-
- The important characteristics of datagram communications, like those
-of the postal system are thus:
-
- * Delivery is "best effort;" the data may never get there.
-
- * Each message is self-contained, including the source and
- destination addresses.
-
- * Delivery is _not_ sequenced; packets may arrive out of order,
- and/or multiple times.
-
- * Unlike the phone system, overhead is considerably lower. It is not
- necessary to set up the call first.
-
- The price the user pays for the lower overhead of datagram
-communications is exactly the lower reliability; it is often necessary
-for user-level protocols that use datagram communications to add their
-own reliability features on top of the basic communications.
-
-
-File: gawkinet.info, Node: The TCP/IP Protocols, Next: Making Connections, Prev: Datagram Communications, Up: Introduction
-
-1.3 The Internet Protocols
-==========================
-
-The Internet Protocol Suite (usually referred to as just TCP/IP)(1)
-consists of a number of different protocols at different levels or
-"layers." For our purposes, three protocols provide the fundamental
-communications mechanisms. All other defined protocols are referred to
-as user-level protocols (e.g., HTTP, used later in this Info file).
-
-* Menu:
-
-* Basic Protocols:: The basic protocols.
-* Ports:: The idea behind ports.
-
- ---------- Footnotes ----------
-
- (1) It should be noted that although the Internet seems to have
-conquered the world, there are other networking protocol suites in
-existence and in use.
-
-
-File: gawkinet.info, Node: Basic Protocols, Next: Ports, Prev: The TCP/IP Protocols, Up: The TCP/IP Protocols
-
-1.3.1 The Basic Internet Protocols
-----------------------------------
-
-IP
- The Internet Protocol. This protocol is almost never used directly
- by applications. It provides the basic packet delivery and routing
- infrastructure of the Internet. Much like the phone company's
- switching centers or the Post Office's trucks, it is not of much
- day-to-day interest to the regular user (or programmer). It
- happens to be a best effort datagram protocol. In the early
- twenty-first century, there are two versions of this protocol in
- use:
-
- IPv4
- The original version of the Internet Protocol, with 32-bit
- addresses, on which most of the current Internet is based.
-
- IPv6
- The "next generation" of the Internet Protocol, with 128-bit
- addresses. This protocol is in wide use in certain parts of
- the world, but has not yet replaced IPv4.(1)
-
- Versions of the other protocols that sit "atop" IP exist for both
- IPv4 and IPv6. However, as the IPv6 versions are fundamentally the
- same as the original IPv4 versions, we will not distinguish further
- between them.
-
-UDP
- The User Datagram Protocol. This is a best effort datagram
- protocol. It provides a small amount of extra reliability over IP,
- and adds the notion of "ports", described in *note TCP and UDP
- Ports: Ports.
-
-TCP
- The Transmission Control Protocol. This is a duplex, reliable,
- sequenced byte-stream protocol, again layered on top of IP, and
- also providing the notion of ports. This is the protocol that you
- will most likely use when using 'gawk' for network programming.
-
- All other user-level protocols use either TCP or UDP to do their
-basic communications. Examples are SMTP (Simple Mail Transfer
-Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer
-Protocol).
-
- ---------- Footnotes ----------
-
- (1) There isn't an IPv5.
-
-
-File: gawkinet.info, Node: Ports, Prev: Basic Protocols, Up: The TCP/IP Protocols
-
-1.3.2 TCP and UDP Ports
------------------------
-
-In the postal system, the address on an envelope indicates a physical
-location, such as a residence or office building. But there may be more
-than one person at the location; thus you have to further quantify the
-recipient by putting a person or company name on the envelope.
-
- In the phone system, one phone number may represent an entire
-company, in which case you need a person's extension number in order to
-reach that individual directly. Or, when you call a home, you have to
-say, "May I please speak to ..." before talking to the person directly.
-
- IP networking provides the concept of addressing. An IP address
-represents a particular computer, but no more. In order to reach the
-mail service on a system, or the FTP or WWW service on a system, you
-must have some way to further specify which service you want. In the
-Internet Protocol suite, this is done with "port numbers", which
-represent the services, much like an extension number used with a phone
-number.
-
- Port numbers are 16-bit integers. Unix and Unix-like systems reserve
-ports below 1024 for "well known" services, such as SMTP, FTP, and HTTP.
-Numbers 1024 and above may be used by any application, although there is
-no promise made that a particular port number is always available.
-
-
-File: gawkinet.info, Node: Making Connections, Prev: The TCP/IP Protocols, Up: Introduction
-
-1.4 Making TCP/IP Connections (And Some Terminology)
-====================================================
-
-Two terms come up repeatedly when discussing networking: "client" and
-"server". For now, we'll discuss these terms at the "connection level",
-when first establishing connections between two processes on different
-systems over a network. (Once the connection is established, the higher
-level, or "application level" protocols, such as HTTP or FTP, determine
-who is the client and who is the server. Often, it turns out that the
-client and server are the same in both roles.)
-
- The "server" is the system providing the service, such as the web
-server or email server. It is the "host" (system) which is _connected
-to_ in a transaction. For this to work though, the server must be
-expecting connections. Much as there has to be someone at the office
-building to answer the phone(1), the server process (usually) has to be
-started first and be waiting for a connection.
-
- The "client" is the system requesting the service. It is the system
-_initiating the connection_ in a transaction. (Just as when you pick up
-the phone to call an office or store.)
-
- In the TCP/IP framework, each end of a connection is represented by a
-pair of (ADDRESS, PORT) pairs. For the duration of the connection, the
-ports in use at each end are unique, and cannot be used simultaneously
-by other processes on the same system. (Only after closing a connection
-can a new one be built up on the same port. This is contrary to the
-usual behavior of fully developed web servers which have to avoid
-situations in which they are not reachable. We have to pay this price
-in order to enjoy the benefits of a simple communication paradigm in
-'gawk'.)
-
- Furthermore, once the connection is established, communications are
-"synchronous".(2) I.e., each end waits on the other to finish
-transmitting, before replying. This is much like two people in a phone
-conversation. While both could talk simultaneously, doing so usually
-doesn't work too well.
-
- In the case of TCP, the synchronicity is enforced by the protocol
-when sending data. Data writes "block" until the data have been
-received on the other end. For both TCP and UDP, data reads block until
-there is incoming data waiting to be read. This is summarized in the
-following table, where an "X" indicates that the given action blocks.
-
-TCP X X
-UDP X
-
- ---------- Footnotes ----------
-
- (1) In the days before voice mail systems!
-
- (2) For the technically savvy, data reads block--if there's no
-incoming data, the program is made to wait until there is, instead of
-receiving a "there's no data" error return.
-
-
-File: gawkinet.info, Node: Using Networking, Next: Some Applications and Techniques, Prev: Introduction, Up: Top
-
-2 Networking With 'gawk'
-************************
-
-The 'awk' programming language was originally developed as a
-pattern-matching language for writing short programs to perform data
-manipulation tasks. 'awk''s strength is the manipulation of textual
-data that is stored in files. It was never meant to be used for
-networking purposes. To exploit its features in a networking context,
-it's necessary to use an access mode for network connections that
-resembles the access of files as closely as possible.
-
- 'awk' is also meant to be a prototyping language. It is used to
-demonstrate feasibility and to play with features and user interfaces.
-This can be done with file-like handling of network connections. 'gawk'
-trades the lack of many of the advanced features of the TCP/IP family of
-protocols for the convenience of simple connection handling. The
-advanced features are available when programming in C or Perl. In fact,
-the network programming in this major node is very similar to what is
-described in books such as 'Internet Programming with Python', 'Advanced
-Perl Programming', or 'Web Client Programming with Perl'.
-
- However, you can do the programming here without first having to
-learn object-oriented ideology; underlying languages such as Tcl/Tk,
-Perl, Python; or all of the libraries necessary to extend these
-languages before they are ready for the Internet.
-
- This major node demonstrates how to use the TCP protocol. The UDP
-protocol is much less important for most users.
-
-* Menu:
-
-* Gawk Special Files:: How to do 'gawk' networking.
-* TCP Connecting:: Making a TCP connection.
-* Troubleshooting:: Troubleshooting TCP/IP connections.
-* Interacting:: Interacting with a service.
-* Setting Up:: Setting up a service.
-* Email:: Reading email.
-* Web page:: Reading a Web page.
-* Primitive Service:: A primitive Web service.
-* Interacting Service:: A Web service with interaction.
-* Simple Server:: A simple Web server.
-* Caveats:: Network programming caveats.
-* Challenges:: Where to go from here.
-
-
-File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Using Networking, Up: Using Networking
-
-2.1 'gawk''s Networking Mechanisms
-==================================
-
-The '|&' operator for use in communicating with a "coprocess" is
-described in *note Two-way Communications With Another Process:
-(gawk)Two-way I/O. It shows how to do two-way I/O to a separate process,
-sending it data with 'print' or 'printf' and reading data with
-'getline'. If you haven't read it already, you should detour there to
-do so.
-
- 'gawk' transparently extends the two-way I/O mechanism to simple
-networking through the use of special file names. When a "coprocess"
-that matches the special files we are about to describe is started,
-'gawk' creates the appropriate network connection, and then two-way I/O
-proceeds as usual.
-
- At the C, C++, and Perl level, networking is accomplished via
-"sockets", an Application Programming Interface (API) originally
-developed at the University of California at Berkeley that is now used
-almost universally for TCP/IP networking. Socket level programming,
-while fairly straightforward, requires paying attention to a number of
-details, as well as using binary data. It is not well-suited for use
-from a high-level language like 'awk'. The special files provided in
-'gawk' hide the details from the programmer, making things much simpler
-and easier to use.
-
- The special file name for network access is made up of several
-fields, all of which are mandatory:
-
- /NET-TYPE/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT
-
- The NET-TYPE field lets you specify IPv4 versus IPv6, or lets you
-allow the system to choose.
-
-* Menu:
-
-* Special File Fields:: The fields in the special file name.
-* Comparing Protocols:: Differences between the protocols.
-
-
-File: gawkinet.info, Node: Special File Fields, Next: Comparing Protocols, Prev: Gawk Special Files, Up: Gawk Special Files
-
-2.1.1 The Fields of the Special File Name
------------------------------------------
-
-This node explains the meaning of all the other fields, as well as the
-range of values and the defaults. All of the fields are mandatory. To
-let the system pick a value, or if the field doesn't apply to the
-protocol, specify it as '0':
-
-NET-TYPE
- This is one of 'inet4' for IPv4, 'inet6' for IPv6, or 'inet' to use
- the system default (which is likely to be IPv4). For the rest of
- this document, we will use the generic '/inet' in our descriptions
- of how 'gawk''s networking works.
-
-PROTOCOL
- Determines which member of the TCP/IP family of protocols is
- selected to transport the data across the network. There are two
- possible values (always written in lowercase): 'tcp' and 'udp'.
- The exact meaning of each is explained later in this node.
-
-LOCALPORT
- Determines which port on the local machine is used to communicate
- across the network. Application-level clients usually use '0' to
- indicate they do not care which local port is used--instead they
- specify a remote port to connect to. It is vital for
- application-level servers to use a number different from '0' here
- because their service has to be available at a specific publicly
- known port number. It is possible to use a name from
- '/etc/services' here.
-
-HOSTNAME
- Determines which remote host is to be at the other end of the
- connection. Application-level servers must fill this field with a
- '0' to indicate their being open for all other hosts to connect to
- them and enforce connection level server behavior this way. It is
- not possible for an application-level server to restrict its
- availability to one remote host by entering a host name here.
- Application-level clients must enter a name different from '0'.
- The name can be either symbolic (e.g., 'jpl-devvax.jpl.nasa.gov')
- or numeric (e.g., '128.149.1.143').
-
-REMOTEPORT
- Determines which port on the remote machine is used to communicate
- across the network. For '/inet/tcp' and '/inet/udp',
- application-level clients _must_ use a number other than '0' to
- indicate to which port on the remote machine they want to connect.
- Application-level servers must not fill this field with a '0'.
- Instead they specify a local port to which clients connect. It is
- possible to use a name from '/etc/services' here.
-
- Experts in network programming will notice that the usual
-client/server asymmetry found at the level of the socket API is not
-visible here. This is for the sake of simplicity of the high-level
-concept. If this asymmetry is necessary for your application, use
-another language. For 'gawk', it is more important to enable users to
-write a client program with a minimum of code. What happens when first
-accessing a network connection is seen in the following pseudocode:
-
- if ((name of remote host given) && (other side accepts connection)) {
- rendez-vous successful; transmit with getline or print
- } else {
- if ((other side did not accept) && (localport == 0))
- exit unsuccessful
- if (TCP) {
- set up a server accepting connections
- this means waiting for the client on the other side to connect
- } else
- ready
- }
-
- The exact behavior of this algorithm depends on the values of the
-fields of the special file name. When in doubt, *note Table 2.1:
-table-inet-components. gives you the combinations of values and their
-meaning. If this table is too complicated, focus on the three lines
-printed in *bold*. All the examples in *note Networking With 'gawk':
-Using Networking, use only the patterns printed in bold letters.
-
-PROTOCOL LOCAL HOST NAME REMOTE RESULTING CONNECTION-LEVEL
- PORT PORT BEHAVIOR
-------------------------------------------------------------------------------
-*tcp* *0* *x* *x* *Dedicated client, fails if
- immediately connecting to a
- server on the other side
- fails*
-udp 0 x x Dedicated client
-*tcp, *x* *x* *x* *Client, switches to
-udp* dedicated server if
- necessary*
-*tcp, *x* *0* *0* *Dedicated server*
-udp*
-tcp, udp x x 0 Invalid
-tcp, udp 0 0 x Invalid
-tcp, udp x 0 x Invalid
-tcp, udp 0 0 0 Invalid
-tcp, udp 0 x 0 Invalid
-
-Table 2.1: /inet Special File Components
-
- In general, TCP is the preferred mechanism to use. It is the
-simplest protocol to understand and to use. Use UDP only if
-circumstances demand low-overhead.
-
-
-File: gawkinet.info, Node: Comparing Protocols, Prev: Special File Fields, Up: Gawk Special Files
-
-2.1.2 Comparing Protocols
--------------------------
-
-This node develops a pair of programs (sender and receiver) that do
-nothing but send a timestamp from one machine to another. The sender
-and the receiver are implemented with each of the two protocols
-available and demonstrate the differences between them.
-
-* Menu:
-
-* File /inet/tcp:: The TCP special file.
-* File /inet/udp:: The UDP special file.
-
-
-File: gawkinet.info, Node: File /inet/tcp, Next: File /inet/udp, Prev: Comparing Protocols, Up: Comparing Protocols
-
-2.1.2.1 '/inet/tcp'
-...................
-
-Once again, always use TCP. (Use UDP when low overhead is a necessity,
-and use RAW for network experimentation.) The first example is the
-sender program:
-
- # Server
- BEGIN {
- print strftime() |& "/inet/tcp/8888/0/0"
- close("/inet/tcp/8888/0/0")
- }
-
- The receiver is very simple:
-
- # Client
- BEGIN {
- "/inet/tcp/0/localhost/8888" |& getline
- print $0
- close("/inet/tcp/0/localhost/8888")
- }
-
- TCP guarantees that the bytes arrive at the receiving end in exactly
-the same order that they were sent. No byte is lost (except for broken
-connections), doubled, or out of order. Some overhead is necessary to
-accomplish this, but this is the price to pay for a reliable service.
-It does matter which side starts first. The sender/server has to be
-started first, and it waits for the receiver to read a line.
-
-
-File: gawkinet.info, Node: File /inet/udp, Prev: File /inet/tcp, Up: Comparing Protocols
-
-2.1.2.2 '/inet/udp'
-...................
-
-The server and client programs that use UDP are almost identical to
-their TCP counterparts; only the PROTOCOL has changed. As before, it
-does matter which side starts first. The receiving side blocks and
-waits for the sender. In this case, the receiver/client has to be
-started first:
-
- # Server
- BEGIN {
- print strftime() |& "/inet/udp/8888/0/0"
- close("/inet/udp/8888/0/0")
- }
-
- The receiver is almost identical to the TCP receiver:
-
- # Client
- BEGIN {
- print "hi!" |& "/inet/udp/0/localhost/8888"
- "/inet/udp/0/localhost/8888" |& getline
- print $0
- close("/inet/udp/0/localhost/8888")
- }
-
- In the case of UDP, the initial 'print' command is the one that
-actually sends data so that there is a connection. UDP and "connection"
-sounds strange to anyone who has learned that UDP is a connectionless
-protocol. Here, "connection" means that the 'connect()' system call has
-completed its work and completed the "association" between a certain
-socket and an IP address. Thus there are subtle differences between
-'connect()' for TCP and UDP; see the man page for details.(1)
-
- UDP cannot guarantee that the datagrams at the receiving end will
-arrive in exactly the same order they were sent. Some datagrams could
-be lost, some doubled, and some out of order. But no overhead is
-necessary to accomplish this. This unreliable behavior is good enough
-for tasks such as data acquisition, logging, and even stateless services
-like the original versions of NFS.
-
- ---------- Footnotes ----------
-
- (1) This subtlety is just one of many details that are hidden in the
-socket API, invisible and intractable for the 'gawk' user. The
-developers are currently considering how to rework the network
-facilities to make them easier to understand and use.
-
-
-File: gawkinet.info, Node: TCP Connecting, Next: Troubleshooting, Prev: Gawk Special Files, Up: Using Networking
-
-2.2 Establishing a TCP Connection
-=================================
-
-Let's observe a network connection at work. Type in the following
-program and watch the output. Within a second, it connects via TCP
-('/inet/tcp') to the machine it is running on ('localhost') and asks the
-service 'daytime' on the machine what time it is:
-
- BEGIN {
- "/inet/tcp/0/localhost/daytime" |& getline
- print $0
- close("/inet/tcp/0/localhost/daytime")
- }
-
- Even experienced 'awk' users will find the second line strange in two
-respects:
-
- * A special file is used as a shell command that pipes its output
- into 'getline'. One would rather expect to see the special file
- being read like any other file ('getline <
- "/inet/tcp/0/localhost/daytime")'.
-
- * The operator '|&' has not been part of any 'awk' implementation
- (until now). It is actually the only extension of the 'awk'
- language needed (apart from the special files) to introduce network
- access.
-
- The '|&' operator was introduced in 'gawk' 3.1 in order to overcome
-the crucial restriction that access to files and pipes in 'awk' is
-always unidirectional. It was formerly impossible to use both access
-modes on the same file or pipe. Instead of changing the whole concept
-of file access, the '|&' operator behaves exactly like the usual pipe
-operator except for two additions:
-
- * Normal shell commands connected to their 'gawk' program with a '|&'
- pipe can be accessed bidirectionally. The '|&' turns out to be a
- quite general, useful, and natural extension of 'awk'.
-
- * Pipes that consist of a special file name for network connections
- are not executed as shell commands. Instead, they can be read and
- written to, just like a full-duplex network connection.
-
- In the earlier example, the '|&' operator tells 'getline' to read a
-line from the special file '/inet/tcp/0/localhost/daytime'. We could
-also have printed a line into the special file. But instead we just
-read a line with the time, printed it, and closed the connection.
-(While we could just let 'gawk' close the connection by finishing the
-program, in this Info file we are pedantic and always explicitly close
-the connections.)
-
-
-File: gawkinet.info, Node: Troubleshooting, Next: Interacting, Prev: TCP Connecting, Up: Using Networking
-
-2.3 Troubleshooting Connection Problems
-=======================================
-
-It may well be that for some reason the program shown in the previous
-example does not run on your machine. When looking at possible reasons
-for this, you will learn much about typical problems that arise in
-network programming. First of all, your implementation of 'gawk' may
-not support network access because it is a pre-3.1 version or you do not
-have a network interface in your machine. Perhaps your machine uses
-some other protocol, such as DECnet or Novell's IPX. For the rest of
-this major node, we will assume you work on a Unix machine that supports
-TCP/IP. If the previous example program does not run on your machine, it
-may help to replace the name 'localhost' with the name of your machine
-or its IP address. If it does, you could replace 'localhost' with the
-name of another machine in your vicinity--this way, the program connects
-to another machine. Now you should see the date and time being printed
-by the program, otherwise your machine may not support the 'daytime'
-service. Try changing the service to 'chargen' or 'ftp'. This way, the
-program connects to other services that should give you some response.
-If you are curious, you should have a look at your '/etc/services' file.
-It could look like this:
-
- # /etc/services:
- #
- # Network services, Internet style
- #
- # Name Number/Protocol Alternate name # Comments
-
- echo 7/tcp
- echo 7/udp
- discard 9/tcp sink null
- discard 9/udp sink null
- daytime 13/tcp
- daytime 13/udp
- chargen 19/tcp ttytst source
- chargen 19/udp ttytst source
- ftp 21/tcp
- telnet 23/tcp
- smtp 25/tcp mail
- finger 79/tcp
- www 80/tcp http # WorldWideWeb HTTP
- www 80/udp # HyperText Transfer Protocol
- pop-2 109/tcp postoffice # POP version 2
- pop-2 109/udp
- pop-3 110/tcp # POP version 3
- pop-3 110/udp
- nntp 119/tcp readnews untp # USENET News
- irc 194/tcp # Internet Relay Chat
- irc 194/udp
- ...
-
- Here, you find a list of services that traditional Unix machines
-usually support. If your GNU/Linux machine does not do so, it may be
-that these services are switched off in some startup script. Systems
-running some flavor of Microsoft Windows usually do _not_ support these
-services. Nevertheless, it _is_ possible to do networking with 'gawk'
-on Microsoft Windows.(1) The first column of the file gives the name of
-the service, and the second column gives a unique number and the
-protocol that one can use to connect to this service. The rest of the
-line is treated as a comment. You see that some services ('echo')
-support TCP as well as UDP.
-
- ---------- Footnotes ----------
-
- (1) Microsoft preferred to ignore the TCP/IP family of protocols
-until 1995. Then came the rise of the Netscape browser as a landmark
-"killer application." Microsoft added TCP/IP support and their own
-browser to Microsoft Windows 95 at the last minute. They even
-back-ported their TCP/IP implementation to Microsoft Windows for
-Workgroups 3.11, but it was a rather rudimentary and half-hearted
-implementation. Nevertheless, the equivalent of '/etc/services' resides
-under 'C:\WINNT\system32\drivers\etc\services' on Microsoft Windows 2000
-and Microsoft Windows XP.
-
-
-File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking
-
-2.4 Interacting with a Network Service
-======================================
-
-The next program makes use of the possibility to really interact with a
-network service by printing something into the special file. It asks
-the so-called 'finger' service if a user of the machine is logged in.
-When testing this program, try to change 'localhost' to some other
-machine name in your local network:
-
- BEGIN {
- NetService = "/inet/tcp/0/localhost/finger"
- print "NAME" |& NetService
- while ((NetService |& getline) > 0)
- print $0
- close(NetService)
- }
-
- After telling the service on the machine which user to look for, the
-program repeatedly reads lines that come as a reply. When no more lines
-are coming (because the service has closed the connection), the program
-also closes the connection. Try replacing '"NAME"' with your login name
-(or the name of someone else logged in). For a list of all users
-currently logged in, replace NAME with an empty string ('""').
-
- The final 'close()' command could be safely deleted from the above
-script, because the operating system closes any open connection by
-default when a script reaches the end of execution. In order to avoid
-portability problems, it is best to always close connections explicitly.
-With the Linux kernel, for example, proper closing results in flushing
-of buffers. Letting the close happen by default may result in
-discarding buffers.
-
- When looking at '/etc/services' you may have noticed that the
-'daytime' service is also available with 'udp'. In the earlier example,
-change 'tcp' to 'udp', and change 'finger' to 'daytime'. After starting
-the modified program, you see the expected day and time message. The
-program then hangs, because it waits for more lines coming from the
-service. However, they never come. This behavior is a consequence of
-the differences between TCP and UDP. When using UDP, neither party is
-automatically informed about the other closing the connection.
-Continuing to experiment this way reveals many other subtle differences
-between TCP and UDP. To avoid such trouble, one should always remember
-the advice Douglas E. Comer and David Stevens give in Volume III of
-their series 'Internetworking With TCP' (page 14):
-
- When designing client-server applications, beginners are strongly
- advised to use TCP because it provides reliable,
- connection-oriented communication. Programs only use UDP if the
- application protocol handles reliability, the application requires
- hardware broadcast or multicast, or the application cannot tolerate
- virtual circuit overhead.
-
-
-File: gawkinet.info, Node: Setting Up, Next: Email, Prev: Interacting, Up: Using Networking
-
-2.5 Setting Up a Service
-========================
-
-The preceding programs behaved as clients that connect to a server
-somewhere on the Internet and request a particular service. Now we set
-up such a service to mimic the behavior of the 'daytime' service. Such
-a server does not know in advance who is going to connect to it over the
-network. Therefore, we cannot insert a name for the host to connect to
-in our special file name.
-
- Start the following program in one window. Notice that the service
-does not have the name 'daytime', but the number '8888'. From looking
-at '/etc/services', you know that names like 'daytime' are just
-mnemonics for predetermined 16-bit integers. Only the system
-administrator ('root') could enter our new service into '/etc/services'
-with an appropriate name. Also notice that the service name has to be
-entered into a different field of the special file name because we are
-setting up a server, not a client:
-
- BEGIN {
- print strftime() |& "/inet/tcp/8888/0/0"
- close("/inet/tcp/8888/0/0")
- }
-
- Now open another window on the same machine. Copy the client program
-given as the first example (*note Establishing a TCP Connection: TCP
-Connecting.) to a new file and edit it, changing the name 'daytime' to
-'8888'. Then start the modified client. You should get a reply like
-this:
-
- Sat Sep 27 19:08:16 CEST 1997
-
-Both programs explicitly close the connection.
-
- Now we will intentionally make a mistake to see what happens when the
-name '8888' (the so-called port) is already used by another service.
-Start the server program in both windows. The first one works, but the
-second one complains that it could not open the connection. Each port
-on a single machine can only be used by one server program at a time.
-Now terminate the server program and change the name '8888' to 'echo'.
-After restarting it, the server program does not run any more, and you
-know why: there is already an 'echo' service running on your machine.
-But even if this isn't true, you would not get your own 'echo' server
-running on a Unix machine, because the ports with numbers smaller than
-1024 ('echo' is at port 7) are reserved for 'root'. On machines running
-some flavor of Microsoft Windows, there is no restriction that reserves
-ports 1 to 1024 for a privileged user; hence, you can start an 'echo'
-server there.
-
- Turning this short server program into something really useful is
-simple. Imagine a server that first reads a file name from the client
-through the network connection, then does something with the file and
-sends a result back to the client. The server-side processing could be:
-
- BEGIN {
- NetService = "/inet/tcp/8888/0/0"
- NetService |& getline
- CatPipe = ("cat " $1) # sets $0 and the fields
- while ((CatPipe | getline) > 0)
- print $0 |& NetService
- close(NetService)
- }
-
-and we would have a remote copying facility. Such a server reads the
-name of a file from any client that connects to it and transmits the
-contents of the named file across the net. The server-side processing
-could also be the execution of a command that is transmitted across the
-network. From this example, you can see how simple it is to open up a
-security hole on your machine. If you allow clients to connect to your
-machine and execute arbitrary commands, anyone would be free to do 'rm
--rf *'.
-
-
-File: gawkinet.info, Node: Email, Next: Web page, Prev: Setting Up, Up: Using Networking
-
-2.6 Reading Email
-=================
-
-The distribution of email is usually done by dedicated email servers
-that communicate with your machine using special protocols. To receive
-email, we will use the Post Office Protocol (POP). Sending can be done
-with the much older Simple Mail Transfer Protocol (SMTP).
-
- When you type in the following program, replace the EMAILHOST by the
-name of your local email server. Ask your administrator if the server
-has a POP service, and then use its name or number in the program below.
-Now the program is ready to connect to your email server, but it will
-not succeed in retrieving your mail because it does not yet know your
-login name or password. Replace them in the program and it shows you
-the first email the server has in store:
-
- BEGIN {
- POPService = "/inet/tcp/0/EMAILHOST/pop3"
- RS = ORS = "\r\n"
- print "user NAME" |& POPService
- POPService |& getline
- print "pass PASSWORD" |& POPService
- POPService |& getline
- print "retr 1" |& POPService
- POPService |& getline
- if ($1 != "+OK") exit
- print "quit" |& POPService
- RS = "\r\n\\.\r\n"
- POPService |& getline
- print $0
- close(POPService)
- }
-
- The record separators 'RS' and 'ORS' are redefined because the
-protocol (POP) requires CR-LF to separate lines. After identifying
-yourself to the email service, the command 'retr 1' instructs the
-service to send the first of all your email messages in line. If the
-service replies with something other than '+OK', the program exits;
-maybe there is no email. Otherwise, the program first announces that it
-intends to finish reading email, and then redefines 'RS' in order to
-read the entire email as multiline input in one record. From the POP
-RFC, we know that the body of the email always ends with a single line
-containing a single dot. The program looks for this using 'RS =
-"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it
-quits. You can invoke this program as often as you like; it does not
-delete the message it reads, but instead leaves it on the server.
-
-
-File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking
-
-2.7 Reading a Web Page
-======================
-
-Retrieving a web page from a web server is as simple as retrieving email
-from an email server. We only have to use a similar, but not identical,
-protocol and a different port. The name of the protocol is HyperText
-Transfer Protocol (HTTP) and the port number is usually 80. As in the
-preceding node, ask your administrator about the name of your local web
-server or proxy web server and its port number for HTTP requests.
-
- The following program employs a rather crude approach toward
-retrieving a web page. It uses the prehistoric syntax of HTTP 0.9,
-which almost all web servers still support. The most noticeable thing
-about it is that the program directs the request to the local proxy
-server whose name you insert in the special file name (which in turn
-calls 'www.yahoo.com'):
-
- BEGIN {
- RS = ORS = "\r\n"
- HttpService = "/inet/tcp/0/PROXY/80"
- print "GET http://www.yahoo.com" |& HttpService
- while ((HttpService |& getline) > 0)
- print $0
- close(HttpService)
- }
-
- Again, lines are separated by a redefined 'RS' and 'ORS'. The 'GET'
-request that we send to the server is the only kind of HTTP request that
-existed when the web was created in the early 1990s. HTTP calls this
-'GET' request a "method," which tells the service to transmit a web page
-(here the home page of the Yahoo! search engine). Version 1.0 added
-the request methods 'HEAD' and 'POST'. The current version of HTTP is
-1.1,(1) and knows the additional request methods 'OPTIONS', 'PUT',
-'DELETE', and 'TRACE'. You can fill in any valid web address, and the
-program prints the HTML code of that page to your screen.
-
- Notice the similarity between the responses of the POP and HTTP
-services. First, you get a header that is terminated by an empty line,
-and then you get the body of the page in HTML. The lines of the headers
-also have the same form as in POP. There is the name of a parameter,
-then a colon, and finally the value of that parameter.
-
- Images ('.png' or '.gif' files) can also be retrieved this way, but
-then you get binary data that should be redirected into a file. Another
-application is calling a CGI (Common Gateway Interface) script on some
-server. CGI scripts are used when the contents of a web page are not
-constant, but generated instantly at the moment you send a request for
-the page. For example, to get a detailed report about the current
-quotes of Motorola stock shares, call a CGI script at Yahoo! with the
-following:
-
- get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
- print get |& HttpService
-
- You can also request weather reports this way.
-
- ---------- Footnotes ----------
-
- (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was
-initially specified in RFC 2068. In June 1999, RFC 2068 was made
-obsolete by RFC 2616, an update without any substantial changes.
-
-
-File: gawkinet.info, Node: Primitive Service, Next: Interacting Service, Prev: Web page, Up: Using Networking
-
-2.8 A Primitive Web Service
-===========================
-
-Now we know enough about HTTP to set up a primitive web service that
-just says '"Hello, world"' when someone connects to it with a browser.
-Compared to the situation in the preceding node, our program changes the
-role. It tries to behave just like the server we have observed. Since
-we are setting up a server here, we have to insert the port number in
-the 'localport' field of the special file name. The other two fields
-(HOSTNAME and REMOTEPORT) have to contain a '0' because we do not know
-in advance which host will connect to our service.
-
- In the early 1990s, all a server had to do was send an HTML document
-and close the connection. Here, we adhere to the modern syntax of HTTP.
-The steps are as follows:
-
- 1. Send a status line telling the web browser that everything is okay.
-
- 2. Send a line to tell the browser how many bytes follow in the body
- of the message. This was not necessary earlier because both
- parties knew that the document ended when the connection closed.
- Nowadays it is possible to stay connected after the transmission of
- one web page. This is to avoid the network traffic necessary for
- repeatedly establishing TCP connections for requesting several
- images. Thus, there is the need to tell the receiving party how
- many bytes will be sent. The header is terminated as usual with an
- empty line.
-
- 3. Send the '"Hello, world"' body in HTML. The useless 'while' loop
- swallows the request of the browser. We could actually omit the
- loop, and on most machines the program would still work. First,
- start the following program:
-
- BEGIN {
- RS = ORS = "\r\n"
- HttpService = "/inet/tcp/8080/0/0"
- Hello = "<HTML><HEAD>" \
- "<TITLE>A Famous Greeting</TITLE></HEAD>" \
- "<BODY><H1>Hello, world</H1></BODY></HTML>"
- Len = length(Hello) + length(ORS)
- print "HTTP/1.0 200 OK" |& HttpService
- print "Content-Length: " Len ORS |& HttpService
- print Hello |& HttpService
- while ((HttpService |& getline) > 0)
- continue;
- close(HttpService)
- }
-
- Now, on the same machine, start your favorite browser and let it
-point to <http://localhost:8080> (the browser needs to know on which
-port our server is listening for requests). If this does not work, the
-browser probably tries to connect to a proxy server that does not know
-your machine. If so, change the browser's configuration so that the
-browser does not try to use a proxy to connect to your machine.
-
-
-File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking
-
-2.9 A Web Service with Interaction
-==================================
-
-This node shows how to set up a simple web server. The subnode is a
-library file that we will use with all the examples in *note Some
-Applications and Techniques::.
-
-* Menu:
-
-* CGI Lib:: A simple CGI library.
-
- Setting up a web service that allows user interaction is more
-difficult and shows us the limits of network access in 'gawk'. In this
-node, we develop a main program (a 'BEGIN' pattern and its action) that
-will become the core of event-driven execution controlled by a graphical
-user interface (GUI). Each HTTP event that the user triggers by some
-action within the browser is received in this central procedure.
-Parameters and menu choices are extracted from this request, and an
-appropriate measure is taken according to the user's choice. For
-example:
-
- BEGIN {
- if (MyHost == "") {
- "uname -n" | getline MyHost
- close("uname -n")
- }
- if (MyPort == 0) MyPort = 8080
- HttpService = "/inet/tcp/" MyPort "/0/0"
- MyPrefix = "http://" MyHost ":" MyPort
- SetUpServer()
- while ("awk" != "complex") {
- # header lines are terminated this way
- RS = ORS = "\r\n"
- Status = 200 # this means OK
- Reason = "OK"
- Header = TopHeader
- Document = TopDoc
- Footer = TopFooter
- if (GETARG["Method"] == "GET") {
- HandleGET()
- } else if (GETARG["Method"] == "HEAD") {
- # not yet implemented
- } else if (GETARG["Method"] != "") {
- print "bad method", GETARG["Method"]
- }
- Prompt = Header Document Footer
- print "HTTP/1.0", Status, Reason |& HttpService
- print "Connection: Close" |& HttpService
- print "Pragma: no-cache" |& HttpService
- len = length(Prompt) + length(ORS)
- print "Content-length:", len |& HttpService
- print ORS Prompt |& HttpService
- # ignore all the header lines
- while ((HttpService |& getline) > 0)
- ;
- # stop talking to this client
- close(HttpService)
- # wait for new client request
- HttpService |& getline
- # do some logging
- print systime(), strftime(), $0
- # read request parameters
- CGI_setup($1, $2, $3)
- }
- }
-
- This web server presents menu choices in the form of HTML links.
-Therefore, it has to tell the browser the name of the host it is
-residing on. When starting the server, the user may supply the name of
-the host from the command line with 'gawk -v MyHost="Rumpelstilzchen"'.
-If the user does not do this, the server looks up the name of the host
-it is running on for later use as a web address in HTML documents. The
-same applies to the port number. These values are inserted later into
-the HTML content of the web pages to refer to the home system.
-
- Each server that is built around this core has to initialize some
-application-dependent variables (such as the default home page) in a
-procedure 'SetUpServer()', which is called immediately before entering
-the infinite loop of the server. For now, we will write an instance
-that initiates a trivial interaction. With this home page, the client
-user can click on two possible choices, and receive the current date
-either in human-readable format or in seconds since 1970:
-
- function SetUpServer() {
- TopHeader = "<HTML><HEAD>"
- TopHeader = TopHeader \
- "<title>My name is GAWK, GNU AWK</title></HEAD>"
- TopDoc = "<BODY><h2>\
- Do you prefer your date <A HREF=" MyPrefix \
- "/human>human</A> or \
- <A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS
- TopFooter = "</BODY></HTML>"
- }
-
- On the first run through the main loop, the default line terminators
-are set and the default home page is copied to the actual home page.
-Since this is the first run, 'GETARG["Method"]' is not initialized yet,
-hence the case selection over the method does nothing. Now that the
-home page is initialized, the server can start communicating to a client
-browser.
-
- It does so by printing the HTTP header into the network connection
-('print ... |& HttpService'). This command blocks execution of the
-server script until a client connects. If this server script is
-compared with the primitive one we wrote before, you will notice two
-additional lines in the header. The first instructs the browser to
-close the connection after each request. The second tells the browser
-that it should never try to _remember_ earlier requests that had
-identical web addresses (no caching). Otherwise, it could happen that
-the browser retrieves the time of day in the previous example just once,
-and later it takes the web page from the cache, always displaying the
-same time of day although time advances each second.
-
- Having supplied the initial home page to the browser with a valid
-document stored in the parameter 'Prompt', it closes the connection and
-waits for the next request. When the request comes, a log line is
-printed that allows us to see which request the server receives. The
-final step in the loop is to call the function 'CGI_setup()', which
-reads all the lines of the request (coming from the browser), processes
-them, and stores the transmitted parameters in the array 'PARAM'. The
-complete text of these application-independent functions can be found in
-*note A Simple CGI Library: CGI Lib. For now, we use a simplified
-version of 'CGI_setup()':
-
- function CGI_setup( method, uri, version, i) {
- delete GETARG; delete MENU; delete PARAM
- GETARG["Method"] = $1
- GETARG["URI"] = $2
- GETARG["Version"] = $3
- i = index($2, "?")
- # is there a "?" indicating a CGI request?
- if (i > 0) {
- split(substr($2, 1, i-1), MENU, "[/:]")
- split(substr($2, i+1), PARAM, "&")
- for (i in PARAM) {
- j = index(PARAM[i], "=")
- GETARG[substr(PARAM[i], 1, j-1)] = \
- substr(PARAM[i], j+1)
- }
- } else { # there is no "?", no need for splitting PARAMs
- split($2, MENU, "[/:]")
- }
- }
-
- At first, the function clears all variables used for global storage
-of request parameters. The rest of the function serves the purpose of
-filling the global parameters with the extracted new values. To
-accomplish this, the name of the requested resource is split into parts
-and stored for later evaluation. If the request contains a '?', then
-the request has CGI variables seamlessly appended to the web address.
-Everything in front of the '?' is split up into menu items, and
-everything behind the '?' is a list of 'VARIABLE=VALUE' pairs (separated
-by '&') that also need splitting. This way, CGI variables are isolated
-and stored. This procedure lacks recognition of special characters that
-are transmitted in coded form(1). Here, any optional request header and
-body parts are ignored. We do not need header parameters and the
-request body. However, when refining our approach or working with the
-'POST' and 'PUT' methods, reading the header and body becomes
-inevitable. Header parameters should then be stored in a global array
-as well as the body.
-
- On each subsequent run through the main loop, one request from a
-browser is received, evaluated, and answered according to the user's
-choice. This can be done by letting the value of the HTTP method guide
-the main loop into execution of the procedure 'HandleGET()', which
-evaluates the user's choice. In this case, we have only one
-hierarchical level of menus, but in the general case, menus are nested.
-The menu choices at each level are separated by '/', just as in file
-names. Notice how simple it is to construct menus of arbitrary depth:
-
- function HandleGET() {
- if ( MENU[2] == "human") {
- Footer = strftime() TopFooter
- } else if (MENU[2] == "POSIX") {
- Footer = systime() TopFooter
- }
- }
-
- The disadvantage of this approach is that our server is slow and can
-handle only one request at a time. Its main advantage, however, is that
-the server consists of just one 'gawk' program. No need for installing
-an 'httpd', and no need for static separate HTML files, CGI scripts, or
-'root' privileges. This is rapid prototyping. This program can be
-started on the same host that runs your browser. Then let your browser
-point to <http://localhost:8080>.
-
- It is also possible to include images into the HTML pages. Most
-browsers support the not very well-known '.xbm' format, which may
-contain only monochrome pictures but is an ASCII format. Binary images
-are possible but not so easy to handle. Another way of including images
-is to generate them with a tool such as GNUPlot, by calling the tool
-with the 'system()' function or through a pipe.
-
- ---------- Footnotes ----------
-
- (1) As defined in RFC 2068.
-
-
-File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service
-
-2.9.1 A Simple CGI Library
---------------------------
-
- HTTP is like being married: you have to be able to handle whatever
- you're given, while being very careful what you send back.
- Phil Smith III,
- <http://www.netfunny.com/rhf/jokes/99/Mar/http.html>
-
- In *note A Web Service with Interaction: Interacting Service, we saw
-the function 'CGI_setup()' as part of the web server "core logic"
-framework. The code presented there handles almost everything necessary
-for CGI requests. One thing it doesn't do is handle encoded characters
-in the requests. For example, an '&' is encoded as a percent sign
-followed by the hexadecimal value: '%26'. These encoded values should
-be decoded. Following is a simple library to perform these tasks. This
-code is used for all web server examples used throughout the rest of
-this Info file. If you want to use it for your own web server, store
-the source code into a file named 'inetlib.awk'. Then you can include
-these functions into your code by placing the following statement into
-your program (on the first line of your script):
-
- @include inetlib.awk
-
-But beware, this mechanism is only possible if you invoke your web
-server script with 'igawk' instead of the usual 'awk' or 'gawk'. Here
-is the code:
-
- # CGI Library and core of a web server
- # Global arrays
- # GETARG --- arguments to CGI GET command
- # MENU --- menu items (path names)
- # PARAM --- parameters of form x=y
-
- # Optional variable MyHost contains host address
- # Optional variable MyPort contains port number
- # Needs TopHeader, TopDoc, TopFooter
- # Sets MyPrefix, HttpService, Status, Reason
-
- BEGIN {
- if (MyHost == "") {
- "uname -n" | getline MyHost
- close("uname -n")
- }
- if (MyPort == 0) MyPort = 8080
- HttpService = "/inet/tcp/" MyPort "/0/0"
- MyPrefix = "http://" MyHost ":" MyPort
- SetUpServer()
- while ("awk" != "complex") {
- # header lines are terminated this way
- RS = ORS = "\r\n"
- Status = 200 # this means OK
- Reason = "OK"
- Header = TopHeader
- Document = TopDoc
- Footer = TopFooter
- if (GETARG["Method"] == "GET") {
- HandleGET()
- } else if (GETARG["Method"] == "HEAD") {
- # not yet implemented
- } else if (GETARG["Method"] != "") {
- print "bad method", GETARG["Method"]
- }
- Prompt = Header Document Footer
- print "HTTP/1.0", Status, Reason |& HttpService
- print "Connection: Close" |& HttpService
- print "Pragma: no-cache" |& HttpService
- len = length(Prompt) + length(ORS)
- print "Content-length:", len |& HttpService
- print ORS Prompt |& HttpService
- # ignore all the header lines
- while ((HttpService |& getline) > 0)
- continue
- # stop talking to this client
- close(HttpService)
- # wait for new client request
- HttpService |& getline
- # do some logging
- print systime(), strftime(), $0
- CGI_setup($1, $2, $3)
- }
- }
-
- function CGI_setup( method, uri, version, i)
- {
- delete GETARG
- delete MENU
- delete PARAM
- GETARG["Method"] = method
- GETARG["URI"] = uri
- GETARG["Version"] = version
-
- i = index(uri, "?")
- if (i > 0) { # is there a "?" indicating a CGI request?
- split(substr(uri, 1, i-1), MENU, "[/:]")
- split(substr(uri, i+1), PARAM, "&")
- for (i in PARAM) {
- PARAM[i] = _CGI_decode(PARAM[i])
- j = index(PARAM[i], "=")
- GETARG[substr(PARAM[i], 1, j-1)] = \
- substr(PARAM[i], j+1)
- }
- } else { # there is no "?", no need for splitting PARAMs
- split(uri, MENU, "[/:]")
- }
- for (i in MENU) # decode characters in path
- if (i > 4) # but not those in host name
- MENU[i] = _CGI_decode(MENU[i])
- }
-
- This isolates details in a single function, 'CGI_setup()'. Decoding
-of encoded characters is pushed off to a helper function,
-'_CGI_decode()'. The use of the leading underscore ('_') in the
-function name is intended to indicate that it is an "internal" function,
-although there is nothing to enforce this:
-
- function _CGI_decode(str, hexdigs, i, pre, code1, code2,
- val, result)
- {
- hexdigs = "123456789abcdef"
-
- i = index(str, "%")
- if (i == 0) # no work to do
- return str
-
- do {
- pre = substr(str, 1, i-1) # part before %xx
- code1 = substr(str, i+1, 1) # first hex digit
- code2 = substr(str, i+2, 1) # second hex digit
- str = substr(str, i+3) # rest of string
-
- code1 = tolower(code1)
- code2 = tolower(code2)
- val = index(hexdigs, code1) * 16 \
- + index(hexdigs, code2)
-
- result = result pre sprintf("%c", val)
- i = index(str, "%")
- } while (i != 0)
- if (length(str) > 0)
- result = result str
- return result
- }
-
- This works by splitting the string apart around an encoded character.
-The two digits are converted to lowercase characters and looked up in a
-string of hex digits. Note that '0' is not in the string on purpose;
-'index()' returns zero when it's not found, automatically giving the
-correct value! Once the hexadecimal value is converted from characters
-in a string into a numerical value, 'sprintf()' converts the value back
-into a real character. The following is a simple test harness for the
-above functions:
-
- BEGIN {
- CGI_setup("GET",
- "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
- "&percent=a %25 sign",
- "1.0")
- for (i in MENU)
- printf "MENU[\"%s\"] = %s\n", i, MENU[i]
- for (i in PARAM)
- printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
- for (i in GETARG)
- printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
- }
-
- And this is the result when we run it:
-
- $ gawk -f testserv.awk
- -| MENU["4"] = www.gnu.org
- -| MENU["5"] = cgi-bin
- -| MENU["6"] = foo
- -| MENU["1"] = http
- -| MENU["2"] =
- -| MENU["3"] =
- -| PARAM["1"] = p1=stuff
- -| PARAM["2"] = p2=stuff&junk
- -| PARAM["3"] = percent=a % sign
- -| GETARG["p1"] = stuff
- -| GETARG["percent"] = a % sign
- -| GETARG["p2"] = stuff&junk
- -| GETARG["Method"] = GET
- -| GETARG["Version"] = 1.0
- -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&
- p2=stuff%26junk&percent=a %25 sign
-
-
-File: gawkinet.info, Node: Simple Server, Next: Caveats, Prev: Interacting Service, Up: Using Networking
-
-2.10 A Simple Web Server
-========================
-
-In the preceding node, we built the core logic for event-driven GUIs.
-In this node, we finally extend the core to a real application. No one
-would actually write a commercial web server in 'gawk', but it is
-instructive to see that it is feasible in principle.
-
- The application is ELIZA, the famous program by Joseph Weizenbaum
-that mimics the behavior of a professional psychotherapist when talking
-to you. Weizenbaum would certainly object to this description, but this
-is part of the legend around ELIZA. Take the site-independent core logic
-and append the following code:
-
- function SetUpServer() {
- SetUpEliza()
- TopHeader = \
- "<HTML><title>An HTTP-based System with GAWK</title>\
- <HEAD><META HTTP-EQUIV=\"Content-Type\"\
- CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\
- <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\
- LINK=\"#0000ff\" VLINK=\"#0000ff\"\
- ALINK=\"#0000ff\"> <A NAME=\"top\">"
- TopDoc = "\
- <h2>Please choose one of the following actions:</h2>\
- <UL>\
- <LI>\
- <A HREF=" MyPrefix "/AboutServer>About this server</A>\
- </LI><LI>\
- <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\
- <LI>\
- <A HREF=" MyPrefix \
- "/StartELIZA>Start talking to Eliza</A></LI></UL>"
- TopFooter = "</BODY></HTML>"
- }
-
- 'SetUpServer()' is similar to the previous example, except for
-calling another function, 'SetUpEliza()'. This approach can be used to
-implement other kinds of servers. The only changes needed to do so are
-hidden in the functions 'SetUpServer()' and 'HandleGET()'. Perhaps it
-might be necessary to implement other HTTP methods. The 'igawk' program
-that comes with 'gawk' may be useful for this process.
-
- When extending this example to a complete application, the first
-thing to do is to implement the function 'SetUpServer()' to initialize
-the HTML pages and some variables. These initializations determine the
-way your HTML pages look (colors, titles, menu items, etc.).
-
- The function 'HandleGET()' is a nested case selection that decides
-which page the user wants to see next. Each nesting level refers to a
-menu level of the GUI. Each case implements a certain action of the
-menu. On the deepest level of case selection, the handler essentially
-knows what the user wants and stores the answer into the variable that
-holds the HTML page contents:
-
- function HandleGET() {
- # A real HTTP server would treat some parts of the URI as a file name.
- # We take parts of the URI as menu choices and go on accordingly.
- if(MENU[2] == "AboutServer") {
- Document = "This is not a CGI script.\
- This is an httpd, an HTML file, and a CGI script all \
- in one GAWK script. It needs no separate www-server, \
- no installation, and no root privileges.\
- <p>To run it, do this:</p><ul>\
- <li> start this script with \"gawk -f httpserver.awk\",</li>\
- <li> and on the same host let your www browser open location\
- \"http://localhost:8080\"</li>\
- </ul>\<p>\ Details of HTTP come from:</p><ul>\
- <li>Hethmon: Illustrated Guide to HTTP</p>\
- <li>RFC 2068</li></ul><p>JK 14.9.1997</p>"
- } else if (MENU[2] == "AboutELIZA") {
- Document = "This is an implementation of the famous ELIZA\
- program by Joseph Weizenbaum. It is written in GAWK and\
- uses an HTML GUI."
- } else if (MENU[2] == "StartELIZA") {
- gsub(/\+/, " ", GETARG["YouSay"])
- # Here we also have to substitute coded special characters
- Document = "<form method=GET>" \
- "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\
- <p><input type=text name=YouSay value=\"\" size=60>\
- <br><input type=submit value=\"Tell her about it\"></p></form>"
- }
- }
-
- Now we are down to the heart of ELIZA, so you can see how it works.
-Initially the user does not say anything; then ELIZA resets its money
-counter and asks the user to tell what comes to mind open heartedly.
-The subsequent answers are converted to uppercase characters and stored
-for later comparison. ELIZA presents the bill when being confronted
-with a sentence that contains the phrase "shut up." Otherwise, it looks
-for keywords in the sentence, conjugates the rest of the sentence,
-remembers the keyword for later use, and finally selects an answer from
-the set of possible answers:
-
- function ElizaSays(YouSay) {
- if (YouSay == "") {
- cost = 0
- answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
- } else {
- q = toupper(YouSay)
- gsub("'", "", q)
- if(q == qold) {
- answer = "PLEASE DONT REPEAT YOURSELF !"
- } else {
- if (index(q, "SHUT UP") > 0) {
- answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
- int(100*rand()+30+cost/100)
- } else {
- qold = q
- w = "-" # no keyword recognized yet
- for (i in k) { # search for keywords
- if (index(q, i) > 0) {
- w = i
- break
- }
- }
- if (w == "-") { # no keyword, take old subject
- w = wold
- subj = subjold
- } else { # find subject
- subj = substr(q, index(q, w) + length(w)+1)
- wold = w
- subjold = subj # remember keyword and subject
- }
- for (i in conj)
- gsub(i, conj[i], q) # conjugation
- # from all answers to this keyword, select one randomly
- answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
- # insert subject into answer
- gsub("_", subj, answer)
- }
- }
- }
- cost += length(answer) # for later payment : 1 cent per character
- return answer
- }
-
- In the long but simple function 'SetUpEliza()', you can see tables
-for conjugation, keywords, and answers.(1) The associative array 'k'
-contains indices into the array of answers 'r'. To choose an answer,
-ELIZA just picks an index randomly:
-
- function SetUpEliza() {
- srand()
- wold = "-"
- subjold = " "
-
- # table for conjugation
- conj[" ARE " ] = " AM "
- conj["WERE " ] = "WAS "
- conj[" YOU " ] = " I "
- conj["YOUR " ] = "MY "
- conj[" IVE " ] =\
- conj[" I HAVE " ] = " YOU HAVE "
- conj[" YOUVE " ] =\
- conj[" YOU HAVE "] = " I HAVE "
- conj[" IM " ] =\
- conj[" I AM " ] = " YOU ARE "
- conj[" YOURE " ] =\
- conj[" YOU ARE " ] = " I AM "
-
- # table of all answers
- r[1] = "DONT YOU BELIEVE THAT I CAN _"
- r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
- ...
-
- # table for looking up answers that
- # fit to a certain keyword
- k["CAN YOU"] = "1 2 3"
- k["CAN I"] = "4 5"
- k["YOU ARE"] =\
- k["YOURE"] = "6 7 8 9"
- ...
- }
-
- Some interesting remarks and details (including the original source
-code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has
-a page with a collection of ELIZA-like programs. Many of them are
-written in Java, some of them disclosing the Java source code, and a few
-even explain how to modify the Java source code.
-
- ---------- Footnotes ----------
-
- (1) The version shown here is abbreviated. The full version comes
-with the 'gawk' distribution.
-
-
-File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking
-
-2.11 Network Programming Caveats
-================================
-
-By now it should be clear that debugging a networked application is more
-complicated than debugging a single-process single-hosted application.
-The behavior of a networked application sometimes looks noncausal
-because it is not reproducible in a strong sense. Whether a network
-application works or not sometimes depends on the following:
-
- * How crowded the underlying network is
-
- * If the party at the other end is running or not
-
- * The state of the party at the other end
-
- The most difficult problems for a beginner arise from the hidden
-states of the underlying network. After closing a TCP connection, it's
-often necessary to wait a short while before reopening the connection.
-Even more difficult is the establishment of a connection that previously
-ended with a "broken pipe." Those connections have to "time out" for a
-minute or so before they can reopen. Check this with the command
-'netstat -a', which provides a list of still "active" connections.
-
-
-File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking
-
-2.12 Where To Go From Here
-==========================
-
-Now, you have learned enough to build your own application. You could,
-for example, take part in the Loebner Contest to win $100,000. The
-Loebner Prize is the first formal instantiation of a Turing Test. Hugh
-Loebner agreed with The Cambridge Center for Behavioral Studies to
-underwrite a contest designed to implement the Turing Test. Dr. Loebner
-pledged a Grand Prize of $100,000 for the first computer whose responses
-were indistinguishable from a human's. Each year an annual prize of
-$2000 and a bronze medal is awarded to the _most_ human computer. The
-winner of the annual contest is the best entry relative to other entries
-that year, irrespective of how good it is in an absolute sense. Here is
-an example of a conversation with the winning program of 1997:
-
- (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
- [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
- PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
- JUDGE02[10:39:36]My name is Nathan.
- PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
- PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
- PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
- JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it?
- PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
- PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
- PROGRAM[10:41:21]embarrassed?
- JUDGE02[10:41:37]You tell me. I didn't see it.
- PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
- JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture.
- PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
- PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
- PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
- JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
- PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
- PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
- PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
- PROGRAM[10:44:01]dramatic actually happen?
- JUDGE02[10:44:19]Do you know what sculpture is?
- PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
- PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
- PROGRAM[10:44:51]must say.
- JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
- PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
- PROGRAM[10:45:43]off this one I think and onto something more down to earth!
- JUDGE02[10:46:20]What is more down to earth than art?
- PROGRAM[10:46:21]I don't know what -- to be honest. -
- PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
- PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
- PROGRAM[10:47:03]man? "
- JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
- JUDGE02[10:48:10]from another play the name of which I cannot remember.
- PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
- JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
- PROGRAM[10:49:02]Do you think of yourself as being attractive?
-
- This program insists on always speaking about the same story around
-Bill Clinton. You see, even a program with a rather narrow mind can
-behave so much like a human being that it can win this prize. It is
-quite common to let these programs talk to each other via network
-connections. But during the competition itself, the program and its
-computer have to be present at the place the competition is held. We
-all would love to see a 'gawk' program win in such an event. Maybe it
-is up to you to accomplish this?
-
- Some other ideas for useful networked applications:
- * Read the file 'doc/awkforai.txt' in the 'gawk' distribution. It
- was written by Ronald P. Loui (at the time, Associate Professor of
- Computer Science, at Washington University in St. Louis,
- <loui@ai.wustl.edu>) and summarizes why he taught 'gawk' to
- students of Artificial Intelligence. Here are some passages from
- the text:
-
- The GAWK manual can be consumed in a single lab session and
- the language can be mastered by the next morning by the
- average student. GAWK's automatic initialization, implicit
- coercion, I/O support and lack of pointers forgive many of the
- mistakes that young programmers are likely to make. Those who
- have seen C but not mastered it are happy to see that GAWK
- retains some of the same sensibilities while adding what must
- be regarded as spoonsful of syntactic sugar.
- ...
- There are further simple answers. Probably the best is the
- fact that increasingly, undergraduate AI programming is
- involving the Web. Oren Etzioni (University of Washington,
- Seattle) has for a while been arguing that the "softbot" is
- replacing the mechanical engineers' robot as the most
- glamorous AI testbed. If the artifact whose behavior needs to
- be controlled in an intelligent way is the software agent,
- then a language that is well-suited to controlling the
- software environment is the appropriate language. That would
- imply a scripting language. If the robot is KAREL, then the
- right language is "turn left; turn right." If the robot is
- Netscape, then the right language is something that can
- generate 'netscape -remote
- 'openURL(http://cs.wustl.edu/~loui)'' with elan.
- ...
- AI programming requires high-level thinking. There have
- always been a few gifted programmers who can write high-level
- programs in assembly language. Most however need the ambient
- abstraction to have a higher floor.
- ...
- Second, inference is merely the expansion of notation. No
- matter whether the logic that underlies an AI program is
- fuzzy, probabilistic, deontic, defeasible, or deductive, the
- logic merely defines how strings can be transformed into other
- strings. A language that provides the best support for string
- processing in the end provides the best support for logic, for
- the exploration of various logics, and for most forms of
- symbolic processing that AI might choose to call "reasoning"
- instead of "logic." The implication is that PROLOG, which
- saves the AI programmer from having to write a unifier, saves
- perhaps two dozen lines of GAWK code at the expense of
- strongly biasing the logic and representational expressiveness
- of any approach.
-
- Now that 'gawk' itself can connect to the Internet, it should be
- obvious that it is suitable for writing intelligent web agents.
-
- * 'awk' is strong at pattern recognition and string processing. So,
- it is well suited to the classic problem of language translation.
- A first try could be a program that knows the 100 most frequent
- English words and their counterparts in German or French. The
- service could be implemented by regularly reading email with the
- program above, replacing each word by its translation and sending
- the translation back via SMTP. Users would send English email to
- their translation service and get back a translated email message
- in return. As soon as this works, more effort can be spent on a
- real translation program.
-
- * Another dialogue-oriented application (on the verge of ridicule) is
- the email "support service." Troubled customers write an email to
- an automatic 'gawk' service that reads the email. It looks for
- keywords in the mail and assembles a reply email accordingly. By
- carefully investigating the email header, and repeating these
- keywords through the reply email, it is rather simple to give the
- customer a feeling that someone cares. Ideally, such a service
- would search a database of previous cases for solutions. If none
- exists, the database could, for example, consist of all the
- newsgroups, mailing lists and FAQs on the Internet.
-
-
-File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top
-
-3 Some Applications and Techniques
-**********************************
-
-In this major node, we look at a number of self-contained scripts, with
-an emphasis on concise networking. Along the way, we work towards
-creating building blocks that encapsulate often needed functions of the
-networking world, show new techniques that broaden the scope of problems
-that can be solved with 'gawk', and explore leading edge technology that
-may shape the future of networking.
-
- We often refer to the site-independent core of the server that we
-built in *note A Simple Web Server: Simple Server. When building new
-and nontrivial servers, we always copy this building block and append
-new instances of the two functions 'SetUpServer()' and 'HandleGET()'.
-
- This makes a lot of sense, since this scheme of event-driven
-execution provides 'gawk' with an interface to the most widely accepted
-standard for GUIs: the web browser. Now, 'gawk' can rival even Tcl/Tk.
-
- Tcl and 'gawk' have much in common. Both are simple scripting
-languages that allow us to quickly solve problems with short programs.
-But Tcl has Tk on top of it, and 'gawk' had nothing comparable up to
-now. While Tcl needs a large and ever-changing library (Tk, which was
-bound to the X Window System until recently), 'gawk' needs just the
-networking interface and some kind of browser on the client's side.
-Besides better portability, the most important advantage of this
-approach (embracing well-established standards such HTTP and HTML) is
-that _we do not need to change the language_. We let others do the work
-of fighting over protocols and standards. We can use HTML, JavaScript,
-VRML, or whatever else comes along to do our work.
-
-* Menu:
-
-* PANIC:: An Emergency Web Server.
-* GETURL:: Retrieving Web Pages.
-* REMCONF:: Remote Configuration Of Embedded Systems.
-* URLCHK:: Look For Changed Web Pages.
-* WEBGRAB:: Extract Links From A Page.
-* STATIST:: Graphing A Statistical Distribution.
-* MAZE:: Walking Through A Maze In Virtual Reality.
-* MOBAGWHO:: A Simple Mobile Agent.
-* STOXPRED:: Stock Market Prediction As A Service.
-* PROTBASE:: Searching Through A Protein Database.
-
-
-File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques
-
-3.1 PANIC: An Emergency Web Server
-==================================
-
-At first glance, the '"Hello, world"' example in *note A Primitive Web
-Service: Primitive Service, seems useless. By adding just a few lines,
-we can turn it into something useful.
-
- The PANIC program tells everyone who connects that the local site is
-not working. When a web server breaks down, it makes a difference if
-customers get a strange "network unreachable" message, or a short
-message telling them that the server has a problem. In such an
-emergency, the hard disk and everything on it (including the regular web
-service) may be unavailable. Rebooting the web server off a diskette
-makes sense in this setting.
-
- To use the PANIC program as an emergency web server, all you need are
-the 'gawk' executable and the program below on a diskette. By default,
-it connects to port 8080. A different value may be supplied on the
-command line:
-
- BEGIN {
- RS = ORS = "\r\n"
- if (MyPort == 0) MyPort = 8080
- HttpService = "/inet/tcp/" MyPort "/0/0"
- Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \
- "</HEAD><BODY><H1>" \
- "This site is temporarily out of service." \
- "</H1></BODY></HTML>"
- Len = length(Hello) + length(ORS)
- while ("awk" != "complex") {
- print "HTTP/1.0 200 OK" |& HttpService
- print "Content-Length: " Len ORS |& HttpService
- print Hello |& HttpService
- while ((HttpService |& getline) > 0)
- continue;
- close(HttpService)
- }
- }
-
-
-File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques
-
-3.2 GETURL: Retrieving Web Pages
-================================
-
-GETURL is a versatile building block for shell scripts that need to
-retrieve files from the Internet. It takes a web address as a
-command-line parameter and tries to retrieve the contents of this
-address. The contents are printed to standard output, while the header
-is printed to '/dev/stderr'. A surrounding shell script could analyze
-the contents and extract the text or the links. An ASCII browser could
-be written around GETURL. But more interestingly, web robots are
-straightforward to write on top of GETURL. On the Internet, you can find
-several programs of the same name that do the same job. They are
-usually much more complex internally and at least 10 times longer.
-
- At first, GETURL checks if it was called with exactly one web
-address. Then, it checks if the user chose to use a special proxy
-server whose name is handed over in a variable. By default, it is
-assumed that the local machine serves as proxy. GETURL uses the 'GET'
-method by default to access the web page. By handing over the name of a
-different method (such as 'HEAD'), it is possible to choose a different
-behavior. With the 'HEAD' method, the user does not receive the body of
-the page content, but does receive the header:
-
- BEGIN {
- if (ARGC != 2) {
- print "GETURL - retrieve Web page via HTTP 1.0"
- print "IN:\n the URL as a command-line parameter"
- print "PARAM(S):\n -v Proxy=MyProxy"
- print "OUT:\n the page content on stdout"
- print " the page header on stderr"
- print "JK 16.05.1997"
- print "ADR 13.08.2000"
- exit
- }
- URL = ARGV[1]; ARGV[1] = ""
- if (Proxy == "") Proxy = "127.0.0.1"
- if (ProxyPort == 0) ProxyPort = 80
- if (Method == "") Method = "GET"
- HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
- ORS = RS = "\r\n\r\n"
- print Method " " URL " HTTP/1.0" |& HttpService
- HttpService |& getline Header
- print Header > "/dev/stderr"
- while ((HttpService |& getline) > 0)
- printf "%s", $0
- close(HttpService)
- }
-
- This program can be changed as needed, but be careful with the last
-lines. Make sure transmission of binary data is not corrupted by
-additional line breaks. Even as it is now, the byte sequence
-'"\r\n\r\n"' would disappear if it were contained in binary data. Don't
-get caught in a trap when trying a quick fix on this one.
-
-
-File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques
-
-3.3 REMCONF: Remote Configuration of Embedded Systems
-=====================================================
-
-Today, you often find powerful processors in embedded systems.
-Dedicated network routers and controllers for all kinds of machinery are
-examples of embedded systems. Processors like the Intel 80x86 or the
-AMD Elan are able to run multitasking operating systems, such as XINU or
-GNU/Linux in embedded PCs. These systems are small and usually do not
-have a keyboard or a display. Therefore it is difficult to set up their
-configuration. There are several widespread ways to set them up:
-
- * DIP switches
-
- * Read Only Memories such as EPROMs
-
- * Serial lines or some kind of keyboard
-
- * Network connections via 'telnet' or SNMP
-
- * HTTP connections with HTML GUIs
-
- In this node, we look at a solution that uses HTTP connections to
-control variables of an embedded system that are stored in a file.
-Since embedded systems have tight limits on resources like memory, it is
-difficult to employ advanced techniques such as SNMP and HTTP servers.
-'gawk' fits in quite nicely with its single executable which needs just
-a short script to start working. The following program stores the
-variables in a file, and a concurrent process in the embedded system may
-read the file. The program uses the site-independent part of the simple
-web server that we developed in *note A Web Service with Interaction:
-Interacting Service. As mentioned there, all we have to do is to write
-two new procedures 'SetUpServer()' and 'HandleGET()':
-
- function SetUpServer() {
- TopHeader = "<HTML><title>Remote Configuration</title>"
- TopDoc = "<BODY>\
- <h2>Please choose one of the following actions:</h2>\
- <UL>\
- <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
- <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\
- <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\
- <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\
- <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\
- </UL>"
- TopFooter = "</BODY></HTML>"
- if (ConfigFile == "") ConfigFile = "config.asc"
- }
-
- The function 'SetUpServer()' initializes the top level HTML texts as
-usual. It also initializes the name of the file that contains the
-configuration parameters and their values. In case the user supplies a
-name from the command line, that name is used. The file is expected to
-contain one parameter per line, with the name of the parameter in column
-one and the value in column two.
-
- The function 'HandleGET()' reflects the structure of the menu tree as
-usual. The first menu choice tells the user what this is all about.
-The second choice reads the configuration file line by line and stores
-the parameters and their values. Notice that the record separator for
-this file is '"\n"', in contrast to the record separator for HTTP. The
-third menu choice builds an HTML table to show the contents of the
-configuration file just read. The fourth choice does the real work of
-changing parameters, and the last one just saves the configuration into
-a file:
-
- function HandleGET() {
- if(MENU[2] == "AboutServer") {
- Document = "This is a GUI for remote configuration of an\
- embedded system. It is is implemented as one GAWK script."
- } else if (MENU[2] == "ReadConfig") {
- RS = "\n"
- while ((getline < ConfigFile) > 0)
- config[$1] = $2;
- close(ConfigFile)
- RS = "\r\n"
- Document = "Configuration has been read."
- } else if (MENU[2] == "CheckConfig") {
- Document = "<TABLE BORDER=1 CELLPADDING=5>"
- for (i in config)
- Document = Document "<TR><TD>" i "</TD>" \
- "<TD>" config[i] "</TD></TR>"
- Document = Document "</TABLE>"
- } else if (MENU[2] == "ChangeConfig") {
- if ("Param" in GETARG) { # any parameter to set?
- if (GETARG["Param"] in config) { # is parameter valid?
- config[GETARG["Param"]] = GETARG["Value"]
- Document = (GETARG["Param"] " = " GETARG["Value"] ".")
- } else {
- Document = "Parameter <b>" GETARG["Param"] "</b> is invalid."
- }
- } else {
- Document = "<FORM method=GET><h4>Change one parameter</h4>\
- <TABLE BORDER CELLPADDING=5>\
- <TR><TD>Parameter</TD><TD>Value</TD></TR>\
- <TR><TD><input type=text name=Param value=\"\" size=20></TD>\
- <TD><input type=text name=Value value=\"\" size=40></TD>\
- </TR></TABLE><input type=submit value=\"Set\"></FORM>"
- }
- } else if (MENU[2] == "SaveConfig") {
- for (i in config)
- printf("%s %s\n", i, config[i]) > ConfigFile
- close(ConfigFile)
- Document = "Configuration has been saved."
- }
- }
-
- We could also view the configuration file as a database. From this
-point of view, the previous program acts like a primitive database
-server. Real SQL database systems also make a service available by
-providing a TCP port that clients can connect to. But the application
-level protocols they use are usually proprietary and also change from
-time to time. This is also true for the protocol that MiniSQL uses.
-
-
-File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques
-
-3.4 URLCHK: Look for Changed Web Pages
-======================================
-
-Most people who make heavy use of Internet resources have a large
-bookmark file with pointers to interesting web sites. It is impossible
-to regularly check by hand if any of these sites have changed. A
-program is needed to automatically look at the headers of web pages and
-tell which ones have changed. URLCHK does the comparison after using
-GETURL with the 'HEAD' method to retrieve the header.
-
- Like GETURL, this program first checks that it is called with exactly
-one command-line parameter. URLCHK also takes the same command-line
-variables 'Proxy' and 'ProxyPort' as GETURL, because these variables are
-handed over to GETURL for each URL that gets checked. The one and only
-parameter is the name of a file that contains one line for each URL. In
-the first column, we find the URL, and the second and third columns hold
-the length of the URL's body when checked for the two last times. Now,
-we follow this plan:
-
- 1. Read the URLs from the file and remember their most recent lengths
-
- 2. Delete the contents of the file
-
- 3. For each URL, check its new length and write it into the file
-
- 4. If the most recent and the new length differ, tell the user
-
- It may seem a bit peculiar to read the URLs from a file together with
-their two most recent lengths, but this approach has several advantages.
-You can call the program again and again with the same file. After
-running the program, you can regenerate the changed URLs by extracting
-those lines that differ in their second and third columns:
-
- BEGIN {
- if (ARGC != 2) {
- print "URLCHK - check if URLs have changed"
- print "IN:\n the file with URLs as a command-line parameter"
- print " file contains URL, old length, new length"
- print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
- print "OUT:\n same as file with URLs"
- print "JK 02.03.1998"
- exit
- }
- URLfile = ARGV[1]; ARGV[1] = ""
- if (Proxy != "") Proxy = " -v Proxy=" Proxy
- if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
- while ((getline < URLfile) > 0)
- Length[$1] = $3 + 0
- close(URLfile) # now, URLfile is read in and can be updated
- GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
- for (i in Length) {
- GetThisHeader = GetHeader i " 2>&1"
- while ((GetThisHeader | getline) > 0)
- if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
- close(GetThisHeader)
- print i, Length[i], NewLength > URLfile
- if (Length[i] != NewLength) # report only changed URLs
- print i, Length[i], NewLength
- }
- close(URLfile)
- }
-
- Another thing that may look strange is the way GETURL is called.
-Before calling GETURL, we have to check if the proxy variables need to
-be passed on. If so, we prepare strings that will become part of the
-command line later. In 'GetHeader()', we store these strings together
-with the longest part of the command line. Later, in the loop over the
-URLs, 'GetHeader()' is appended with the URL and a redirection operator
-to form the command that reads the URL's header over the Internet.
-GETURL always produces the headers over '/dev/stderr'. That is the
-reason why we need the redirection operator to have the header piped in.
-
- This program is not perfect because it assumes that changing URLs
-results in changed lengths, which is not necessarily true. A more
-advanced approach is to look at some other header line that holds time
-information. But, as always when things get a bit more complicated,
-this is left as an exercise to the reader.
-
-
-File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques
-
-3.5 WEBGRAB: Extract Links from a Page
-======================================
-
-Sometimes it is necessary to extract links from web pages. Browsers do
-it, web robots do it, and sometimes even humans do it. Since we have a
-tool like GETURL at hand, we can solve this problem with some help from
-the Bourne shell:
-
- BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" }
- RT != "" {
- command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
- " > doc" NR ".html")
- print command
- }
-
- Notice that the regular expression for URLs is rather crude. A
-precise regular expression is much more complex. But this one works
-rather well. One problem is that it is unable to find internal links of
-an HTML document. Another problem is that 'ftp', 'telnet', 'news',
-'mailto', and other kinds of links are missing in the regular
-expression. However, it is straightforward to add them, if doing so is
-necessary for other tasks.
-
- This program reads an HTML file and prints all the HTTP links that it
-finds. It relies on 'gawk''s ability to use regular expressions as
-record separators. With 'RS' set to a regular expression that matches
-links, the second action is executed each time a non-empty link is
-found. We can find the matching link itself in 'RT'.
-
- The action could use the 'system()' function to let another GETURL
-retrieve the page, but here we use a different approach. This simple
-program prints shell commands that can be piped into 'sh' for execution.
-This way it is possible to first extract the links, wrap shell commands
-around them, and pipe all the shell commands into a file. After editing
-the file, execution of the file retrieves exactly those files that we
-really need. In case we do not want to edit, we can retrieve all the
-pages like this:
-
- gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
-
- After this, you will find the contents of all referenced documents in
-files named 'doc*.html' even if they do not contain HTML code. The most
-annoying thing is that we always have to pass the proxy to GETURL. If
-you do not like to see the headers of the web pages appear on the
-screen, you can redirect them to '/dev/null'. Watching the headers
-appear can be quite interesting, because it reveals interesting details
-such as which web server the companies use. Now, it is clear how the
-clever marketing people use web robots to determine the market shares of
-Microsoft and Netscape in the web server market.
-
- Port 80 of any web server is like a small hole in a repellent
-firewall. After attaching a browser to port 80, we usually catch a
-glimpse of the bright side of the server (its home page). With a tool
-like GETURL at hand, we are able to discover some of the more concealed
-or even "indecent" services (i.e., lacking conformity to standards of
-quality). It can be exciting to see the fancy CGI scripts that lie
-there, revealing the inner workings of the server, ready to be called:
-
- * With a command such as:
-
- gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
-
- some servers give you a directory listing of the CGI files.
- Knowing the names, you can try to call some of them and watch for
- useful results. Sometimes there are executables in such
- directories (such as Perl interpreters) that you may call remotely.
- If there are subdirectories with configuration data of the web
- server, this can also be quite interesting to read.
-
- * The well-known Apache web server usually has its CGI files in the
- directory '/cgi-bin'. There you can often find the scripts
- 'test-cgi' and 'printenv'. Both tell you some things about the
- current connection and the installation of the web server. Just
- call:
-
- gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
- gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
-
- * Sometimes it is even possible to retrieve system files like the web
- server's log file--possibly containing customer data--or even the
- file '/etc/passwd'. (We don't recommend this!)
-
- *Caution:* Although this may sound funny or simply irrelevant, we are
-talking about severe security holes. Try to explore your own system
-this way and make sure that none of the above reveals too much
-information about your system.
-
-
-File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques
-
-3.6 STATIST: Graphing a Statistical Distribution
-================================================
-
-In the HTTP server examples we've shown thus far, we never present an
-image to the browser and its user. Presenting images is one task.
-Generating images that reflect some user input and presenting these
-dynamically generated images is another. In this node, we use GNUPlot
-for generating '.png', '.ps', or '.gif' files.(1)
-
- The program we develop takes the statistical parameters of two
-samples and computes the t-test statistics. As a result, we get the
-probabilities that the means and the variances of both samples are the
-same. In order to let the user check plausibility, the program presents
-an image of the distributions. The statistical computation follows
-'Numerical Recipes in C: The Art of Scientific Computing' by William H.
-Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery.
-Since 'gawk' does not have a built-in function for the computation of
-the beta function, we use the 'ibeta()' function of GNUPlot. As a side
-effect, we learn how to use GNUPlot as a sophisticated calculator. The
-comparison of means is done as in 'tutest', paragraph 14.2, page 613,
-and the comparison of variances is done as in 'ftest', page 611 in
-'Numerical Recipes'.
-
- As usual, we take the site-independent code for servers and append
-our own functions 'SetUpServer()' and 'HandleGET()':
-
- function SetUpServer() {
- TopHeader = "<HTML><title>Statistics with GAWK</title>"
- TopDoc = "<BODY>\
- <h2>Please choose one of the following actions:</h2>\
- <UL>\
- <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
- <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\
- </UL>"
- TopFooter = "</BODY></HTML>"
- GnuPlot = "gnuplot 2>&1"
- m1=m2=0; v1=v2=1; n1=n2=10
- }
-
- Here, you see the menu structure that the user sees. Later, we will
-see how the program structure of the 'HandleGET()' function reflects the
-menu structure. What is missing here is the link for the image we
-generate. In an event-driven environment, request, generation, and
-delivery of images are separated.
-
- Notice the way we initialize the 'GnuPlot' command string for the
-pipe. By default, GNUPlot outputs the generated image via standard
-output, as well as the results of 'print'(ed) calculations via standard
-error. The redirection causes standard error to be mixed into standard
-output, enabling us to read results of calculations with 'getline'. By
-initializing the statistical parameters with some meaningful defaults,
-we make sure the user gets an image the first time he uses the program.
-
- Following is the rather long function 'HandleGET()', which implements
-the contents of this service by reacting to the different kinds of
-requests from the browser. Before you start playing with this script,
-make sure that your browser supports JavaScript and that it also has
-this option switched on. The script uses a short snippet of JavaScript
-code for delayed opening of a window with an image. A more detailed
-explanation follows:
-
- function HandleGET() {
- if(MENU[2] == "AboutServer") {
- Document = "This is a GUI for a statistical computation.\
- It compares means and variances of two distributions.\
- It is implemented as one GAWK script and uses GNUPLOT."
- } else if (MENU[2] == "EnterParameters") {
- Document = ""
- if ("m1" in GETARG) { # are there parameters to compare?
- Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\
- setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\
- "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>"
- m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
- m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
- t = (m1-m2)/sqrt(v1/n1+v2/n2)
- df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
- + (v2/n2)*(v2/n2) /(n2-1))
- if (v1>v2) {
- f = v1/v2
- df1 = n1 - 1
- df2 = n2 - 1
- } else {
- f = v2/v1
- df1 = n2 - 1
- df2 = n1 - 1
- }
- print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
- print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
- df2/(df2+df1*f) ")" |& GnuPlot
- print "print pt, pF" |& GnuPlot
- RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
- print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
- print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
- print "set term png small color" |& GnuPlot
- #print "set term postscript color" |& GnuPlot
- #print "set term gif medium size 320,240" |& GnuPlot
- print "set yrange[-0.3:]" |& GnuPlot
- print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
- print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
- print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
- mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
- print "quit" |& GnuPlot
- GnuPlot |& getline Image
- while ((GnuPlot |& getline) > 0)
- Image = Image RS $0
- close(GnuPlot)
- }
- Document = Document "\
- <h3>Do these samples have the same Gaussian distribution?</h3>\
- <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\
- <TR>\
- <TD>1. Mean </TD>
- <TD><input type=text name=m1 value=" m1 " size=8></TD>\
- <TD>1. Variance</TD>
- <TD><input type=text name=v1 value=" v1 " size=8></TD>\
- <TD>1. Count </TD>
- <TD><input type=text name=n1 value=" n1 " size=8></TD>\
- </TR><TR>\
- <TD>2. Mean </TD>
- <TD><input type=text name=m2 value=" m2 " size=8></TD>\
- <TD>2. Variance</TD>
- <TD><input type=text name=v2 value=" v2 " size=8></TD>\
- <TD>2. Count </TD>
- <TD><input type=text name=n2 value=" n2 " size=8></TD>\
- </TR> <input type=submit value=\"Compute\">\
- </TABLE></FORM><BR>"
- } else if (MENU[2] ~ "Image") {
- Reason = "OK" ORS "Content-type: image/png"
- #Reason = "OK" ORS "Content-type: application/x-postscript"
- #Reason = "OK" ORS "Content-type: image/gif"
- Header = Footer = ""
- Document = Image
- }
- }
-
- As usual, we give a short description of the service in the first
-menu choice. The third menu choice shows us that generation and
-presentation of an image are two separate actions. While the latter
-takes place quite instantly in the third menu choice, the former takes
-place in the much longer second choice. Image data passes from the
-generating action to the presenting action via the variable 'Image' that
-contains a complete '.png' image, which is otherwise stored in a file.
-If you prefer '.ps' or '.gif' images over the default '.png' images, you
-may select these options by uncommenting the appropriate lines. But
-remember to do so in two places: when telling GNUPlot which kind of
-images to generate, and when transmitting the image at the end of the
-program.
-
- Looking at the end of the program, the way we pass the 'Content-type'
-to the browser is a bit unusual. It is appended to the 'OK' of the
-first header line to make sure the type information becomes part of the
-header. The other variables that get transmitted across the network are
-made empty, because in this case we do not have an HTML document to
-transmit, but rather raw image data to contain in the body.
-
- Most of the work is done in the second menu choice. It starts with a
-strange JavaScript code snippet. When first implementing this server,
-we used a short '"<IMG SRC=" MyPrefix "/Image>"' here. But then
-browsers got smarter and tried to improve on speed by requesting the
-image and the HTML code at the same time. When doing this, the browser
-tries to build up a connection for the image request while the request
-for the HTML text is not yet completed. The browser tries to connect to
-the 'gawk' server on port 8080 while port 8080 is still in use for
-transmission of the HTML text. The connection for the image cannot be
-built up, so the image appears as "broken" in the browser window. We
-solved this problem by telling the browser to open a separate window for
-the image, but only after a delay of 1000 milliseconds. By this time,
-the server should be ready for serving the next request.
-
- But there is one more subtlety in the JavaScript code. Each time the
-JavaScript code opens a window for the image, the name of the image is
-appended with a timestamp ('systime()'). Why this constant change of
-name for the image? Initially, we always named the image 'Image', but
-then the Netscape browser noticed the name had _not_ changed since the
-previous request and displayed the previous image (caching behavior).
-The server core is implemented so that browsers are told _not_ to cache
-anything. Obviously HTTP requests do not always work as expected. One
-way to circumvent the cache of such overly smart browsers is to change
-the name of the image with each request. These three lines of
-JavaScript caused us a lot of trouble.
-
- The rest can be broken down into two phases. At first, we check if
-there are statistical parameters. When the program is first started,
-there usually are no parameters because it enters the page coming from
-the top menu. Then, we only have to present the user a form that he can
-use to change statistical parameters and submit them. Subsequently, the
-submission of the form causes the execution of the first phase because
-_now_ there _are_ parameters to handle.
-
- Now that we have parameters, we know there will be an image
-available. Therefore we insert the JavaScript code here to initiate the
-opening of the image in a separate window. Then, we prepare some
-variables that will be passed to GNUPlot for calculation of the
-probabilities. Prior to reading the results, we must temporarily change
-'RS' because GNUPlot separates lines with newlines. After instructing
-GNUPlot to generate a '.png' (or '.ps' or '.gif') image, we initiate the
-insertion of some text, explaining the resulting probabilities. The
-final 'plot' command actually generates the image data. This raw binary
-has to be read in carefully without adding, changing, or deleting a
-single byte. Hence the unusual initialization of 'Image' and completion
-with a 'while' loop.
-
- When using this server, it soon becomes clear that it is far from
-being perfect. It mixes source code of six scripting languages or
-protocols:
-
- * GNU 'awk' implements a server for the protocol:
- * HTTP which transmits:
- * HTML text which contains a short piece of:
- * JavaScript code opening a separate window.
- * A Bourne shell script is used for piping commands into:
- * GNUPlot to generate the image to be opened.
-
- After all this work, the GNUPlot image opens in the JavaScript window
-where it can be viewed by the user.
-
- It is probably better not to mix up so many different languages. The
-result is not very readable. Furthermore, the statistical part of the
-server does not take care of invalid input. Among others, using
-negative variances will cause invalid results.
-
- ---------- Footnotes ----------
-
- (1) Due to licensing problems, the default installation of GNUPlot
-disables the generation of '.gif' files. If your installed version does
-not accept 'set term gif', just download and install the most recent
-version of GNUPlot and the GD library (http://www.boutell.com/gd/) by
-Thomas Boutell. Otherwise you still have the chance to generate some
-ASCII-art style images with GNUPlot by using 'set term dumb'. (We tried
-it and it worked.)
-
-
-File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques
-
-3.7 MAZE: Walking Through a Maze In Virtual Reality
-===================================================
-
- In the long run, every program becomes rococo, and then rubble.
- Alan Perlis
-
- By now, we know how to present arbitrary 'Content-type's to a
-browser. In this node, our server will present a 3D world to our
-browser. The 3D world is described in a scene description language
-(VRML, Virtual Reality Modeling Language) that allows us to travel
-through a perspective view of a 2D maze with our browser. Browsers with
-a VRML plugin enable exploration of this technology. We could do one of
-those boring 'Hello world' examples here, that are usually presented
-when introducing novices to VRML. If you have never written any VRML
-code, have a look at the VRML FAQ. Presenting a static VRML scene is a
-bit trivial; in order to expose 'gawk''s new capabilities, we will
-present a dynamically generated VRML scene. The function
-'SetUpServer()' is very simple because it only sets the default HTML
-page and initializes the random number generator. As usual, the
-surrounding server lets you browse the maze.
-
- function SetUpServer() {
- TopHeader = "<HTML><title>Walk through a maze</title>"
- TopDoc = "\
- <h2>Please choose one of the following actions:</h2>\
- <UL>\
- <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
- <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\
- </UL>"
- TopFooter = "</HTML>"
- srand()
- }
-
- The function 'HandleGET()' is a bit longer because it first computes
-the maze and afterwards generates the VRML code that is sent across the
-network. As shown in the STATIST example (*note STATIST::), we set the
-type of the content to VRML and then store the VRML representation of
-the maze as the page content. We assume that the maze is stored in a 2D
-array. Initially, the maze consists of walls only. Then, we add an
-entry and an exit to the maze and let the rest of the work be done by
-the function 'MakeMaze()'. Now, only the wall fields are left in the
-maze. By iterating over the these fields, we generate one line of VRML
-code for each wall field.
-
- function HandleGET() {
- if (MENU[2] == "AboutServer") {
- Document = "If your browser has a VRML 2 plugin,\
- this server shows you a simple VRML scene."
- } else if (MENU[2] == "VRMLtest") {
- XSIZE = YSIZE = 11 # initially, everything is wall
- for (y = 0; y < YSIZE; y++)
- for (x = 0; x < XSIZE; x++)
- Maze[x, y] = "#"
- delete Maze[0, 1] # entry is not wall
- delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
- MakeMaze(1, 1)
- Document = "\
- #VRML V2.0 utf8\n\
- Group {\n\
- children [\n\
- PointLight {\n\
- ambientIntensity 0.2\n\
- color 0.7 0.7 0.7\n\
- location 0.0 8.0 10.0\n\
- }\n\
- DEF B1 Background {\n\
- skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
- skyAngle 1.6\n\
- groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
- groundAngle [ 1.2 1.57 ]\n\
- }\n\
- DEF Wall Shape {\n\
- geometry Box {size 1 1 1}\n\
- appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
- }\n\
- DEF Entry Viewpoint {\n\
- position 0.5 1.0 5.0\n\
- orientation 0.0 0.0 -1.0 0.52\n\
- }\n"
- for (i in Maze) {
- split(i, t, SUBSEP)
- Document = Document " Transform { translation "
- Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
- }
- Document = Document " ] # end of group for world\n}"
- Reason = "OK" ORS "Content-type: model/vrml"
- Header = Footer = ""
- }
- }
-
- Finally, we have a look at 'MakeMaze()', the function that generates
-the 'Maze' array. When entered, this function assumes that the array
-has been initialized so that each element represents a wall element and
-the maze is initially full of wall elements. Only the entrance and the
-exit of the maze should have been left free. The parameters of the
-function tell us which element must be marked as not being a wall.
-After this, we take a look at the four neighboring elements and remember
-which we have already treated. Of all the neighboring elements, we take
-one at random and walk in that direction. Therefore, the wall element
-in that direction has to be removed and then, we call the function
-recursively for that element. The maze is only completed if we iterate
-the above procedure for _all_ neighboring elements (in random order) and
-for our present element by recursively calling the function for the
-present element. This last iteration could have been done in a loop,
-but it is done much simpler recursively.
-
- Notice that elements with coordinates that are both odd are assumed
-to be on our way through the maze and the generating process cannot
-terminate as long as there is such an element not being 'delete'd. All
-other elements are potentially part of the wall.
-
- function MakeMaze(x, y) {
- delete Maze[x, y] # here we are, we have no wall here
- p = 0 # count unvisited fields in all directions
- if (x-2 SUBSEP y in Maze) d[p++] = "-x"
- if (x SUBSEP y-2 in Maze) d[p++] = "-y"
- if (x+2 SUBSEP y in Maze) d[p++] = "+x"
- if (x SUBSEP y+2 in Maze) d[p++] = "+y"
- if (p>0) { # if there are unvisited fields, go there
- p = int(p*rand()) # choose one unvisited field at random
- if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
- } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
- } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
- } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
- } # we are back from recursion
- MakeMaze(x, y); # try again while there are unvisited fields
- }
- }
-
-
-File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques
-
-3.8 MOBAGWHO: a Simple Mobile Agent
-===================================
-
- There are two ways of constructing a software design: One way is to
- make it so simple that there are obviously no deficiencies, and the
- other way is to make it so complicated that there are no obvious
- deficiencies.
- C. A. R. Hoare
-
- A "mobile agent" is a program that can be dispatched from a computer
-and transported to a remote server for execution. This is called
-"migration", which means that a process on another system is started
-that is independent from its originator. Ideally, it wanders through a
-network while working for its creator or owner. In places like the UMBC
-Agent Web, people are quite confident that (mobile) agents are a
-software engineering paradigm that enables us to significantly increase
-the efficiency of our work. Mobile agents could become the mediators
-between users and the networking world. For an unbiased view at this
-technology, see the remarkable paper 'Mobile Agents: Are they a good
-idea?'.(1)
-
- When trying to migrate a process from one system to another, a server
-process is needed on the receiving side. Depending on the kind of
-server process, several ways of implementation come to mind. How the
-process is implemented depends upon the kind of server process:
-
- * HTTP can be used as the protocol for delivery of the migrating
- process. In this case, we use a common web server as the receiving
- server process. A universal CGI script mediates between migrating
- process and web server. Each server willing to accept migrating
- agents makes this universal service available. HTTP supplies the
- 'POST' method to transfer some data to a file on the web server.
- When a CGI script is called remotely with the 'POST' method instead
- of the usual 'GET' method, data is transmitted from the client
- process to the standard input of the server's CGI script. So, to
- implement a mobile agent, we must not only write the agent program
- to start on the client side, but also the CGI script to receive the
- agent on the server side.
-
- * The 'PUT' method can also be used for migration. HTTP does not
- require a CGI script for migration via 'PUT'. However, with common
- web servers there is no advantage to this solution, because web
- servers such as Apache require explicit activation of a special
- 'PUT' script.
-
- * 'Agent Tcl' pursues a different course; it relies on a dedicated
- server process with a dedicated protocol specialized for receiving
- mobile agents.
-
- Our agent example abuses a common web server as a migration tool.
-So, it needs a universal CGI script on the receiving side (the web
-server). The receiving script is activated with a 'POST' request when
-placed into a location like '/httpd/cgi-bin/PostAgent.sh'. Make sure
-that the server system uses a version of 'gawk' that supports network
-access (Version 3.1 or later; verify with 'gawk --version').
-
- #!/bin/sh
- MobAg=/tmp/MobileAgent.$$
- # direct script to mobile agent file
- cat > $MobAg
- # execute agent concurrently
- gawk -f $MobAg $MobAg > /dev/null &
- # HTTP header, terminator and body
- gawk 'BEGIN { print "\r\nAgent started" }'
- rm $MobAg # delete script file of agent
-
- By making its process id ('$$') part of the unique file name, the
-script avoids conflicts between concurrent instances of the script.
-First, all lines from standard input (the mobile agent's source code)
-are copied into this unique file. Then, the agent is started as a
-concurrent process and a short message reporting this fact is sent to
-the submitting client. Finally, the script file of the mobile agent is
-removed because it is no longer needed. Although it is a short script,
-there are several noteworthy points:
-
-Security
- _There is none_. In fact, the CGI script should never be made
- available on a server that is part of the Internet because everyone
- would be allowed to execute arbitrary commands with it. This
- behavior is acceptable only when performing rapid prototyping.
-
-Self-Reference
- Each migrating instance of an agent is started in a way that
- enables it to read its own source code from standard input and use
- the code for subsequent migrations. This is necessary because it
- needs to treat the agent's code as data to transmit. 'gawk' is not
- the ideal language for such a job. Lisp and Tcl are more suitable
- because they do not make a distinction between program code and
- data.
-
-Independence
- After migration, the agent is not linked to its former home in any
- way. By reporting 'Agent started', it waves "Goodbye" to its
- origin. The originator may choose to terminate or not.
-
- The originating agent itself is started just like any other
-command-line script, and reports the results on standard output. By
-letting the name of the original host migrate with the agent, the agent
-that migrates to a host far away from its origin can report the result
-back home. Having arrived at the end of the journey, the agent
-establishes a connection and reports the results. This is the reason
-for determining the name of the host with 'uname -n' and storing it in
-'MyOrigin' for later use. We may also set variables with the '-v'
-option from the command line. This interactivity is only of importance
-in the context of starting a mobile agent; therefore this 'BEGIN'
-pattern and its action do not take part in migration:
-
- BEGIN {
- if (ARGC != 2) {
- print "MOBAG - a simple mobile agent"
- print "CALL:\n gawk -f mobag.awk mobag.awk"
- print "IN:\n the name of this script as a command-line parameter"
- print "PARAM:\n -v MyOrigin=myhost.com"
- print "OUT:\n the result on stdout"
- print "JK 29.03.1998 01.04.1998"
- exit
- }
- if (MyOrigin == "") {
- "uname -n" | getline MyOrigin
- close("uname -n")
- }
- }
-
- Since 'gawk' cannot manipulate and transmit parts of the program
-directly, the source code is read and stored in strings. Therefore, the
-program scans itself for the beginning and the ending of functions.
-Each line in between is appended to the code string until the end of the
-function has been reached. A special case is this part of the program
-itself. It is not a function. Placing a similar framework around it
-causes it to be treated like a function. Notice that this mechanism
-works for all the functions of the source code, but it cannot guarantee
-that the order of the functions is preserved during migration:
-
- #ReadMySelf
- /^function / { FUNC = $2 }
- /^END/ || /^#ReadMySelf/ { FUNC = $1 }
- FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
- (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \
- { FUNC = "" }
- #EndOfMySelf
-
- The web server code in *note A Web Service with Interaction:
-Interacting Service, was first developed as a site-independent core.
-Likewise, the 'gawk'-based mobile agent starts with an agent-independent
-core, to which can be appended application-dependent functions. What
-follows is the only application-independent function needed for the
-mobile agent:
-
- function migrate(Destination, MobCode, Label) {
- MOBVAR["Label"] = Label
- MOBVAR["Destination"] = Destination
- RS = ORS = "\r\n"
- HttpService = "/inet/tcp/0/" Destination
- for (i in MOBFUN)
- MobCode = (MobCode "\n" MOBFUN[i])
- MobCode = MobCode "\n\nBEGIN {"
- for (i in MOBVAR)
- MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
- MobCode = MobCode "\n}\n"
- print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
- print "Content-length:", length(MobCode) ORS |& HttpService
- printf "%s", MobCode |& HttpService
- while ((HttpService |& getline) > 0)
- print $0
- close(HttpService)
- }
-
- The 'migrate()' function prepares the aforementioned strings
-containing the program code and transmits them to a server. A
-consequence of this modular approach is that the 'migrate()' function
-takes some parameters that aren't needed in this application, but that
-will be in future ones. Its mandatory parameter 'Destination' holds the
-name (or IP address) of the server that the agent wants as a host for
-its code. The optional parameter 'MobCode' may contain some 'gawk' code
-that is inserted during migration in front of all other code. The
-optional parameter 'Label' may contain a string that tells the agent
-what to do in program execution after arrival at its new home site. One
-of the serious obstacles in implementing a framework for mobile agents
-is that it does not suffice to migrate the code. It is also necessary
-to migrate the state of execution of the agent. In contrast to 'Agent
-Tcl', this program does not try to migrate the complete set of
-variables. The following conventions are used:
-
- * Each variable in an agent program is local to the current host and
- does _not_ migrate.
-
- * The array 'MOBFUN' shown above is an exception. It is handled by
- the function 'migrate()' and does migrate with the application.
-
- * The other exception is the array 'MOBVAR'. Each variable that
- takes part in migration has to be an element of this array.
- 'migrate()' also takes care of this.
-
- Now it's clear what happens to the 'Label' parameter of the function
-'migrate()'. It is copied into 'MOBVAR["Label"]' and travels alongside
-the other data. Since travelling takes place via HTTP, records must be
-separated with '"\r\n"' in 'RS' and 'ORS' as usual. The code assembly
-for migration takes place in three steps:
-
- * Iterate over 'MOBFUN' to collect all functions verbatim.
-
- * Prepare a 'BEGIN' pattern and put assignments to mobile variables
- into the action part.
-
- * Transmission itself resembles GETURL: the header with the request
- and the 'Content-length' is followed by the body. In case there is
- any reply over the network, it is read completely and echoed to
- standard output to avoid irritating the server.
-
- The application-independent framework is now almost complete. What
-follows is the 'END' pattern that is executed when the mobile agent has
-finished reading its own code. First, it checks whether it is already
-running on a remote host or not. In case initialization has not yet
-taken place, it starts 'MyInit()'. Otherwise (later, on a remote host),
-it starts 'MyJob()':
-
- END {
- if (ARGC != 2) exit # stop when called with wrong parameters
- if (MyOrigin != "") # is this the originating host?
- MyInit() # if so, initialize the application
- else # we are on a host with migrated data
- MyJob() # so we do our job
- }
-
- All that's left to extend the framework into a complete application
-is to write two application-specific functions: 'MyInit()' and
-'MyJob()'. Keep in mind that the former is executed once on the
-originating host, while the latter is executed after each migration:
-
- function MyInit() {
- MOBVAR["MyOrigin"] = MyOrigin
- MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
- split(MOBVAR["Machines"], Machines) # which host is the first?
- migrate(Machines[1], "", "") # go to the first host
- while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
- print $0 # print result
- close("/inet/tcp/8080/0/0")
- }
-
- As mentioned earlier, this agent takes the name of its origin
-('MyOrigin') with it. Then, it takes the name of its first destination
-and goes there for further work. Notice that this name has the port
-number of the web server appended to the name of the server, because the
-function 'migrate()' needs it this way to create the 'HttpService'
-variable. Finally, it waits for the result to arrive. The 'MyJob()'
-function runs on the remote host:
-
- function MyJob() {
- # forget this host
- sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
- MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
- while (("who" | getline) > 0) # who is logged in?
- MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
- close("who")
- if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit?
- split(MOBVAR["Machines"], Machines) # which host is next?
- migrate(Machines[1], "", "") # go there
- } else { # no more machines
- gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
- print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
- close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
- }
- }
-
- After migrating, the first thing to do in 'MyJob()' is to delete the
-name of the current host from the list of hosts to visit. Now, it is
-time to start the real work by appending the host's name to the result
-string, and reading line by line who is logged in on this host. A very
-annoying circumstance is the fact that the elements of 'MOBVAR' cannot
-hold the newline character ('"\n"'). If they did, migration of this
-string did not work because the string didn't obey the syntax rule for a
-string in 'gawk'. 'SUBSEP' is used as a temporary replacement. If the
-list of hosts to visit holds at least one more entry, the agent migrates
-to that place to go on working there. Otherwise, we replace the
-'SUBSEP's with a newline character in the resulting string, and report
-it to the originating host, whose name is stored in
-'MOBVAR["MyOrigin"]'.
-
- ---------- Footnotes ----------
-
- (1) <http://www.research.ibm.com/massive/mobag.ps>
-
-
-File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques
-
-3.9 STOXPRED: Stock Market Prediction As A Service
-==================================================
-
- Far out in the uncharted backwaters of the unfashionable end of the
- Western Spiral arm of the Galaxy lies a small unregarded yellow
- sun.
-
- Orbiting this at a distance of roughly ninety-two million miles is
- an utterly insignificant little blue-green planet whose
- ape-descendent life forms are so amazingly primitive that they
- still think digital watches are a pretty neat idea.
-
- This planet has -- or rather had -- a problem, which was this: most
- of the people living on it were unhappy for pretty much of the
- time. Many solutions were suggested for this problem, but most of
- these were largely concerned with the movements of small green
- pieces of paper, which is odd because it wasn't the small green
- pieces of paper that were unhappy.
- Douglas Adams, 'The Hitch Hiker's Guide to the Galaxy'
-
- Valuable services on the Internet are usually _not_ implemented as
-mobile agents. There are much simpler ways of implementing services.
-All Unix systems provide, for example, the 'cron' service. Unix system
-users can write a list of tasks to be done each day, each week, twice a
-day, or just once. The list is entered into a file named 'crontab'.
-For example, to distribute a newsletter on a daily basis this way, use
-'cron' for calling a script each day early in the morning.
-
- # run at 8 am on weekdays, distribute the newsletter
- 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
-
- The script first looks for interesting information on the Internet,
-assembles it in a nice form and sends the results via email to the
-customers.
-
- The following is an example of a primitive newsletter on stock market
-prediction. It is a report which first tries to predict the change of
-each share in the Dow Jones Industrial Index for the particular day.
-Then it mentions some especially promising shares as well as some shares
-which look remarkably bad on that day. The report ends with the usual
-disclaimer which tells every child _not_ to try this at home and hurt
-anybody.
-
- Good morning Uncle Scrooge,
-
- This is your daily stock market report for Monday, October 16, 2000.
- Here are the predictions for today:
-
- AA neutral
- GE up
- JNJ down
- MSFT neutral
- ...
- UTX up
- DD down
- IBM up
- MO down
- WMT up
- DIS up
- INTC up
- MRK down
- XOM down
- EK down
- IP down
-
- The most promising shares for today are these:
-
- INTC http://biz.yahoo.com/n/i/intc.html
-
- The stock shares to avoid today are these:
-
- EK http://biz.yahoo.com/n/e/ek.html
- IP http://biz.yahoo.com/n/i/ip.html
- DD http://biz.yahoo.com/n/d/dd.html
- ...
-
- The script as a whole is rather long. In order to ease the pain of
-studying other people's source code, we have broken the script up into
-meaningful parts which are invoked one after the other. The basic
-structure of the script is as follows:
-
- BEGIN {
- Init()
- ReadQuotes()
- CleanUp()
- Prediction()
- Report()
- SendMail()
- }
-
- The earlier parts store data into variables and arrays which are
-subsequently used by later parts of the script. The 'Init()' function
-first checks if the script is invoked correctly (without any
-parameters). If not, it informs the user of the correct usage. What
-follows are preparations for the retrieval of the historical quote data.
-The names of the 30 stock shares are stored in an array 'name' along
-with the current date in 'day', 'month', and 'year'.
-
- All users who are separated from the Internet by a firewall and have
-to direct their Internet accesses to a proxy must supply the name of the
-proxy to this script with the '-v Proxy=NAME' option. For most users,
-the default proxy and port number should suffice.
-
- function Init() {
- if (ARGC != 1) {
- print "STOXPRED - daily stock share prediction"
- print "IN:\n no parameters, nothing on stdin"
- print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
- print "OUT:\n commented predictions as email"
- print "JK 09.10.2000"
- exit
- }
- # Remember ticker symbols from Dow Jones Industrial Index
- StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
- SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
- MRK XOM EK IP", name);
- # Remember the current date as the end of the time series
- day = strftime("%d")
- month = strftime("%m")
- year = strftime("%Y")
- if (Proxy == "") Proxy = "chart.yahoo.com"
- if (ProxyPort == 0) ProxyPort = 80
- YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
- }
-
- There are two really interesting parts in the script. One is the
-function which reads the historical stock quotes from an Internet
-server. The other is the one that does the actual prediction. In the
-following function we see how the quotes are read from the Yahoo server.
-The data which comes from the server is in CSV format (comma-separated
-values):
-
- Date,Open,High,Low,Close,Volume
- 9-Oct-00,22.75,22.75,21.375,22.375,7888500
- 6-Oct-00,23.8125,24.9375,21.5625,22,10701100
- 5-Oct-00,24.4375,24.625,23.125,23.50,5810300
-
- Lines contain values of the same time instant, whereas columns are
-separated by commas and contain the kind of data that is described in
-the header (first) line. At first, 'gawk' is instructed to separate
-columns by commas ('FS = ","'). In the loop that follows, a connection
-to the Yahoo server is first opened, then a download takes place, and
-finally the connection is closed. All this happens once for each ticker
-symbol. In the body of this loop, an Internet address is built up as a
-string according to the rules of the Yahoo server. The starting and
-ending date are chosen to be exactly the same, but one year apart in the
-past. All the action is initiated within the 'printf' command which
-transmits the request for data to the Yahoo server.
-
- In the inner loop, the server's data is first read and then scanned
-line by line. Only lines which have six columns and the name of a month
-in the first column contain relevant data. This data is stored in the
-two-dimensional array 'quote'; one dimension being time, the other being
-the ticker symbol. During retrieval of the first stock's data, the
-calendar names of the time instances are stored in the array 'day'
-because we need them later.
-
- function ReadQuotes() {
- # Retrieve historical data for each ticker symbol
- FS = ","
- for (stock = 1; stock <= StockCount; stock++) {
- URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
- "&a=" month "&b=" day "&c=" year-1 \
- "&d=" month "&e=" day "&f=" year \
- "g=d&q=q&y=0&z=" name[stock] "&x=.csv"
- printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
- while ((YahooData |& getline) > 0) {
- if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) {
- if (stock == 1)
- days[++daycount] = $1;
- quote[$1, stock] = $5
- }
- }
- close(YahooData)
- }
- FS = " "
- }
-
- Now that we _have_ the data, it can be checked once again to make
-sure that no individual stock is missing or invalid, and that all the
-stock quotes are aligned correctly. Furthermore, we renumber the time
-instances. The most recent day gets day number 1 and all other days get
-consecutive numbers. All quotes are rounded toward the nearest whole
-number in US Dollars.
-
- function CleanUp() {
- # clean up time series; eliminate incomplete data sets
- for (d = 1; d <= daycount; d++) {
- for (stock = 1; stock <= StockCount; stock++)
- if (! ((days[d], stock) in quote))
- stock = StockCount + 10
- if (stock > StockCount + 1)
- continue
- datacount++
- for (stock = 1; stock <= StockCount; stock++)
- data[datacount, stock] = int(0.5 + quote[days[d], stock])
- }
- delete quote
- delete days
- }
-
- Now we have arrived at the second really interesting part of the
-whole affair. What we present here is a very primitive prediction
-algorithm: _If a stock fell yesterday, assume it will also fall today;
-if it rose yesterday, assume it will rise today_. (Feel free to replace
-this algorithm with a smarter one.) If a stock changed in the same
-direction on two consecutive days, this is an indication which should be
-highlighted. Two-day advances are stored in 'hot' and two-day declines
-in 'avoid'.
-
- The rest of the function is a sanity check. It counts the number of
-correct predictions in relation to the total number of predictions one
-could have made in the year before.
-
- function Prediction() {
- # Predict each ticker symbol by prolonging yesterday's trend
- for (stock = 1; stock <= StockCount; stock++) {
- if (data[1, stock] > data[2, stock]) {
- predict[stock] = "up"
- } else if (data[1, stock] < data[2, stock]) {
- predict[stock] = "down"
- } else {
- predict[stock] = "neutral"
- }
- if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
- hot[stock] = 1
- if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
- avoid[stock] = 1
- }
- # Do a plausibility check: how many predictions proved correct?
- for (s = 1; s <= StockCount; s++) {
- for (d = 1; d <= datacount-2; d++) {
- if (data[d+1, s] > data[d+2, s]) {
- UpCount++
- } else if (data[d+1, s] < data[d+2, s]) {
- DownCount++
- } else {
- NeutralCount++
- }
- if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) ||
- ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) ||
- ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
- CorrectCount++
- }
- }
- }
-
- At this point the hard work has been done: the array 'predict'
-contains the predictions for all the ticker symbols. It is up to the
-function 'Report()' to find some nice words to introduce the desired
-information.
-
- function Report() {
- # Generate report
- report = "\nThis is your daily "
- report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
- report = report "Here are the predictions for today:\n\n"
- for (stock = 1; stock <= StockCount; stock++)
- report = report "\t" name[stock] "\t" predict[stock] "\n"
- for (stock in hot) {
- if (HotCount++ == 0)
- report = report "\nThe most promising shares for today are these:\n\n"
- report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
- tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
- }
- for (stock in avoid) {
- if (AvoidCount++ == 0)
- report = report "\nThe stock shares to avoid today are these:\n\n"
- report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
- tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
- }
- report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
- report = report " losers. When using this kind\nof prediction scheme for"
- report = report " the 12 months which lie behind us,\nwe get " UpCount
- report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
- report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
- report = report " predictions " CorrectCount " proved correct next day.\n"
- report = report "A success rate of "\
- int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
- report = report "Random choice would have produced a 33% success rate.\n"
- report = report "Disclaimer: Like every other prediction of the stock\n"
- report = report "market, this report is, of course, complete nonsense.\n"
- report = report "If you are stupid enough to believe these predictions\n"
- report = report "you should visit a doctor who can treat your ailment."
- }
-
- The function 'SendMail()' goes through the list of customers and
-opens a pipe to the 'mail' command for each of them. Each one receives
-an email message with a proper subject heading and is addressed with his
-full name.
-
- function SendMail() {
- # send report to customers
- customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge"
- customer["more@utopia.org" ] = "Sir Thomas More"
- customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza"
- customer["marx@highgate.uk" ] = "Karl Marx"
- customer["keynes@the.long.run" ] = "John Maynard Keynes"
- customer["bierce@devil.hell.org" ] = "Ambrose Bierce"
- customer["laplace@paris.fr" ] = "Pierre Simon de Laplace"
- for (c in customer) {
- MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
- print "Good morning " customer[c] "," | MailPipe
- print report "\n.\n" | MailPipe
- close(MailPipe)
- }
- }
-
- Be patient when running the script by hand. Retrieving the data for
-all the ticker symbols and sending the emails may take several minutes
-to complete, depending upon network traffic and the speed of the
-available Internet link. The quality of the prediction algorithm is
-likely to be disappointing. Try to find a better one. Should you find
-one with a success rate of more than 50%, please tell us about it! It
-is only for the sake of curiosity, of course. ':-)'
-
-
-File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques
-
-3.10 PROTBASE: Searching Through A Protein Database
-===================================================
-
- Hoare's Law of Large Problems: Inside every large problem is a
- small problem struggling to get out.
-
- Yahoo's database of stock market data is just one among the many
-large databases on the Internet. Another one is located at NCBI
-(National Center for Biotechnology Information). Established in 1988 as
-a national resource for molecular biology information, NCBI creates
-public databases, conducts research in computational biology, develops
-software tools for analyzing genome data, and disseminates biomedical
-information. In this section, we look at one of NCBI's public services,
-which is called BLAST (Basic Local Alignment Search Tool).
-
- You probably know that the information necessary for reproducing
-living cells is encoded in the genetic material of the cells. The
-genetic material is a very long chain of four base nucleotides. It is
-the order of appearance (the sequence) of nucleotides which contains the
-information about the substance to be produced. Scientists in
-biotechnology often find a specific fragment, determine the nucleotide
-sequence, and need to know where the sequence at hand comes from. This
-is where the large databases enter the game. At NCBI, databases store
-the knowledge about which sequences have ever been found and where they
-have been found. When the scientist sends his sequence to the BLAST
-service, the server looks for regions of genetic material in its
-database which look the most similar to the delivered nucleotide
-sequence. After a search time of some seconds or minutes the server
-sends an answer to the scientist. In order to make access simple, NCBI
-chose to offer their database service through popular Internet
-protocols. There are four basic ways to use the so-called BLAST
-services:
-
- * The easiest way to use BLAST is through the web. Users may simply
- point their browsers at the NCBI home page and link to the BLAST
- pages. NCBI provides a stable URL that may be used to perform
- BLAST searches without interactive use of a web browser. This is
- what we will do later in this section. A demonstration client and
- a 'README' file demonstrate how to access this URL.
-
- * Currently, 'blastcl3' is the standard network BLAST client. You
- can download 'blastcl3' from the anonymous FTP location.
-
- * BLAST 2.0 can be run locally as a full executable and can be used
- to run BLAST searches against private local databases, or
- downloaded copies of the NCBI databases. BLAST 2.0 executables may
- be found on the NCBI anonymous FTP server.
-
- * The NCBI BLAST Email server is the best option for people without
- convenient access to the web. A similarity search can be performed
- by sending a properly formatted mail message containing the
- nucleotide or protein query sequence to <blast@ncbi.nlm.nih.gov>.
- The query sequence is compared against the specified database using
- the BLAST algorithm and the results are returned in an email
- message. For more information on formulating email BLAST searches,
- you can send a message consisting of the word "HELP" to the same
- address, <blast@ncbi.nlm.nih.gov>.
-
- Our starting point is the demonstration client mentioned in the first
-option. The 'README' file that comes along with the client explains the
-whole process in a nutshell. In the rest of this section, we first show
-what such requests look like. Then we show how to use 'gawk' to
-implement a client in about 10 lines of code. Finally, we show how to
-interpret the result returned from the service.
-
- Sequences are expected to be represented in the standard IUB/IUPAC
-amino acid and nucleic acid codes, with these exceptions: lower-case
-letters are accepted and are mapped into upper-case; a single hyphen or
-dash can be used to represent a gap of indeterminate length; and in
-amino acid sequences, 'U' and '*' are acceptable letters (see below).
-Before submitting a request, any numerical digits in the query sequence
-should either be removed or replaced by appropriate letter codes (e.g.,
-'N' for unknown nucleic acid residue or 'X' for unknown amino acid
-residue). The nucleic acid codes supported are:
-
- A --> adenosine M --> A C (amino)
- C --> cytidine S --> G C (strong)
- G --> guanine W --> A T (weak)
- T --> thymidine B --> G T C
- U --> uridine D --> G A T
- R --> G A (purine) H --> A C T
- Y --> T C (pyrimidine) V --> G C A
- K --> G T (keto) N --> A G C T (any)
- - gap of indeterminate length
-
- Now you know the alphabet of nucleotide sequences. The last two
-lines of the following example query show you such a sequence, which is
-obviously made up only of elements of the alphabet just described.
-Store this example query into a file named 'protbase.request'. You are
-now ready to send it to the server with the demonstration client.
-
- PROGRAM blastn
- DATALIB month
- EXPECT 0.75
- BEGIN
- >GAWK310 the gawking gene GNU AWK
- tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
- caccaccatggacagcaaa
-
- The actual search request begins with the mandatory parameter
-'PROGRAM' in the first column followed by the value 'blastn' (the name
-of the program) for searching nucleic acids. The next line contains the
-mandatory search parameter 'DATALIB' with the value 'month' for the
-newest nucleic acid sequences. The third line contains an optional
-'EXPECT' parameter and the value desired for it. The fourth line
-contains the mandatory 'BEGIN' directive, followed by the query sequence
-in FASTA/Pearson format. Each line of information must be less than 80
-characters in length.
-
- The "month" database contains all new or revised sequences released
-in the last 30 days and is useful for searching against new sequences.
-There are five different blast programs, 'blastn' being the one that
-compares a nucleotide query sequence against a nucleotide sequence
-database.
-
- The last server directive that must appear in every request is the
-'BEGIN' directive. The query sequence should immediately follow the
-'BEGIN' directive and must appear in FASTA/Pearson format. A sequence
-in FASTA/Pearson format begins with a single-line description. The
-description line, which is required, is distinguished from the lines of
-sequence data that follow it by having a greater-than ('>') symbol in
-the first column. For the purposes of the BLAST server, the text of the
-description is arbitrary.
-
- If you prefer to use a client written in 'gawk', just store the
-following 10 lines of code into a file named 'protbase.awk' and use this
-client instead. Invoke it with 'gawk -f protbase.awk protbase.request'.
-Then wait a minute and watch the result coming in. In order to
-replicate the demonstration client's behavior as closely as possible,
-this client does not use a proxy server. We could also have extended
-the client program in *note Retrieving Web Pages: GETURL, to implement
-the client request from 'protbase.awk' as a special case.
-
- { request = request "\n" $0 }
-
- END {
- BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
- printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
- printf "Content-Length: " length(request) "\n\n" |& BLASTService
- printf request |& BLASTService
- while ((BLASTService |& getline) > 0)
- print $0
- close(BLASTService)
- }
-
- The demonstration client from NCBI is 214 lines long (written in C)
-and it is not immediately obvious what it does. Our client is so short
-that it _is_ obvious what it does. First it loops over all lines of the
-query and stores the whole query into a variable. Then the script
-establishes an Internet connection to the NCBI server and transmits the
-query by framing it with a proper HTTP request. Finally it receives and
-prints the complete result coming from the server.
-
- Now, let us look at the result. It begins with an HTTP header, which
-you can ignore. Then there are some comments about the query having
-been filtered to avoid spuriously high scores. After this, there is a
-reference to the paper that describes the software being used for
-searching the data base. After a repetition of the original query's
-description we find the list of significant alignments:
-
- Sequences producing significant alignments: (bits) Value
-
- gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
- gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
- emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
- emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
- emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
- emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
- gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
-
- This means that the query sequence was found in seven human
-chromosomes. But the value 0.20 (20%) means that the probability of an
-accidental match is rather high (20%) in all cases and should be taken
-into account. You may wonder what the first column means. It is a key
-to the specific database in which this occurrence was found. The unique
-sequence identifiers reported in the search results can be used as
-sequence retrieval keys via the NCBI server. The syntax of sequence
-header lines used by the NCBI BLAST server depends on the database from
-which each sequence was obtained. The table below lists the identifiers
-for the databases from which the sequences were derived.
-
- Database Name Identifier Syntax
- ============================ ========================
- GenBank gb|accession|locus
- EMBL Data Library emb|accession|locus
- DDBJ, DNA Database of Japan dbj|accession|locus
- NBRF PIR pir||entry
- Protein Research Foundation prf||name
- SWISS-PROT sp|accession|entry name
- Brookhaven Protein Data Bank pdb|entry|chain
- Kabat's Sequences of Immuno... gnl|kabat|identifier
- Patents pat|country|number
- GenInfo Backbone Id bbs|number
-
- For example, an identifier might be 'gb|AC021182.14|AC021182', where
-the 'gb' tag indicates that the identifier refers to a GenBank sequence,
-'AC021182.14' is its GenBank ACCESSION, and 'AC021182' is the GenBank
-LOCUS. The identifier contains no spaces, so that a space indicates the
-end of the identifier.
-
- Let us continue in the result listing. Each of the seven alignments
-mentioned above is subsequently described in detail. We will have a
-closer look at the first of them.
-
- >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
- unordered pieces
- Length = 176383
-
- Score = 38.2 bits (19), Expect = 0.20
- Identities = 19/19 (100%)
- Strand = Plus / Plus
-
- Query: 35 tggtgaagtgtgtttcttg 53
- |||||||||||||||||||
- Sbjct: 69786 tggtgaagtgtgtttcttg 69804
-
- This alignment was located on the human chromosome 7. The fragment
-on which part of the query was found had a total length of 176383. Only
-19 of the nucleotides matched and the matching sequence ran from
-character 35 to 53 in the query sequence and from 69786 to 69804 in the
-fragment on chromosome 7. If you are still reading at this point, you
-are probably interested in finding out more about Computational Biology
-and you might appreciate the following hints.
-
- 1. There is a book called 'Introduction to Computational Biology' by
- Michael S. Waterman, which is worth reading if you are seriously
- interested. You can find a good book review on the Internet.
-
- 2. While Waterman's book can explain to you the algorithms employed
- internally in the database search engines, most practitioners
- prefer to approach the subject differently. The applied side of
- Computational Biology is called Bioinformatics, and emphasizes the
- tools available for day-to-day work as well as how to actually
- _use_ them. One of the very few affordable books on Bioinformatics
- is 'Developing Bioinformatics Computer Skills'.
-
- 3. The sequences _gawk_ and _gnuawk_ are in widespread use in the
- genetic material of virtually every earthly living being. Let us
- take this as a clear indication that the divine creator has
- intended 'gawk' to prevail over other scripting languages such as
- 'perl', 'tcl', or 'python' which are not even proper sequences.
- (:-)
-
-
-File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top
-
-4 Related Links
-***************
-
-This section lists the URLs for various items discussed in this major
-node. They are presented in the order in which they appear.
-
-'Internet Programming with Python'
- <http://www.fsbassociates.com/books/python.htm>
-
-'Advanced Perl Programming'
- <http://www.oreilly.com/catalog/advperl>
-
-'Web Client Programming with Perl'
- <http://www.oreilly.com/catalog/webclient>
-
-Richard Stevens's home page and book
- <http://www.kohala.com/~rstevens>
-
-The SPAK home page
- <http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html>
-
-Volume III of 'Internetworking with TCP/IP', by Comer and Stevens
- <http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html>
-
-XBM Graphics File Format
- <http://www.wotsit.org/download.asp?f=xbm>
-
-GNUPlot
- <http://www.cs.dartmouth.edu/gnuplot_info.html>
-
-Mark Humphrys' Eliza page
- <http://www.compapp.dcu.ie/~humphrys/eliza.html>
-
-Yahoo! Eliza Information
- <http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence>
-
-Java versions of Eliza
- <http://www.tjhsst.edu/Psych/ch1/eliza.html>
-
-Java versions of Eliza with source code
- <http://home.adelphia.net/~lifeisgood/eliza/eliza.htm>
-
-Eliza Programs with Explanations
- <http://chayden.net/chayden/eliza/Eliza.shtml>
-
-Loebner Contest
- <http://acm.org/~loebner/loebner-prize.htmlx>
-
-Tck/Tk Information
- <http://www.scriptics.com/>
-
-Intel 80x86 Processors
- <http://developer.intel.com/design/platform/embedpc/what_is.htm>
-
-AMD Elan Processors
- <http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html>
-
-XINU
- <http://willow.canberra.edu.au/~chrisc/xinu.html>
-
-GNU/Linux
- <http://uclinux.lineo.com/>
-
-Embedded PCs
- <http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/>
-
-MiniSQL
- <http://www.hughes.com.au/library/>
-
-Market Share Surveys
- <http://www.netcraft.com/survey>
-
-'Numerical Recipes in C: The Art of Scientific Computing'
- <http://www.nr.com>
-
-VRML
- <http://www.vrml.org>
-
-The VRML FAQ
- <http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ>
-
-The UMBC Agent Web
- <http://www.cs.umbc.edu/agents>
-
-Apache Web Server
- <http://www.apache.org>
-
-National Center for Biotechnology Information (NCBI)
- <http://www.ncbi.nlm.nih.gov>
-
-Basic Local Alignment Search Tool (BLAST)
- <http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html>
-
-NCBI Home Page
- <http://www.ncbi.nlm.nih.gov>
-
-BLAST Pages
- <http://www.ncbi.nlm.nih.gov/BLAST>
-
-BLAST Demonstration Client
- <ftp://ncbi.nlm.nih.gov/blast/blasturl/>
-
-BLAST anonymous FTP location
- <ftp://ncbi.nlm.nih.gov/blast/network/netblast/>
-
-BLAST 2.0 Executables
- <ftp://ncbi.nlm.nih.gov/blast/executables/>
-
-IUB/IUPAC Amino Acid and Nucleic Acid Codes
- <http://www.uthscsa.edu/geninfo/blastmail.html#item6>
-
-FASTA/Pearson Format
- <http://www.ncbi.nlm.nih.gov/BLAST/fasta.html>
-
-Fasta/Pearson Sequence in Java
- <http://www.kazusa.or.jp/java/codon_table_java/>
-
-Book Review of 'Introduction to Computational Biology'
- <http://www.acm.org/crossroads/xrds5-1/introcb.html>
-
-'Developing Bioinformatics Computer Skills'
- <http://www.oreilly.com/catalog/bioskills/>
-
-
-File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top
-
-GNU Free Documentation License
-******************************
-
- Version 1.3, 3 November 2008
-
- Copyright (C) 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc.
- <http://fsf.org/>
-
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
- 0. PREAMBLE
-
- The purpose of this License is to make a manual, textbook, or other
- functional and useful document "free" in the sense of freedom: to
- assure everyone the effective freedom to copy and redistribute it,
- with or without modifying it, either commercially or
- noncommercially. Secondarily, this License preserves for the
- author and publisher a way to get credit for their work, while not
- being considered responsible for modifications made by others.
-
- This License is a kind of "copyleft", which means that derivative
- works of the document must themselves be free in the same sense.
- It complements the GNU General Public License, which is a copyleft
- license designed for free software.
-
- We have designed this License in order to use it for manuals for
- free software, because free software needs free documentation: a
- free program should come with manuals providing the same freedoms
- that the software does. But this License is not limited to
- software manuals; it can be used for any textual work, regardless
- of subject matter or whether it is published as a printed book. We
- recommend this License principally for works whose purpose is
- instruction or reference.
-
- 1. APPLICABILITY AND DEFINITIONS
-
- This License applies to any manual or other work, in any medium,
- that contains a notice placed by the copyright holder saying it can
- be distributed under the terms of this License. Such a notice
- grants a world-wide, royalty-free license, unlimited in duration,
- to use that work under the conditions stated herein. The
- "Document", below, refers to any such manual or work. Any member
- of the public is a licensee, and is addressed as "you". You accept
- the license if you copy, modify or distribute the work in a way
- requiring permission under copyright law.
-
- A "Modified Version" of the Document means any work containing the
- Document or a portion of it, either copied verbatim, or with
- modifications and/or translated into another language.
-
- A "Secondary Section" is a named appendix or a front-matter section
- of the Document that deals exclusively with the relationship of the
- publishers or authors of the Document to the Document's overall
- subject (or to related matters) and contains nothing that could
- fall directly within that overall subject. (Thus, if the Document
- is in part a textbook of mathematics, a Secondary Section may not
- explain any mathematics.) The relationship could be a matter of
- historical connection with the subject or with related matters, or
- of legal, commercial, philosophical, ethical or political position
- regarding them.
-
- The "Invariant Sections" are certain Secondary Sections whose
- titles are designated, as being those of Invariant Sections, in the
- notice that says that the Document is released under this License.
- If a section does not fit the above definition of Secondary then it
- is not allowed to be designated as Invariant. The Document may
- contain zero Invariant Sections. If the Document does not identify
- any Invariant Sections then there are none.
-
- The "Cover Texts" are certain short passages of text that are
- listed, as Front-Cover Texts or Back-Cover Texts, in the notice
- that says that the Document is released under this License. A
- Front-Cover Text may be at most 5 words, and a Back-Cover Text may
- be at most 25 words.
-
- A "Transparent" copy of the Document means a machine-readable copy,
- represented in a format whose specification is available to the
- general public, that is suitable for revising the document
- straightforwardly with generic text editors or (for images composed
- of pixels) generic paint programs or (for drawings) some widely
- available drawing editor, and that is suitable for input to text
- formatters or for automatic translation to a variety of formats
- suitable for input to text formatters. A copy made in an otherwise
- Transparent file format whose markup, or absence of markup, has
- been arranged to thwart or discourage subsequent modification by
- readers is not Transparent. An image format is not Transparent if
- used for any substantial amount of text. A copy that is not
- "Transparent" is called "Opaque".
-
- Examples of suitable formats for Transparent copies include plain
- ASCII without markup, Texinfo input format, LaTeX input format,
- SGML or XML using a publicly available DTD, and standard-conforming
- simple HTML, PostScript or PDF designed for human modification.
- Examples of transparent image formats include PNG, XCF and JPG.
- Opaque formats include proprietary formats that can be read and
- edited only by proprietary word processors, SGML or XML for which
- the DTD and/or processing tools are not generally available, and
- the machine-generated HTML, PostScript or PDF produced by some word
- processors for output purposes only.
-
- The "Title Page" means, for a printed book, the title page itself,
- plus such following pages as are needed to hold, legibly, the
- material this License requires to appear in the title page. For
- works in formats which do not have any title page as such, "Title
- Page" means the text near the most prominent appearance of the
- work's title, preceding the beginning of the body of the text.
-
- The "publisher" means any person or entity that distributes copies
- of the Document to the public.
-
- A section "Entitled XYZ" means a named subunit of the Document
- whose title either is precisely XYZ or contains XYZ in parentheses
- following text that translates XYZ in another language. (Here XYZ
- stands for a specific section name mentioned below, such as
- "Acknowledgements", "Dedications", "Endorsements", or "History".)
- To "Preserve the Title" of such a section when you modify the
- Document means that it remains a section "Entitled XYZ" according
- to this definition.
-
- The Document may include Warranty Disclaimers next to the notice
- which states that this License applies to the Document. These
- Warranty Disclaimers are considered to be included by reference in
- this License, but only as regards disclaiming warranties: any other
- implication that these Warranty Disclaimers may have is void and
- has no effect on the meaning of this License.
-
- 2. VERBATIM COPYING
-
- You may copy and distribute the Document in any medium, either
- commercially or noncommercially, provided that this License, the
- copyright notices, and the license notice saying this License
- applies to the Document are reproduced in all copies, and that you
- add no other conditions whatsoever to those of this License. You
- may not use technical measures to obstruct or control the reading
- or further copying of the copies you make or distribute. However,
- you may accept compensation in exchange for copies. If you
- distribute a large enough number of copies you must also follow the
- conditions in section 3.
-
- You may also lend copies, under the same conditions stated above,
- and you may publicly display copies.
-
- 3. COPYING IN QUANTITY
-
- If you publish printed copies (or copies in media that commonly
- have printed covers) of the Document, numbering more than 100, and
- the Document's license notice requires Cover Texts, you must
- enclose the copies in covers that carry, clearly and legibly, all
- these Cover Texts: Front-Cover Texts on the front cover, and
- Back-Cover Texts on the back cover. Both covers must also clearly
- and legibly identify you as the publisher of these copies. The
- front cover must present the full title with all words of the title
- equally prominent and visible. You may add other material on the
- covers in addition. Copying with changes limited to the covers, as
- long as they preserve the title of the Document and satisfy these
- conditions, can be treated as verbatim copying in other respects.
-
- If the required texts for either cover are too voluminous to fit
- legibly, you should put the first ones listed (as many as fit
- reasonably) on the actual cover, and continue the rest onto
- adjacent pages.
-
- If you publish or distribute Opaque copies of the Document
- numbering more than 100, you must either include a machine-readable
- Transparent copy along with each Opaque copy, or state in or with
- each Opaque copy a computer-network location from which the general
- network-using public has access to download using public-standard
- network protocols a complete Transparent copy of the Document, free
- of added material. If you use the latter option, you must take
- reasonably prudent steps, when you begin distribution of Opaque
- copies in quantity, to ensure that this Transparent copy will
- remain thus accessible at the stated location until at least one
- year after the last time you distribute an Opaque copy (directly or
- through your agents or retailers) of that edition to the public.
-
- It is requested, but not required, that you contact the authors of
- the Document well before redistributing any large number of copies,
- to give them a chance to provide you with an updated version of the
- Document.
-
- 4. MODIFICATIONS
-
- You may copy and distribute a Modified Version of the Document
- under the conditions of sections 2 and 3 above, provided that you
- release the Modified Version under precisely this License, with the
- Modified Version filling the role of the Document, thus licensing
- distribution and modification of the Modified Version to whoever
- possesses a copy of it. In addition, you must do these things in
- the Modified Version:
-
- A. Use in the Title Page (and on the covers, if any) a title
- distinct from that of the Document, and from those of previous
- versions (which should, if there were any, be listed in the
- History section of the Document). You may use the same title
- as a previous version if the original publisher of that
- version gives permission.
-
- B. List on the Title Page, as authors, one or more persons or
- entities responsible for authorship of the modifications in
- the Modified Version, together with at least five of the
- principal authors of the Document (all of its principal
- authors, if it has fewer than five), unless they release you
- from this requirement.
-
- C. State on the Title page the name of the publisher of the
- Modified Version, as the publisher.
-
- D. Preserve all the copyright notices of the Document.
-
- E. Add an appropriate copyright notice for your modifications
- adjacent to the other copyright notices.
-
- F. Include, immediately after the copyright notices, a license
- notice giving the public permission to use the Modified
- Version under the terms of this License, in the form shown in
- the Addendum below.
-
- G. Preserve in that license notice the full lists of Invariant
- Sections and required Cover Texts given in the Document's
- license notice.
-
- H. Include an unaltered copy of this License.
-
- I. Preserve the section Entitled "History", Preserve its Title,
- and add to it an item stating at least the title, year, new
- authors, and publisher of the Modified Version as given on the
- Title Page. If there is no section Entitled "History" in the
- Document, create one stating the title, year, authors, and
- publisher of the Document as given on its Title Page, then add
- an item describing the Modified Version as stated in the
- previous sentence.
-
- J. Preserve the network location, if any, given in the Document
- for public access to a Transparent copy of the Document, and
- likewise the network locations given in the Document for
- previous versions it was based on. These may be placed in the
- "History" section. You may omit a network location for a work
- that was published at least four years before the Document
- itself, or if the original publisher of the version it refers
- to gives permission.
-
- K. For any section Entitled "Acknowledgements" or "Dedications",
- Preserve the Title of the section, and preserve in the section
- all the substance and tone of each of the contributor
- acknowledgements and/or dedications given therein.
-
- L. Preserve all the Invariant Sections of the Document, unaltered
- in their text and in their titles. Section numbers or the
- equivalent are not considered part of the section titles.
-
- M. Delete any section Entitled "Endorsements". Such a section
- may not be included in the Modified Version.
-
- N. Do not retitle any existing section to be Entitled
- "Endorsements" or to conflict in title with any Invariant
- Section.
-
- O. Preserve any Warranty Disclaimers.
-
- If the Modified Version includes new front-matter sections or
- appendices that qualify as Secondary Sections and contain no
- material copied from the Document, you may at your option designate
- some or all of these sections as invariant. To do this, add their
- titles to the list of Invariant Sections in the Modified Version's
- license notice. These titles must be distinct from any other
- section titles.
-
- You may add a section Entitled "Endorsements", provided it contains
- nothing but endorsements of your Modified Version by various
- parties--for example, statements of peer review or that the text
- has been approved by an organization as the authoritative
- definition of a standard.
-
- You may add a passage of up to five words as a Front-Cover Text,
- and a passage of up to 25 words as a Back-Cover Text, to the end of
- the list of Cover Texts in the Modified Version. Only one passage
- of Front-Cover Text and one of Back-Cover Text may be added by (or
- through arrangements made by) any one entity. If the Document
- already includes a cover text for the same cover, previously added
- by you or by arrangement made by the same entity you are acting on
- behalf of, you may not add another; but you may replace the old
- one, on explicit permission from the previous publisher that added
- the old one.
-
- The author(s) and publisher(s) of the Document do not by this
- License give permission to use their names for publicity for or to
- assert or imply endorsement of any Modified Version.
-
- 5. COMBINING DOCUMENTS
-
- You may combine the Document with other documents released under
- this License, under the terms defined in section 4 above for
- modified versions, provided that you include in the combination all
- of the Invariant Sections of all of the original documents,
- unmodified, and list them all as Invariant Sections of your
- combined work in its license notice, and that you preserve all
- their Warranty Disclaimers.
-
- The combined work need only contain one copy of this License, and
- multiple identical Invariant Sections may be replaced with a single
- copy. If there are multiple Invariant Sections with the same name
- but different contents, make the title of each such section unique
- by adding at the end of it, in parentheses, the name of the
- original author or publisher of that section if known, or else a
- unique number. Make the same adjustment to the section titles in
- the list of Invariant Sections in the license notice of the
- combined work.
-
- In the combination, you must combine any sections Entitled
- "History" in the various original documents, forming one section
- Entitled "History"; likewise combine any sections Entitled
- "Acknowledgements", and any sections Entitled "Dedications". You
- must delete all sections Entitled "Endorsements."
-
- 6. COLLECTIONS OF DOCUMENTS
-
- You may make a collection consisting of the Document and other
- documents released under this License, and replace the individual
- copies of this License in the various documents with a single copy
- that is included in the collection, provided that you follow the
- rules of this License for verbatim copying of each of the documents
- in all other respects.
-
- You may extract a single document from such a collection, and
- distribute it individually under this License, provided you insert
- a copy of this License into the extracted document, and follow this
- License in all other respects regarding verbatim copying of that
- document.
-
- 7. AGGREGATION WITH INDEPENDENT WORKS
-
- A compilation of the Document or its derivatives with other
- separate and independent documents or works, in or on a volume of a
- storage or distribution medium, is called an "aggregate" if the
- copyright resulting from the compilation is not used to limit the
- legal rights of the compilation's users beyond what the individual
- works permit. When the Document is included in an aggregate, this
- License does not apply to the other works in the aggregate which
- are not themselves derivative works of the Document.
-
- If the Cover Text requirement of section 3 is applicable to these
- copies of the Document, then if the Document is less than one half
- of the entire aggregate, the Document's Cover Texts may be placed
- on covers that bracket the Document within the aggregate, or the
- electronic equivalent of covers if the Document is in electronic
- form. Otherwise they must appear on printed covers that bracket
- the whole aggregate.
-
- 8. TRANSLATION
-
- Translation is considered a kind of modification, so you may
- distribute translations of the Document under the terms of section
- 4. Replacing Invariant Sections with translations requires special
- permission from their copyright holders, but you may include
- translations of some or all Invariant Sections in addition to the
- original versions of these Invariant Sections. You may include a
- translation of this License, and all the license notices in the
- Document, and any Warranty Disclaimers, provided that you also
- include the original English version of this License and the
- original versions of those notices and disclaimers. In case of a
- disagreement between the translation and the original version of
- this License or a notice or disclaimer, the original version will
- prevail.
-
- If a section in the Document is Entitled "Acknowledgements",
- "Dedications", or "History", the requirement (section 4) to
- Preserve its Title (section 1) will typically require changing the
- actual title.
-
- 9. TERMINATION
-
- You may not copy, modify, sublicense, or distribute the Document
- except as expressly provided under this License. Any attempt
- otherwise to copy, modify, sublicense, or distribute it is void,
- and will automatically terminate your rights under this License.
-
- However, if you cease all violation of this License, then your
- license from a particular copyright holder is reinstated (a)
- provisionally, unless and until the copyright holder explicitly and
- finally terminates your license, and (b) permanently, if the
- copyright holder fails to notify you of the violation by some
- reasonable means prior to 60 days after the cessation.
-
- Moreover, your license from a particular copyright holder is
- reinstated permanently if the copyright holder notifies you of the
- violation by some reasonable means, this is the first time you have
- received notice of violation of this License (for any work) from
- that copyright holder, and you cure the violation prior to 30 days
- after your receipt of the notice.
-
- Termination of your rights under this section does not terminate
- the licenses of parties who have received copies or rights from you
- under this License. If your rights have been terminated and not
- permanently reinstated, receipt of a copy of some or all of the
- same material does not give you any rights to use it.
-
- 10. FUTURE REVISIONS OF THIS LICENSE
-
- The Free Software Foundation may publish new, revised versions of
- the GNU Free Documentation License from time to time. Such new
- versions will be similar in spirit to the present version, but may
- differ in detail to address new problems or concerns. See
- <http://www.gnu.org/copyleft/>.
-
- Each version of the License is given a distinguishing version
- number. If the Document specifies that a particular numbered
- version of this License "or any later version" applies to it, you
- have the option of following the terms and conditions either of
- that specified version or of any later version that has been
- published (not as a draft) by the Free Software Foundation. If the
- Document does not specify a version number of this License, you may
- choose any version ever published (not as a draft) by the Free
- Software Foundation. If the Document specifies that a proxy can
- decide which future versions of this License can be used, that
- proxy's public statement of acceptance of a version permanently
- authorizes you to choose that version for the Document.
-
- 11. RELICENSING
-
- "Massive Multiauthor Collaboration Site" (or "MMC Site") means any
- World Wide Web server that publishes copyrightable works and also
- provides prominent facilities for anybody to edit those works. A
- public wiki that anybody can edit is an example of such a server.
- A "Massive Multiauthor Collaboration" (or "MMC") contained in the
- site means any set of copyrightable works thus published on the MMC
- site.
-
- "CC-BY-SA" means the Creative Commons Attribution-Share Alike 3.0
- license published by Creative Commons Corporation, a not-for-profit
- corporation with a principal place of business in San Francisco,
- California, as well as future copyleft versions of that license
- published by that same organization.
-
- "Incorporate" means to publish or republish a Document, in whole or
- in part, as part of another Document.
-
- An MMC is "eligible for relicensing" if it is licensed under this
- License, and if all works that were first published under this
- License somewhere other than this MMC, and subsequently
- incorporated in whole or in part into the MMC, (1) had no cover
- texts or invariant sections, and (2) were thus incorporated prior
- to November 1, 2008.
-
- The operator of an MMC Site may republish an MMC contained in the
- site under CC-BY-SA on the same site at any time before August 1,
- 2009, provided the MMC is eligible for relicensing.
-
-ADDENDUM: How to use this License for your documents
-====================================================
-
-To use this License in a document you have written, include a copy of
-the License in the document and put the following copyright and license
-notices just after the title page:
-
- Copyright (C) YEAR YOUR NAME.
- Permission is granted to copy, distribute and/or modify this document
- under the terms of the GNU Free Documentation License, Version 1.3
- or any later version published by the Free Software Foundation;
- with no Invariant Sections, no Front-Cover Texts, and no Back-Cover
- Texts. A copy of the license is included in the section entitled ``GNU
- Free Documentation License''.
-
- If you have Invariant Sections, Front-Cover Texts and Back-Cover
-Texts, replace the "with...Texts." line with this:
-
- with the Invariant Sections being LIST THEIR TITLES, with
- the Front-Cover Texts being LIST, and with the Back-Cover Texts
- being LIST.
-
- If you have Invariant Sections without Cover Texts, or some other
-combination of the three, merge those two alternatives to suit the
-situation.
-
- If your document contains nontrivial examples of program code, we
-recommend releasing these examples in parallel under your choice of free
-software license, such as the GNU General Public License, to permit
-their use in free software.
-
-
-File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top
-
-Index
-*****
-
-
-* Menu:
-
-* /inet/ files (gawk): Gawk Special Files. (line 34)
-* /inet/tcp special files (gawk): File /inet/tcp. (line 6)
-* /inet/udp special files (gawk): File /inet/udp. (line 6)
-* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25)
-* advanced features, network connections: Troubleshooting. (line 6)
-* agent: Challenges. (line 75)
-* agent <1>: MOBAGWHO. (line 6)
-* AI: Challenges. (line 75)
-* apache: WEBGRAB. (line 72)
-* apache <1>: MOBAGWHO. (line 42)
-* Bioinformatics: PROTBASE. (line 227)
-* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6)
-* blocking: Making Connections. (line 35)
-* Boutell, Thomas: STATIST. (line 6)
-* CGI (Common Gateway Interface): MOBAGWHO. (line 42)
-* CGI (Common Gateway Interface), dynamic web pages and: Web page.
- (line 45)
-* CGI (Common Gateway Interface), library: CGI Lib. (line 11)
-* clients: Making Connections. (line 21)
-* Clinton, Bill: Challenges. (line 58)
-* Common Gateway Interface, See CGI: Web page. (line 45)
-* Computational Biology: PROTBASE. (line 227)
-* contest: Challenges. (line 6)
-* cron utility: STOXPRED. (line 23)
-* CSV format: STOXPRED. (line 128)
-* Dow Jones Industrial Index: STOXPRED. (line 44)
-* ELIZA program: Simple Server. (line 11)
-* ELIZA program <1>: Simple Server. (line 178)
-* email: Email. (line 11)
-* FASTA/Pearson format: PROTBASE. (line 102)
-* FDL (Free Documentation License): GNU Free Documentation License.
- (line 6)
-* filenames, for network access: Gawk Special Files. (line 29)
-* files, /inet/ (gawk): Gawk Special Files. (line 34)
-* files, /inet/tcp (gawk): File /inet/tcp. (line 6)
-* files, /inet/udp (gawk): File /inet/udp. (line 6)
-* finger utility: Setting Up. (line 22)
-* Free Documentation License (FDL): GNU Free Documentation License.
- (line 6)
-* FTP (File Transfer Protocol): Basic Protocols. (line 45)
-* gawk, networking: Using Networking. (line 6)
-* gawk, networking, connections: Special File Fields. (line 53)
-* gawk, networking, connections <1>: TCP Connecting. (line 6)
-* gawk, networking, filenames: Gawk Special Files. (line 29)
-* gawk, networking, See Also email: Email. (line 6)
-* gawk, networking, service, establishing: Setting Up. (line 6)
-* gawk, networking, troubleshooting: Caveats. (line 6)
-* gawk, web and, See web service: Interacting Service. (line 6)
-* getline command: TCP Connecting. (line 11)
-* GETURL program: GETURL. (line 6)
-* GIF image format: Web page. (line 45)
-* GIF image format <1>: STATIST. (line 6)
-* GNU Free Documentation License: GNU Free Documentation License.
- (line 6)
-* GNU/Linux: Troubleshooting. (line 54)
-* GNU/Linux <1>: Interacting. (line 27)
-* GNU/Linux <2>: REMCONF. (line 6)
-* GNUPlot utility: Interacting Service. (line 189)
-* GNUPlot utility <1>: STATIST. (line 6)
-* Hoare, C.A.R.: MOBAGWHO. (line 6)
-* Hoare, C.A.R. <1>: PROTBASE. (line 6)
-* hostname field: Special File Fields. (line 34)
-* HTML (Hypertext Markup Language): Web page. (line 29)
-* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 45)
-* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6)
-* HTTP (Hypertext Transfer Protocol), record separators and: Web page.
- (line 29)
-* HTTP server, core logic: Interacting Service. (line 6)
-* HTTP server, core logic <1>: Interacting Service. (line 24)
-* Humphrys, Mark: Simple Server. (line 178)
-* Hypertext Markup Language (HTML): Web page. (line 29)
-* Hypertext Transfer Protocol, See HTTP: Web page. (line 6)
-* image format: STATIST. (line 6)
-* images, in web pages: Interacting Service. (line 189)
-* images, retrieving over networks: Web page. (line 45)
-* input/output, two-way, See Also gawk, networking: Gawk Special Files.
- (line 19)
-* Internet, See networks: Interacting. (line 48)
-* JavaScript: STATIST. (line 56)
-* Linux: Troubleshooting. (line 54)
-* Linux <1>: Interacting. (line 27)
-* Linux <2>: REMCONF. (line 6)
-* Lisp: MOBAGWHO. (line 98)
-* localport field: Gawk Special Files. (line 34)
-* Loebner, Hugh: Challenges. (line 6)
-* Loui, Ronald: Challenges. (line 75)
-* MAZE: MAZE. (line 6)
-* Microsoft Windows: WEBGRAB. (line 43)
-* Microsoft Windows, networking: Troubleshooting. (line 54)
-* Microsoft Windows, networking, ports: Setting Up. (line 37)
-* MiniSQL: REMCONF. (line 109)
-* MOBAGWHO program: MOBAGWHO. (line 6)
-* NCBI, National Center for Biotechnology Information: PROTBASE.
- (line 6)
-* network type field: Special File Fields. (line 11)
-* networks, gawk and: Using Networking. (line 6)
-* networks, gawk and, connections: Special File Fields. (line 53)
-* networks, gawk and, connections <1>: TCP Connecting. (line 6)
-* networks, gawk and, filenames: Gawk Special Files. (line 29)
-* networks, gawk and, See Also email: Email. (line 6)
-* networks, gawk and, service, establishing: Setting Up. (line 6)
-* networks, gawk and, troubleshooting: Caveats. (line 6)
-* networks, ports, reserved: Setting Up. (line 37)
-* networks, ports, specifying: Special File Fields. (line 24)
-* networks, See Also web pages: PANIC. (line 6)
-* Numerical Recipes: STATIST. (line 24)
-* ORS variable, HTTP and: Web page. (line 29)
-* ORS variable, POP and: Email. (line 36)
-* PANIC program: PANIC. (line 6)
-* Perl: Using Networking. (line 14)
-* Perl, gawk networking and: Using Networking. (line 24)
-* Perlis, Alan: MAZE. (line 6)
-* pipes, networking and: TCP Connecting. (line 30)
-* PNG image format: Web page. (line 45)
-* PNG image format <1>: STATIST. (line 6)
-* POP (Post Office Protocol): Email. (line 6)
-* POP (Post Office Protocol) <1>: Email. (line 36)
-* Post Office Protocol (POP): Email. (line 6)
-* PostScript: STATIST. (line 138)
-* PROLOG: Challenges. (line 75)
-* PROTBASE: PROTBASE. (line 6)
-* protocol field: Special File Fields. (line 17)
-* PS image format: STATIST. (line 6)
-* Python: Using Networking. (line 14)
-* Python, gawk networking and: Using Networking. (line 24)
-* record separators, HTTP and: Web page. (line 29)
-* record separators, POP and: Email. (line 36)
-* REMCONF program: REMCONF. (line 6)
-* remoteport field: Gawk Special Files. (line 34)
-* RFC 1939: Email. (line 6)
-* RFC 1939 <1>: Email. (line 36)
-* RFC 1945: Web page. (line 29)
-* RFC 2068: Web page. (line 6)
-* RFC 2068 <1>: Interacting Service. (line 104)
-* RFC 2616: Web page. (line 6)
-* RFC 821: Email. (line 6)
-* robot: Challenges. (line 84)
-* robot <1>: WEBGRAB. (line 6)
-* RS variable, HTTP and: Web page. (line 29)
-* RS variable, POP and: Email. (line 36)
-* servers: Making Connections. (line 14)
-* servers <1>: Setting Up. (line 22)
-* servers, as hosts: Special File Fields. (line 34)
-* servers, HTTP: Interacting Service. (line 6)
-* servers, web: Simple Server. (line 6)
-* Simple Mail Transfer Protocol (SMTP): Email. (line 6)
-* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 45)
-* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6)
-* STATIST program: STATIST. (line 6)
-* STOXPRED program: STOXPRED. (line 6)
-* synchronous communications: Making Connections. (line 35)
-* Tcl/Tk: Using Networking. (line 14)
-* Tcl/Tk, gawk and: Using Networking. (line 24)
-* Tcl/Tk, gawk and <1>: Some Applications and Techniques.
- (line 22)
-* TCP (Transmission Control Protocol): Using Networking. (line 29)
-* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6)
-* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting.
- (line 6)
-* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48)
-* TCP/IP, network type, selecting: Special File Fields. (line 11)
-* TCP/IP, protocols, selecting: Special File Fields. (line 17)
-* TCP/IP, sockets and: Gawk Special Files. (line 19)
-* Transmission Control Protocol, See TCP: Using Networking. (line 29)
-* troubleshooting, gawk, networks: Caveats. (line 6)
-* troubleshooting, networks, connections: Troubleshooting. (line 6)
-* troubleshooting, networks, timeouts: Caveats. (line 18)
-* UDP (User Datagram Protocol): File /inet/udp. (line 6)
-* UDP (User Datagram Protocol), TCP and: Interacting. (line 48)
-* Unix, network ports and: Setting Up. (line 37)
-* URLCHK program: URLCHK. (line 6)
-* User Datagram Protocol, See UDP: File /inet/udp. (line 6)
-* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25)
-* VRML: MAZE. (line 6)
-* web browsers, See web service: Interacting Service. (line 6)
-* web pages: Web page. (line 6)
-* web pages, images in: Interacting Service. (line 189)
-* web pages, retrieving: GETURL. (line 6)
-* web servers: Simple Server. (line 6)
-* web service: Primitive Service. (line 6)
-* web service <1>: PANIC. (line 6)
-* WEBGRAB program: WEBGRAB. (line 6)
-* Weizenbaum, Joseph: Simple Server. (line 11)
-* XBM image format: Interacting Service. (line 189)
-* Yahoo!: REMCONF. (line 6)
-* Yahoo! <1>: STOXPRED. (line 6)
-
-
-
-Tag Table:
-Node: Top2022
-Node: Preface5665
-Node: Introduction7040
-Node: Stream Communications8066
-Node: Datagram Communications9240
-Node: The TCP/IP Protocols10870
-Ref: The TCP/IP Protocols-Footnote-111554
-Node: Basic Protocols11711
-Ref: Basic Protocols-Footnote-113756
-Node: Ports13785
-Node: Making Connections15192
-Ref: Making Connections-Footnote-117750
-Ref: Making Connections-Footnote-217797
-Node: Using Networking17978
-Node: Gawk Special Files20301
-Node: Special File Fields22110
-Ref: table-inet-components26003
-Node: Comparing Protocols27312
-Node: File /inet/tcp27846
-Node: File /inet/udp28874
-Ref: File /inet/udp-Footnote-130573
-Node: TCP Connecting30827
-Node: Troubleshooting33173
-Ref: Troubleshooting-Footnote-136232
-Node: Interacting36805
-Node: Setting Up39545
-Node: Email43048
-Node: Web page45380
-Ref: Web page-Footnote-148197
-Node: Primitive Service48395
-Node: Interacting Service51136
-Ref: Interacting Service-Footnote-160303
-Node: CGI Lib60335
-Node: Simple Server67310
-Ref: Simple Server-Footnote-175053
-Node: Caveats75154
-Node: Challenges76299
-Node: Some Applications and Techniques84997
-Node: PANIC87462
-Node: GETURL89186
-Node: REMCONF91819
-Node: URLCHK97314
-Node: WEBGRAB101166
-Node: STATIST105628
-Ref: STATIST-Footnote-1117377
-Node: MAZE117822
-Node: MOBAGWHO124029
-Ref: MOBAGWHO-Footnote-1138047
-Node: STOXPRED138102
-Node: PROTBASE152390
-Node: Links165506
-Node: GNU Free Documentation License168939
-Node: Index194059
-
-End Tag Table
diff --git a/doc/gawktexi.in b/doc/gawktexi.in
index afcf749a..14a1748c 100644
--- a/doc/gawktexi.in
+++ b/doc/gawktexi.in
@@ -18491,12 +18491,12 @@ Return the value of @var{val}, shifted right by @var{count} bits.
Return the bitwise XOR of the arguments. There must be at least two.
@end table
-For all of these functions, first the double-precision floating-point value is
-converted to the widest C unsigned integer type, then the bitwise operation is
-performed. If the result cannot be represented exactly as a C @code{double},
-leading nonzero bits are removed one by one until it can be represented
-exactly. The result is then converted back into a C @code{double}. (If
-you don't understand this paragraph, don't worry about it.)
+@quotation CAUTION
+Beginning with @command{gawk} @value{VERSION} 4.2, negative
+operands are not allowed for any of these functions. A negative
+operand produces a fatal error. See the sidebar
+``Beware The Smoke and Mirrors!'' for more information as to why.
+@end quotation
Here is a user-defined function (@pxref{User-defined})
that illustrates the use of these functions:
@@ -18601,6 +18601,60 @@ decimal and octal values for the same numbers
and then demonstrates the
results of the @code{compl()}, @code{lshift()}, and @code{rshift()} functions.
+@sidebar Beware The Smoke and Mirrors!
+
+It other languages, bitwise operations are performed on integer values,
+not floating-point values. As a general statement, such operations work
+best when performed on unsigned integers.
+
+@command{gawk} attempts to treat the arguments to the bitwise functions
+as unsigned integers. For this reason, negative arguments produce a
+fatal error.
+
+In normal operation, for all of these functions, first the
+double-precision floating-point value is converted to the widest C
+unsigned integer type, then the bitwise operation is performed. If the
+result cannot be represented exactly as a C @code{double}, leading
+nonzero bits are removed one by one until it can be represented exactly.
+The result is then converted back into a C @code{double}.@footnote{If you don't
+understand this paragraph, the upshot is that @command{gawk} can only
+store a particular range of integer values; numbers outside that range
+are reduced to fit within the range.}
+
+However, when using arbitrary precision arithmetic with the @option{-M}
+option (@pxref{Arbitrary Precision Arithmetic}), the results may differ.
+This is particularly noticable with the @code{compl()} function:
+
+@example
+$ @kbd{gawk 'BEGIN @{ print compl(42) @}'}
+@print{} 9007199254740949
+$ @kbd{gawk -M 'BEGIN @{ print compl(42) @}'}
+@print{} -43
+@end example
+
+What's going on becomes clear when printing the results
+in hexadecimal:
+
+@example
+$ @kbd{gawk 'BEGIN @{ printf "%#x\n", compl(42) @}'}
+@print{} 0x1fffffffffffd5
+$ @kbd{gawk -M 'BEGIN @{ printf "%#x\n", compl(42) @}'}
+@print{} 0xffffffffffffffd5
+@end example
+
+When using the @option{-M} option, under the hood, @command{gawk} uses
+GNU MP arbitrary precision integers which have at least 64 bits of precision.
+When not using @option{-M}, @command{gawk} stores integral values in
+regular double-precision floating point, which only maintain 53 bits of
+precision. Furthermore, the GNU MP library treats (or least seems to treat)
+the leading bit as a sign bit; thus the result with @option{-M} in this case is
+a negative number.
+
+In short, using @command{gawk} for any but the simplest kind of bitwise
+operations is probably a bad idea; caveat emptor!
+
+@end sidebar
+
@node Type Functions
@subsection Getting Type Information