diff options
author | Arnold D. Robbins <arnold@skeeve.com> | 2021-01-25 20:49:28 +0200 |
---|---|---|
committer | Arnold D. Robbins <arnold@skeeve.com> | 2021-01-25 20:49:28 +0200 |
commit | 632ce2171a57e291e6ba7eed7726b955b3a1bb3b (patch) | |
tree | e48b4bcaaee8aadd012fb86a3cc978b412414e3f /doc | |
parent | 3fa8862c5822db15eb977d2b02cc936d1b87b6f3 (diff) | |
parent | e02e38ad7bd54ced8baa24cca6e931a62b0c1deb (diff) | |
download | egawk-632ce2171a57e291e6ba7eed7726b955b3a1bb3b.tar.gz egawk-632ce2171a57e291e6ba7eed7726b955b3a1bb3b.tar.bz2 egawk-632ce2171a57e291e6ba7eed7726b955b3a1bb3b.zip |
Merge branch 'gawk-5.1-stable'
Diffstat (limited to 'doc')
-rw-r--r-- | doc/ChangeLog | 6 | ||||
-rw-r--r-- | doc/gawk.info | 2 | ||||
-rw-r--r-- | doc/gawk.texi | 2 | ||||
-rw-r--r-- | doc/gawkinet.info | 72 | ||||
-rw-r--r-- | doc/gawkinet.texi | 2 | ||||
-rw-r--r-- | doc/gawktexi.in | 2 | ||||
-rw-r--r-- | doc/wordlist | 11 | ||||
-rw-r--r-- | doc/wordlist2 | 3 | ||||
-rw-r--r-- | doc/wordlist4 | 63 |
9 files changed, 123 insertions, 40 deletions
diff --git a/doc/ChangeLog b/doc/ChangeLog index 8e94b98e..4c086ff8 100644 --- a/doc/ChangeLog +++ b/doc/ChangeLog @@ -1,3 +1,9 @@ +2021-01-25 Arnold D. Robbins <arnold@skeeve.com> + + * gawktexi.in: Fix some spelling errors. + * gawkinet.texi: Ditto. + * wordlist, wordlist2, wordlist4: Updated. + 2021-01-23 Arnold D. Robbins <arnold@skeeve.com> * gawktexi.in: A number of small fixes, thanks to diff --git a/doc/gawk.info b/doc/gawk.info index 12b712c6..fd56f412 100644 --- a/doc/gawk.info +++ b/doc/gawk.info @@ -21897,7 +21897,7 @@ File: gawk.info, Node: Advanced Features Summary, Prev: Extension Philosophy, * You can also just "pretty-print" the program. - * New features should be developed using the extension mechansim if + * New features should be developed using the extension mechanism if possible; they should be added to the core interpreter only as a last resort. diff --git a/doc/gawk.texi b/doc/gawk.texi index 4a0fb3ae..956bb549 100644 --- a/doc/gawk.texi +++ b/doc/gawk.texi @@ -30652,7 +30652,7 @@ you tune them more easily. Sending the @code{USR1} signal while profiling cause You can also just ``pretty-print'' the program. @item -New features should be developed using the extension mechansim if possible; +New features should be developed using the extension mechanism if possible; they should be added to the core interpreter only as a last resort. @end itemize diff --git a/doc/gawkinet.info b/doc/gawkinet.info index 527f469f..1054441f 100644 --- a/doc/gawkinet.info +++ b/doc/gawkinet.info @@ -716,7 +716,7 @@ machine what time it is: Even experienced 'awk' users will find the fourth and sixth line strange in two respects: - * A string containg the name of a special file is used as a shell + * A string containing the name of a special file is used as a shell command that pipes its output into 'getline'. One would rather expect to see the special file being read like any other file ('getline < "/inet/tcp/0/time-a-g.nist.gov/daytime"'). @@ -4454,41 +4454,41 @@ Node: File /inet/tcp26947 Node: File /inet/udp27933 Ref: File /inet/udp-Footnote-129645 Node: TCP Connecting29899 -Node: Troubleshooting33332 -Ref: Troubleshooting-Footnote-136096 -Node: Interacting37053 -Node: Setting Up41411 -Node: Email45960 -Ref: Email-Footnote-148382 -Node: Web page49190 -Ref: Web page-Footnote-152010 -Ref: Web page-Footnote-252208 -Node: Primitive Service52702 -Node: Interacting Service55436 -Ref: Interacting Service-Footnote-164591 -Node: CGI Lib64623 -Node: Simple Server71623 -Ref: Simple Server-Footnote-179425 -Node: Caveats79526 -Node: Challenges80669 -Ref: Challenges-Footnote-189411 -Node: Some Applications and Techniques89512 -Node: PANIC91973 -Node: GETURL93699 -Node: REMCONF96332 -Node: URLCHK101828 -Node: WEBGRAB105672 -Node: STATIST110136 -Ref: STATIST-Footnote-1123284 -Node: MAZE123727 -Node: MOBAGWHO129952 -Ref: MOBAGWHO-Footnote-1143854 -Node: STOXPRED143922 -Node: PROTBASE158214 -Ref: PROTBASE-Footnote-1171381 -Node: Links171496 -Node: GNU Free Documentation License174387 -Node: Index199507 +Node: Troubleshooting33334 +Ref: Troubleshooting-Footnote-136098 +Node: Interacting37055 +Node: Setting Up41413 +Node: Email45962 +Ref: Email-Footnote-148384 +Node: Web page49192 +Ref: Web page-Footnote-152012 +Ref: Web page-Footnote-252210 +Node: Primitive Service52704 +Node: Interacting Service55438 +Ref: Interacting Service-Footnote-164593 +Node: CGI Lib64625 +Node: Simple Server71625 +Ref: Simple Server-Footnote-179427 +Node: Caveats79528 +Node: Challenges80671 +Ref: Challenges-Footnote-189413 +Node: Some Applications and Techniques89514 +Node: PANIC91975 +Node: GETURL93701 +Node: REMCONF96334 +Node: URLCHK101830 +Node: WEBGRAB105674 +Node: STATIST110138 +Ref: STATIST-Footnote-1123286 +Node: MAZE123729 +Node: MOBAGWHO129954 +Ref: MOBAGWHO-Footnote-1143856 +Node: STOXPRED143924 +Node: PROTBASE158216 +Ref: PROTBASE-Footnote-1171383 +Node: Links171498 +Node: GNU Free Documentation License174389 +Node: Index199509 End Tag Table diff --git a/doc/gawkinet.texi b/doc/gawkinet.texi index 342b067b..94c666c5 100644 --- a/doc/gawkinet.texi +++ b/doc/gawkinet.texi @@ -892,7 +892,7 @@ strange in two respects: @itemize @bullet @item -A string containg the name of a special file is used as a shell command that pipes its output +A string containing the name of a special file is used as a shell command that pipes its output into @code{getline}. One would rather expect to see the special file being read like any other file (@samp{getline < "/inet/tcp/0/time-a-g.nist.gov/daytime"}). diff --git a/doc/gawktexi.in b/doc/gawktexi.in index 6e9930d1..b463e6ba 100644 --- a/doc/gawktexi.in +++ b/doc/gawktexi.in @@ -29588,7 +29588,7 @@ you tune them more easily. Sending the @code{USR1} signal while profiling cause You can also just ``pretty-print'' the program. @item -New features should be developed using the extension mechansim if possible; +New features should be developed using the extension mechanism if possible; they should be added to the core interpreter only as a last resort. @end itemize diff --git a/doc/wordlist b/doc/wordlist index 9ce31188..be7655ec 100644 --- a/doc/wordlist +++ b/doc/wordlist @@ -34,6 +34,7 @@ Automake Autotools Avahi Awk +Awka Awklib Awkstuff Ayalon @@ -77,6 +78,7 @@ CONVFMT CRC CRTL CSV +CSVMODE CTYPE Cc Chana @@ -89,6 +91,7 @@ Cloutier Cn Co Collado +Collado's Coprocess Coprocesses Coreutils @@ -202,6 +205,7 @@ Hartholz Hasegawa Hermann Hoare's +Hoijui's Hurd IA IDs @@ -241,6 +245,7 @@ JUN JVM Jaegermann Jannick +Jawk Jeroen Johansen's Jul @@ -895,6 +900,7 @@ expat expr ext ezalloc +ezrosent ezwinports fPIC fabi @@ -951,6 +957,7 @@ fpath fpbits fprintf fr +frawk freebsd freefriends freq @@ -1047,6 +1054,7 @@ hhhh hhob histsort hlp +hoijui hotmail hpmuseum hrule @@ -1170,6 +1178,7 @@ li libexec libintl libmawk +libs libtool licensors lineannotation @@ -1212,6 +1221,7 @@ mawk maxelt maxsub mbs +mcollado mediaobject mem memcpy @@ -1337,6 +1347,7 @@ nonrectangular nonrepeated nonspecial nonwhitespace +noyesno nr ns nul diff --git a/doc/wordlist2 b/doc/wordlist2 index d6980be5..2441b5ea 100644 --- a/doc/wordlist2 +++ b/doc/wordlist2 @@ -21,6 +21,7 @@ TODO Ta Texinfo UsingGit +Wiegley Yehezkel ac api @@ -89,7 +90,9 @@ iftex ifxml inlineraw insertcopying +io jpdev +jwiegley kbd labelled libtool diff --git a/doc/wordlist4 b/doc/wordlist4 index f267327a..e3fe646b 100644 --- a/doc/wordlist4 +++ b/doc/wordlist4 @@ -14,10 +14,12 @@ Ayalon BGCOLOR BLASTService BR +BitMap Boutell CC CELLPADDING CEST +CET CGI CNN CSV @@ -36,6 +38,7 @@ DECnet DEF DONT DTD +DarkFinger Degeneres DownCount EK @@ -76,6 +79,7 @@ Hoare's HotCount HttpService Humphrys +Humphrys's HyperText IM IMG @@ -127,11 +131,13 @@ MyOrigin MyPort MyPrefix MyProxy +NBK NBRF NCBI NCBI's NF NR +Nace NetService NeutralCount NewLength @@ -161,6 +167,7 @@ PostScript Pragma Prez ProxyPort +QUIC REMCONF RFCs RP @@ -173,7 +180,9 @@ SA SBC SNMP SPAK +SPDY SRC +SSRNYG STARTOFRANGE STATIST STOXPRED @@ -202,6 +211,7 @@ UMBC URI URLCHK URLfile +USB UTX UpCount VLINK @@ -213,6 +223,7 @@ WINNT WMT Waterman's Weizenbaum +WinDir WorldWideWeb XBM XCF @@ -226,7 +237,9 @@ YOUVE YSIZE YahooData YouSay +ab abcdef +abs acm adelphia adenosine @@ -234,6 +247,8 @@ advperl ai ambientIntensity amd +andrew +arihuang arnold asc ascii @@ -242,7 +257,9 @@ au awk awkforai awkinet +awklib bbs +berkeley bierce bigskip bioskills @@ -256,6 +273,9 @@ boutell br caccaccatggacagcaaa canberra +catpipeclient +catpipeserver +cewing cgi cgilib ch @@ -264,6 +284,8 @@ charset chayden chrisc cindex +cmu +codeanticode codon columnfractions com @@ -284,6 +306,8 @@ cytidine dartmouth datacount daycount +daytimeclient +daytimeserver dbj dcu dd @@ -303,7 +327,11 @@ dir dircategory direntry dist +dl +doi +downloader ducktown +eda edu eg ek @@ -312,9 +340,12 @@ emailhost emb embedpc emph +en endfile +english epd evenheading +exe exp fakenode fasta @@ -331,15 +362,18 @@ fr fsbassociates fsf ftest +fulldisclosure gawcon gawkinet gawknet gawnetf gd +genebee geninfo getline geturl gif +github gnl gnuawk gnuplot @@ -362,17 +396,20 @@ httpd https httpserver hughes +hughestech humphrys iX ibeta ibm ie +ietf ifhtml ifinfo ifnotinfo ifnottex iftex igawk +igw inet inetlib inmargin @@ -383,7 +420,9 @@ intel interline introcb invsqrt +io ip +ips irc iso java @@ -391,14 +430,17 @@ jp jpl kabat kazusa +kbd keto keynes +knowledgecenter kohala laplace len lflashlight li libc +libgd lifeisgood lineo linespace @@ -407,11 +449,15 @@ localhost localport loebner loui +mailpopclient mailto marx +microsoft mkdir mobag moritz +msql +msu multiline multitable myhost @@ -430,6 +476,7 @@ netgawk netscape netstat nih +nist nl nlm nntp @@ -442,6 +489,7 @@ nph nr nthese nwe +ocf oddheading offinterlineskip openURL @@ -455,6 +503,7 @@ pdb pdict perl pir +plaintext png postoffice pre @@ -478,6 +527,7 @@ remoteport rendez retr rf +rfc rflashlight rhf rm @@ -486,8 +536,10 @@ rvices samp sapiens sc +scitable scriptics sd +seclists seealso seeentry serv @@ -497,6 +549,7 @@ setchapternewpage setfilename settitle sez +sg shtml skeeve skyAngle @@ -511,6 +564,7 @@ spinoza spoonsful sprintf srand +stackexchange statist stderr stdin @@ -519,6 +573,7 @@ stoxdata stoxpred str strftime +su subentry subj subjold @@ -535,10 +590,13 @@ tcl tcp tcpcon tcpip +technet technicalinfo +techrepublic testserv tex texinfo +tf tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat tggtgaagtgtgtttcttg thischapter @@ -549,6 +607,7 @@ titlepage tjhsst tmp tolower +topicpage toupper ttytst tutest @@ -585,9 +644,13 @@ webclient webgrab webser webserx +wikipedia +windowsserver +wnace wold wotsit wouldnt +ws wustl www xbm |