aboutsummaryrefslogtreecommitdiffstats
path: root/doc
diff options
context:
space:
mode:
Diffstat (limited to 'doc')
-rw-r--r--doc/ChangeLog147
-rw-r--r--doc/Makefile.am14
-rw-r--r--doc/Makefile.in232
-rw-r--r--doc/awkcard.in43
-rw-r--r--doc/gawk.1237
-rw-r--r--doc/gawk.info11711
-rw-r--r--[-rwxr-xr-x]doc/gawk.texi1644
-rw-r--r--doc/gawkinet.info1527
-rw-r--r--doc/gawkinet.texi16
-rw-r--r--doc/lflashlight.pdf56
-rw-r--r--doc/rflashlight.pdf57
-rw-r--r--doc/statist.pdfbin0 -> 5313 bytes
-rw-r--r--doc/texinfo.tex2935
13 files changed, 11111 insertions, 7508 deletions
diff --git a/doc/ChangeLog b/doc/ChangeLog
index 7d7f2050..91d01a33 100644
--- a/doc/ChangeLog
+++ b/doc/ChangeLog
@@ -1,3 +1,148 @@
+Mon Oct 22 08:49:05 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * Release 3.1.6: Release tar file made.
+
+Fri Oct 19 04:13:33 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.1: Add length(array) to list of extensions at end.
+ Revise date.
+
+Thu Oct 18 08:40:59 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * texinfo.tex: Updated to version from Texinfo 4.11.
+
+Sun Oct 14 20:37:59 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * awkcard.in: Fix version numbers and copyright info, minor
+ cleanups to format nicely.
+
+Sun Sep 30 22:30:05 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi (Conversion): Add table describing locale decimal
+ point versus period.
+
+Sat Sep 8 23:53:46 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: A number of minor fixes based on suggestions
+ from Jack Kelley <Jack.Kelley@epa.qld.gov.au>.
+
+Sat Aug 11 22:46:14 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi (Copying): Move to GPL 3.
+
+Wed May 30 17:11:19 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * Makefile.am (CLEANFILES): Added, so that even "make distclean"
+ will do the right thing.
+ (clean): Removed, let automake to do it.
+
+Tue May 29 22:49:16 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: Document --use-lc-numeric. Document that some
+ VMS systems come with an old version of gawk.
+
+Mon May 28 08:21:51 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.1, awkcard.in: Document --use-lc-numeric.
+
+Tue May 15 13:27:38 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi, gawk.1: Documented --disable-directories-fatal
+ configure option.
+
+Wed May 9 21:50:44 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.1: Reviewed and updated, minor typos fixed.
+ * awkcard.in: Added mention of %F.
+
+Wed May 2 19:55:02 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: Cleaned up discussion of string concatenation
+ where needed, including a note about the mixed treatment
+ of `"echo " "date" | getline'. Sigh.
+
+Sun Apr 29 13:33:27 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi (Time Functions): Update description of strftime
+ for third utc-flag argument. Other minor fixes.
+ * gawk.1, awkcard.in: Same.
+
+Tue Apr 3 22:47:40 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi (New Ports): Update list of files for all of
+ regex that should not be messed with lightly.
+
+Wed Mar 21 09:02:53 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: Removed last vestiges of arnold@gnu.org
+ email address.
+
+Wed Mar 7 13:06:31 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi (Getopt Function): Add a note that user level
+ code must clear out ARGV from 1 to Optind.
+ Thanks to Matthew.Hall1@VerizonWireless.com, from mail
+ dated Tue, 02 Aug 2005 09:04:37 -0700.
+
+Wed Mar 7 08:48:02 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: Fix my personal email address. Sheesh.
+ Thanks again to Sahak Petrosyan <petrosyan@gmail.com>.
+
+Tue Mar 6 09:13:38 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: Fix link to online version of the manual.
+ Thanks to Sahak Petrosyan <petrosyan@gmail.com>.
+
+Wed Feb 14 19:40:33 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.texi: Add discussion of magic values for Inf, NaN,
+ and hexadecimal floating point in appendix on numbers.
+ Other minor updates for date, trademarks, etc.
+
+Sun Jan 21 12:59:33 2007 "Ennio-(Sr)" <ennio@WouldBe-ei.net>
+
+ * gawk.1: Add note that locale settings can influence the
+ choice of decimal point character.
+
+Sat Jan 13 22:43:39 2007 Ralf Wildenhues <Ralf.Wildenhues@gmx.de>
+
+ * gawk.texi: Fix some typos.
+ * gawkinet.texi: Likewise.
+
+Sat Jan 13 21:25:28 2007 Ralf Wildenhues <Ralf.Wildenhues@gmx.de>
+
+ * awkcard.in: next is POSIX.
+ * gawk.texi: V7/SVR3.1: Mention assignable `$0', `var in index'
+ as expression. Specify `FS' limitation.
+
+Fri Jan 12 12:28:51 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * texinfo.tex: Updated upon move to current autotools.
+
+Thu Jan 4 19:56:45 2007 Arnold D. Robbins <arnold@skeeve.com>
+
+ * gawk.1: Applied patch from Eric Raymond to stop his stupid
+ automated email kvetching about the wonders of docbook.
+
+2006-07-29 Paul Eggert <eggert@cs.ucla.edu>
+
+ * gawk.texi: Document that `$$0++--' isn't valid even though it
+ is unambiguous according to the Awk grammar. This is in response
+ to Open Group XCU ERN 86
+ <http://www.opengroup.org/austin/aardvark/latest/xcubug2.txt>.
+
+Fri Oct 21 12:50:19 2005 Arnold D. Robbins <arnold@skeeve.com>
+
+ Better support for PDF, thanks to Marty Leisner
+ <leisner@rochester.rr.com> for the prodding.
+
+ * Makefile.am: Add lflashlight.pdf, rflashlight.pdf, statist.pdf
+ to EXTRADIST and add gawk.pdf and gawkinet.pdf to list of files
+ to remove for `clean'.
+ * lflashlight.pdf, rflashlight.pdf, statist.pdf: New files, created
+ with `epstopdf foo.eps > foo.pdf'.
+
Tue Jul 26 21:46:16 2005 Arnold D. Robbins <arnold@skeeve.com>
* Release 3.1.5: Release tar file made.
@@ -331,7 +476,7 @@ Thu Jul 29 23:15:34 1999 Arnold D. Robbins <arnold@skeeve.com>
install it directly.
Wed Jun 30 16:14:36 1999 Arnold D. Robbins <arnold@gnu.org>
-
+
* Release 3.0.4: Release tar file made. This time for sure.
Wed Oct 7 21:59:33 1998 Arnold D. Robbins <arnold@gnu.org>
diff --git a/doc/Makefile.am b/doc/Makefile.am
index f3a26815..b83f9d67 100644
--- a/doc/Makefile.am
+++ b/doc/Makefile.am
@@ -1,14 +1,15 @@
#
# doc/Makefile.am --- automake input file for gawk
#
-# Copyright (C) 2000, 2001, 2002, 2004, 2005 the Free Software Foundation, Inc.
+# Copyright (C) 2000, 2001, 2002, 2004, 2005, 2007
+# the Free Software Foundation, Inc.
#
# This file is part of GAWK, the GNU implementation of the
# AWK Programming Language.
#
# GAWK is free software; you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2 of the License, or
+# the Free Software Foundation; either version 3 of the License, or
# (at your option) any later version.
#
# GAWK is distributed in the hope that it will be useful,
@@ -31,7 +32,11 @@ EXTRA_DIST = ChangeLog README.card ad.block setter.outline \
awkcard.in awkforai.txt texinfo.tex cardfonts \
macros colors no.colors $(man_MANS) \
lflashlight.eps rflashlight.eps \
- statist.jpg statist.eps
+ lflashlight.pdf rflashlight.pdf \
+ statist.jpg statist.eps statist.pdf
+
+# Get rid of generated files when cleaning
+CLEANFILES = *.ps *.html *.dvi *~ awkcard.nc awkcard.tr gawk.pdf gawkinet.pdf
MAKEINFO = @MAKEINFO@ --no-split --force
@@ -90,6 +95,3 @@ awkcard.ps: $(CARDFILES)
awkcard.nc: $(CARDFILES)
$(TROFF) $(CARDSRC_N) | $(SEDME) | cat $(srcdir)/setter.outline - > awkcard.ps && touch awkcard.nc
-
-clean:
- rm -f *.ps *~ awkcard.nc awkcard.tr *.html
diff --git a/doc/Makefile.in b/doc/Makefile.in
index 93a4d28f..efd6ff05 100644
--- a/doc/Makefile.in
+++ b/doc/Makefile.in
@@ -1,8 +1,8 @@
-# Makefile.in generated by automake 1.9.5 from Makefile.am.
+# Makefile.in generated by automake 1.10 from Makefile.am.
# @configure_input@
# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,
-# 2003, 2004, 2005 Free Software Foundation, Inc.
+# 2003, 2004, 2005, 2006 Free Software Foundation, Inc.
# This Makefile.in is free software; the Free Software Foundation
# gives unlimited permission to copy and/or distribute it,
# with or without modifications, as long as this notice is preserved.
@@ -17,14 +17,15 @@
#
# doc/Makefile.am --- automake input file for gawk
#
-# Copyright (C) 2000, 2001, 2002, 2004, 2005 the Free Software Foundation, Inc.
+# Copyright (C) 2000, 2001, 2002, 2004, 2005, 2007
+# the Free Software Foundation, Inc.
#
# This file is part of GAWK, the GNU implementation of the
# AWK Programming Language.
#
# GAWK is free software; you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2 of the License, or
+# the Free Software Foundation; either version 3 of the License, or
# (at your option) any later version.
#
# GAWK is distributed in the hope that it will be useful,
@@ -36,15 +37,11 @@
# along with this program; if not, write to the Free Software
# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA
#
-srcdir = @srcdir@
-top_srcdir = @top_srcdir@
VPATH = @srcdir@
pkgdatadir = $(datadir)/@PACKAGE@
pkglibdir = $(libdir)/@PACKAGE@
pkgincludedir = $(includedir)/@PACKAGE@
-top_builddir = ..
am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-INSTALL = @INSTALL@
install_sh_DATA = $(install_sh) -c -m 644
install_sh_PROGRAM = $(install_sh) -c
install_sh_SCRIPT = $(install_sh) -c
@@ -63,13 +60,14 @@ DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in ChangeLog \
texinfo.tex
ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
am__aclocal_m4_deps = $(top_srcdir)/m4/arch.m4 \
- $(top_srcdir)/m4/gettext.m4 $(top_srcdir)/m4/iconv.m4 \
- $(top_srcdir)/m4/intmax_t.m4 $(top_srcdir)/m4/inttypes_h.m4 \
- $(top_srcdir)/m4/lib-ld.m4 $(top_srcdir)/m4/lib-link.m4 \
- $(top_srcdir)/m4/lib-prefix.m4 $(top_srcdir)/m4/longlong.m4 \
- $(top_srcdir)/m4/nls.m4 $(top_srcdir)/m4/po.m4 \
- $(top_srcdir)/m4/progtest.m4 $(top_srcdir)/m4/socket.m4 \
- $(top_srcdir)/m4/stdint_h.m4 $(top_srcdir)/m4/strtod.m4 \
+ $(top_srcdir)/m4/codeset.m4 $(top_srcdir)/m4/gettext.m4 \
+ $(top_srcdir)/m4/iconv.m4 $(top_srcdir)/m4/intmax_t.m4 \
+ $(top_srcdir)/m4/inttypes_h.m4 $(top_srcdir)/m4/isc-posix.m4 \
+ $(top_srcdir)/m4/lcmessage.m4 $(top_srcdir)/m4/lib-ld.m4 \
+ $(top_srcdir)/m4/lib-link.m4 $(top_srcdir)/m4/lib-prefix.m4 \
+ $(top_srcdir)/m4/longlong.m4 $(top_srcdir)/m4/nls.m4 \
+ $(top_srcdir)/m4/po.m4 $(top_srcdir)/m4/progtest.m4 \
+ $(top_srcdir)/m4/socket.m4 $(top_srcdir)/m4/stdint_h.m4 \
$(top_srcdir)/m4/uintmax_t.m4 $(top_srcdir)/m4/ulonglong.m4 \
$(top_srcdir)/configure.ac
am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
@@ -92,13 +90,17 @@ MAKEINFOHTML = $(MAKEINFO) --html
AM_MAKEINFOHTMLFLAGS = $(AM_MAKEINFOFLAGS)
DVIPS = dvips
am__installdirs = "$(DESTDIR)$(infodir)" "$(DESTDIR)$(man1dir)"
+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
+am__vpath_adj = case $$p in \
+ $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
+ *) f=$$p;; \
+ esac;
+am__strip_dir = `echo $$p | sed -e 's|^.*/||'`;
man1dir = $(mandir)/man1
NROFF = nroff
MANS = $(man_MANS)
DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
ACLOCAL = @ACLOCAL@
-AMDEP_FALSE = @AMDEP_FALSE@
-AMDEP_TRUE = @AMDEP_TRUE@
AMTAR = @AMTAR@
AUTOCONF = @AUTOCONF@
AUTOHEADER = @AUTOHEADER@
@@ -118,6 +120,9 @@ ECHO_T = @ECHO_T@
EGREP = @EGREP@
EXEEXT = @EXEEXT@
GMSGFMT = @GMSGFMT@
+GMSGFMT_015 = @GMSGFMT_015@
+GREP = @GREP@
+INSTALL = @INSTALL@
INSTALL_DATA = @INSTALL_DATA@
INSTALL_PROGRAM = @INSTALL_PROGRAM@
INSTALL_SCRIPT = @INSTALL_SCRIPT@
@@ -134,8 +139,9 @@ LTLIBICONV = @LTLIBICONV@
LTLIBINTL = @LTLIBINTL@
LTLIBOBJS = @LTLIBOBJS@
MAKEINFO = @MAKEINFO@ --no-split --force
-MKINSTALLDIRS = @MKINSTALLDIRS@
+MKDIR_P = @MKDIR_P@
MSGFMT = @MSGFMT@
+MSGFMT_015 = @MSGFMT_015@
MSGMERGE = @MSGMERGE@
OBJEXT = @OBJEXT@
PACKAGE = @PACKAGE@
@@ -155,12 +161,14 @@ U = @U@
USE_NLS = @USE_NLS@
VERSION = @VERSION@
XGETTEXT = @XGETTEXT@
+XGETTEXT_015 = @XGETTEXT_015@
YACC = @YACC@
+YFLAGS = @YFLAGS@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
ac_ct_CC = @ac_ct_CC@
-ac_ct_RANLIB = @ac_ct_RANLIB@
-ac_ct_STRIP = @ac_ct_STRIP@
-am__fastdepCC_FALSE = @am__fastdepCC_FALSE@
-am__fastdepCC_TRUE = @am__fastdepCC_TRUE@
am__include = @am__include@
am__leading_dot = @am__leading_dot@
am__quote = @am__quote@
@@ -172,36 +180,51 @@ build_alias = @build_alias@
build_cpu = @build_cpu@
build_os = @build_os@
build_vendor = @build_vendor@
+builddir = @builddir@
datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
exec_prefix = @exec_prefix@
host = @host@
host_alias = @host_alias@
host_cpu = @host_cpu@
host_os = @host_os@
host_vendor = @host_vendor@
+htmldir = @htmldir@
includedir = @includedir@
infodir = @infodir@
install_sh = @install_sh@
libdir = @libdir@
libexecdir = @libexecdir@
+localedir = @localedir@
localstatedir = @localstatedir@
mandir = @mandir@
mkdir_p = @mkdir_p@
oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
prefix = @prefix@
program_transform_name = @program_transform_name@
+psdir = @psdir@
sbindir = @sbindir@
sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
sysconfdir = @sysconfdir@
target_alias = @target_alias@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
info_TEXINFOS = gawk.texi gawkinet.texi
man_MANS = gawk.1 igawk.1
EXTRA_DIST = ChangeLog README.card ad.block setter.outline \
awkcard.in awkforai.txt texinfo.tex cardfonts \
macros colors no.colors $(man_MANS) \
lflashlight.eps rflashlight.eps \
- statist.jpg statist.eps
+ lflashlight.pdf rflashlight.pdf \
+ statist.jpg statist.eps statist.pdf
+
+# Get rid of generated files when cleaning
+CLEANFILES = *.ps *.html *.dvi *~ awkcard.nc awkcard.tr gawk.pdf gawkinet.pdf
TROFF = groff -t -Tps -U
SEDME = sed -e "s/^level0 restore/level0 restore flashme 100 72 moveto (Copyright `date '+%m-%d-%y %T'`, FSF, Inc. (all)) show/" \
-e "s/^\/level0 save def/\/level0 save def 30 -48 translate/"
@@ -262,9 +285,11 @@ $(ACLOCAL_M4): $(am__aclocal_m4_deps)
restore=: && backupdir="$(am__leading_dot)am$$$$" && \
am__cwd=`pwd` && cd $(srcdir) && \
rm -rf $$backupdir && mkdir $$backupdir && \
- for f in $@ $@-[0-9] $@-[0-9][0-9] $(@:.info=).i[0-9] $(@:.info=).i[0-9][0-9]; do \
- if test -f $$f; then mv $$f $$backupdir; restore=mv; else :; fi; \
- done; \
+ if ($(MAKEINFO) --version) >/dev/null 2>&1; then \
+ for f in $@ $@-[0-9] $@-[0-9][0-9] $(@:.info=).i[0-9] $(@:.info=).i[0-9][0-9]; do \
+ if test -f $$f; then mv $$f $$backupdir; restore=mv; else :; fi; \
+ done; \
+ else :; fi && \
cd "$$am__cwd"; \
if $(MAKEINFO) $(AM_MAKEINFOFLAGS) $(MAKEINFOFLAGS) -I $(srcdir) \
-o $@ $<; \
@@ -310,11 +335,29 @@ gawkinet.dvi: gawkinet.texi
gawkinet.pdf: gawkinet.texi
gawkinet.html: gawkinet.texi
.dvi.ps:
+ TEXINPUTS="$(am__TEXINFO_TEX_DIR)$(PATH_SEPARATOR)$$TEXINPUTS" \
$(DVIPS) -o $@ $<
+uninstall-dvi-am:
+ @$(NORMAL_UNINSTALL)
+ @list='$(DVIS)'; for p in $$list; do \
+ f=$(am__strip_dir) \
+ echo " rm -f '$(DESTDIR)$(dvidir)/$$f'"; \
+ rm -f "$(DESTDIR)$(dvidir)/$$f"; \
+ done
+
+uninstall-html-am:
+ @$(NORMAL_UNINSTALL)
+ @list='$(HTMLS)'; for p in $$list; do \
+ f=$(am__strip_dir) \
+ echo " rm -rf '$(DESTDIR)$(htmldir)/$$f'"; \
+ rm -rf "$(DESTDIR)$(htmldir)/$$f"; \
+ done
+
uninstall-info-am:
@$(PRE_UNINSTALL)
- @if (install-info --version && \
+ @if test -d '$(DESTDIR)$(infodir)' && \
+ (install-info --version && \
install-info --version 2>&1 | sed 1q | grep -i -v debian) >/dev/null 2>&1; then \
list='$(INFO_DEPS)'; \
for file in $$list; do \
@@ -328,12 +371,28 @@ uninstall-info-am:
for file in $$list; do \
relfile=`echo "$$file" | sed 's|^.*/||'`; \
relfile_i=`echo "$$relfile" | sed 's|\.info$$||;s|$$|.i|'`; \
- (if cd "$(DESTDIR)$(infodir)"; then \
+ (if test -d "$(DESTDIR)$(infodir)" && cd "$(DESTDIR)$(infodir)"; then \
echo " cd '$(DESTDIR)$(infodir)' && rm -f $$relfile $$relfile-[0-9] $$relfile-[0-9][0-9] $$relfile_i[0-9] $$relfile_i[0-9][0-9]"; \
rm -f $$relfile $$relfile-[0-9] $$relfile-[0-9][0-9] $$relfile_i[0-9] $$relfile_i[0-9][0-9]; \
else :; fi); \
done
+uninstall-pdf-am:
+ @$(NORMAL_UNINSTALL)
+ @list='$(PDFS)'; for p in $$list; do \
+ f=$(am__strip_dir) \
+ echo " rm -f '$(DESTDIR)$(pdfdir)/$$f'"; \
+ rm -f "$(DESTDIR)$(pdfdir)/$$f"; \
+ done
+
+uninstall-ps-am:
+ @$(NORMAL_UNINSTALL)
+ @list='$(PSS)'; for p in $$list; do \
+ f=$(am__strip_dir) \
+ echo " rm -f '$(DESTDIR)$(psdir)/$$f'"; \
+ rm -f "$(DESTDIR)$(psdir)/$$f"; \
+ done
+
dist-info: $(INFO_DEPS)
@srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; \
list='$(INFO_DEPS)'; \
@@ -342,10 +401,13 @@ dist-info: $(INFO_DEPS)
$(srcdir)/*) base=`echo "$$base" | sed "s|^$$srcdirstrip/||"`;; \
esac; \
if test -f $$base; then d=.; else d=$(srcdir); fi; \
- for file in $$d/$$base*; do \
- relfile=`expr "$$file" : "$$d/\(.*\)"`; \
- test -f $(distdir)/$$relfile || \
- cp -p $$file $(distdir)/$$relfile; \
+ base_i=`echo "$$base" | sed 's|\.info$$||;s|$$|.i|'`; \
+ for file in $$d/$$base $$d/$$base-[0-9] $$d/$$base-[0-9][0-9] $$d/$$base_i[0-9] $$d/$$base_i[0-9][0-9]; do \
+ if test -f $$file; then \
+ relfile=`expr "$$file" : "$$d/\(.*\)"`; \
+ test -f $(distdir)/$$relfile || \
+ cp -p $$file $(distdir)/$$relfile; \
+ else :; fi; \
done; \
done
@@ -366,7 +428,7 @@ maintainer-clean-aminfo:
done
install-man1: $(man1_MANS) $(man_MANS)
@$(NORMAL_INSTALL)
- test -z "$(man1dir)" || $(mkdir_p) "$(DESTDIR)$(man1dir)"
+ test -z "$(man1dir)" || $(MKDIR_P) "$(DESTDIR)$(man1dir)"
@list='$(man1_MANS) $(dist_man1_MANS) $(nodist_man1_MANS)'; \
l2='$(man_MANS) $(dist_man_MANS) $(nodist_man_MANS)'; \
for i in $$l2; do \
@@ -417,22 +479,21 @@ CTAGS:
distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's|.|.|g'`; \
- list='$(DISTFILES)'; for file in $$list; do \
- case $$file in \
- $(srcdir)/*) file=`echo "$$file" | sed "s|^$$srcdirstrip/||"`;; \
- $(top_srcdir)/*) file=`echo "$$file" | sed "s|^$$topsrcdirstrip/|$(top_builddir)/|"`;; \
- esac; \
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- dir=`echo "$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test "$$dir" != "$$file" && test "$$dir" != "."; then \
- dir="/$$dir"; \
- $(mkdir_p) "$(distdir)$$dir"; \
- else \
- dir=''; \
- fi; \
if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \
fi; \
@@ -451,7 +512,7 @@ check: check-am
all-am: Makefile $(INFO_DEPS) $(MANS)
installdirs:
for dir in "$(DESTDIR)$(infodir)" "$(DESTDIR)$(man1dir)"; do \
- test -z "$$dir" || $(mkdir_p) "$$dir"; \
+ test -z "$$dir" || $(MKDIR_P) "$$dir"; \
done
install: install-am
install-exec: install-exec-am
@@ -470,6 +531,7 @@ install-strip:
mostlyclean-generic:
clean-generic:
+ -test -z "$(CLEANFILES)" || rm -f $(CLEANFILES)
distclean-generic:
-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
@@ -477,6 +539,8 @@ distclean-generic:
maintainer-clean-generic:
@echo "This command is intended for maintainers to use"
@echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
clean-am: clean-generic mostlyclean-am
distclean: distclean-am
@@ -499,13 +563,42 @@ install-data-am: install-info-am install-man
@$(NORMAL_INSTALL)
$(MAKE) $(AM_MAKEFLAGS) install-data-hook
+install-dvi: install-dvi-am
+
+install-dvi-am: $(DVIS)
+ @$(NORMAL_INSTALL)
+ test -z "$(dvidir)" || $(MKDIR_P) "$(DESTDIR)$(dvidir)"
+ @list='$(DVIS)'; for p in $$list; do \
+ if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+ f=$(am__strip_dir) \
+ echo " $(INSTALL_DATA) '$$d$$p' '$(DESTDIR)$(dvidir)/$$f'"; \
+ $(INSTALL_DATA) "$$d$$p" "$(DESTDIR)$(dvidir)/$$f"; \
+ done
install-exec-am:
+install-html: install-html-am
+
+install-html-am: $(HTMLS)
+ @$(NORMAL_INSTALL)
+ test -z "$(htmldir)" || $(MKDIR_P) "$(DESTDIR)$(htmldir)"
+ @list='$(HTMLS)'; for p in $$list; do \
+ if test -f "$$p" || test -d "$$p"; then d=; else d="$(srcdir)/"; fi; \
+ f=$(am__strip_dir) \
+ if test -d "$$d$$p"; then \
+ echo " $(MKDIR_P) '$(DESTDIR)$(htmldir)/$$f'"; \
+ $(MKDIR_P) "$(DESTDIR)$(htmldir)/$$f" || exit 1; \
+ echo " $(INSTALL_DATA) '$$d$$p'/* '$(DESTDIR)$(htmldir)/$$f'"; \
+ $(INSTALL_DATA) "$$d$$p"/* "$(DESTDIR)$(htmldir)/$$f"; \
+ else \
+ echo " $(INSTALL_DATA) '$$d$$p' '$(DESTDIR)$(htmldir)/$$f'"; \
+ $(INSTALL_DATA) "$$d$$p" "$(DESTDIR)$(htmldir)/$$f"; \
+ fi; \
+ done
install-info: install-info-am
install-info-am: $(INFO_DEPS)
@$(NORMAL_INSTALL)
- test -z "$(infodir)" || $(mkdir_p) "$(DESTDIR)$(infodir)"
+ test -z "$(infodir)" || $(MKDIR_P) "$(DESTDIR)$(infodir)"
@srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; \
list='$(INFO_DEPS)'; \
for file in $$list; do \
@@ -535,6 +628,28 @@ install-info-am: $(INFO_DEPS)
else : ; fi
install-man: install-man1
+install-pdf: install-pdf-am
+
+install-pdf-am: $(PDFS)
+ @$(NORMAL_INSTALL)
+ test -z "$(pdfdir)" || $(MKDIR_P) "$(DESTDIR)$(pdfdir)"
+ @list='$(PDFS)'; for p in $$list; do \
+ if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+ f=$(am__strip_dir) \
+ echo " $(INSTALL_DATA) '$$d$$p' '$(DESTDIR)$(pdfdir)/$$f'"; \
+ $(INSTALL_DATA) "$$d$$p" "$(DESTDIR)$(pdfdir)/$$f"; \
+ done
+install-ps: install-ps-am
+
+install-ps-am: $(PSS)
+ @$(NORMAL_INSTALL)
+ test -z "$(psdir)" || $(MKDIR_P) "$(DESTDIR)$(psdir)"
+ @list='$(PSS)'; for p in $$list; do \
+ if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+ f=$(am__strip_dir) \
+ echo " $(INSTALL_DATA) '$$d$$p' '$(DESTDIR)$(psdir)/$$f'"; \
+ $(INSTALL_DATA) "$$d$$p" "$(DESTDIR)$(psdir)/$$f"; \
+ done
installcheck-am:
maintainer-clean: maintainer-clean-am
@@ -554,22 +669,28 @@ ps: ps-am
ps-am: $(PSS)
-uninstall-am: uninstall-info-am uninstall-man
+uninstall-am: uninstall-dvi-am uninstall-html-am uninstall-info-am \
+ uninstall-man uninstall-pdf-am uninstall-ps-am
@$(NORMAL_INSTALL)
$(MAKE) $(AM_MAKEFLAGS) uninstall-hook
uninstall-man: uninstall-man1
+.MAKE: install-am install-data-am install-strip uninstall-am
+
.PHONY: all all-am check check-am clean clean-generic dist-info \
distclean distclean-generic distdir dvi dvi-am html html-am \
info info-am install install-am install-data install-data-am \
- install-data-hook install-exec install-exec-am install-info \
- install-info-am install-man install-man1 install-strip \
+ install-data-hook install-dvi install-dvi-am install-exec \
+ install-exec-am install-html install-html-am install-info \
+ install-info-am install-man install-man1 install-pdf \
+ install-pdf-am install-ps install-ps-am install-strip \
installcheck installcheck-am installdirs maintainer-clean \
maintainer-clean-aminfo maintainer-clean-generic mostlyclean \
mostlyclean-aminfo mostlyclean-generic pdf pdf-am ps ps-am \
- uninstall uninstall-am uninstall-hook uninstall-info-am \
- uninstall-man uninstall-man1
+ uninstall uninstall-am uninstall-dvi-am uninstall-hook \
+ uninstall-html-am uninstall-info-am uninstall-man \
+ uninstall-man1 uninstall-pdf-am uninstall-ps-am
# Link gawk.1 to pgawk.1
@@ -604,9 +725,6 @@ awkcard.ps: $(CARDFILES)
awkcard.nc: $(CARDFILES)
$(TROFF) $(CARDSRC_N) | $(SEDME) | cat $(srcdir)/setter.outline - > awkcard.ps && touch awkcard.nc
-
-clean:
- rm -f *.ps *~ awkcard.nc awkcard.tr *.html
# Tell versions [3.59,3.63) of GNU make to not export all variables.
# Otherwise a system limit (for SysV at least) may be exceeded.
.NOEXPORT:
diff --git a/doc/awkcard.in b/doc/awkcard.in
index 7d55d977..30591403 100644
--- a/doc/awkcard.in
+++ b/doc/awkcard.in
@@ -1,7 +1,7 @@
.\" AWK Reference Card --- Arnold Robbins, arnold@skeeve.com
.\"
.\" Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002,
-.\" 2003, 2004, 2005 Free Software Foundation, Inc.
+.\" 2003, 2004, 2005, 2007 Free Software Foundation, Inc.
.\"
.\" Permission is granted to make and distribute verbatim copies of
.\" this reference card provided the copyright notice and this permission
@@ -100,8 +100,8 @@ Brian Kernighan and Michael Brennan who reviewed it.
\*(CD
.SL
.nf
-\*(FRCopyright \(co 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004
-Free Software Foundation, Inc.
+\*(FRCopyright \(co 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004,
+2005, 2007 Free Software Foundation, Inc.
.nf
.BT
@@ -223,11 +223,10 @@ mail to \*(FCbug-gawk@gnu.org\*(FR.\*(CX
.\" --- Command Line Arguments (gawk)
.ES
.fi
-\*(CDThe following options are specific to \*(GK.
-You may also use ``\*(FC\-W \*(FIoption\*(FR''
-for full POSIX compliance.
-Long options may abbreviated as long as the abbreviation
+\*(CDLong options may abbreviated as long as the abbreviation
remains unique.
+You may use ``\*(FC\-W \*(FIoption\*(FR''
+for full POSIX compliance.
.sp .5
.ig
.\" This option is left undocumented, on purpose.
@@ -355,21 +354,28 @@ T}
ls
l lw(2.2i).
\*(FC\-\^\-source '\*(FItext\*(FC'\*(FR
-%use \*(FItext\*(FR as AWK program source code.
+%T{
+use \*(FItext\*(FR as AWK program source code.
\*(FC\-\^\-version\*(FR%T{
print version information on \*(FCstdout\fP
and exit zero.
T}
+.T&
+ls
+l lw(2.2i).
+\*(FC\-\^\-use\-lc\-numeric
+%T{
+force use of the locale's decimal point character when parsing input data.
+T}
.TE
.sp .5
.fi
In compatibility mode,
any other options are flagged as invalid, but are otherwise ignored.
-In normal operation, as long as program text has been supplied, unknown
+Normally, if there is program text, unknown options
options are passed on to the AWK program in
\*(FCARGV\*(FR
-for processing. This is most useful for running AWK
-programs via the \*(FC#!\*(FR executable interpreter mechanism.\*(CB
+for processing.\*(CB
.EB "\s+2\f(HBCOMMAND LINE ARGUMENTS (\*(GK\f(HB)\*(FR\s0"
.BT
@@ -1168,7 +1174,7 @@ T}
.br
co-process pipe into \*(FCgetline\*(FR; set \*(FIv\*(FR.
.ti -.2i
-\*(FCnext\fP
+\*(CD\*(FCnext\fP
.br
stop processing the current input
record. Read next input record and
@@ -1297,6 +1303,8 @@ accept the following conversion specification formats:
\*(FC%E\fP like \*(FC%e\fP, but use \*(FCE\fP instead of \*(FCe\*(FR
\*(FC%f\fP a floating point number of the form
\*(FC[\-]ddd.dddddd\*(FR
+\*(FC%F\fP like \*(FC%f\fP, but use capital letters for infinity and
+ not-a-number values.
\*(FC%g\fP use \*(FC%e\fP or \*(FC%f\fP, whichever is shorter, with
nonsignificant zeros suppressed
\*(FC%G\fP like \*(FC%g\fP, but use \*(FC%E\fP instead of \*(FC%e\*(FR
@@ -1672,12 +1680,15 @@ stamp of the same form as returned by \*(FCsystime()\*(FR.
The \*(FIdatespec\fP is a string of the form
\*(FC"\*(FIYYYY MM DD HH MM SS[ DST]\*(FC"\*(FR.
.ti -.2i
-\*(FCstrftime(\*(FR[\*(FIformat \*(FR[\*(FC, \*(FItimestamp\*(FR]]\*(FC)\*(FR
+\*(FCstrftime(\*(FR[\*(FIformat \*(FR[\*(FC, \*(FItimestamp\*(FR[\*(FC, \*(FIutc-flag\*(FR]]]\*(FC)\*(FR
.br
formats \*(FItimestamp\fP
according to the specification in \*(FIformat\*(FR. The
\*(FItimestamp\fP should be of the same form as returned by
\*(FCsystime()\*(FR.
+If \*(FIutc-flag\*(FR
+is present and is non-zero or non-null, the result
+is in UTC, otherwise the result is in local time.
If \*(FItimestamp\fP is missing, the current time of day is used. If
\*(FIformat\fP is missing, a default format equivalent to the output
of \*(FIdate\*(FR(1) is used.
@@ -1902,7 +1913,7 @@ to use the current domain.\*(CB
.ES
.nf
\*(CDHost: \*(FCftp.gnu.org\*(FR
-File: \*(FC/gnu/gawk/gawk-3.1.5.tar.gz\fP
+File: \*(FC/gnu/gawk/gawk-3.1.6.tar.gz\fP
.in +.2i
.fi
GNU \*(AK (\*(GK). There may be a later version.
@@ -1929,8 +1940,8 @@ Michael Brennan's \*(MK. There may be a newer version.\*(CX
.\" --- Copying Permissions
.ES
.fi
-\*(CDCopyright \(co 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005
-Free Software Foundation, Inc.
+\*(CDCopyright \(co 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005,
+2007 Free Software Foundation, Inc.
.sp .5
Permission is granted to make and distribute verbatim copies of this
reference card provided the copyright notice and this permission notice
diff --git a/doc/gawk.1 b/doc/gawk.1
index 9859e7d3..3e950452 100644
--- a/doc/gawk.1
+++ b/doc/gawk.1
@@ -3,6 +3,14 @@
.ds AN \s-1ANSI\s+1
.ds GN \s-1GNU\s+1
.ds AK \s-1AWK\s+1
+.de EX
+.nf
+.ft CW
+..
+.de EE
+.ft R
+.fi
+..
.ds EP \fIGAWK: Effective AWK Programming\fP
.if !\n(.g \{\
. if !\w|\*(lq| \{\
@@ -14,7 +22,7 @@
. if \w'\(rq' .ds rq "\(rq
. \}
.\}
-.TH GAWK 1 "June 26 2005" "Free Software Foundation" "Utility Commands"
+.TH GAWK 1 "Oct 19 2007" "Free Software Foundation" "Utility Commands"
.SH NAME
gawk \- pattern scanning and processing language
.SH SYNOPSIS
@@ -53,7 +61,7 @@ file .\|.\|.
.I Gawk
is the \*(GN Project's implementation of the \*(AK programming language.
It conforms to the definition of the language in
-the \*(PX 1003.2 Command Language And Utilities Standard.
+the \*(PX 1003.1 Standard.
This version in turn is based on the description in
.IR "The AWK Programming Language" ,
by Aho, Kernighan, and Weinberger,
@@ -94,7 +102,7 @@ pre-defined \*(AK variables.
.PP
.I Gawk
options may be either traditional \*(PX one letter options,
-or \*(GN style long options. \*(PX options start with a single \*(lq\-\*(rq,
+or \*(GN-style long options. \*(PX options start with a single \*(lq\-\*(rq,
while long options start with \*(lq\-\^\-\*(rq.
Long options are provided for both \*(GN-specific features and
for \*(PX-mandated features.
@@ -119,7 +127,7 @@ remains unique.
.SH OPTIONS
.PP
.I Gawk
-accepts the following options, listed alphabetically.
+accepts the following options, listed by frequency.
.TP
.PD 0
.BI \-F " fs"
@@ -174,7 +182,8 @@ flag sets the maximum number of fields, and the
.B r
flag sets the maximum record size. These two flags and the
.B \-m
-option are from the Bell Laboratories research version of \*(UX
+option are from an earlier version of the Bell Laboratories
+research version of \*(UX
.IR awk .
They are ignored by
.IR gawk ,
@@ -233,7 +242,7 @@ If no
is provided,
.I gawk
uses a file named
-.I awkvars.out
+.B awkvars.out
in the current directory.
.sp .5
Having a list of all the global variables is a good way to look for
@@ -446,6 +455,25 @@ It is intended primarily for medium to large \*(AK programs used
in shell scripts.
.TP
.PD 0
+.B "\-W use\-lc\-numeric"
+.TP
+.PD
+.B \-\^\-use\-lc\-numeric
+This forces
+.I gawk
+to use the locale's decimal point character when parsing input data.
+Although the POSIX standard requires this behavior, and
+.I gawk
+does so when
+.B \-\^\-posix
+is in effect, the default is to follow traditional behavior and use a
+period as the decimal point, even in locales where the period is not the
+decimal point character. This option overrides the default behavior,
+without the full draconian strictness of the
+.B \-\^\-posix
+option.
+.TP
+.PD 0
.B "\-W version"
.TP
.PD
@@ -467,7 +495,7 @@ these options cause an immediate, successful exit.)
.B \-\^\-
Signal the end of options. This is useful to allow further arguments to the
\*(AK program itself to start with a \*(lq\-\*(rq.
-This is mainly for consistency with the argument parsing convention used
+This provides consistency with the argument parsing convention used
by most other \*(PX programs.
.PP
In compatibility mode,
@@ -588,7 +616,7 @@ or both,
depending upon how they are used. \*(AK also has one dimensional
arrays; arrays with multiple dimensions may be simulated.
Several pre-defined variables are set as a program
-runs; these will be described as needed and summarized below.
+runs; these are described as needed and summarized below.
.SS Records
Normally, records are separated by newline characters. You can control how
records are separated by assigning values to the built-in variable
@@ -636,10 +664,10 @@ In the special case that
.B FS
is a single space, fields are separated
by runs of spaces and/or tabs and/or newlines.
-(But see the discussion of
-.BR \-\^\-posix ,
+(But see the section
+.BR "POSIX COMPATIBILITY" ,
below).
-.B NOTE:
+.BR NOTE :
The value of
.B IGNORECASE
(see below) also affects how fields are split when
@@ -828,7 +856,7 @@ and
.B sub()
built-in functions all ignore case when doing regular expression
operations.
-.B NOTE:
+.BR NOTE :
Array subscripting is
.I not
affected.
@@ -858,7 +886,7 @@ the C
facilities such as
.BR isalpha() ,
and
-.BR tolupper() .
+.BR toupper() .
.TP
.B LINT
Provides dynamic control of the
@@ -1003,11 +1031,7 @@ are associative, i.e. indexed by string values.
.PP
The special operator
.B in
-may be used in an
-.B if
-or
-.B while
-statement to see if an array has an index consisting of a particular
+may be used to test if an array has an index consisting of a particular
value.
.PP
.RS
@@ -1040,7 +1064,7 @@ just by specifying the array name without a subscript.
Variables and fields
may be (floating point) numbers, or strings, or both. How the
value of a variable is interpreted depends upon its context. If used in
-a numeric expression, it will be treated as a number, if used as a string
+a numeric expression, it will be treated as a number; if used as a string
it will be treated as a string.
.PP
To force a variable to be treated as a number, add 0 to it; to force it
@@ -1073,6 +1097,16 @@ the variable
.B b
has a string value of \fB"12"\fR and not \fB"12.00"\fR.
.PP
+When operating in POSIX mode (such as with the
+.B \-\^\-posix
+command line option),
+beware that locale settings may interfere with the way
+decimal numbers are treated: the decimal separator of the numbers you
+are feeding to
+.I gawk
+must conform to what your locale would expect, be it
+a comma (,) or a period (.).
+.PP
.I Gawk
performs comparisons as follows:
If two variables are numeric, they are compared numerically.
@@ -1081,13 +1115,6 @@ If one value is numeric and the other has a string value that is a
Otherwise, the numeric value is converted to a string and a string
comparison is performed.
Two strings are compared, of course, as strings.
-Note that the POSIX standard applies the concept of
-\*(lqnumeric string\*(rq everywhere, even to string constants.
-However, this is
-clearly incorrect, and
-.I gawk
-does not do this.
-(Fortunately, this is fixed in the next version of the standard.)
.PP
Note that string constants, such as \fB"57"\fP, are
.I not
@@ -1335,7 +1362,7 @@ matches the end of a string.
character list, matches any of the characters
.IR abc.\|.\|. .
.TP
-.BI [^ abc.\|.\|. ]
+\fB[^\fIabc.\|.\|.\fB]\fR
negated character list, matches any character except
.IR abc.\|.\|. .
.TP
@@ -1429,7 +1456,7 @@ The escape sequences that are valid in string constants (see below)
are also valid in regular expressions.
.PP
.I "Character classes"
-are a new feature introduced in the \*(PX standard.
+are a feature introduced in the \*(PX standard.
A character class is a special notation for describing
lists of characters that have a specific attribute, but where the
actual characters themselves can vary from country to country and/or
@@ -1495,7 +1522,8 @@ match them, and if your character set collated differently from
With the \*(PX character classes, you can write
.BR /[[:alnum:]]/ ,
and this matches
-the alphabetic and numeric characters in your character set.
+the alphabetic and numeric characters in your character set,
+no matter what it is.
.PP
Two additional special sequences can appear in character lists.
These apply to non-\s-1ASCII\s+1 character sets, which can have single symbols
@@ -1505,7 +1533,7 @@ that are represented with more than one
character, as well as several characters that are equivalent for
.IR collating ,
or sorting, purposes. (E.g., in French, a plain \*(lqe\*(rq
-and a grave-accented e\` are equivalent.)
+and a grave-accented \*(lqe\h'-\w:e:u'\`\*(rq are equivalent.)
.TP
Collating Symbols
A collating symbol is a multi-character collating element enclosed in
@@ -1637,6 +1665,13 @@ Addition and subtraction.
.I space
String concatenation.
.TP
+.B "| |&"
+Piped I/O for
+.BR getline ,
+.BR print ,
+and
+.BR printf .
+.TP
.PD 0
.B "< >"
.TP
@@ -1649,7 +1684,7 @@ The regular relational operators.
.TP
.B "~ !~"
Regular expression match, negated match.
-.B NOTE:
+.BR NOTE :
Do not use a constant regular expression
.RB ( /foo/ )
on the left-hand side of a
@@ -1780,6 +1815,10 @@ as above.
Co-processes are a
.I gawk
extension.
+.RI ( command
+can also be a socket. See the subsection
+.BR "Special File Names" ,
+below.)
.TP
.B next
Stop processing the current input record. The next input record
@@ -1856,14 +1895,17 @@ and
.BR printf .
.TP
.BI "print .\|.\|. >>" " file"
-appends output to the
+Appends output to the
.IR file .
.TP
.BI "print .\|.\|. |" " command"
-writes on a pipe.
+Writes on a pipe.
.TP
.BI "print .\|.\|. |&" " command"
-sends data to a co-process.
+Sends data to a co-process or socket.
+(See also the subsection
+.BR "Special File Names" ,
+below.)
.PP
The
.BR getline
@@ -1872,8 +1914,8 @@ Upon an error,
.B ERRNO
contains a string describing the problem.
.PP
-.B NOTE:
-If using a pipe or co-process to
+.BR NOTE :
+If using a pipe, co-process, or socket to
.BR getline ,
or from
.B print
@@ -1883,8 +1925,8 @@ within a loop, you
.I must
use
.B close()
-to create new instances of the command.
-\*(AK does not automatically close pipes or co-processes when
+to create new instances of the command or socket.
+\*(AK does not automatically close pipes, sockets, or co-processes when
they return EOF.
.SS The \fIprintf\fP\^ Statement
.PP
@@ -1907,7 +1949,7 @@ character of that string is printed.
.BR "%d" "," " %i"
A decimal number (the integer part).
.TP
-.B %e , " %E"
+.BR %e , " %E"
A floating point number of the form
.BR [\-]d.dddddde[+\^\-]dd .
The
@@ -1917,11 +1959,22 @@ format uses
instead of
.BR e .
.TP
-.B %f
+.BR %f , " %F"
A floating point number of the form
.BR [\-]ddd.dddddd .
+If the system library supports it,
+.B %F
+is available as well. This is like
+.BR %f ,
+but uses capital letters for special \*(lqnot a number\*(rq
+and \*(lqinfinity\*(rq values. If
+.B %F
+is not available,
+.I gawk
+uses
+.BR %f .
.TP
-.B %g , " %G"
+.BR %g , " %G"
Use
.B %e
or
@@ -1944,7 +1997,7 @@ An unsigned decimal number (again, an integer).
.B %s
A character string.
.TP
-.B %x , " %X"
+.BR %x , " %X"
An unsigned hexadecimal number (an integer).
The
.B %X
@@ -1965,7 +2018,7 @@ outside the range of a C
integer,
.I gawk
switches to the
-.B %g
+.B %0f
format specifier. If
.B \-\^\-lint
is provided on the command line
@@ -2023,8 +2076,9 @@ a nonzero result.
For
.BR %e ,
.BR %E ,
+.B %f
and
-.BR %f ,
+.BR %F ,
the result always contains a
decimal point.
For
@@ -2053,8 +2107,9 @@ A number that specifies the precision to use when printing.
For the
.BR %e ,
.BR %E ,
+.B %f
and
-.BR %f
+.BR %F ,
formats, this specifies the
number of digits you want printed to the right of the decimal point.
For the
@@ -2275,7 +2330,7 @@ The contents of
are sorted using
.IR gawk\^ "'s"
normal rules for
-comparing values, and the indexes of the
+comparing values, and the indices of the
sorted values of
.I s
are replaced with sequential
@@ -2288,7 +2343,7 @@ is first duplicated into
.IR d ,
and then
.I d
-is sorted, leaving the indexes of the
+is sorted, leaving the indices of the
source array
.I s
unchanged.
@@ -2530,6 +2585,16 @@ with all the lower-case characters in
.I str
translated to their corresponding upper-case counterparts.
Non-alphabetic characters are left unchanged.
+.PP
+As of version 3.1.5,
+.I gawk
+is multibyte aware. This means that
+.BR index() ,
+.BR length() ,
+.B substr()
+and
+.B match()
+all work in terms of characters, not bytes.
.SS Time Functions
Since one of the primary uses of \*(AK programs is processing log files
that contain time stamp information,
@@ -2574,11 +2639,15 @@ is out of range,
.B mktime()
returns \-1.
.TP
-\fBstrftime(\fR[\fIformat \fR[\fB, \fItimestamp\fR]]\fB)\fR
+\fBstrftime(\fR[\fIformat \fR[\fB, \fItimestamp\fR[\fB, \fIutc-flag\fR]]]\fB)\fR
Formats
.I timestamp
according to the specification in
.IR format.
+If
+.I utc-flag
+is present and is non-zero or non-null, the result
+is in UTC, otherwise the result is in local time.
The
.I timestamp
should be of the same form as returned by
@@ -2595,14 +2664,6 @@ See the specification for the
.B strftime()
function in \*(AN C for the format conversions that are
guaranteed to be available.
-A public-domain version of
-.IR strftime (3)
-and a man page for it come with
-.IR gawk ;
-if that version was used to build
-.IR gawk ,
-then all of the conversions described in that man page are available to
-.IR gawk.
.TP
.B systime()
Returns the current time of day as the number of seconds since the Epoch
@@ -2613,7 +2674,7 @@ Starting with version 3.1 of
the following bit manipulation functions are available.
They work by converting double-precision floating point
values to
-.B "unsigned long"
+.B uintmax_t
integers, doing the operation, and then converting the
result back to floating point.
The functions are:
@@ -2771,7 +2832,7 @@ function f(p, q, a, b) # a and b are local
The left parenthesis in a function call is required
to immediately follow the function name,
without any intervening white space.
-This is to avoid a syntactic ambiguity with the concatenation operator.
+This avoids a syntactic ambiguity with the concatenation operator.
This restriction does not apply to the built-in functions listed above.
.PP
Functions may call each other and may be recursive.
@@ -2819,7 +2880,7 @@ Returns the value returned by
.ft B
This function is provided and documented in \*(EP,
but everything about this feature is likely to change
-in the next release.
+eventually.
We STRONGLY recommend that you do not use this feature
for anything that you aren't willing to redo.
.ft R
@@ -2834,7 +2895,9 @@ or whatever file was named with the
.B \-\^\-profile
option. It then continues to run.
.B SIGHUP
-causes it to dump the profile and function call stack and then exit.
+causes
+.I pgawk
+to dump the profile and function call stack and then exit.
.SH EXAMPLES
.nf
Print and sort the login names of all users:
@@ -2907,10 +2970,11 @@ action to assign a value to the
.B TEXTDOMAIN
variable to set the text domain to a name associated with your program.
.sp
-.ti +5n
-.ft B
+.RS
+.EX
BEGIN { TEXTDOMAIN = "myprog" }
-.ft R
+.EE
+.RE
.sp
This allows
.I gawk
@@ -2942,9 +3006,9 @@ to generate a
file for your program.
.TP
5.
-Provide appropriate translations, and build and install a corresponding
+Provide appropriate translations, and build and install the corresponding
.B \&.mo
-file.
+files.
.PP
The internationalization features are described in full detail in \*(EP.
.SH POSIX COMPATIBILITY
@@ -3080,7 +3144,9 @@ invoking
.I gawk
with the
.B \-\^\-traditional
-option.
+or
+.B \-\^\-posix
+options.
.PP
The following features of
.I gawk
@@ -3186,6 +3252,10 @@ The ability to use positional specifiers with
.B printf
and
.BR sprintf() .
+.TP
+\(bu
+The ability to pass an array to
+.BR length() .
.\" New keywords or changes to keywords
.TP
\(bu
@@ -3258,7 +3328,7 @@ option is \*(lqt\*(rq, then
is set to the tab character.
Note that typing
.B "gawk \-F\et \&.\|.\|."
-simply causes the shell to quote the \*(lqt,\*(rq, and does not pass
+simply causes the shell to quote the \*(lqt,\*(rq and does not pass
\*(lq\et\*(rq to the
.B \-F
option.
@@ -3310,6 +3380,15 @@ command, then it accepts an additional control-flow statement:
\fB}\fR
.fi
.RE
+.PP
+If
+.I gawk
+is configured with the
+.B \-\^\-disable\-directories-fatal
+option, then it will silently skip directories named on the command line.
+Otherwise, it will do so only if invoked with the
+.B \-\^\-traditional
+option.
.SH ENVIRONMENT VARIABLES
The
.B AWKPATH
@@ -3350,6 +3429,8 @@ Addison-Wesley, 1988. ISBN 0-201-07981-X.
.PP
\*(EP,
Edition 3.0, published by the Free Software Foundation, 2001.
+The current version of this document is available online at
+.BR http://www.gnu.org/software/gawk/manual .
.SH BUGS
The
.B \-F
@@ -3385,13 +3466,16 @@ The initial DOS port was done by Conrad Kwok and Scott Garfinkle.
Scott Deifik is the current DOS maintainer. Pat Rankin did the
port to VMS, and Michal Jaegermann did the port to the Atari ST.
The port to OS/2 was done by Kai Uwe Rommel, with contributions and
-help from Darrel Hankerson. Fred Fish supplied support for the Amiga,
-Stephen Davies provided the Tandem port,
+help from Darrel Hankerson.
+Juan M.\& Guerrero now maintains the OS/2 port.
+Fred Fish supplied support for the Amiga,
and Martin Brown provided the BeOS port.
+Stephen Davies provided the original Tandem port, and
+Matthew Woehlke provided changes for Tandem's POSIX-compliant systems.
.SH VERSION INFORMATION
This man page documents
.IR gawk ,
-version 3.1.5.
+version 3.1.6.
.SH BUG REPORTS
If you find a bug in
.IR gawk ,
@@ -3404,12 +3488,18 @@ Please include your operating system and its revision, the version of
what C compiler you used to compile it, and a test program
and data that are as small as possible for reproducing the problem.
.PP
-Before sending a bug report, please do two things. First, verify that
+Before sending a bug report, please do the following things. First, verify that
you have the latest version of
.IR gawk .
Many bugs (usually subtle ones) are fixed at each release, and if
yours is out of date, the problem may already have been solved.
-Second, please read this man page and the reference manual carefully to
+Second, please see if setting the environment variable
+.B LC_ALL
+to
+.B LC_ALL=C
+causes things to behave as you expect. If so, it's a locale issue,
+and may or may not really be a bug.
+Finally, please read this man page and the reference manual carefully to
be sure that what you think is a bug really is, instead of just a quirk
in the language.
.PP
@@ -3435,7 +3525,8 @@ provided valuable assistance during testing and debugging.
We thank him.
.SH COPYING PERMISSIONS
Copyright \(co 1989, 1991, 1992, 1993, 1994, 1995, 1996,
-1997, 1998, 1999, 2001, 2002, 2003, 2004, 2005 Free Software Foundation, Inc.
+1997, 1998, 1999, 2001, 2002, 2003, 2004, 2005, 2007
+Free Software Foundation, Inc.
.PP
Permission is granted to make and distribute verbatim copies of
this manual page provided the copyright notice and this permission
diff --git a/doc/gawk.info b/doc/gawk.info
index edc9939c..98e33fba 100644
--- a/doc/gawk.info
+++ b/doc/gawk.info
@@ -1,7 +1,7 @@
-This is gawk.info, produced by makeinfo version 4.6 from gawk.texi.
-
INFO-DIR-SECTION Text creation and manipulation
START-INFO-DIR-ENTRY
+This is gawk.info, produced by makeinfo version 4.11 from gawk.texi.
+
* Gawk: (gawk). A text scanning and processing language.
END-INFO-DIR-ENTRY
INFO-DIR-SECTION Individual utilities
@@ -9,12 +9,12 @@ START-INFO-DIR-ENTRY
* awk: (gawk)Invoking gawk. Text scanning and processing.
END-INFO-DIR-ENTRY
-Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000,
-2001, 2002, 2003, 2004, 2005 Free Software Foundation, Inc.
+ Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000,
+2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc.
This is Edition 3 of `GAWK: Effective AWK Programming: A User's
-Guide for GNU Awk', for the 3.1.5 (or later) version of the GNU
+Guide for GNU Awk', for the 3.1.6 (or later) version of the GNU
implementation of AWK.
Permission is granted to copy, distribute and/or modify this document
@@ -40,12 +40,12 @@ General Introduction
This file documents `awk', a program that you can use to select
particular records in a file and perform operations upon them.
-Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000,
-2001, 2002, 2003, 2004, 2005 Free Software Foundation, Inc.
+ Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000,
+2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc.
This is Edition 3 of `GAWK: Effective AWK Programming: A User's
-Guide for GNU Awk', for the 3.1.5 (or later) version of the GNU
+Guide for GNU Awk', for the 3.1.6 (or later) version of the GNU
implementation of AWK.
Permission is granted to copy, distribute and/or modify this document
@@ -98,7 +98,7 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
operating systems.
* Notes:: Notes about `gawk' extensions and
possible future work.
-* Basic Concepts:: A very quick intoduction to programming
+* Basic Concepts:: A very quick introduction to programming
concepts.
* Glossary:: An explanation of some unfamiliar terms.
* Copying:: Your right to copy and distribute
@@ -222,6 +222,8 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
* Typing and Comparison:: How variables acquire types and how this
affects comparison of numbers and strings
with `<', etc.
+* Variable Typing:: String type versus numeric type.
+* Comparison Operators:: The comparison operators.
* Boolean Ops:: Combining comparison expressions using
boolean operators `||' (``or''),
`&&' (``and'') and `!' (``not'').
@@ -417,6 +419,7 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
* VMS Installation Details:: How to install `gawk' under VMS.
* VMS Running:: How to run `gawk' under VMS.
* VMS POSIX:: Alternate instructions for VMS POSIX.
+* VMS Old Gawk:: An old version comes with some VMS systems.
* Unsupported:: Systems whose ports are no longer
supported.
* Atari Installation:: Installing `gawk' on the Atari ST.
@@ -446,6 +449,10 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
* Basic High Level:: The high level view.
* Basic Data Typing:: A very quick intro to data types.
* Floating Point Issues:: Stuff to know about floating-point numbers.
+* String Conversion Precision:: The String Value Can Lie.
+* Unexpected Results:: Floating Point Numbers Are Not
+ Abstract Numbers.
+* POSIX Floating Point Problems:: Standards Versus Existing Practice.
To Miriam, for making me complete.
@@ -456,8 +463,6 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
To Nachum, for the added dimension.
To Malka, for the new beginning.
-
-

File: gawk.info, Node: Foreword, Next: Preface, Prev: Top, Up: Top
@@ -559,14 +564,14 @@ inconvenient. Such jobs are often easier with `awk'. The `awk'
utility interprets a special-purpose programming language that makes it
easy to handle simple data-reformatting jobs.
-The GNU implementation of `awk' is called `gawk'; it is fully
+ The GNU implementation of `awk' is called `gawk'; it is fully
compatible with the System V Release 4 version of `awk'. `gawk' is
also compatible with the POSIX specification of the `awk' language.
This means that all properly written `awk' programs should work with
`gawk'. Thus, we usually don't distinguish between `gawk' and other
`awk' implementations.
-Using `awk' allows you to:
+ Using `awk' allows you to:
* Manage small, personal databases
@@ -579,7 +584,7 @@ Using `awk' allows you to:
* Experiment with algorithms that you can adapt later to other
computer languages
-In addition, `gawk' provides facilities that make it easy to:
+ In addition, `gawk' provides facilities that make it easy to:
* Extract bits and pieces of data for processing
@@ -587,15 +592,15 @@ In addition, `gawk' provides facilities that make it easy to:
* Perform simple network communications
-This Info file teaches you about the `awk' language and how you can use
-it effectively. You should already be familiar with basic system
+ This Info file teaches you about the `awk' language and how you can
+use it effectively. You should already be familiar with basic system
commands, such as `cat' and `ls',(1) as well as basic shell facilities,
such as input/output (I/O) redirection and pipes.
-Implementations of the `awk' language are available for many different
-computing environments. This Info file, while describing the `awk'
-language in general, also describes the particular implementation of
-`awk' called `gawk' (which stands for "GNU awk"). `gawk' runs on a
+ Implementations of the `awk' language are available for many
+different computing environments. This Info file, while describing the
+`awk' language in general, also describes the particular implementation
+of `awk' called `gawk' (which stands for "GNU awk"). `gawk' runs on a
broad range of Unix systems, ranging from 80386 PC-based computers up
through large-scale systems, such as Crays. `gawk' has also been ported
to Mac OS X, MS-DOS, Microsoft Windows (all versions) and OS/2 PCs,
@@ -614,10 +619,10 @@ Atari and Amiga microcomputers, BeOS, Tandem D20, and VMS.
* How To Contribute:: Helping to save the world.
* Acknowledgments:: Acknowledgments.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) These commands are available on POSIX-compliant systems, as well as
-on traditional Unix-based systems. If you are using some other
+ (1) These commands are available on POSIX-compliant systems, as well
+as on traditional Unix-based systems. If you are using some other
operating system, you still need to be familiar with the ideas of I/O
redirection and pipes.
@@ -628,6 +633,7 @@ History of `awk' and `gawk'
===========================
Recipe For A Programming Language
+
1 part `egrep' 1 part `snobol'
2 parts `ed' 3 parts C
@@ -637,7 +643,7 @@ History of `awk' and `gawk'
After eight years, add another part `egrep' and two more parts C.
Document very well and release.
-The name `awk' comes from the initials of its designers: Alfred V.
+ The name `awk' comes from the initials of its designers: Alfred V.
Aho, Peter J. Weinberger and Brian W. Kernighan. The original version
of `awk' was written in 1977 at AT&T Bell Laboratories. In 1985, a new
version made the programming language more powerful, introducing
@@ -650,23 +656,23 @@ and Utilities standard further clarified the language. Both the `gawk'
designers and the original Bell Laboratories `awk' designers provided
feedback for the POSIX specification.
-Paul Rubin wrote the GNU implementation, `gawk', in 1986. Jay Fenlason
-completed it, with advice from Richard Stallman. John Woods
+ Paul Rubin wrote the GNU implementation, `gawk', in 1986. Jay
+Fenlason completed it, with advice from Richard Stallman. John Woods
contributed parts of the code as well. In 1988 and 1989, David
Trueman, with help from me, thoroughly reworked `gawk' for compatibility
with the newer `awk'. Circa 1995, I became the primary maintainer.
Current development focuses on bug fixes, performance improvements,
standards compliance, and occasionally, new features.
-In May of 1997, Ju"rgen Kahrs felt the need for network access from
+ In May of 1997, Ju"rgen Kahrs felt the need for network access from
`awk', and with a little help from me, set about adding features to do
this for `gawk'. At that time, he also wrote the bulk of `TCP/IP
Internetworking with `gawk'' (a separate document, available as part of
the `gawk' distribution). His code finally became part of the main
`gawk' distribution with `gawk' version 3.1.
-*Note Contributors::, for a complete list of those who made important
-contributions to `gawk'.
+ *Note Contributors::, for a complete list of those who made
+important contributions to `gawk'.

File: gawk.info, Node: Names, Next: This Manual, Prev: History, Up: Preface
@@ -675,17 +681,17 @@ A Rose by Any Other Name
========================
The `awk' language has evolved over the years. Full details are
-provided in *Note Language History::. The language described in this
+provided in *note Language History::. The language described in this
Info file is often referred to as "new `awk'" (`nawk').
-Because of this, many systems have multiple versions of `awk'. Some
+ Because of this, many systems have multiple versions of `awk'. Some
systems have an `awk' utility that implements the original version of
the `awk' language and a `nawk' utility for the new version. Others
have an `oawk' version for the "old `awk'" language and plain `awk' for
the new one. Still others only have one version, which is usually the
new one.(1)
-All in all, this makes it difficult for you to know which version of
+ All in all, this makes it difficult for you to know which version of
`awk' you should run when writing your programs. The best advice I can
give here is to check your local documentation. Look for `awk', `oawk',
and `nawk', as well as for `gawk'. It is likely that you already have
@@ -693,14 +699,14 @@ some version of new `awk' on your system, which is what you should use
when running your programs. (Of course, if you're reading this Info
file, chances are good that you have `gawk'!)
-Throughout this Info file, whenever we refer to a language feature that
-should be available in any complete implementation of POSIX `awk', we
-simply use the term `awk'. When referring to a feature that is
+ Throughout this Info file, whenever we refer to a language feature
+that should be available in any complete implementation of POSIX `awk',
+we simply use the term `awk'. When referring to a feature that is
specific to the GNU implementation, we use the term `gawk'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Often, these systems use `gawk' for their `awk' implementation!
+ (1) Often, these systems use `gawk' for their `awk' implementation!

File: gawk.info, Node: This Manual, Next: Conventions, Prev: Names, Up: Preface
@@ -715,99 +721,100 @@ careful, we call the language "the `awk' language," and the program
and how to run the `awk' utility. The term "`awk' program" refers to a
program written by you in the `awk' programming language.
-Primarily, this Info file explains the features of `awk', as defined in
-the POSIX standard. It does so in the context of the `gawk'
+ Primarily, this Info file explains the features of `awk', as defined
+in the POSIX standard. It does so in the context of the `gawk'
implementation. While doing so, it also attempts to describe important
differences between `gawk' and other `awk' implementations.(1) Finally,
any `gawk' features that are not in the POSIX standard for `awk' are
noted.
-There are subsections labelled as *Advanced Notes* scattered throughout
-the Info file. They add a more complete explanation of points that are
-relevant, but not likely to be of interest on first reading. All
-appear in the index, under the heading "advanced features."
+ There are subsections labelled as *Advanced Notes* scattered
+throughout the Info file. They add a more complete explanation of
+points that are relevant, but not likely to be of interest on first
+reading. All appear in the index, under the heading "advanced
+features."
-Most of the time, the examples use complete `awk' programs. In some of
-the more advanced sections, only the part of the `awk' program that
+ Most of the time, the examples use complete `awk' programs. In some
+of the more advanced sections, only the part of the `awk' program that
illustrates the concept currently being described is shown.
-While this Info file is aimed principally at people who have not been
+ While this Info file is aimed principally at people who have not been
exposed to `awk', there is a lot of information here that even the `awk'
expert should find useful. In particular, the description of POSIX
-`awk' and the example programs in *Note Library Functions::, and in
-*Note Sample Programs::, should be of interest.
+`awk' and the example programs in *note Library Functions::, and in
+*note Sample Programs::, should be of interest.
-*Note Getting Started::, provides the essentials you need to know to
+ *note Getting Started::, provides the essentials you need to know to
begin using `awk'.
-*Note Regexp::, introduces regular expressions in general, and in
+ *note Regexp::, introduces regular expressions in general, and in
particular the flavors supported by POSIX `awk' and `gawk'.
-*Note Reading Files::, describes how `awk' reads your data. It
+ *note Reading Files::, describes how `awk' reads your data. It
introduces the concepts of records and fields, as well as the `getline'
command. I/O redirection is first described here.
-*Note Printing::, describes how `awk' programs can produce output with
-`print' and `printf'.
+ *note Printing::, describes how `awk' programs can produce output
+with `print' and `printf'.
-*Note Expressions::, describes expressions, which are the basic
+ *note Expressions::, describes expressions, which are the basic
building blocks for getting most things done in a program.
-*Note Patterns and Actions::, describes how to write patterns for
+ *note Patterns and Actions::, describes how to write patterns for
matching records, actions for doing something when a record is matched,
and the built-in variables `awk' and `gawk' use.
-*Note Arrays::, covers `awk''s one-and-only data structure: associative
-arrays. Deleting array elements and whole arrays is also described, as
-well as sorting arrays in `gawk'.
+ *note Arrays::, covers `awk''s one-and-only data structure:
+associative arrays. Deleting array elements and whole arrays is also
+described, as well as sorting arrays in `gawk'.
-*Note Functions::, describes the built-in functions `awk' and `gawk'
+ *note Functions::, describes the built-in functions `awk' and `gawk'
provide, as well as how to define your own functions.
-*Note Internationalization::, describes special features in `gawk' for
-translating program messages into different languages at runtime.
+ *note Internationalization::, describes special features in `gawk'
+for translating program messages into different languages at runtime.
-*Note Advanced Features::, describes a number of `gawk'-specific
+ *note Advanced Features::, describes a number of `gawk'-specific
advanced features. Of particular note are the abilities to have
two-way communications with another process, perform TCP/IP networking,
and profile your `awk' programs.
-*Note Invoking Gawk::, describes how to run `gawk', the meaning of its
-command-line options, and how it finds `awk' program source files.
+ *note Invoking Gawk::, describes how to run `gawk', the meaning of
+its command-line options, and how it finds `awk' program source files.
-*Note Library Functions::, and *Note Sample Programs::, provide many
+ *note Library Functions::, and *note Sample Programs::, provide many
sample `awk' programs. Reading them allows you to see `awk' solving
real problems.
-*Note Language History::, describes how the `awk' language has evolved
-since first release to present. It also describes how `gawk' has
-acquired features over time.
+ *note Language History::, describes how the `awk' language has
+evolved since first release to present. It also describes how `gawk'
+has acquired features over time.
-*Note Installation::, describes how to get `gawk', how to compile it
+ *note Installation::, describes how to get `gawk', how to compile it
under Unix, and how to compile and use it on different non-Unix
systems. It also describes how to report bugs in `gawk' and where to
get three other freely available implementations of `awk'.
-*Note Notes::, describes how to disable `gawk''s extensions, as well as
-how to contribute new code to `gawk', how to write extension libraries,
-and some possible future directions for `gawk' development.
+ *note Notes::, describes how to disable `gawk''s extensions, as well
+as how to contribute new code to `gawk', how to write extension
+libraries, and some possible future directions for `gawk' development.
-*Note Basic Concepts::, provides some very cursory background material
-for those who are completely unfamiliar with computer programming.
-Also centralized there is a discussion of some of the issues
-surrounding floating-point numbers.
+ *note Basic Concepts::, provides some very cursory background
+material for those who are completely unfamiliar with computer
+programming. Also centralized there is a discussion of some of the
+issues surrounding floating-point numbers.
-The *Note Glossary::, defines most, if not all, the significant terms
-used throughout the book. If you find terms that you aren't familiar
-with, try looking them up here.
+ The *note Glossary::, defines most, if not all, the significant
+terms used throughout the book. If you find terms that you aren't
+familiar with, try looking them up here.
-*Note Copying::, and *Note GNU Free Documentation License::, present
+ *note Copying::, and *note GNU Free Documentation License::, present
the licenses that cover the `gawk' source code and this Info file,
respectively.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) All such differences appear in the index under the entry
+ (1) All such differences appear in the index under the entry
"differences in `awk' and `gawk'."

@@ -821,10 +828,10 @@ formatting language. A single Texinfo source file is used to produce
both the printed and online versions of the documentation. This minor
node briefly documents the typographical conventions used in Texinfo.
-Examples you would type at the command-line are preceded by the common
-shell primary and secondary prompts, `$' and `>'. Output from the
-command is preceded by the glyph "-|". This typically represents the
-command's standard output. Error messages, and other output on the
+ Examples you would type at the command-line are preceded by the
+common shell primary and secondary prompts, `$' and `>'. Output from
+the command is preceded by the glyph "-|". This typically represents
+the command's standard output. Error messages, and other output on the
command's standard error, are preceded by the glyph "error-->". For
example:
@@ -833,7 +840,7 @@ example:
$ echo hello on stderr 1>&2
error--> hello on stderr
-Characters that you type at the keyboard look `like this'. In
+ Characters that you type at the keyboard look `like this'. In
particular, there are special characters called "control characters."
These are characters that you type by holding down both the `CONTROL'
key and another key, at the same time. For example, a `Ctrl-d' is typed
@@ -847,14 +854,14 @@ Dark Corners
illuminate, there's always a smaller but darker one.
Brian Kernighan
-Until the POSIX standard (and `The Gawk Manual'), many features of
+ Until the POSIX standard (and `The Gawk Manual'), many features of
`awk' were either poorly documented or not documented at all.
Descriptions of such features (often called "dark corners") are noted
in this Info file with "(d.c.)". They also appear in the index under
the heading "dark corner."
-As noted by the opening quote, though, any coverage of dark corners is,
-by definition, something that is incomplete.
+ As noted by the opening quote, though, any coverage of dark corners
+is, by definition, something that is incomplete.

File: gawk.info, Node: Manual History, Next: How To Contribute, Prev: Conventions, Up: Preface
@@ -867,23 +874,24 @@ to the production and distribution of freely distributable software.
It was founded by Richard M. Stallman, the author of the original Emacs
editor. GNU Emacs is the most widely used version of Emacs today.
-The GNU(1) Project is an ongoing effort on the part of the Free Software
-Foundation to create a complete, freely distributable, POSIX-compliant
-computing environment. The FSF uses the "GNU General Public License"
-(GPL) to ensure that their software's source code is always available
-to the end user. A copy of the GPL is included for your reference
-(*note Copying::). The GPL applies to the C language source code for
-`gawk'. To find out more about the FSF and the GNU Project online, see
-the GNU Project's home page (http://www.gnu.org). This Info file may
-also be read from their web site (http://www.gnu.org/manual/gawk/).
-
-A shell, an editor (Emacs), highly portable optimizing C, C++, and
+ The GNU(1) Project is an ongoing effort on the part of the Free
+Software Foundation to create a complete, freely distributable,
+POSIX-compliant computing environment. The FSF uses the "GNU General
+Public License" (GPL) to ensure that their software's source code is
+always available to the end user. A copy of the GPL is included for
+your reference (*note Copying::). The GPL applies to the C language
+source code for `gawk'. To find out more about the FSF and the GNU
+Project online, see the GNU Project's home page (http://www.gnu.org).
+This Info file may also be read from their web site
+(http://www.gnu.org/software/gawk/manual/).
+
+ A shell, an editor (Emacs), highly portable optimizing C, C++, and
Objective-C compilers, a symbolic debugger and dozens of large and
small utilities (such as `gawk'), have all been completed and are
freely available. The GNU operating system kernel (the HURD), has been
released but is still in an early stage of development.
-Until the GNU operating system is more fully developed, you should
+ Until the GNU operating system is more fully developed, you should
consider using GNU/Linux, a freely distributable, Unix-like operating
system for Intel 80386, DEC Alpha, Sun SPARC, IBM S/390, and other
systems.(2) There are many books on GNU/Linux. One that is freely
@@ -895,35 +903,35 @@ systems: NetBSD, FreeBSD, and OpenBSD. All are based on the 4.4-Lite
Berkeley Software Distribution, and they use recent versions of `gawk'
for their versions of `awk'.)
-The Info file itself has gone through a number of previous editions.
+ The Info file itself has gone through a number of previous editions.
Paul Rubin wrote the very first draft of `The GAWK Manual'; it was
around 40 pages in size. Diane Close and Richard Stallman improved it,
yielding a version that was around 90 pages long and barely described
the original, "old" version of `awk'.
-I started working with that version in the fall of 1988. As work on it
-progressed, the FSF published several preliminary versions (numbered
+ I started working with that version in the fall of 1988. As work on
+it progressed, the FSF published several preliminary versions (numbered
0.X). In 1996, Edition 1.0 was released with `gawk' 3.0.0. The FSF
published the first two editions under the title `The GNU Awk User's
Guide'.
-This edition maintains the basic structure of Edition 1.0, but with
+ This edition maintains the basic structure of Edition 1.0, but with
significant additional material, reflecting the host of new features in
-`gawk' version 3.1. Of particular note is *Note Array Sorting::, as
-well as *Note Bitwise Functions::, *Note Internationalization::, and
-also *Note Advanced Features::, and *Note Dynamic Extensions::.
+`gawk' version 3.1. Of particular note is *note Array Sorting::, as
+well as *note Bitwise Functions::, *note Internationalization::, and
+also *note Advanced Features::, and *note Dynamic Extensions::.
-`GAWK: Effective AWK Programming' will undoubtedly continue to evolve.
-An electronic version comes with the `gawk' distribution from the FSF.
-If you find an error in this Info file, please report it! *Note
-Bugs::, for information on submitting problem reports electronically,
-or write to me in care of the publisher.
+ `GAWK: Effective AWK Programming' will undoubtedly continue to
+evolve. An electronic version comes with the `gawk' distribution from
+the FSF. If you find an error in this Info file, please report it!
+*Note Bugs::, for information on submitting problem reports
+electronically, or write to me in care of the publisher.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) GNU stands for "GNU's not Unix."
+ (1) GNU stands for "GNU's not Unix."
-(2) The terminology "GNU/Linux" is explained in the *Note Glossary::.
+ (2) The terminology "GNU/Linux" is explained in the *note Glossary::.

File: gawk.info, Node: How To Contribute, Next: Acknowledgments, Prev: Manual History, Up: Preface
@@ -957,59 +965,59 @@ acknowledgments:
implementation and to this manual, that would otherwise have
escaped us.
-I would like to acknowledge Richard M. Stallman, for his vision of a
+ I would like to acknowledge Richard M. Stallman, for his vision of a
better world and for his courage in founding the FSF and starting the
GNU Project.
-The following people (in alphabetical order) provided helpful comments
-on various versions of this book, up to and including this edition.
-Rick Adams, Nelson H.F. Beebe, Karl Berry, Dr. Michael Brennan, Rich
-Burridge, Claire Cloutier, Diane Close, Scott Deifik, Christopher
-("Topher") Eliot, Jeffrey Friedl, Dr. Darrel Hankerson, Michal
-Jaegermann, Dr. Richard J. LeBlanc, Michael Lijewski, Pat Rankin,
+ The following people (in alphabetical order) provided helpful
+comments on various versions of this book, up to and including this
+edition. Rick Adams, Nelson H.F. Beebe, Karl Berry, Dr. Michael
+Brennan, Rich Burridge, Claire Cloutier, Diane Close, Scott Deifik,
+Christopher ("Topher") Eliot, Jeffrey Friedl, Dr. Darrel Hankerson,
+Michal Jaegermann, Dr. Richard J. LeBlanc, Michael Lijewski, Pat Rankin,
Miriam Robbins, Mary Sheehan, and Chuck Toporek.
-Robert J. Chassell provided much valuable advice on the use of Texinfo.
-He also deserves special thanks for convincing me _not_ to title this
-Info file `How To Gawk Politely'. Karl Berry helped significantly with
-the TeX part of Texinfo.
+ Robert J. Chassell provided much valuable advice on the use of
+Texinfo. He also deserves special thanks for convincing me _not_ to
+title this Info file `How To Gawk Politely'. Karl Berry helped
+significantly with the TeX part of Texinfo.
-I would like to thank Marshall and Elaine Hartholz of Seattle and Dr.
-Bert and Rita Schreiber of Detroit for large amounts of quiet vacation
-time in their homes, which allowed me to make significant progress on
-this Info file and on `gawk' itself.
+ I would like to thank Marshall and Elaine Hartholz of Seattle and
+Dr. Bert and Rita Schreiber of Detroit for large amounts of quiet
+vacation time in their homes, which allowed me to make significant
+progress on this Info file and on `gawk' itself.
-Phil Hughes of SSC contributed in a very important way by loaning me
+ Phil Hughes of SSC contributed in a very important way by loaning me
his laptop GNU/Linux system, not once, but twice, which allowed me to
do a lot of work while away from home.
-David Trueman deserves special credit; he has done a yeoman job of
+ David Trueman deserves special credit; he has done a yeoman job of
evolving `gawk' so that it performs well and without bugs. Although he
is no longer involved with `gawk', working with him on this project was
a significant pleasure.
-The intrepid members of the GNITS mailing list, and most notably Ulrich
-Drepper, provided invaluable help and feedback for the design of the
-internationalization features.
+ The intrepid members of the GNITS mailing list, and most notably
+Ulrich Drepper, provided invaluable help and feedback for the design of
+the internationalization features.
-Nelson Beebe, Martin Brown, Andreas Buening, Scott Deifik, Darrel
+ Nelson Beebe, Martin Brown, Andreas Buening, Scott Deifik, Darrel
Hankerson, Isamu Hasegawa, Michal Jaegermann, Ju"rgen Kahrs, Pat Rankin,
Kai Uwe Rommel, and Eli Zaretskii (in alphabetical order) make up the
`gawk' "crack portability team." Without their hard work and help,
`gawk' would not be nearly the fine program it is today. It has been
and continues to be a pleasure working with this team of fine people.
-David and I would like to thank Brian Kernighan of Bell Laboratories for
-invaluable assistance during the testing and debugging of `gawk', and
-for help in clarifying numerous points about the language. We could
-not have done nearly as good a job on either `gawk' or its
+ David and I would like to thank Brian Kernighan of Bell Laboratories
+for invaluable assistance during the testing and debugging of `gawk',
+and for help in clarifying numerous points about the language. We
+could not have done nearly as good a job on either `gawk' or its
documentation without his help.
-Chuck Toporek, Mary Sheehan, and Claire Coutier of O'Reilly &
+ Chuck Toporek, Mary Sheehan, and Claire Coutier of O'Reilly &
Associates contributed significant editorial help for this Info file
for the 3.1 release of `gawk'.
-I must thank my wonderful wife, Miriam, for her patience through the
+ I must thank my wonderful wife, Miriam, for her patience through the
many versions of this project, for her proofreading, and for sharing me
with the computer. I would like to thank my parents for their love,
and for the grace with which they raised and educated me. Finally, I
@@ -1035,23 +1043,23 @@ of the patterns, `awk' performs specified actions on that line. `awk'
keeps processing input lines in this way until it reaches the end of
the input files.
-Programs in `awk' are different from programs in most other languages,
-because `awk' programs are "data-driven"; that is, you describe the
-data you want to work with and then what to do when you find it. Most
-other languages are "procedural"; you have to describe, in great
-detail, every step the program is to take. When working with procedural
-languages, it is usually much harder to clearly describe the data your
-program will process. For this reason, `awk' programs are often
-refreshingly easy to read and write.
+ Programs in `awk' are different from programs in most other
+languages, because `awk' programs are "data-driven"; that is, you
+describe the data you want to work with and then what to do when you
+find it. Most other languages are "procedural"; you have to describe,
+in great detail, every step the program is to take. When working with
+procedural languages, it is usually much harder to clearly describe the
+data your program will process. For this reason, `awk' programs are
+often refreshingly easy to read and write.
-When you run `awk', you specify an `awk' "program" that tells `awk'
+ When you run `awk', you specify an `awk' "program" that tells `awk'
what to do. The program consists of a series of "rules". (It may also
contain "function definitions", an advanced feature that we will ignore
for now. *Note User-defined::.) Each rule specifies one pattern to
search for and one action to perform upon finding the pattern.
-Syntactically, a rule consists of a pattern followed by an action. The
-action is enclosed in curly braces to separate it from the pattern.
+ Syntactically, a rule consists of a pattern followed by an action.
+The action is enclosed in curly braces to separate it from the pattern.
Newlines usually separate rules. Therefore, an `awk' program looks
like this:
@@ -1087,12 +1095,12 @@ this:
awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ...
-When the program is long, it is usually more convenient to put it in a
-file and run it with a command like this:
+ When the program is long, it is usually more convenient to put it in
+a file and run it with a command like this:
awk -f PROGRAM-FILE INPUT-FILE1 INPUT-FILE2 ...
-This minor node discusses both mechanisms, along with several
+ This minor node discusses both mechanisms, along with several
variations of each.
* Menu:
@@ -1123,19 +1131,19 @@ program as the first argument of the `awk' command, like this:
where PROGRAM consists of a series of PATTERNS and ACTIONS, as
described earlier.
-This command format instructs the "shell", or command interpreter, to
-start `awk' and use the PROGRAM to process records in the input
+ This command format instructs the "shell", or command interpreter,
+to start `awk' and use the PROGRAM to process records in the input
file(s). There are single quotes around PROGRAM so the shell won't
interpret any `awk' characters as special shell characters. The quotes
also cause the shell to treat all of PROGRAM as a single argument for
`awk', and allow PROGRAM to be more than one line long.
-This format is also useful for running short or medium-sized `awk'
+ This format is also useful for running short or medium-sized `awk'
programs from shell scripts, because it avoids the need for a separate
file for the `awk' program. A self-contained shell script is more
reliable because there are no other files to misplace.
-*Note Very Simple::, presents several short, self-contained programs.
+ *note Very Simple::, presents several short, self-contained programs.

File: gawk.info, Node: Read Terminal, Next: Long, Prev: One-shot, Up: Running gawk
@@ -1154,19 +1162,20 @@ end-of-file by typing `Ctrl-d'. (On other operating systems, the
end-of-file character may be different. For example, on OS/2 and
MS-DOS, it is `Ctrl-z'.)
-As an example, the following program prints a friendly piece of advice
-(from Douglas Adams's `The Hitchhiker's Guide to the Galaxy'), to keep
-you from worrying about the complexities of computer programming
+ As an example, the following program prints a friendly piece of
+advice (from Douglas Adams's `The Hitchhiker's Guide to the Galaxy'),
+to keep you from worrying about the complexities of computer programming
(`BEGIN' is a feature we haven't discussed yet):
$ awk "BEGIN { print \"Don't Panic!\" }"
-| Don't Panic!
-This program does not read any input. The `\' before each of the inner
-double quotes is necessary because of the shell's quoting rules--in
-particular because it mixes both single quotes and double quotes.(1)
+ This program does not read any input. The `\' before each of the
+inner double quotes is necessary because of the shell's quoting
+rules--in particular because it mixes both single quotes and double
+quotes.(1)
-This next simple `awk' program emulates the `cat' utility; it copies
+ This next simple `awk' program emulates the `cat' utility; it copies
whatever you type on the keyboard to its standard output (why this
works is explained shortly).
@@ -1181,11 +1190,11 @@ works is explained shortly).
-| What, me worry?
Ctrl-d
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Although we generally recommend the use of single quotes around the
-program text, double quotes are needed here in order to put the single
-quote into the message.
+ (1) Although we generally recommend the use of single quotes around
+the program text, double quotes are needed here in order to put the
+single quote into the message.

File: gawk.info, Node: Long, Next: Executable Scripts, Prev: Read Terminal, Up: Running gawk
@@ -1199,8 +1208,8 @@ tell `awk' to use that file for its program, you type:
awk -f SOURCE-FILE INPUT-FILE1 INPUT-FILE2 ...
-The `-f' instructs the `awk' utility to get the `awk' program from the
-file SOURCE-FILE. Any file name can be used for SOURCE-FILE. For
+ The `-f' instructs the `awk' utility to get the `awk' program from
+the file SOURCE-FILE. Any file name can be used for SOURCE-FILE. For
example, you could put the program:
BEGIN { print "Don't Panic!" }
@@ -1220,9 +1229,10 @@ special characters. Notice that in `advice', the `awk' program did not
have single quotes around it. The quotes are only needed for programs
that are provided on the `awk' command line.
-If you want to identify your `awk' program files clearly as such, you
-can add the extension `.awk' to the file name. This doesn't affect the
-execution of the `awk' program but it does make "housekeeping" easier.
+ If you want to identify your `awk' program files clearly as such,
+you can add the extension `.awk' to the file name. This doesn't affect
+the execution of the `awk' program but it does make "housekeeping"
+easier.

File: gawk.info, Node: Executable Scripts, Next: Comments, Prev: Long, Up: Running gawk
@@ -1251,7 +1261,7 @@ if you had typed `awk -f advice':
variable (typically `$PATH'). If not, you may need to type `./advice'
at the shell.)
-Self-contained `awk' scripts are useful when you want to write a
+ Self-contained `awk' scripts are useful when you want to write a
program that users can invoke without their having to know that the
program is written in `awk'.
@@ -1261,25 +1271,25 @@ Advanced Notes: Portability Issues with `#!'
Some systems limit the length of the interpreter name to 32 characters.
Often, this can be dealt with by using a symbolic link.
-You should not put more than one argument on the `#!' line after the
+ You should not put more than one argument on the `#!' line after the
path to `awk'. It does not work. The operating system treats the rest
of the line as a single argument and passes it to `awk'. Doing this
leads to confusing behavior--most likely a usage diagnostic of some
sort from `awk'.
-Finally, the value of `ARGV[0]' (*note Built-in Variables::) varies
+ Finally, the value of `ARGV[0]' (*note Built-in Variables::) varies
depending upon your operating system. Some systems put `awk' there,
some put the full pathname of `awk' (such as `/bin/awk'), and some put
the name of your script (`advice'). Don't rely on the value of
`ARGV[0]' to provide your script name.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The `#!' mechanism works on Linux systems, systems derived from the
-4.4-Lite Berkeley Software Distribution, and most commercial Unix
+ (1) The `#!' mechanism works on Linux systems, systems derived from
+the 4.4-Lite Berkeley Software Distribution, and most commercial Unix
systems.
-(2) The line beginning with `#!' lists the full file name of an
+ (2) The line beginning with `#!' lists the full file name of an
interpreter to run and an optional initial command-line argument to
pass to that interpreter. The operating system then runs the
interpreter with the given argument and the full argument list of the
@@ -1290,7 +1300,7 @@ options to `awk', or data files, or both.

File: gawk.info, Node: Comments, Next: Quoting, Prev: Executable Scripts, Up: Running gawk
-1.1.6 Comments in `awk' Programs
+1.1.5 Comments in `awk' Programs
--------------------------------
A "comment" is some text that is included in a program for the sake of
@@ -1299,51 +1309,52 @@ Comments can explain what the program does and how it works. Nearly all
programming languages have provisions for comments, as programs are
typically hard to understand without them.
-In the `awk' language, a comment starts with the sharp sign character
-(`#') and continues to the end of the line. The `#' does not have to
-be the first character on the line. The `awk' language ignores the rest
-of a line following a sharp sign. For example, we could have put the
-following into `advice':
+ In the `awk' language, a comment starts with the sharp sign
+character (`#') and continues to the end of the line. The `#' does not
+have to be the first character on the line. The `awk' language ignores
+the rest of a line following a sharp sign. For example, we could have
+put the following into `advice':
# This program prints a nice friendly message. It helps
# keep novice users from being afraid of the computer.
BEGIN { print "Don't Panic!" }
-You can put comment lines into keyboard-composed throwaway `awk'
+ You can put comment lines into keyboard-composed throwaway `awk'
programs, but this usually isn't very useful; the purpose of a comment
is to help you or another person understand the program when reading it
at a later time.
-*Caution:* As mentioned in *Note One-shot::, you can enclose small to
-medium programs in single quotes, in order to keep your shell scripts
-self-contained. When doing so, _don't_ put an apostrophe (i.e., a
-single quote) into a comment (or anywhere else in your program). The
-shell interprets the quote as the closing quote for the entire program.
-As a result, usually the shell prints a message about mismatched
-quotes, and if `awk' actually runs, it will probably print strange
-messages about syntax errors. For example, look at the following:
+ *Caution:* As mentioned in *note One-shot::, you can enclose small
+to medium programs in single quotes, in order to keep your shell
+scripts self-contained. When doing so, _don't_ put an apostrophe
+(i.e., a single quote) into a comment (or anywhere else in your
+program). The shell interprets the quote as the closing quote for the
+entire program. As a result, usually the shell prints a message about
+mismatched quotes, and if `awk' actually runs, it will probably print
+strange messages about syntax errors. For example, look at the
+following:
$ awk '{ print "hello" } # let's be cute'
>
-The shell sees that the first two quotes match, and that a new quoted
-object begins at the end of the command line. It therefore prompts
-with the secondary prompt, waiting for more input. With Unix `awk',
-closing the quoted string produces this result:
+ The shell sees that the first two quotes match, and that a new
+quoted object begins at the end of the command line. It therefore
+prompts with the secondary prompt, waiting for more input. With Unix
+`awk', closing the quoted string produces this result:
$ awk '{ print "hello" } # let's be cute'
> '
error--> awk: can't open file be
error--> source line number 1
-Putting a backslash before the single quote in `let's' wouldn't help,
+ Putting a backslash before the single quote in `let's' wouldn't help,
since backslashes are not special inside single quotes. The next
node describes the shell's quoting rules.

File: gawk.info, Node: Quoting, Prev: Comments, Up: Running gawk
-1.1.7 Shell-Quoting Issues
+1.1.6 Shell-Quoting Issues
--------------------------
For short to medium length `awk' programs, it is most convenient to
@@ -1354,7 +1365,7 @@ writing it as part of a larger shell script:
awk 'PROGRAM TEXT' INPUT-FILE1 INPUT-FILE2 ...
-Once you are working with the shell, it is helpful to have a basic
+ Once you are working with the shell, it is helpful to have a basic
knowledge of shell quoting rules. The following rules apply only to
POSIX-compliant, Bourne-style shells (such as `bash', the GNU
Bourne-Again Shell). If you use `csh', you're on your own.
@@ -1371,7 +1382,7 @@ Bourne-Again Shell). If you use `csh', you're on your own.
quotes. The shell does no interpretation of the quoted text,
passing it on verbatim to the command. It is _impossible_ to
embed a single quote inside single-quoted text. Refer back to
- *Note Comments::, for an example of what happens if you try.
+ *note Comments::, for an example of what happens if you try.
* Double quotes protect most things between the opening and closing
quotes. The shell does at least variable and command substitution
@@ -1383,7 +1394,7 @@ Bourne-Again Shell). If you use `csh', you're on your own.
the characters `$', ``', `\', and `"', all of which must be
preceded by a backslash within double-quoted text if they are to
be passed on literally to the program. (The leading backslash is
- stripped first.) Thus, the example seen in *Note Read Terminal::,
+ stripped first.) Thus, the example seen in *note Read Terminal::,
is applicable:
$ awk "BEGIN { print \"Don't Panic!\" }"
@@ -1407,7 +1418,7 @@ Bourne-Again Shell). If you use `csh', you're on your own.
of the program! This results in syntax errors at best, and
confusing behavior at worst.
-Mixing single and double quotes is difficult. You have to resort to
+ Mixing single and double quotes is difficult. You have to resort to
shell quoting tricks, like this:
$ awk 'BEGIN { print "Here is a single quote <'"'"'>" }'
@@ -1416,14 +1427,14 @@ shell quoting tricks, like this:
This program consists of three concatenated quoted strings. The first
and the third are single-quoted, the second is double-quoted.
-This can be "simplified" to:
+ This can be "simplified" to:
$ awk 'BEGIN { print "Here is a single quote <'\''>" }'
-| Here is a single quote <'>
Judge for yourself which of these two is the more readable.
-Another option is to use double quotes, escaping the embedded,
+ Another option is to use double quotes, escaping the embedded,
`awk'-level double quotes:
$ awk "BEGIN { print \"Here is a single quote <'>\" }"
@@ -1432,8 +1443,8 @@ Another option is to use double quotes, escaping the embedded,
This option is also painful, because double quotes, backslashes, and
dollar signs are very common in `awk' programs.
-A third option is to use the octal escape sequence equivalents for the
-single- and double-quote characters, like so:
+ A third option is to use the octal escape sequence equivalents for
+the single- and double-quote characters, like so:
$ awk 'BEGIN { print "Here is a single quote <\47>" }'
-| Here is a single quote <'>
@@ -1443,14 +1454,15 @@ single- and double-quote characters, like so:
This works nicely, except that you should comment clearly what the
escapes mean.
-A fourth option is to use command-line variable assignment, like this:
+ A fourth option is to use command-line variable assignment, like
+this:
$ awk -v sq="'" 'BEGIN { print "Here is a single quote <" sq ">" }'
-| Here is a single quote <'>
-If you really need both single and double quotes in your `awk' program,
-it is probably best to move it into a separate file, where the shell
-won't be part of the picture, and you can say what you mean.
+ If you really need both single and double quotes in your `awk'
+program, it is probably best to move it into a separate file, where the
+shell won't be part of the picture, and you can say what you mean.

File: gawk.info, Node: Sample Data Files, Next: Very Simple, Prev: Running gawk, Up: Getting Started
@@ -1465,12 +1477,12 @@ The second data file, called `inventory-shipped', contains information
about monthly shipments. In both files, each line is considered to be
one "record".
-In the data file `BBS-list', each record contains the name of a computer
-bulletin board, its phone number, the board's baud rate(s), and a code
-for the number of hours it is operational. An `A' in the last column
-means the board operates 24 hours a day. A `B' in the last column
-means the board only operates on evening and weekend hours. A `C'
-means the board operates only on weekends:
+ In the data file `BBS-list', each record contains the name of a
+computer bulletin board, its phone number, the board's baud rate(s),
+and a code for the number of hours it is operational. An `A' in the
+last column means the board operates 24 hours a day. A `B' in the last
+column means the board only operates on evening and weekend hours. A
+`C' means the board operates only on weekends:
aardvark 555-5553 1200/300 B
alpo-net 555-3412 2400/1200/300 A
@@ -1484,7 +1496,7 @@ means the board operates only on weekends:
sdace 555-3430 2400/1200/300 A
sabafoo 555-2127 1200/300 C
-The data file `inventory-shipped' represents information about
+ The data file `inventory-shipped' represents information about
shipments during the year. Each record contains the month, the number
of green crates shipped, the number of red boxes shipped, the number of
orange bags shipped, and the number of blue packages shipped,
@@ -1509,7 +1521,7 @@ and the first four months of the current year.
Mar 24 75 70 495
Apr 21 70 74 514
-If you are reading this in GNU Emacs using Info, you can copy the
+ If you are reading this in GNU Emacs using Info, you can copy the
regions of text showing these sample files into your own test files.
This way you can try out the examples shown in the remainder of this
document. You do this by using the command `M-x write-region' to copy
@@ -1518,7 +1530,7 @@ Miscellaneous File Operations: (emacs)Misc File Ops, for more
information). Using this information, create your own `BBS-list' and
`inventory-shipped' files and practice what you learn in this Info file.
-If you are using the stand-alone version of Info, see *Note Extract
+ If you are using the stand-alone version of Info, see *note Extract
Program::, for an `awk' program that extracts these data files from
`gawk.texi', the Texinfo source file for this Info file.
@@ -1540,7 +1552,7 @@ When lines containing `foo' are found, they are printed because
`print $0' means print the current line. (Just `print' by itself means
the same thing, so we could have written that instead.)
-You will notice that slashes (`/') surround the string `foo' in the
+ You will notice that slashes (`/') surround the string `foo' in the
`awk' program. The slashes indicate that `foo' is the pattern to
search for. This type of pattern is called a "regular expression",
which is covered in more detail later (*note Regexp::). The pattern is
@@ -1548,7 +1560,7 @@ allowed to match parts of words. There are single quotes around the
`awk' program so that the shell won't interpret any of it as special
shell characters.
-Here is what this program prints:
+ Here is what this program prints:
$ awk '/foo/ { print $0 }' BBS-list
-| fooey 555-1234 2400/1200/300 B
@@ -1556,18 +1568,18 @@ Here is what this program prints:
-| macfoo 555-6480 1200/300 A
-| sabafoo 555-2127 1200/300 C
-In an `awk' rule, either the pattern or the action can be omitted, but
-not both. If the pattern is omitted, then the action is performed for
-_every_ input line. If the action is omitted, the default action is to
-print all lines that match the pattern.
+ In an `awk' rule, either the pattern or the action can be omitted,
+but not both. If the pattern is omitted, then the action is performed
+for _every_ input line. If the action is omitted, the default action
+is to print all lines that match the pattern.
-Thus, we could leave out the action (the `print' statement and the curly
-braces) in the previous example and the result would be the same: all
-lines matching the pattern `foo' are printed. By comparison, omitting
-the `print' statement but retaining the curly braces makes an empty
-action that does nothing (i.e., no lines are printed).
+ Thus, we could leave out the action (the `print' statement and the
+curly braces) in the previous example and the result would be the same:
+all lines matching the pattern `foo' are printed. By comparison,
+omitting the `print' statement but retaining the curly braces makes an
+empty action that does nothing (i.e., no lines are printed).
-Many practical `awk' programs are just a line or two. Following is a
+ Many practical `awk' programs are just a line or two. Following is a
collection of useful, short programs to get you started. Some of these
programs contain constructs that haven't been covered yet. (The
description of the program will give you a good idea of what is going
@@ -1650,11 +1662,11 @@ patterns match, then several actions are run in the order in which they
appear in the `awk' program. If no patterns match, then no actions are
run.
-After processing all the rules that match the line (and perhaps there
-are none), `awk' reads the next line. (However, *note Next Statement::,
-and also *note Nextfile Statement::). This continues until the program
-reaches the end of the file. For example, the following `awk' program
-contains two rules:
+ After processing all the rules that match the line (and perhaps
+there are none), `awk' reads the next line. (However, *note Next
+Statement::, and also *note Nextfile Statement::). This continues
+until the program reaches the end of the file. For example, the
+following `awk' program contains two rules:
/12/ { print $0 }
/21/ { print $0 }
@@ -1664,11 +1676,11 @@ action. The second rule has the string `21' as the pattern and also
has `print $0' as the action. Each rule's action is enclosed in its
own pair of braces.
-This program prints every line that contains the string `12' _or_ the
-string `21'. If a line contains both strings, it is printed twice,
+ This program prints every line that contains the string `12' _or_
+the string `21'. If a line contains both strings, it is printed twice,
once by each rule.
-This is what happens if we run this program on our two sample data
+ This is what happens if we run this program on our two sample data
files, `BBS-list' and `inventory-shipped':
$ awk '/12/ { print $0 }
@@ -1705,7 +1717,7 @@ understand all the details:
ls -l | awk '$6 == "Nov" { sum += $5 }
END { print sum }'
-This command prints the total number of bytes in all the files in the
+ This command prints the total number of bytes in all the files in the
current directory that were last modified in November (of any year).
(1) The `ls -l' part of this example is a system command that gives you
a listing of the files in a directory, including each file's size and
@@ -1728,7 +1740,7 @@ The sixth, seventh, and eighth fields contain the month, day, and time,
respectively, that the file was last modified. Finally, the ninth field
contains the name of the file.(2)
-The `$6 == "Nov"' in our `awk' program is an expression that tests
+ The `$6 == "Nov"' in our `awk' program is an expression that tests
whether the sixth field of the output from `ls -l' matches the string
`Nov'. Each time a line has the string `Nov' for its sixth field, the
action `sum += $5' is performed. This adds the fifth field (the file's
@@ -1737,29 +1749,29 @@ reading all the input lines, `sum' is the total of the sizes of the
files whose lines matched the pattern. (This works because `awk'
variables are automatically initialized to zero.)
-After the last line of output from `ls' has been processed, the `END'
-rule executes and prints the value of `sum'. In this example, the
-value of `sum' is 80600.
+ After the last line of output from `ls' has been processed, the
+`END' rule executes and prints the value of `sum'. In this example,
+the value of `sum' is 80600.
-These more advanced `awk' techniques are covered in later sections
+ These more advanced `awk' techniques are covered in later sections
(*note Action Overview::). Before you can move on to more advanced
`awk' programming, you have to know how `awk' interprets your input and
displays your output. By manipulating fields and using `print'
statements, you can produce some very useful and impressive-looking
reports.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) In the C shell (`csh'), you need to type a semicolon and then a
-backslash at the end of the first line; see *Note Statements/Lines::,
+ (1) In the C shell (`csh'), you need to type a semicolon and then a
+backslash at the end of the first line; see *note Statements/Lines::,
for an explanation. In a POSIX-compliant shell, such as the Bourne
shell or `bash', you can type the example as shown. If the command
`echo $path' produces an empty output line, you are most likely using a
POSIX-compliant shell. Otherwise, you are probably using the C shell
or a shell derived from it.
-(2) On some very old systems, you may need to use `ls -lg' to get this
-output.
+ (2) On some very old systems, you may need to use `ls -lg' to get
+this output.

File: gawk.info, Node: Statements/Lines, Next: Other Features, Prev: More Complex, Up: Getting Started
@@ -1773,19 +1785,20 @@ separate rule, like this:
awk '/12/ { print $0 }
/21/ { print $0 }' BBS-list inventory-shipped
-However, `gawk' ignores newlines after any of the following symbols and
-keywords:
+ However, `gawk' ignores newlines after any of the following symbols
+and keywords:
, { ? : || && do else
A newline at any other point is considered the end of the statement.(1)
-If you would like to split a single statement into two lines at a point
-where a newline would terminate it, you can "continue" it by ending the
-first line with a backslash character (`\'). The backslash must be the
-final character on the line in order to be recognized as a continuation
-character. A backslash is allowed anywhere in the statement, even in
-the middle of a string or regular expression. For example:
+ If you would like to split a single statement into two lines at a
+point where a newline would terminate it, you can "continue" it by
+ending the first line with a backslash character (`\'). The backslash
+must be the final character on the line in order to be recognized as a
+continuation character. A backslash is allowed anywhere in the
+statement, even in the middle of a string or regular expression. For
+example:
awk '/This regular expression is too long, so continue it\
on the next line/ { print $1 }'
@@ -1804,8 +1817,8 @@ constant using backslash continuation. Thus, for maximum portability
of your `awk' programs, it is best not to split your lines in the
middle of a regular expression or a string.
-*Caution:* _Backslash continuation does not work as described with the
-C shell._ It works for `awk' programs in files and for one-shot
+ *Caution:* _Backslash continuation does not work as described with
+the C shell._ It works for `awk' programs in files and for one-shot
programs, _provided_ you are using a POSIX-compliant shell, such as the
Unix Bourne shell or `bash'. But the C shell behaves differently!
There, you must use two backslashes in a row, followed by a newline.
@@ -1821,8 +1834,8 @@ program must be escaped with a backslash. To illustrate:
Here, the `%' and `?' are the C shell's primary and secondary prompts,
analogous to the standard shell's `$' and `>'.
-Compare the previous example to how it is done with a POSIX-compliant
-shell:
+ Compare the previous example to how it is done with a
+POSIX-compliant shell:
$ awk 'BEGIN {
> print \
@@ -1830,12 +1843,12 @@ shell:
> }'
-| hello, world
-`awk' is a line-oriented language. Each rule's action has to begin on
-the same line as the pattern. To have the pattern and action on
+ `awk' is a line-oriented language. Each rule's action has to begin
+on the same line as the pattern. To have the pattern and action on
separate lines, you _must_ use backslash continuation; there is no
other option.
-Another thing to keep in mind is that backslash continuation and
+ Another thing to keep in mind is that backslash continuation and
comments do not mix. As soon as `awk' sees the `#' that starts a
comment, it ignores _everything_ on the rest of the line. For example:
@@ -1850,11 +1863,11 @@ onto the next line. However, the backslash-newline combination is never
even noticed because it is "hidden" inside the comment. Thus, the
`BEGIN' is noted as a syntax error.
-When `awk' statements within one rule are short, you might want to put
-more than one of them on a line. This is accomplished by separating
-the statements with a semicolon (`;'). This also applies to the rules
-themselves. Thus, the program shown at the start of this minor node
-could also be written this way:
+ When `awk' statements within one rule are short, you might want to
+put more than one of them on a line. This is accomplished by
+separating the statements with a semicolon (`;'). This also applies to
+the rules themselves. Thus, the program shown at the start of this
+minor node could also be written this way:
/12/ { print $0 } ; /21/ { print $0 }
@@ -1863,12 +1876,12 @@ could also be written this way:
language; it was added for consistency with the treatment of
statements within an action.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The `?' and `:' referred to here is the three-operand conditional
-expression described in *Note Conditional Exp::. Splitting lines after
-`?' and `:' is a minor `gawk' extension; if `--posix' is specified
-(*note Options::), then this extension is disabled.
+ (1) The `?' and `:' referred to here is the three-operand
+conditional expression described in *note Conditional Exp::. Splitting
+lines after `?' and `:' is a minor `gawk' extension; if `--posix' is
+specified (*note Options::), then this extension is disabled.

File: gawk.info, Node: Other Features, Next: When, Prev: Statements/Lines, Up: Getting Started
@@ -1881,14 +1894,14 @@ variables that your programs can use to get information from `awk'.
There are other variables your program can set as well to control how
`awk' processes your data.
-In addition, `awk' provides a number of built-in functions for doing
+ In addition, `awk' provides a number of built-in functions for doing
common computational and string-related operations. `gawk' provides
built-in functions for working with timestamps, performing bit
manipulation, and for runtime string translation.
-As we develop our presentation of the `awk' language, we introduce most
-of the variables and many of the functions. They are defined
-systematically in *Note Built-in Variables::, and *Note Built-in::.
+ As we develop our presentation of the `awk' language, we introduce
+most of the variables and many of the functions. They are defined
+systematically in *note Built-in Variables::, and *note Built-in::.

File: gawk.info, Node: When, Prev: Other Features, Up: Getting Started
@@ -1904,14 +1917,14 @@ is very useful for producing reports from large amounts of raw data,
such as summarizing information from the output of other utility
programs like `ls'. (*Note More Complex::.)
-Programs written with `awk' are usually much smaller than they would be
-in other languages. This makes `awk' programs easy to compose and use.
-Often, `awk' programs can be quickly composed at your terminal, used
-once, and thrown away. Because `awk' programs are interpreted, you can
-avoid the (usually lengthy) compilation part of the typical
+ Programs written with `awk' are usually much smaller than they would
+be in other languages. This makes `awk' programs easy to compose and
+use. Often, `awk' programs can be quickly composed at your terminal,
+used once, and thrown away. Because `awk' programs are interpreted, you
+can avoid the (usually lengthy) compilation part of the typical
edit-compile-test-debug cycle of software development.
-Complex programs have been written in `awk', including a complete
+ Complex programs have been written in `awk', including a complete
retargetable assembler for eight-bit microprocessors (*note Glossary::,
for more information), and a microcode assembler for a special-purpose
Prolog computer. More recently, `gawk' was used for writing a Wiki
@@ -1920,7 +1933,7 @@ of such complexity, modern versions are more capable. Even the Bell
Labs version of `awk' has fewer predefined limits, and those that it
has are much larger than they used to be.
-If you find yourself writing `awk' scripts of more than, say, a few
+ If you find yourself writing `awk' scripts of more than, say, a few
hundred lines, you might consider using a different programming
language. Emacs Lisp is a good choice if you need sophisticated string
or pattern matching capabilities. The shell is also good at string and
@@ -1931,10 +1944,10 @@ of large programs. Programs in these languages may require more lines
of source code than the equivalent `awk' programs, but they are easier
to maintain and usually run more efficiently.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Yet Another Wiki Clone
-(http://www.awk-scripting.de/cgi/wiki.cgi/yawk/).
+ (1) Yet Another Wiki Clone
+(http://www.awk-scripting.de/cgi-bin/wiki.cgi/yawk/).

File: gawk.info, Node: Regexp, Next: Reading Files, Prev: Getting Started, Up: Top
@@ -1946,8 +1959,8 @@ A "regular expression", or "regexp", is a way of describing a set of
strings. Because regular expressions are such a fundamental part of
`awk' programming, their format and use deserve a separate major node.
-A regular expression enclosed in slashes (`/') is an `awk' pattern that
-matches every input record whose text belongs to that set. The
+ A regular expression enclosed in slashes (`/') is an `awk' pattern
+that matches every input record whose text belongs to that set. The
simplest regular expression is a sequence of letters, numbers, or both.
Such a regexp matches any string that contains that sequence. Thus,
the regexp `foo' matches any string containing `foo'. Therefore, the
@@ -1986,7 +1999,7 @@ it:
-| 555-6480
-| 555-2127
-`~' (tilde), `~' operator Regular expressions can also be used in
+ `~' (tilde), `~' operator Regular expressions can also be used in
matching expressions. These expressions allow you to specify the
string to match against; it need not be the entire current input
record. The two operators `~' and `!~' perform regular expression
@@ -2006,16 +2019,16 @@ uppercase letter `J' somewhere in the first field:
-| Jul 24 34 67 436
-| Jan 21 36 64 620
-So does this:
+ So does this:
awk '{ if ($1 ~ /J/) print }' inventory-shipped
-This next example is true if the expression EXP (taken as a character
-string) does _not_ match REGEXP:
+ This next example is true if the expression EXP (taken as a
+character string) does _not_ match REGEXP:
EXP !~ /REGEXP/
-The following example matches, or selects, all input records whose
+ The following example matches, or selects, all input records whose
first field _does not_ contain the uppercase letter `J':
$ awk '$1 !~ /J/' inventory-shipped
@@ -2025,7 +2038,7 @@ first field _does not_ contain the uppercase letter `J':
-| May 16 34 29 208
...
-When a regexp is enclosed in slashes, such as `/foo/', we call it a
+ When a regexp is enclosed in slashes, such as `/foo/', we call it a
"regexp constant", much like `5.27' is a numeric constant and `"foo"'
is a string constant.
@@ -2046,17 +2059,17 @@ double-quote character as a part of the string. For example:
$ awk 'BEGIN { print "He said \"hi!\" to her." }'
-| He said "hi!" to her.
-The backslash character itself is another character that cannot be
+ The backslash character itself is another character that cannot be
included normally; you must write `\\' to put one backslash in the
string or regexp. Thus, the string whose contents are the two
characters `"' and `\' must be written `"\"\\"'.
-Backslash also represents unprintable characters such as TAB or
+ Backslash also represents unprintable characters such as TAB or
newline. While there is nothing to stop you from entering most
unprintable characters directly in a string constant or regexp constant,
they may look ugly.
-The following table lists all the escape sequences used in `awk' and
+ The following table lists all the escape sequences used in `awk' and
what they represent. Unless noted otherwise, all these escape sequences
apply to both string constants and regexp constants:
@@ -2113,27 +2126,27 @@ apply to both string constants and regexp constants:
string, in order to tell `awk' to keep processing the rest of the
string.
-In `gawk', a number of additional two-character sequences that begin
+ In `gawk', a number of additional two-character sequences that begin
with a backslash have special meaning in regexps. *Note GNU Regexp
Operators::.
-In a regexp, a backslash before any character that is not in the
-previous list and not listed in *Note GNU Regexp Operators::, means
+ In a regexp, a backslash before any character that is not in the
+previous list and not listed in *note GNU Regexp Operators::, means
that the next character should be taken literally, even if it would
normally be a regexp operator. For example, `/a\+b/' matches the three
characters `a+b'.
-For complete portability, do not use a backslash before any character
-not shown in the previous list.
+ For complete portability, do not use a backslash before any
+character not shown in the previous list.
-To summarize:
+ To summarize:
* The escape sequences in the table above are always processed first,
for both string constants and regexp constants. This happens very
early, as soon as `awk' reads your program.
* `gawk' processes both regexp constants and dynamic regexps (*note
- Computed Regexps::), for the special operators listed in *Note GNU
+ Computed Regexps::), for the special operators listed in *note GNU
Regexp Operators::.
* A backslash before any other character means to treat that
@@ -2162,12 +2175,12 @@ Advanced Notes: Escape Sequences for Metacharacters
---------------------------------------------------
Suppose you use an octal or hexadecimal escape to represent a regexp
-metacharacter. (See *Note Regexp Operators::.) Does `awk' treat the
+metacharacter. (See *note Regexp Operators::.) Does `awk' treat the
character as a literal character or as a regexp operator?
-Historically, such characters were taken literally. (d.c.) However,
-the POSIX standard indicates that they should be treated as real
-metacharacters, which is what `gawk' does. In compatibility mode
+ Historically, such characters were taken literally. (d.c.)
+However, the POSIX standard indicates that they should be treated as
+real metacharacters, which is what `gawk' does. In compatibility mode
(*note Options::), `gawk' treats the characters represented by octal
and hexadecimal escape sequences literally when used in regexp
constants. Thus, `/a\52b/' is equivalent to `/a\*b/'.
@@ -2182,12 +2195,12 @@ You can combine regular expressions with special characters, called
"regular expression operators" or "metacharacters", to increase the
power and versatility of regular expressions.
-The escape sequences described in *Note Escape Sequences::, are valid
-inside a regexp. They are introduced by a `\' and are recognized and
-converted into corresponding real characters as the very first step in
-processing regexps.
+ The escape sequences described in *note Escape Sequences::, are
+valid inside a regexp. They are introduced by a `\' and are recognized
+and converted into corresponding real characters as the very first step
+in processing regexps.
-Here is a list of metacharacters. All characters that are not escape
+ Here is a list of metacharacters. All characters that are not escape
sequences and that are not listed in the table stand for themselves:
`\'
@@ -2232,7 +2245,7 @@ sequences and that are not listed in the table stand for themselves:
characters that are enclosed in the square brackets. For example,
`[MVX]' matches any one of the characters `M', `V', or `X' in a
string. A full discussion of what can be inside the square
- brackets of a character list is given in *Note Character Lists::.
+ brackets of a character list is given in *note Character Lists::.
`[^ ...]'
This is a "complemented character list". The first character after
@@ -2321,28 +2334,28 @@ sequences and that are not listed in the table stand for themselves:
regexp constants are valid and work the way you want them to, using
any version of `awk'.(2)
-In regular expressions, the `*', `+', and `?' operators, as well as the
-braces `{' and `}', have the highest precedence, followed by
+ In regular expressions, the `*', `+', and `?' operators, as well as
+the braces `{' and `}', have the highest precedence, followed by
concatenation, and finally by `|'. As in arithmetic, parentheses can
change how operators are grouped.
-In POSIX `awk' and `gawk', the `*', `+', and `?' operators stand for
+ In POSIX `awk' and `gawk', the `*', `+', and `?' operators stand for
themselves when there is nothing in the regexp that precedes them. For
example, `/+/' matches a literal plus sign. However, many other
versions of `awk' treat such a usage as a syntax error.
-If `gawk' is in compatibility mode (*note Options::), POSIX character
-classes and interval expressions are not available in regular
+ If `gawk' is in compatibility mode (*note Options::), POSIX
+character classes and interval expressions are not available in regular
expressions.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) In other literature, you may see a character list referred to as
+ (1) In other literature, you may see a character list referred to as
either a "character set", a "character class", or a "bracket
expression".
-(2) Use two backslashes if you're using a string constant with a regexp
-operator or function.
+ (2) Use two backslashes if you're using a string constant with a
+regexp operator or function.

File: gawk.info, Node: Character Lists, Next: GNU Regexp Operators, Prev: Regexp Operators, Up: Regexp
@@ -2361,61 +2374,49 @@ example. To obtain the traditional interpretation of bracket
expressions, you can use the C locale by setting the `LC_ALL'
environment variable to the value `C'.
-To include one of the characters `\', `]', `-', or `^' in a character
-list, put a `\' in front of it. For example:
+ To include one of the characters `\', `]', `-', or `^' in a
+character list, put a `\' in front of it. For example:
[d\]]
matches either `d' or `]'.
-This treatment of `\' in character lists is compatible with other `awk'
-implementations and is also mandated by POSIX. The regular expressions
-in `awk' are a superset of the POSIX specification for Extended Regular
-Expressions (EREs). POSIX EREs are based on the regular expressions
-accepted by the traditional `egrep' utility.
+ This treatment of `\' in character lists is compatible with other
+`awk' implementations and is also mandated by POSIX. The regular
+expressions in `awk' are a superset of the POSIX specification for
+Extended Regular Expressions (EREs). POSIX EREs are based on the
+regular expressions accepted by the traditional `egrep' utility.
-"Character classes" are a new feature introduced in the POSIX standard.
-A character class is a special notation for describing lists of
-characters that have a specific attribute, but the actual characters
+ "Character classes" are a new feature introduced in the POSIX
+standard. A character class is a special notation for describing lists
+of characters that have a specific attribute, but the actual characters
can vary from country to country and/or from character set to character
set. For example, the notion of what is an alphabetic character
differs between the United States and France.
-A character class is only valid in a regexp _inside_ the brackets of a
-character list. Character classes consist of `[:', a keyword denoting
-the class, and `:]'. *Note table-char-classes:: lists the character
-classes defined by the POSIX standard.
+ A character class is only valid in a regexp _inside_ the brackets of
+a character list. Character classes consist of `[:', a keyword
+denoting the class, and `:]'. *note table-char-classes:: lists the
+character classes defined by the POSIX standard.
Class Meaning
---------------------------------------------------------------------------
+--------------------------------------------------------------------------
`[:alnum:]' Alphanumeric characters.
---------------------------------------------------------------------------
`[:alpha:]' Alphabetic characters.
---------------------------------------------------------------------------
`[:blank:]' Space and TAB characters.
---------------------------------------------------------------------------
`[:cntrl:]' Control characters.
---------------------------------------------------------------------------
`[:digit:]' Numeric characters.
---------------------------------------------------------------------------
`[:graph:]' Characters that are both printable and visible. (A space is
printable but not visible, whereas an `a' is both.)
---------------------------------------------------------------------------
`[:lower:]' Lowercase alphabetic characters.
---------------------------------------------------------------------------
`[:print:]' Printable characters (characters that are not control
characters).
---------------------------------------------------------------------------
`[:punct:]' Punctuation characters (characters that are not letters,
digits, control characters, or space characters).
---------------------------------------------------------------------------
`[:space:]' Space characters (such as space, TAB, and formfeed, to name
a few).
---------------------------------------------------------------------------
`[:upper:]' Uppercase alphabetic characters.
---------------------------------------------------------------------------
`[:xdigit:]'Characters that are hexadecimal digits.
---------------------------------------------------------------------------
Table 2.1: POSIX Character Classes
@@ -2519,7 +2520,7 @@ GNU `\b' appears to be the lesser of two evils.
No options
In the default case, `gawk' provides all the facilities of POSIX
- regexps and the GNU regexp operators described in *Note Regexp
+ regexps and the GNU regexp operators described in *note Regexp
Operators::. However, interval expressions are not supported.
`--posix'
@@ -2532,7 +2533,8 @@ No options
not special, interval expressions are not available, nor are the
POSIX character classes (`[[:alnum:]]', etc.). Characters
described by octal and hexadecimal escape sequences are treated
- literally, even if they represent regexp metacharacters.
+ literally, even if they represent regexp metacharacters. Also,
+ `gawk' silently skips directories named on the command line.
`--re-interval'
Allow interval expressions in regexps, even if `--traditional' has
@@ -2566,12 +2568,13 @@ discussed yet; *note String Functions::). For example:
converts the first field to lowercase before matching against it. This
works in any POSIX-compliant `awk'.
-Another method, specific to `gawk', is to set the variable `IGNORECASE'
-to a nonzero value (*note Built-in Variables::). When `IGNORECASE' is
-not zero, _all_ regexp and string operations ignore case. Changing the
-value of `IGNORECASE' dynamically controls the case-sensitivity of the
-program as it runs. Case is significant by default because
-`IGNORECASE' (like most variables) is initialized to zero:
+ Another method, specific to `gawk', is to set the variable
+`IGNORECASE' to a nonzero value (*note Built-in Variables::). When
+`IGNORECASE' is not zero, _all_ regexp and string operations ignore
+case. Changing the value of `IGNORECASE' dynamically controls the
+case-sensitivity of the program as it runs. Case is significant by
+default because `IGNORECASE' (like most variables) is initialized to
+zero:
x = "aB"
if (x ~ /ab/) ... # this test will fail
@@ -2579,40 +2582,40 @@ program as it runs. Case is significant by default because
IGNORECASE = 1
if (x ~ /ab/) ... # now it will succeed
-In general, you cannot use `IGNORECASE' to make certain rules
+ In general, you cannot use `IGNORECASE' to make certain rules
case-insensitive and other rules case-sensitive, because there is no
straightforward way to set `IGNORECASE' just for the pattern of a
particular rule.(1) To do this, use either character lists or
`tolower'. However, one thing you can do with `IGNORECASE' only is
dynamically turn case-sensitivity on or off for all the rules at once.
-`IGNORECASE' can be set on the command line or in a `BEGIN' rule (*note
-Other Arguments::; also *note Using BEGIN/END::). Setting `IGNORECASE'
-from the command line is a way to make a program case-insensitive
-without having to edit it.
+ `IGNORECASE' can be set on the command line or in a `BEGIN' rule
+(*note Other Arguments::; also *note Using BEGIN/END::). Setting
+`IGNORECASE' from the command line is a way to make a program
+case-insensitive without having to edit it.
-Prior to `gawk' 3.0, the value of `IGNORECASE' affected regexp
+ Prior to `gawk' 3.0, the value of `IGNORECASE' affected regexp
operations only. It did not affect string comparison with `==', `!=',
and so on. Beginning with version 3.0, both regexp and string
comparison operations are also affected by `IGNORECASE'.
-Beginning with `gawk' 3.0, the equivalences between upper- and
+ Beginning with `gawk' 3.0, the equivalences between upper- and
lowercase characters are based on the ISO-8859-1 (ISO Latin-1)
character set. This character set is a superset of the traditional 128
ASCII characters, which also provides a number of characters suitable
for use with European languages.
-As of `gawk' 3.1.4, the case equivalencies are fully locale-aware.
+ As of `gawk' 3.1.4, the case equivalences are fully locale-aware.
They are based on the C `<ctype.h>' facilities, such as `isalpha()' and
`toupper()'.
-The value of `IGNORECASE' has no effect if `gawk' is in compatibility
-mode (*note Options::). Case is always significant in compatibility
-mode.
+ The value of `IGNORECASE' has no effect if `gawk' is in
+compatibility mode (*note Options::). Case is always significant in
+compatibility mode.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Experienced C and C++ programmers will note that it is possible,
+ (1) Experienced C and C++ programmers will note that it is possible,
using something like `IGNORECASE = 1 && /foObAr/ { ... }' and
`IGNORECASE = 0 || /foobar/ { ... }'. However, this is somewhat
obscure and we don't recommend it.
@@ -2627,12 +2630,12 @@ Consider the following:
echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }'
-This example uses the `sub' function (which we haven't discussed yet;
+ This example uses the `sub' function (which we haven't discussed yet;
*note String Functions::) to make a change to the input record. Here,
the regexp `/a+/' indicates "one or more `a' characters," and the
replacement text is `<A>'.
-The input contains four `a' characters. `awk' (and POSIX) regular
+ The input contains four `a' characters. `awk' (and POSIX) regular
expressions always match the leftmost, _longest_ sequence of input
characters that can match. Thus, all four `a' characters are replaced
with `<A>' in this example:
@@ -2640,7 +2643,7 @@ with `<A>' in this example:
$ echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }'
-| <A>bcd
-For simple match/no-match tests, this is not so important. But when
+ For simple match/no-match tests, this is not so important. But when
doing text matching and substitutions with the `match', `sub', `gsub',
and `gensub' functions, it is very important. *Note String Functions::,
for more information on these functions. Understanding this principle
@@ -2665,26 +2668,27 @@ that is computed in this way is called a "dynamic regexp":
This sets `digits_regexp' to a regexp that describes one or more digits,
and tests whether the input record matches this regexp.
-*Caution:* When using the `~' and `!~' operators, there is a difference
-between a regexp constant enclosed in slashes and a string constant
-enclosed in double quotes. If you are going to use a string constant,
-you have to understand that the string is, in essence, scanned _twice_:
-the first time when `awk' reads your program, and the second time when
-it goes to match the string on the lefthand side of the operator with
-the pattern on the right. This is true of any string-valued expression
-(such as `digits_regexp', shown previously), not just string constants.
-
-What difference does it make if the string is scanned twice? The answer
-has to do with escape sequences, and particularly with backslashes. To
-get a backslash into a regular expression inside a string, you have to
-type two backslashes.
-
-For example, `/\*/' is a regexp constant for a literal `*'. Only one
-backslash is needed. To do the same thing with a string, you have to
-type `"\\*"'. The first backslash escapes the second one so that the
-string actually contains the two characters `\' and `*'.
-
-Given that you can use both regexp and string constants to describe
+ *Caution:* When using the `~' and `!~' operators, there is a
+difference between a regexp constant enclosed in slashes and a string
+constant enclosed in double quotes. If you are going to use a string
+constant, you have to understand that the string is, in essence,
+scanned _twice_: the first time when `awk' reads your program, and the
+second time when it goes to match the string on the lefthand side of
+the operator with the pattern on the right. This is true of any
+string-valued expression (such as `digits_regexp', shown previously),
+not just string constants.
+
+ What difference does it make if the string is scanned twice? The
+answer has to do with escape sequences, and particularly with
+backslashes. To get a backslash into a regular expression inside a
+string, you have to type two backslashes.
+
+ For example, `/\*/' is a regexp constant for a literal `*'. Only
+one backslash is needed. To do the same thing with a string, you have
+to type `"\\*"'. The first backslash escapes the second one so that
+the string actually contains the two characters `\' and `*'.
+
+ Given that you can use both regexp and string constants to describe
regular expressions, which should you use? The answer is "regexp
constants," for several reasons:
@@ -2715,15 +2719,15 @@ be used inside a character list for a dynamic regexp:
error--> context is
error--> >>> <<<
-But a newline in a regexp constant works with no problem:
+ But a newline in a regexp constant works with no problem:
$ awk '$0 ~ /[ \t\n]/'
here is a sample line
-| here is a sample line
Ctrl-d
-`gawk' does not have this problem, and it isn't likely to occur often
-in practice, but it's worth noting for future reference.
+ `gawk' does not have this problem, and it isn't likely to occur
+often in practice, but it's worth noting for future reference.

File: gawk.info, Node: Locales, Prev: Computed Regexps, Up: Regexp
@@ -2737,7 +2741,7 @@ setting can affect the way regexp matching works, often in surprising
ways. In particular, many locales do case-insensitive matching, even
when you may have specified characters of only one particular case.
-The following example uses the `sub' function, which does text
+ The following example uses the `sub' function, which does text
replacement (*note String Functions::). Here, the intent is to remove
trailing uppercase characters:
@@ -2748,28 +2752,33 @@ This output is unexpected, since the `abc' at the end of
`something1234abc' should not normally match `[A-Z]*'. This result is
due to the locale setting (and thus you may not see it on your system).
There are two fixes. The first is to use the POSIX character class
-`[[:upper:]]', instead of `[A-Z]'. The second is to change the locale
+`[[:upper:]]', instead of `[A-Z]'. (This is preferred, since then your
+program will work everywhere.) The second is to change the locale
setting in the environment, before running `gawk', by using the shell
statements:
LANG=C LC_ALL=C
export LANG LC_ALL
-The setting `C' forces `gawk' to behave in the traditional Unix manner,
-where case distinctions do matter. You may wish to put these
+ The setting `C' forces `gawk' to behave in the traditional Unix
+manner, where case distinctions do matter. You may wish to put these
statements into your shell startup file, e.g., `$HOME/.profile'.
-Similar considerations apply to other ranges. For example, `["-/]' is
-perfectly valid in ASCII, but is not valid in many Unicode locales,
+ Similar considerations apply to other ranges. For example, `["-/]'
+is perfectly valid in ASCII, but is not valid in many Unicode locales,
such as `en_US.UTF-8'. (In general, such ranges should be avoided;
either list the characters individually, or use a POSIX character class
such as `[[:punct:]]'.)
-For the normal case of `RS = "\n"', the locale is largely irrelevant.
-For other single byte record separators, using `LC_ALL=C' will give you
-much better performance when reading records. Otherwise, `gawk' has to
-make several function calls, _per input character_ to find the record
-terminator.
+ For the normal case of `RS = "\n"', the locale is largely irrelevant.
+For other single-character record separators, using `LC_ALL=C' will
+give you much better performance when reading records. Otherwise,
+`gawk' has to make several function calls, _per input character_ to
+find the record terminator.
+
+ Finally, the locale affects the value of the decimal point character
+used when `gawk' parses input data. This is discussed in detail in
+*note Conversion::.

File: gawk.info, Node: Reading Files, Next: Printing, Prev: Regexp, Up: Top
@@ -2785,13 +2794,13 @@ order, processing all the data from one before going on to the next.
The name of the current input file can be found in the built-in variable
`FILENAME' (*note Built-in Variables::).
-The input is read in units called "records", and is processed by the
+ The input is read in units called "records", and is processed by the
rules of your program one record at a time. By default, each record is
one line. Each record is automatically split into chunks called
"fields". This makes it more convenient for programs to work on the
parts of a record.
-On rare occasions, you may need to use the `getline' command. The
+ On rare occasions, you may need to use the `getline' command. The
`getline' command is valuable, both because it can do explicit input
from any number of files, and because the files used with it do not
have to be named on the `awk' command line (*note Getline::).
@@ -2822,19 +2831,20 @@ started. Another built-in variable, `NR', is the total number of input
records read so far from all data files. It starts at zero, but is
never automatically reset to zero.
-Records are separated by a character called the "record separator". By
-default, the record separator is the newline character. This is why
+ Records are separated by a character called the "record separator".
+By default, the record separator is the newline character. This is why
records are, by default, single lines. A different character can be
used for the record separator by assigning the character to the
built-in variable `RS'.
-Like any other variable, the value of `RS' can be changed in the `awk'
-program with the assignment operator, `=' (*note Assignment Ops::).
-The new record-separator character should be enclosed in quotation
-marks, which indicate a string constant. Often the right time to do
-this is at the beginning of execution, before any input is processed,
-so that the very first record is read with the proper separator. To do
-this, use the special `BEGIN' pattern (*note BEGIN/END::). For example:
+ Like any other variable, the value of `RS' can be changed in the
+`awk' program with the assignment operator, `=' (*note Assignment
+Ops::). The new record-separator character should be enclosed in
+quotation marks, which indicate a string constant. Often the right
+time to do this is at the beginning of execution, before any input is
+processed, so that the very first record is read with the proper
+separator. To do this, use the special `BEGIN' pattern (*note
+BEGIN/END::). For example:
awk 'BEGIN { RS = "/" }
{ print $0 }' BBS-list
@@ -2888,37 +2898,38 @@ record is treated as part of the record for the `core' BBS; the newline
separating them in the output is the original newline in the data file,
not the one added by `awk' when it printed the record!
-Another way to change the record separator is on the command line,
+ Another way to change the record separator is on the command line,
using the variable-assignment feature (*note Other Arguments::):
awk '{ print $0 }' RS="/" BBS-list
This sets `RS' to `/' before processing `BBS-list'.
-Using an unusual character such as `/' for the record separator
+ Using an unusual character such as `/' for the record separator
produces correct behavior in the vast majority of cases. However, the
following (extreme) pipeline prints a surprising `1':
$ echo | awk 'BEGIN { RS = "a" } ; { print NF }'
-| 1
-There is one field, consisting of a newline. The value of the built-in
-variable `NF' is the number of fields in the current record.
+ There is one field, consisting of a newline. The value of the
+built-in variable `NF' is the number of fields in the current record.
-Reaching the end of an input file terminates the current input record,
-even if the last character in the file is not the character in `RS'.
-(d.c.)
+ Reaching the end of an input file terminates the current input
+record, even if the last character in the file is not the character in
+`RS'. (d.c.)
-The empty string `""' (a string without any characters) has a special
-meaning as the value of `RS'. It means that records are separated by
-one or more blank lines and nothing else. *Note Multiple Line::, for
-more details.
+ The empty string `""' (a string without any characters) has a
+special meaning as the value of `RS'. It means that records are
+separated by one or more blank lines and nothing else. *Note Multiple
+Line::, for more details.
-If you change the value of `RS' in the middle of an `awk' run, the new
-value is used to delimit subsequent records, but the record currently
-being processed, as well as records already processed, are not affected.
+ If you change the value of `RS' in the middle of an `awk' run, the
+new value is used to delimit subsequent records, but the record
+currently being processed, as well as records already processed, are not
+affected.
-After the end of the record has been determined, `gawk' sets the
+ After the end of the record has been determined, `gawk' sets the
variable `RT' to the text in the input that matched `RS'. When using
`gawk', the value of `RS' is not limited to a one-character string. It
can be any regular expression (*note Regexp::). In general, each record
@@ -2930,14 +2941,14 @@ newline in the input), and the following record starts just after the
end of this string (at the first character of the following line). The
newline, because it matches `RS', is not part of either record.
-When `RS' is a single character, `RT' contains the same single
+ When `RS' is a single character, `RT' contains the same single
character. However, when `RS' is a regular expression, `RT' contains
the actual input text that matched the regular expression.
-The following example illustrates both of these features. It sets `RS'
-equal to a regular expression that matches either a newline or a series
-of one or more uppercase letters with optional leading and/or trailing
-whitespace:
+ The following example illustrates both of these features. It sets
+`RS' equal to a regular expression that matches either a newline or a
+series of one or more uppercase letters with optional leading and/or
+trailing whitespace:
$ echo record 1 AAAA record 2 BBBB record 3 |
> gawk 'BEGIN { RS = "\n|( *[[:upper:]]+ *)" }
@@ -2952,13 +2963,13 @@ value of `RT' is a newline, and the `print' statement supplies its own
terminating newline. *Note Simple Sed::, for a more useful example of
`RS' as a regexp and `RT'.
-If you set `RS' to a regular expression that allows optional trailing
-text, such as `RS = "abc(XYZ)?"' it is possible, due to implementation
-constraints, that `gawk' may match the leading part of the regular
-expression, but not the trailing part, particularly if the input text
-that could match the trailing part is fairly long. `gawk' attempts to
-avoid this problem, but currently, there's no guarantee that this will
-never happen.
+ If you set `RS' to a regular expression that allows optional
+trailing text, such as `RS = "abc(XYZ)?"' it is possible, due to
+implementation constraints, that `gawk' may match the leading part of
+the regular expression, but not the trailing part, particularly if the
+input text that could match the trailing part is fairly long. `gawk'
+attempts to avoid this problem, but currently, there's no guarantee
+that this will never happen.
NOTE: Remember that in `awk', the `^' and `$' anchor
metacharacters match the beginning and end of a _string_, and not
@@ -2968,7 +2979,7 @@ never happen.
that happens to contain newline characters in it. It is thus best
to avoid anchor characters in the value of `RS'.
-The use of `RS' as a regular expression and the `RT' variable are
+ The use of `RS' as a regular expression and the `RT' variable are
`gawk' extensions; they are not available in compatibility mode (*note
Options::). In compatibility mode, only the first character of the
value of `RS' is used to determine the end of the record.
@@ -2982,28 +2993,28 @@ value that you know doesn't occur in the input file. This is hard to
do in a general way, such that a program always works for arbitrary
input files.
-You might think that for text files, the NUL character, which consists
-of a character with all bits equal to zero, is a good value to use for
-`RS' in this case:
+ You might think that for text files, the NUL character, which
+consists of a character with all bits equal to zero, is a good value to
+use for `RS' in this case:
BEGIN { RS = "\0" } # whole file becomes one record?
-`gawk' in fact accepts this, and uses the NUL character for the record
-separator. However, this usage is _not_ portable to other `awk'
+ `gawk' in fact accepts this, and uses the NUL character for the
+record separator. However, this usage is _not_ portable to other `awk'
implementations.
-All other `awk' implementations(1) store strings internally as C-style
-strings. C strings use the NUL character as the string terminator. In
-effect, this means that `RS = "\0"' is the same as `RS = ""'.
-(d.c.)
+ All other `awk' implementations(1) store strings internally as
+C-style strings. C strings use the NUL character as the string
+terminator. In effect, this means that `RS = "\0"' is the same as `RS
+= ""'. (d.c.)
-The best way to treat a whole file as a single record is to simply read
-the file in, one record at a time, concatenating each record onto the
-end of the previous ones.
+ The best way to treat a whole file as a single record is to simply
+read the file in, one record at a time, concatenating each record onto
+the end of the previous ones.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) At least that we know about.
+ (1) At least that we know about.

File: gawk.info, Node: Fields, Next: Nonconstant Fields, Prev: Records, Up: Reading Files
@@ -3019,12 +3030,12 @@ newlines;(1) other characters, such as formfeed, vertical tab, etc.
that are considered whitespace by other languages, are _not_ considered
whitespace by `awk'.
-The purpose of fields is to make it more convenient for you to refer to
-these pieces of the record. You don't have to use them--you can
+ The purpose of fields is to make it more convenient for you to refer
+to these pieces of the record. You don't have to use them--you can
operate on the whole record if you want--but fields are what make
simple `awk' programs so powerful.
-A dollar-sign (`$') is used to refer to a field in an `awk' program,
+ A dollar-sign (`$') is used to refer to a field in an `awk' program,
followed by the number of the field you want. Thus, `$1' refers to the
first field, `$2' to the second, and so on. (Unlike the Unix shells,
the field numbers are not limited to single digits. `$127' is the one
@@ -3038,17 +3049,17 @@ Here the first field, or `$1', is `This', the second field, or `$2', is
Because there is no space between the `e' and the `.', the period is
considered part of the seventh field.
-`NF' is a built-in variable whose value is the number of fields in the
-current record. `awk' automatically updates the value of `NF' each
+ `NF' is a built-in variable whose value is the number of fields in
+the current record. `awk' automatically updates the value of `NF' each
time it reads a record. No matter how many fields there are, the last
field in a record can be represented by `$NF'. So, `$NF' is the same
as `$7', which is `example.'. If you try to reference a field beyond
the last one (such as `$8' when the record has only seven fields), you
get the empty string. (If used in a numeric operation, you get zero.)
-The use of `$0', which looks like a reference to the "zero-th" field, is
-a special case: it represents the whole input record when you are not
-interested in specific fields. Here are some more examples:
+ The use of `$0', which looks like a reference to the "zero-th"
+field, is a special case: it represents the whole input record when you
+are not interested in specific fields. Here are some more examples:
$ awk '$1 ~ /foo/ { print $0 }' BBS-list
-| fooey 555-1234 2400/1200/300 B
@@ -3061,7 +3072,7 @@ field contains the string `foo'. The operator `~' is called a
"matching operator" (*note Regexp Usage::); it tests whether a string
(here, the field `$1') matches a given regular expression.
-By contrast, the following example looks for `foo' in _the entire
+ By contrast, the following example looks for `foo' in _the entire
record_ and prints the first field and the last field for each matching
input record:
@@ -3071,9 +3082,9 @@ input record:
-| macfoo A
-| sabafoo C
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) In POSIX `awk', newlines are not considered whitespace for
+ (1) In POSIX `awk', newlines are not considered whitespace for
separating fields.

@@ -3099,23 +3110,24 @@ another example of using expressions as field numbers:
awk '{ print $(2*2) }' BBS-list
-`awk' evaluates the expression `(2*2)' and uses its value as the number
-of the field to print. The `*' sign represents multiplication, so the
-expression `2*2' evaluates to four. The parentheses are used so that
-the multiplication is done before the `$' operation; they are necessary
-whenever there is a binary operator in the field-number expression.
-This example, then, prints the hours of operation (the fourth field)
-for every line of the file `BBS-list'. (All of the `awk' operators are
-listed, in order of decreasing precedence, in *Note Precedence::.)
-
-If the field number you compute is zero, you get the entire record.
+ `awk' evaluates the expression `(2*2)' and uses its value as the
+number of the field to print. The `*' sign represents multiplication,
+so the expression `2*2' evaluates to four. The parentheses are used so
+that the multiplication is done before the `$' operation; they are
+necessary whenever there is a binary operator in the field-number
+expression. This example, then, prints the hours of operation (the
+fourth field) for every line of the file `BBS-list'. (All of the `awk'
+operators are listed, in order of decreasing precedence, in *note
+Precedence::.)
+
+ If the field number you compute is zero, you get the entire record.
Thus, `$(2-2)' has the same value as `$0'. Negative field numbers are
not allowed; trying to reference one usually terminates the program.
(The POSIX standard does not define what happens when you reference a
negative field number. `gawk' notices this and terminates your
program. Other `awk' implementations may behave differently.)
-As mentioned in *Note Fields::, `awk' stores the current record's
+ As mentioned in *note Fields::, `awk' stores the current record's
number of fields in the built-in variable `NF' (also *note Built-in
Variables::). The expression `$NF' is not a special feature--it is the
direct consequence of evaluating `NF' and using its value as a field
@@ -3146,15 +3158,15 @@ three minus ten: `$3 - 10'. (*Note Arithmetic Ops::.) Then it prints
the original and new values for field three. (Someone in the warehouse
made a consistent mistake while inventorying the red boxes.)
-For this to work, the text in field `$3' must make sense as a number;
-the string of characters must be converted to a number for the computer
-to do arithmetic on it. The number resulting from the subtraction is
-converted back to a string of characters that then becomes field three.
-*Note Conversion::.
+ For this to work, the text in field `$3' must make sense as a
+number; the string of characters must be converted to a number for the
+computer to do arithmetic on it. The number resulting from the
+subtraction is converted back to a string of characters that then
+becomes field three. *Note Conversion::.
-When the value of a field is changed (as perceived by `awk'), the text
-of the input record is recalculated to contain the new field where the
-old one was. In other words, `$0' changes to reflect the altered
+ When the value of a field is changed (as perceived by `awk'), the
+text of the input record is recalculated to contain the new field where
+the old one was. In other words, `$0' changes to reflect the altered
field. Thus, this program prints a copy of the input file, with 10
subtracted from the second field of each line:
@@ -3164,8 +3176,8 @@ subtracted from the second field of each line:
-| Mar 5 24 34 228
...
-It is also possible to also assign contents to fields that are out of
-range. For example:
+ It is also possible to also assign contents to fields that are out
+of range. For example:
$ awk '{ $6 = ($5 + $4 + $3 + $2)
> print $6 }' inventory-shipped
@@ -3179,20 +3191,20 @@ We've just created `$6', whose value is the sum of fields `$2', `$3',
`inventory-shipped', `$6' represents the total number of parcels
shipped for a particular month.
-Creating a new field changes `awk''s internal copy of the current input
-record, which is the value of `$0'. Thus, if you do `print $0' after
-adding a field, the record printed includes the new field, with the
-appropriate number of field separators between it and the previously
+ Creating a new field changes `awk''s internal copy of the current
+input record, which is the value of `$0'. Thus, if you do `print $0'
+after adding a field, the record printed includes the new field, with
+the appropriate number of field separators between it and the previously
existing fields.
-This recomputation affects and is affected by `NF' (the number of
+ This recomputation affects and is affected by `NF' (the number of
fields; *note Fields::). For example, the value of `NF' is set to the
number of the highest field you create. The exact format of `$0' is
also affected by a feature that has not been discussed yet: the "output
field separator", `OFS', used to separate the fields (*note Output
Separators::).
-Note, however, that merely _referencing_ an out-of-range field does
+ Note, however, that merely _referencing_ an out-of-range field does
_not_ change the value of either `$0' or `NF'. Referencing an
out-of-range field only produces an empty string. For example:
@@ -3206,9 +3218,9 @@ out of range. (*Note If Statement::, for more information about
`awk''s `if-else' statements. *Note Typing and Comparison::, for more
information about the `!=' operator.)
-It is important to note that making an assignment to an existing field
-changes the value of `$0' but does not change the value of `NF', even
-when you assign the empty string to a field. For example:
+ It is important to note that making an assignment to an existing
+field changes the value of `$0' but does not change the value of `NF',
+even when you assign the empty string to a field. For example:
$ echo a b c d | awk '{ OFS = ":"; $2 = ""
> print $0; print NF }'
@@ -3228,7 +3240,7 @@ The intervening field, `$5', is created with an empty value (indicated
by the second pair of adjacent colons), and `NF' is updated with the
value six.
-Decrementing `NF' throws away the values of the fields after the new
+ Decrementing `NF' throws away the values of the fields after the new
value of `NF' and recomputes `$0'. (d.c.) Here is an example:
$ echo a b c d e f | awk '{ print "NF =", NF;
@@ -3236,10 +3248,10 @@ value of `NF' and recomputes `$0'. (d.c.) Here is an example:
-| NF = 6
-| a b c
-*Caution:* Some versions of `awk' don't rebuild `$0' when `NF' is
+ *Caution:* Some versions of `awk' don't rebuild `$0' when `NF' is
decremented. Caveat emptor.
-Finally, there are times when it is convenient to force `awk' to
+ Finally, there are times when it is convenient to force `awk' to
rebuild the entire record, using the current value of the fields and
`OFS'. To do this, use the seemingly innocuous assignment:
@@ -3249,11 +3261,11 @@ rebuild the entire record, using the current value of the fields and
This forces `awk' rebuild the record. It does help to add a comment,
as we've shown here.
-There is a flip side to the relationship between `$0' and the fields.
-Any assignment to `$0' causes the record to be reparsed into fields
-using the _current_ value of `FS'. This also applies to any built-in
-function that updates `$0', such as `sub' and `gsub' (*note String
-Functions::).
+ There is a flip side to the relationship between `$0' and the
+fields. Any assignment to `$0' causes the record to be reparsed into
+fields using the _current_ value of `FS'. This also applies to any
+built-in function that updates `$0', such as `sub' and `gsub' (*note
+String Functions::).

File: gawk.info, Node: Field Separators, Next: Constant Size, Prev: Changing Fields, Up: Reading Files
@@ -3268,26 +3280,27 @@ File: gawk.info, Node: Field Separators, Next: Constant Size, Prev: Changing
* Command Line Field Separator:: Setting `FS' from the command-line.
* Field Splitting Summary:: Some final points and a summary table.
-The "field separator", which is either a single character or a regular
-expression, controls the way `awk' splits an input record into fields.
-`awk' scans the input record for character sequences that match the
-separator; the fields themselves are the text between the matches.
+ The "field separator", which is either a single character or a
+regular expression, controls the way `awk' splits an input record into
+fields. `awk' scans the input record for character sequences that
+match the separator; the fields themselves are the text between the
+matches.
-In the examples that follow, we use the bullet symbol (*) to represent
-spaces in the output. If the field separator is `oo', then the
-following line:
+ In the examples that follow, we use the bullet symbol (*) to
+represent spaces in the output. If the field separator is `oo', then
+the following line:
moo goo gai pan
is split into three fields: `m', `*g', and `*gai*pan'. Note the
leading spaces in the values of the second and third fields.
-The field separator is represented by the built-in variable `FS'.
+ The field separator is represented by the built-in variable `FS'.
Shell programmers take note: `awk' does _not_ use the name `IFS' that
is used by the POSIX-compliant shells (such as the Unix Bourne shell,
`sh', or `bash').
-The value of `FS' can be changed in the `awk' program with the
+ The value of `FS' can be changed in the `awk' program with the
assignment operator, `=' (*note Assignment Ops::). Often the right
time to do this is at the beginning of execution before any input has
been processed, so that the very first record is read with the proper
@@ -3303,7 +3316,7 @@ Given the input line:
this `awk' program extracts and prints the string `*29*Oak*St.'.
-Sometimes the input data contains separator characters that don't
+ Sometimes the input data contains separator characters that don't
separate fields the way you thought they would. For instance, the
person's name in the example we just used might have a title or suffix
attached, such as:
@@ -3317,7 +3330,7 @@ characters carefully to prevent such problems. (If the data is not in
a form that is easy to process, perhaps you can massage it first with a
separate `awk' program.)
-Fields are normally separated by whitespace sequences (spaces, tabs,
+ Fields are normally separated by whitespace sequences (spaces, tabs,
and newlines), not by single spaces. Two spaces in a row do not
delimit an empty field. The default value of the field separator `FS'
is a string containing a single space, `" "'. If `awk' interpreted
@@ -3327,7 +3340,7 @@ The reason this does not happen is that a single space as the value of
`FS' is a special case--it is taken to specify the default manner of
delimiting fields.
-If `FS' is any other single character, such as `","', then each
+ If `FS' is any other single character, such as `","', then each
occurrence of that character separates two fields. Two consecutive
occurrences delimit an empty field. If the character occurs at the
beginning or the end of the line, that too delimits an empty field. The
@@ -3353,18 +3366,19 @@ space and a TAB into a field separator. (`\t' is an "escape sequence"
that stands for a TAB; *note Escape Sequences::, for the complete list
of similar escape sequences.)
-For a less trivial example of a regular expression, try using single
+ For a less trivial example of a regular expression, try using single
spaces to separate fields the way single commas are used. `FS' can be
set to `"[ ]"' (left bracket, space, right bracket). This regular
expression matches a single space and nothing else (*note Regexp::).
-There is an important difference between the two cases of `FS = " "' (a
-single space) and `FS = "[ \t\n]+"' (a regular expression matching one
-or more spaces, tabs, or newlines). For both values of `FS', fields
-are separated by "runs" (multiple adjacent occurrences) of spaces, tabs,
-and/or newlines. However, when the value of `FS' is `" "', `awk' first
-strips leading and trailing whitespace from the record and then decides
-where the fields are. For example, the following pipeline prints `b':
+ There is an important difference between the two cases of `FS = " "'
+(a single space) and `FS = "[ \t\n]+"' (a regular expression matching
+one or more spaces, tabs, or newlines). For both values of `FS',
+fields are separated by "runs" (multiple adjacent occurrences) of
+spaces, tabs, and/or newlines. However, when the value of `FS' is
+`" "', `awk' first strips leading and trailing whitespace from the
+record and then decides where the fields are. For example, the
+following pipeline prints `b':
$ echo ' a b c d ' | awk '{ print $2 }'
-| b
@@ -3378,8 +3392,8 @@ letter):
In this case, the first field is "null" or empty.
-The stripping of leading and trailing whitespace also comes into play
-whenever `$0' is recomputed. For instance, study this pipeline:
+ The stripping of leading and trailing whitespace also comes into
+play whenever `$0' is recomputed. For instance, study this pipeline:
$ echo ' a b c d' | awk '{ print; $2 = $2; print }'
-| a b c d
@@ -3412,8 +3426,8 @@ record becomes a separate field. For example:
-| Field 2 is
-| Field 3 is b
-Traditionally, the behavior of `FS' equal to `""' was not defined. In
-this case, most versions of Unix `awk' simply treat the entire record
+ Traditionally, the behavior of `FS' equal to `""' was not defined.
+In this case, most versions of Unix `awk' simply treat the entire record
as only having one field. (d.c.) In compatibility mode (*note
Options::), if `FS' is the null string, then `gawk' also behaves this
way.
@@ -3436,7 +3450,7 @@ command-line options: the `-F' and `-f' options have nothing to do with
each other. You can use both options at the same time to set the `FS'
variable _and_ get an `awk' program from a file.
-The value used for the argument to `-F' is processed in exactly the
+ The value used for the argument to `-F' is processed in exactly the
same way as assignments to the built-in variable `FS'. Any special
characters in the field separator must be escaped appropriately. For
example, to use a `\' as the field separator on the command line, you
@@ -3450,22 +3464,22 @@ Because `\' is used for quoting in the shell, `awk' sees `-F\\'. Then
Sequences::), finally yielding a single `\' to use for the field
separator.
-As a special case, in compatibility mode (*note Options::), if the
+ As a special case, in compatibility mode (*note Options::), if the
argument to `-F' is `t', then `FS' is set to the TAB character. If you
type `-F\t' at the shell, without any quotes, the `\' gets deleted, so
`awk' figures that you really want your fields to be separated with
tabs and not `t's. Use `-v FS="t"' or `-F"[t]"' on the command line if
you really do want to separate your fields with `t's.
-For example, let's use an `awk' program file called `baud.awk' that
+ For example, let's use an `awk' program file called `baud.awk' that
contains the pattern `/300/' and the action `print $1':
/300/ { print $1 }
-Let's also set `FS' to be the `-' character and run the program on the
-file `BBS-list'. The following command prints a list of the names of
-the bulletin boards that operate at 300 baud and the first three digits
-of their phone numbers:
+ Let's also set `FS' to be the `-' character and run the program on
+the file `BBS-list'. The following command prints a list of the names
+of the bulletin boards that operate at 300 baud and the first three
+digits of their phone numbers:
$ awk -F- -f baud.awk BBS-list
-| aardvark 555
@@ -3485,23 +3499,23 @@ looked like this:
alpo-net 555-3412 2400/1200/300 A
-The `-' as part of the system's name was used as the field separator,
-instead of the `-' in the phone number that was originally intended.
-This demonstrates why you have to be careful in choosing your field and
-record separators.
+ The `-' as part of the system's name was used as the field
+separator, instead of the `-' in the phone number that was originally
+intended. This demonstrates why you have to be careful in choosing
+your field and record separators.
-Perhaps the most common use of a single character as the field
+ Perhaps the most common use of a single character as the field
separator occurs when processing the Unix system password file. On
many Unix systems, each user has a separate entry in the system password
file, one line per user. The information in these lines is separated
-by colons. The first field is the user's logon name and the second is
+by colons. The first field is the user's login name and the second is
the user's (encrypted or shadow) password. A password file entry might
look like this:
arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/bash
-The following program searches the system password file and prints the
-entries for users who have no password:
+ The following program searches the system password file and prints
+the entries for users who have no password:
awk -F: '$2 == ""' /etc/passwd
@@ -3520,8 +3534,8 @@ occurrences of any two characters." If instead you want fields to be
separated by a literal period followed by any single character, use `FS
= "\\.."'.
-The following table summarizes how fields are split, based on the value
-of `FS' (`==' means "is equal to"):
+ The following table summarizes how fields are split, based on the
+value of `FS' (`==' means "is equal to"):
`FS == " "'
Fields are separated by runs of whitespace. Leading and trailing
@@ -3552,12 +3566,12 @@ this means that if you change the value of `FS' after a record is read,
the value of the fields (i.e., how they were split) should reflect the
old value of `FS', not the new one.
-However, many implementations of `awk' do not work this way. Instead,
-they defer splitting the fields until a field is actually referenced.
-The fields are split using the _current_ value of `FS'! (d.c.) This
-behavior can be difficult to diagnose. The following example
-illustrates the difference between the two methods. (The `sed'(1)
-command prints just the first line of `/etc/passwd'.)
+ However, many implementations of `awk' do not work this way.
+Instead, they defer splitting the fields until a field is actually
+referenced. The fields are split using the _current_ value of `FS'!
+(d.c.) This behavior can be difficult to diagnose. The following
+example illustrates the difference between the two methods. (The
+`sed'(1) command prints just the first line of `/etc/passwd'.)
sed 1q /etc/passwd | awk '{ FS = ":" ; print $1 }'
@@ -3588,9 +3602,9 @@ alphabetic character while ignoring case, use a regexp that will do it
for you. E.g., `FS = "[c]"'. In this case, `IGNORECASE' will take
effect.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The `sed' utility is a "stream editor." Its behavior is also
+ (1) The `sed' utility is a "stream editor." Its behavior is also
defined by the POSIX standard.

@@ -3608,21 +3622,22 @@ nature arises in the input for old Fortran programs where numbers are
run together, or in the output of programs that did not anticipate the
use of their output as input for other programs.
-An example of the latter is a table where all the columns are lined up
-by the use of a variable number of spaces and _empty fields are just
+ An example of the latter is a table where all the columns are lined
+up by the use of a variable number of spaces and _empty fields are just
spaces_. Clearly, `awk''s normal field splitting based on `FS' does
not work well in this case. Although a portable `awk' program can use
a series of `substr' calls on `$0' (*note String Functions::), this is
awkward and inefficient for a large number of fields.
-The splitting of an input record into fixed-width fields is specified by
-assigning a string containing space-separated numbers to the built-in
-variable `FIELDWIDTHS'. Each number specifies the width of the field,
-_including_ columns between fields. If you want to ignore the columns
-between fields, you can specify the width as a separate field that is
-subsequently ignored. It is a fatal error to supply a field width that
-is not a positive number. The following data is the output of the Unix
-`w' utility. It is useful to illustrate the use of `FIELDWIDTHS':
+ The splitting of an input record into fixed-width fields is
+specified by assigning a string containing space-separated numbers to
+the built-in variable `FIELDWIDTHS'. Each number specifies the width
+of the field, _including_ columns between fields. If you want to
+ignore the columns between fields, you can specify the width as a
+separate field that is subsequently ignored. It is a fatal error to
+supply a field width that is not a positive number. The following data
+is the output of the Unix `w' utility. It is useful to illustrate the
+use of `FIELDWIDTHS':
10:06pm up 21 days, 14:04, 23 users
User tty login idle JCPU PCPU what
@@ -3635,8 +3650,8 @@ is not a positive number. The following data is the output of the Unix
brent ttyp0 26Jun91 4:46 26:46 4:41 bash
dave ttyq4 26Jun9115days 46 46 wnewmail
-The following program takes the above input, converts the idle time to
-number of seconds, and prints out the first two fields and the
+ The following program takes the above input, converts the idle time
+to number of seconds, and prints out the first two fields and the
calculated idle time:
NOTE: This program uses a number of `awk' features that haven't
@@ -3658,7 +3673,7 @@ calculated idle time:
print $1, $2, idle
}
-Running the program on the data produces the following results:
+ Running the program on the data produces the following results:
hzuo ttyV0 0
hzang ttyV3 50
@@ -3669,21 +3684,21 @@ Running the program on the data produces the following results:
brent ttyp0 286
dave ttyq4 1296000
-Another (possibly more practical) example of fixed-width input data is
-the input from a deck of balloting cards. In some parts of the United
-States, voters mark their choices by punching holes in computer cards.
-These cards are then processed to count the votes for any particular
-candidate or on any particular issue. Because a voter may choose not to
-vote on some issue, any column on the card may be empty. An `awk'
-program for processing such data could use the `FIELDWIDTHS' feature to
-simplify reading the data. (Of course, getting `gawk' to run on a
-system with card readers is another story!)
-
-Assigning a value to `FS' causes `gawk' to use `FS' for field splitting
-again. Use `FS = FS' to make this happen, without having to know the
-current value of `FS'. In order to tell which kind of field splitting
-is in effect, use `PROCINFO["FS"]' (*note Auto-set::). The value is
-`"FS"' if regular field splitting is being used, or it is
+ Another (possibly more practical) example of fixed-width input data
+is the input from a deck of balloting cards. In some parts of the
+United States, voters mark their choices by punching holes in computer
+cards. These cards are then processed to count the votes for any
+particular candidate or on any particular issue. Because a voter may
+choose not to vote on some issue, any column on the card may be empty.
+An `awk' program for processing such data could use the `FIELDWIDTHS'
+feature to simplify reading the data. (Of course, getting `gawk' to
+run on a system with card readers is another story!)
+
+ Assigning a value to `FS' causes `gawk' to use `FS' for field
+splitting again. Use `FS = FS' to make this happen, without having to
+know the current value of `FS'. In order to tell which kind of field
+splitting is in effect, use `PROCINFO["FS"]' (*note Auto-set::). The
+value is `"FS"' if regular field splitting is being used, or it is
`"FIELDWIDTHS"' if fixed-width field splitting is being used:
if (PROCINFO["FS"] == "FS")
@@ -3691,7 +3706,7 @@ is in effect, use `PROCINFO["FS"]' (*note Auto-set::). The value is
else
FIXED-WIDTH FIELD SPLITTING ...
-This information is useful when writing a function that needs to
+ This information is useful when writing a function that needs to
temporarily change `FS' or `FIELDWIDTHS', read some records, and then
restore the original settings (*note Passwd Functions::, for an example
of such a function).
@@ -3706,23 +3721,23 @@ In some databases, a single line cannot conveniently hold all the
information in one entry. In such cases, you can use multiline
records. The first step in doing this is to choose your data format.
-One technique is to use an unusual character or string to separate
+ One technique is to use an unusual character or string to separate
records. For example, you could use the formfeed character (written
`\f' in `awk', as in C) to separate them, making each record a page of
the file. To do this, just set the variable `RS' to `"\f"' (a string
containing the formfeed character). Any other character could equally
well be used, as long as it won't be part of the data in a record.
-Another technique is to have blank lines separate records. By a special
-dispensation, an empty string as the value of `RS' indicates that
-records are separated by one or more blank lines. When `RS' is set to
-the empty string, each record always ends at the first blank line
+ Another technique is to have blank lines separate records. By a
+special dispensation, an empty string as the value of `RS' indicates
+that records are separated by one or more blank lines. When `RS' is set
+to the empty string, each record always ends at the first blank line
encountered. The next record doesn't start until the first nonblank
line that follows. No matter how many blank lines appear in a row, they
all act as one record separator. (Blank lines must be completely
empty; lines that contain only whitespace do not count.)
-You can achieve the same effect as `RS = ""' by assigning the string
+ You can achieve the same effect as `RS = ""' by assigning the string
`"\n\n+"' to `RS'. This regexp matches the newline at the end of the
record and one or more blank lines after the record. In addition, a
regular expression always matches the longest possible sequence when
@@ -3731,21 +3746,21 @@ doesn't start until the first nonblank line that follows--no matter how
many blank lines appear in a row, they are considered one record
separator.
-There is an important difference between `RS = ""' and `RS = "\n\n+"'.
-In the first case, leading newlines in the input data file are ignored,
-and if a file ends without extra blank lines after the last record, the
-final newline is removed from the record. In the second case, this
-special processing is not done. (d.c.)
+ There is an important difference between `RS = ""' and `RS =
+"\n\n+"'. In the first case, leading newlines in the input data file
+are ignored, and if a file ends without extra blank lines after the
+last record, the final newline is removed from the record. In the
+second case, this special processing is not done. (d.c.)
-Now that the input is separated into records, the second step is to
+ Now that the input is separated into records, the second step is to
separate the fields in the record. One way to do this is to divide each
of the lines into fields in the normal manner. This happens by default
as the result of a special feature. When `RS' is set to the empty
-string, _and_ `FS' is a set to a single character, the newline
-character _always_ acts as a field separator. This is in addition to
-whatever field separations result from `FS'.(1)
+string, _and_ `FS' is set to a single character, the newline character
+_always_ acts as a field separator. This is in addition to whatever
+field separations result from `FS'.(1)
-The original motivation for this special exception was probably to
+ The original motivation for this special exception was probably to
provide useful behavior in the default case (i.e., `FS' is equal to
`" "'). This feature can be a problem if you really don't want the
newline character to separate fields, because there is no way to
@@ -3756,12 +3771,12 @@ special feature in a different way, by making `FS' into a regexp for
that single character. For example, if the field separator is a
percent character, instead of `FS = "%"', use `FS = "[%]"'.
-Another way to separate fields is to put each field on a separate line:
-to do this, just set the variable `FS' to the string `"\n"'. (This
-single character seperator matches a single newline.) A practical
-example of a data file organized this way might be a mailing list,
-where each entry is separated by blank lines. Consider a mailing list
-in a file named `addresses', which looks like this:
+ Another way to separate fields is to put each field on a separate
+line: to do this, just set the variable `FS' to the string `"\n"'.
+(This single character separator matches a single newline.) A
+practical example of a data file organized this way might be a mailing
+list, where each entry is separated by blank lines. Consider a mailing
+list in a file named `addresses', which looks like this:
Jane Doe
123 Main Street
@@ -3787,7 +3802,7 @@ A simple program to process this file is as follows:
print ""
}
-Running the program produces the following output:
+ Running the program produces the following output:
$ awk -f addrs.awk addresses
-| Name is: Jane Doe
@@ -3800,7 +3815,7 @@ Running the program produces the following output:
-|
...
-*Note Labels Program::, for a more realistic program that deals with
+ *Note Labels Program::, for a more realistic program that deals with
address lists. The following table summarizes how records are split,
based on the value of `RS'. (`==' means "is equal to.")
@@ -3814,10 +3829,10 @@ based on the value of `RS'. (`==' means "is equal to.")
Multiple successive occurrences delimit empty records.
`RS == ""'
- Records are separated by runs of blank lines. The newline
- character always serves as a field separator, in addition to
- whatever value `FS' may have. Leading and trailing newlines in a
- file are ignored.
+ Records are separated by runs of blank lines. When `FS' is a
+ single character, then the newline character always serves as a
+ field separator, in addition to whatever value `FS' may have.
+ Leading and trailing newlines in a file are ignored.
`RS == REGEXP'
Records are separated by occurrences of characters that match
@@ -3825,12 +3840,12 @@ based on the value of `RS'. (`==' means "is equal to.")
records. (This is a `gawk' extension; it is not specified by the
POSIX standard.)
-In all cases, `gawk' sets `RT' to the input text that matched the value
-specified by `RS'.
+ In all cases, `gawk' sets `RT' to the input text that matched the
+value specified by `RS'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) When `FS' is the null string (`""') or a regexp, this special
+ (1) When `FS' is the null string (`""') or a regexp, this special
feature of `RS' does not apply. It does apply to the default field
separator of a single space: `FS = " "'.
@@ -3846,20 +3861,20 @@ output from another program) or from the files specified on the command
line. The `awk' language has a special built-in command called
`getline' that can be used to read input under your explicit control.
-The `getline' command is used in several different ways and should
+ The `getline' command is used in several different ways and should
_not_ be used by beginners. The examples that follow the explanation
of the `getline' command include material that has not been covered
yet. Therefore, come back and study the `getline' command _after_ you
have reviewed the rest of this Info file and have a good knowledge of
how `awk' works.
-The `getline' command returns one if it finds a record and zero if it
-encounters the end of the file. If there is some error in getting a
+ The `getline' command returns one if it finds a record and zero if
+it encounters the end of the file. If there is some error in getting a
record, such as a file that cannot be opened, then `getline' returns
-1. In this case, `gawk' sets the variable `ERRNO' to a string
describing the error that occurred.
-In the following examples, COMMAND stands for a string value that
+ In the following examples, COMMAND stands for a string value that
represents a shell command.
* Menu:
@@ -3902,7 +3917,6 @@ processing on the next record _right now_. For example:
print m > "/dev/stderr"
exit
}
- t = -1
u = index($0, "*/")
}
# substr expression will be "" if */
@@ -3912,14 +3926,14 @@ processing on the next record _right now_. For example:
print $0
}
-This `awk' program deletes all C-style comments (`/* ... */') from the
+ This `awk' program deletes C-style comments (`/* ... */') from the
input. By replacing the `print $0' with other statements, you could
perform more complicated processing on the decommented input, such as
searching for matches of a regular expression. (This program has a
subtle problem--it does not work if one comment ends and another begins
on the same line.)
-This form of the `getline' command sets `NF', `NR', `FNR', and the
+ This form of the `getline' command sets `NF', `NR', `FNR', and the
value of `$0'.
NOTE: The new value of `$0' is used to test the patterns of any
@@ -3965,10 +3979,10 @@ and produces these results:
phore
free
-The `getline' command used in this way sets only the variables `NR' and
-`FNR' (and of course, VAR). The record is not split into fields, so
-the values of the fields (including `$0') and the value of `NF' do not
-change.
+ The `getline' command used in this way sets only the variables `NR'
+and `FNR' (and of course, VAR). The record is not split into fields,
+so the values of the fields (including `$0') and the value of `NF' do
+not change.

File: gawk.info, Node: Getline/File, Next: Getline/Variable/File, Prev: Getline/Variable, Up: Getline
@@ -3991,17 +4005,17 @@ with a value equal to 10 in the current input file:
print
}
-Because the main input stream is not used, the values of `NR' and `FNR'
-are not changed. However, the record it reads is split into fields in
-the normal manner, so the values of `$0' and the other fields are
-changed, resulting in a new value of `NF'.
+ Because the main input stream is not used, the values of `NR' and
+`FNR' are not changed. However, the record it reads is split into
+fields in the normal manner, so the values of `$0' and the other fields
+are changed, resulting in a new value of `NF'.
-According to POSIX, `getline < EXPRESSION' is ambiguous if EXPRESSION
-contains unparenthesized operators other than `$'; for example,
-`getline < dir "/" file' is ambiguous because the concatenation
-operator is not parenthesized. You should write it as `getline < (dir
-"/" file)' if you want your program to be portable to other `awk'
-implementations.
+ According to POSIX, `getline < EXPRESSION' is ambiguous if
+EXPRESSION contains unparenthesized operators other than `$'; for
+example, `getline < dir "/" file' is ambiguous because the
+concatenation operator is not parenthesized. You should write it as
+`getline < (dir "/" file)' if you want your program to be portable to
+other `awk' implementations.

File: gawk.info, Node: Getline/Variable/File, Next: Getline/Pipe, Prev: Getline/File, Up: Getline
@@ -4013,7 +4027,7 @@ Use `getline VAR < FILE' to read input from the file FILE, and put it
in the variable VAR. As above, FILE is a string-valued expression that
specifies the file from which to read.
-In this version of `getline', none of the built-in variables are
+ In this version of `getline', none of the built-in variables are
changed and the record is not split into fields. The only variable
changed is VAR. For example, the following program copies all the
input files to the output, except for records that say
@@ -4029,15 +4043,15 @@ file FILENAME:
print
}
-Note here how the name of the extra input file is not built into the
+ Note here how the name of the extra input file is not built into the
program; it is taken directly from the data, specifically from the
second field on the `@include' line.
-The `close' function is called to ensure that if two identical
+ The `close' function is called to ensure that if two identical
`@include' lines appear in the input, the entire specified file is
included twice. *Note Close Files And Pipes::.
-One deficiency of this program is that it does not process nested
+ One deficiency of this program is that it does not process nested
`@include' statements (i.e., `@include' statements in included files)
the way a true macro preprocessor would. *Note Igawk Program::, for a
program that does handle nested `@include' statements.
@@ -4090,16 +4104,25 @@ Notice that this program ran the command `who' and printed the previous
result. (If you try this program yourself, you will of course get
different results, depending upon who is logged in on your system.)
-This variation of `getline' splits the record into fields, sets the
+ This variation of `getline' splits the record into fields, sets the
value of `NF', and recomputes the value of `$0'. The values of `NR'
and `FNR' are not changed.
-According to POSIX, `EXPRESSION | getline' is ambiguous if EXPRESSION
-contains unparenthesized operators other than `$'--for example,
-`"echo " "date" | getline' is ambiguous because the concatenation
-operator is not parenthesized. You should write it as `("echo "
-"date") | getline' if you want your program to be portable to other
-`awk' implementations.
+ According to POSIX, `EXPRESSION | getline' is ambiguous if
+EXPRESSION contains unparenthesized operators other than `$'--for
+example, `"echo " "date" | getline' is ambiguous because the
+concatenation operator is not parenthesized. You should write it as
+`("echo " "date") | getline' if you want your program to be portable to
+other `awk' implementations.
+
+ NOTE: Unfortunately, `gawk' has not been consistent in its
+ treatment of a construct like `"echo " "date" | getline'. Up to
+ and including version 3.1.1 of `gawk', it was treated as `("echo "
+ "date") | getline'. (This how Unix `awk' behaves.) From 3.1.2
+ through 3.1.5, it was treated as `"echo " ("date" | getline)'.
+ (This is how `mawk' behaves.) Starting with version 3.1.6, the
+ earlier behavior was reinstated. In short, _always_ use explicit
+ parentheses, and then you won't have to worry.

File: gawk.info, Node: Getline/Variable/Pipe, Next: Getline/Coprocess, Prev: Getline/Pipe, Up: Getline
@@ -4118,10 +4141,10 @@ following program reads the current date and time into the variable
print "Report printed on " current_time
}
-In this version of `getline', none of the built-in variables are
+ In this version of `getline', none of the built-in variables are
changed and the record is not split into fields.
-According to POSIX, `EXPRESSION | getline VAR' is ambiguous if
+ According to POSIX, `EXPRESSION | getline VAR' is ambiguous if
EXPRESSION contains unparenthesized operators other than `$'; for
example, `"echo " "date" | getline VAR' is ambiguous because the
concatenation operator is not parenthesized. You should write it as
@@ -4138,9 +4161,9 @@ Input into `getline' from a pipe is a one-way operation. The command
that is started with `COMMAND | getline' only sends data _to_ your
`awk' program.
-On occasion, you might want to send data to another program for
-processing and then read the results back. `gawk' allows you start a
-"coprocess", with which two-way communications are possible. This is
+ On occasion, you might want to send data to another program for
+processing and then read the results back. `gawk' allows you to start
+a "coprocess", with which two-way communications are possible. This is
done with the `|&' operator. Typically, you write data to the
coprocess first and then read results back, as shown in the following:
@@ -4149,12 +4172,12 @@ coprocess first and then read results back, as shown in the following:
which sends a query to `db_server' and then reads the results.
-The values of `NR' and `FNR' are not changed, because the main input
+ The values of `NR' and `FNR' are not changed, because the main input
stream is not used. However, the record is split into fields in the
normal manner, thus changing the values of `$0', of the other fields,
and of `NF'.
-Coprocesses are an advanced feature. They are discussed here only
+ Coprocesses are an advanced feature. They are discussed here only
because this is the minor node on `getline'. *Note Two-way I/O::,
where coprocesses are discussed in more detail.
@@ -4168,11 +4191,11 @@ When you use `COMMAND |& getline VAR', the output from the coprocess
COMMAND is sent through a two-way pipe to `getline' and into the
variable VAR.
-In this version of `getline', none of the built-in variables are
+ In this version of `getline', none of the built-in variables are
changed and the record is not split into fields. The only variable
changed is VAR.
-Coprocesses are an advanced feature. They are discussed here only
+ Coprocesses are an advanced feature. They are discussed here only
because this is the minor node on `getline'. *Note Two-way I/O::,
where coprocesses are discussed in more detail.
@@ -4216,27 +4239,19 @@ File: gawk.info, Node: Getline Summary, Prev: Getline Notes, Up: Getline
3.8.10 Summary of `getline' Variants
------------------------------------
-*Note table-getline-variants:: summarizes the eight variants of
+*note table-getline-variants:: summarizes the eight variants of
`getline', listing which built-in variables are set by each one.
Variant Effect
---------------------------------------------------------------------------
+--------------------------------------------------------------------------
`getline' Sets `$0', `NF', `FNR', and `NR'
---------------------------------------------------------------------------
`getline' VAR Sets VAR, `FNR', and `NR'
---------------------------------------------------------------------------
`getline <' FILE Sets `$0' and `NF'
---------------------------------------------------------------------------
`getline VAR < FILE' Sets VAR
---------------------------------------------------------------------------
COMMAND `| getline' Sets `$0' and `NF'
---------------------------------------------------------------------------
COMMAND `| getline' VAR Sets VAR
---------------------------------------------------------------------------
COMMAND `|& getline' Sets `$0' and `NF'. This is a `gawk' extension
---------------------------------------------------------------------------
COMMAND `|& getline' VAR Sets VAR. This is a `gawk' extension
---------------------------------------------------------------------------
Table 3.1: getline Variants and What They Set
@@ -4252,7 +4267,7 @@ and the `printf' statement for fancier formatting. The `print'
statement is not limited when computing _which_ values to print.
However, with two exceptions, you cannot specify _how_ to print
them--how many columns, whether to use exponential notation or not, and
-so on. (For the exceptions, *note Output Separators::, and *Note
+so on. (For the exceptions, *note Output Separators::, and *note
OFMT::.) For printing with specifications, you need the `printf'
statement (*note Printf::).
@@ -4293,15 +4308,15 @@ parentheses are necessary if any of the item expressions uses the `>'
relational operator; otherwise it could be confused with a redirection
(*note Redirection::).
-The items to print can be constant strings or numbers, fields of the
+ The items to print can be constant strings or numbers, fields of the
current record (such as `$1'), variables, or any `awk' expression.
Numeric values are converted to strings and then printed.
-The simple statement `print' with no items is equivalent to `print $0':
-it prints the entire current record. To print a blank line, use `print
-""', where `""' is the empty string. To print a fixed piece of text,
-use a string constant, such as `"Don't Panic"', as one item. If you
-forget to use the double-quote characters, your text is taken as an
+ The simple statement `print' with no items is equivalent to `print
+$0': it prints the entire current record. To print a blank line, use
+`print ""', where `""' is the empty string. To print a fixed piece of
+text, use a string constant, such as `"Don't Panic"', as one item. If
+you forget to use the double-quote characters, your text is taken as an
`awk' expression, and you will probably get an error. Keep in mind
that a space is printed between any two items.
@@ -4317,17 +4332,18 @@ contains a newline, the newline is output along with the rest of the
string. A single `print' statement can make any number of lines this
way.
-The following is an example of printing a string that contains embedded
-newlines (the `\n' is an escape sequence, used to represent the newline
-character; *note Escape Sequences::):
+ The following is an example of printing a string that contains
+embedded newlines (the `\n' is an escape sequence, used to represent
+the newline character; *note Escape Sequences::):
$ awk 'BEGIN { print "line one\nline two\nline three" }'
-| line one
-| line two
-| line three
-The next example, which is run on the `inventory-shipped' file, prints
-the first two fields of each input record, with a space between them:
+ The next example, which is run on the `inventory-shipped' file,
+prints the first two fields of each input record, with a space between
+them:
$ awk '{ print $1, $2 }' inventory-shipped
-| Jan 13
@@ -4335,7 +4351,7 @@ the first two fields of each input record, with a space between them:
-| Mar 15
...
-A common mistake in using the `print' statement is to omit the comma
+ A common mistake in using the `print' statement is to omit the comma
between two items. This often has the effect of making the items run
together in the output, with no space. The reason for this is that
juxtaposing two string expressions in `awk' means to concatenate them.
@@ -4347,7 +4363,7 @@ Here is the same program, without the comma:
-| Mar15
...
-To someone unfamiliar with the `inventory-shipped' file, neither
+ To someone unfamiliar with the `inventory-shipped' file, neither
example's output makes much sense. A heading line at the beginning
would make it clearer. Let's add some headings to our table of months
(`$1') and green crates shipped (`$2'). We do this using the `BEGIN'
@@ -4374,7 +4390,7 @@ fields:
print "----- ------" }
{ print $1, " ", $2 }' inventory-shipped
-Lining up columns this way can get pretty complicated when there are
+ Lining up columns this way can get pretty complicated when there are
many columns to fix. Counting spaces for two or three columns is
simple, but any more than this can take up a lot of time. This is why
the `printf' statement was created (*note Printf::); one of its
@@ -4398,15 +4414,15 @@ space is only the default. Any string of characters may be used as the
initial value of this variable is the string `" "'--that is, a single
space.
-The output from an entire `print' statement is called an "output
+ The output from an entire `print' statement is called an "output
record". Each `print' statement outputs one output record, and then
outputs a string called the "output record separator" (or `ORS'). The
initial value of `ORS' is the string `"\n"'; i.e., a newline character.
Thus, each `print' statement normally makes a separate line.
-In order to change how output fields and records are separated, assign
-new values to the variables `OFS' and `ORS'. The usual place to do
-this is in the `BEGIN' rule (*note BEGIN/END::), so that it happens
+ In order to change how output fields and records are separated,
+assign new values to the variables `OFS' and `ORS'. The usual place to
+do this is in the `BEGIN' rule (*note BEGIN/END::), so that it happens
before any input is processed. It can also be done with assignments on
the command line, before the names of the input files, or using the
`-v' command-line option (*note Options::). The following example
@@ -4422,8 +4438,8 @@ semicolon, with a blank line added after each newline:
-| barfly;555-7685
...
-If the value of `ORS' does not contain a newline, the program's output
-is run together on a single line.
+ If the value of `ORS' does not contain a newline, the program's
+output is run together on a single line.

File: gawk.info, Node: OFMT, Next: Printf, Prev: Output Separators, Up: Printing
@@ -4438,14 +4454,14 @@ that string. `awk' uses the `sprintf' function to do this conversion
`sprintf' function accepts a "format specification" that tells it how
to format numbers (or strings), and that there are a number of
different ways in which numbers can be formatted. The different format
-specifications are discussed more fully in *Note Control Letters::.
+specifications are discussed more fully in *note Control Letters::.
-The built-in variable `OFMT' contains the default format specification
-that `print' uses with `sprintf' when it wants to convert a number to a
-string for printing. The default value of `OFMT' is `"%.6g"'. The way
-`print' prints numbers can be changed by supplying different format
-specifications as the value of `OFMT', as shown in the following
-example:
+ The built-in variable `OFMT' contains the default format
+specification that `print' uses with `sprintf' when it wants to convert
+a number to a string for printing. The default value of `OFMT' is
+`"%.6g"'. The way `print' prints numbers can be changed by supplying
+different format specifications as the value of `OFMT', as shown in the
+following example:
$ awk 'BEGIN {
> OFMT = "%.0f" # print numbers as integers (rounds)
@@ -4488,23 +4504,23 @@ A simple `printf' statement looks like this:
printf FORMAT, ITEM1, ITEM2, ...
The entire list of arguments may optionally be enclosed in parentheses.
-The parentheses are necessary if any of the item expressions use the
-`>' relational operator; otherwise, it can be confused with a
-redirection (*note Redirection::).
+The parentheses are necessary if any of the item expressions use the `>'
+relational operator; otherwise, it can be confused with a redirection
+(*note Redirection::).
-The difference between `printf' and `print' is the FORMAT argument.
+ The difference between `printf' and `print' is the FORMAT argument.
This is an expression whose value is taken as a string; it specifies
how to output each of the other arguments. It is called the "format
string".
-The format string is very similar to that in the ISO C library function
-`printf'. Most of FORMAT is text to output verbatim. Scattered among
-this text are "format specifiers"--one per item. Each format specifier
-says to output the next item in the argument list at that place in the
-format.
+ The format string is very similar to that in the ISO C library
+function `printf'. Most of FORMAT is text to output verbatim.
+Scattered among this text are "format specifiers"--one per item. Each
+format specifier says to output the next item in the argument list at
+that place in the format.
-The `printf' statement does not automatically append a newline to its
-output. It outputs only what the format string specifies. So if a
+ The `printf' statement does not automatically append a newline to
+its output. It outputs only what the format string specifies. So if a
newline is needed, you must include one in the format string. The
output separator variables `OFS' and `ORS' have no effect on `printf'
statements. For example:
@@ -4562,7 +4578,7 @@ width. Here is a list of the format-control letters:
On systems supporting IEEE 754 floating point format, values
representing negative infinity are formatted as `-inf' or
- `-infinity', and positive infinity as `inf' and `-infinity'. The
+ `-infinity', and positive infinity as `inf' and `infinity'. The
special "not a number" value formats as `-nan' or `nan'.
`%F'
@@ -4570,7 +4586,7 @@ width. Here is a list of the format-control letters:
using uppercase letters.
The `%F' format is a POSIX extension to ISO C; not all systems
- support. On those that don't, `gawk' uses `%f' instead.
+ support it. On those that don't, `gawk' uses `%f' instead.
`%g, %G'
These print a number in either scientific notation or in
@@ -4600,8 +4616,8 @@ width. Here is a list of the format-control letters:
NOTE: When using the integer format-control letters for values
that are outside the range of the widest C integer type, `gawk'
- switches to the the `%g' format specifier. If `--lint' is provided
- on the command line (*note Options::), `gawk' warns about this.
+ switches to the `%g' format specifier. If `--lint' is provided on
+ the command line (*note Options::), `gawk' warns about this.
Other versions of `awk' may print invalid values or do something
else entirely. (d.c.)
@@ -4671,26 +4687,26 @@ which they may appear:
effect when the field width is wider than the value to print.
`''
- A single quote or apostrohe character is a POSIX extension to ISO
+ A single quote or apostrophe character is a POSIX extension to ISO
C. It indicates that the integer part of a floating point value,
or the entire part of an integer decimal value, should have a
thousands-separator character in it. This only works in locales
that support such characters. For example:
- $ cat thousands.awk Show source program
+ $ cat thousands.awk Show source program
-| BEGIN { printf "%'d\n", 1234567 }
- $ LC_ALL=C gawk -f thousands.awk Run it in "C" locale
- -| 1234567
- $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk Run in US English UTF locale
- -| 1,234,567
+ $ LC_ALL=C gawk -f thousands.awk
+ -| 1234567 Results in "C" locale
+ $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk
+ -| 1,234,567 Results in US English UTF locale
For more information about locales and internationalization issues,
- see *Note Locales::.
+ see *note Locales::.
NOTE: The `'' flag is a nice feature, but its use complicates
- things: it now becomes difficult to use it in command-line
+ things: it becomes difficult to use it in command-line
programs. For information on appropriate quoting tricks, see
- *Note Quoting::.
+ *note Quoting::.
`WIDTH'
This is a number specifying the desired minimum width of a field.
@@ -4737,7 +4753,7 @@ which they may appear:
prints `foob'.
-The C library `printf''s dynamic WIDTH and PREC capability (for
+ The C library `printf''s dynamic WIDTH and PREC capability (for
example, `"%*.*s"') is supported. Instead of supplying explicit WIDTH
and/or PREC values in the format string, they are passed in the
argument list. For example:
@@ -4764,7 +4780,7 @@ string, like so:
This is not particularly easy to read but it does work.
-C programmers may be used to supplying additional `l', `L', and `h'
+ C programmers may be used to supplying additional `l', `L', and `h'
modifiers in `printf' format strings. These are not valid in `awk'.
Most `awk' implementations silently ignore these modifiers. If
`--lint' is provided on the command line (*note Options::), `gawk'
@@ -4800,16 +4816,16 @@ an aligned two-column table of names and phone numbers, as shown here:
-| sdace 555-3430
-| sabafoo 555-2127
-In this case, the phone numbers had to be printed as strings because
+ In this case, the phone numbers had to be printed as strings because
the numbers are separated by a dash. Printing the phone numbers as
numbers would have produced just the first three digits: `555'. This
would have been pretty confusing.
-It wasn't necessary to specify a width for the phone numbers because
+ It wasn't necessary to specify a width for the phone numbers because
they are last on their lines. They don't need to have spaces after
them.
-The table could be made to look even nicer by adding headings to the
+ The table could be made to look even nicer by adding headings to the
tops of the columns. This is done using the `BEGIN' pattern (*note
BEGIN/END::) so that the headers are only printed once, at the
beginning of the `awk' program:
@@ -4818,7 +4834,7 @@ beginning of the `awk' program:
print "---- ------" }
{ printf "%-10s %s\n", $1, $2 }' BBS-list
-The above example mixed `print' and `printf' statements in the same
+ The above example mixed `print' and `printf' statements in the same
program. Using just `printf' statements can produce the same results:
awk 'BEGIN { printf "%-10s %s\n", "Name", "Number"
@@ -4829,15 +4845,15 @@ Printing each column heading with the same format specification used
for the column elements ensures that the headings are aligned just like
the columns.
-The fact that the same format specification is used three times can be
-emphasized by storing it in a variable, like this:
+ The fact that the same format specification is used three times can
+be emphasized by storing it in a variable, like this:
awk 'BEGIN { format = "%-10s %s\n"
printf format, "Name", "Number"
printf format, "----", "------" }
{ printf format, $1, $2 }' BBS-list
-At this point, it would be a worthwhile exercise to use the `printf'
+ At this point, it would be a worthwhile exercise to use the `printf'
statement to line up the headings and table data for the
`inventory-shipped' example that was covered earlier in the minor node
on the `print' statement (*note Print::).
@@ -4852,11 +4868,11 @@ So far, the output from `print' and `printf' has gone to the standard
output, usually the terminal. Both `print' and `printf' can also send
their output to other places. This is called "redirection".
-A redirection appears after the `print' or `printf' statement.
+ A redirection appears after the `print' or `printf' statement.
Redirections in `awk' are written just like redirections in shell
commands, except that they are written inside the `awk' program.
-There are four forms of output redirection: output to a file, output
+ There are four forms of output redirection: output to a file, output
appended to a file, output through a pipe to another command, and output
to a coprocess. They are all shown for the `print' statement, but they
work identically for `printf':
@@ -4929,7 +4945,7 @@ work identically for `printf':
The message is built using string concatenation and saved in the
variable `m'. It's then sent down the pipeline to the `mail'
program. (The parentheses group the items to concatenate--see
- *Note Concatenation::.)
+ *note Concatenation::.)
The `close' function is called here because it's a good idea to
close the pipe as soon as all the intended output has been sent to
@@ -4937,9 +4953,9 @@ work identically for `printf':
This example also illustrates the use of a variable to represent a
FILE or COMMAND--it is not necessary to always use a string
- constant. Using a variable is generally a good idea, because
- `awk' requires that the string value be spelled identically every
- time.
+ constant. Using a variable is generally a good idea, because (if
+ you mean to refer to that same file or command) `awk' requires
+ that the string value be spelled identically every time.
`print ITEMS |& COMMAND'
This type of redirection prints the items to the input of COMMAND.
@@ -4949,15 +4965,16 @@ work identically for `printf':
the `awk' program.
This feature is a `gawk' extension, and is not available in POSIX
- `awk'. *Note Two-way I/O::, for a more complete discussion.
+ `awk'. *Note Getline/Coprocess::, for a brief discussion. *Note
+ Two-way I/O::, for a more complete discussion.
-Redirecting output using `>', `>>', `|', or `|&' asks the system to
+ Redirecting output using `>', `>>', `|', or `|&' asks the system to
open a file, pipe, or coprocess only if the particular FILE or COMMAND
you specify has not already been written to by your program or if it
has been closed since it was last written to.
-It is a common error to use `>' redirection for the first `print' to a
-file, and then to use `>>' for subsequent output:
+ It is a common error to use `>' redirection for the first `print' to
+a file, and then to use `>>' for subsequent output:
# clear the file
print "Don't panic" > "guide.txt"
@@ -4968,12 +4985,15 @@ file, and then to use `>>' for subsequent output:
This is indeed how redirections must be used from the shell. But in
`awk', it isn't necessary. In this kind of case, a program should use
`>' for all the `print' statements, since the output file is only
-opened once.
+opened once. (It happens that if you mix `>' and `>>' that output is
+produced in the expected order. However, mixing the operators for the
+same file is definitely poor style, and is confusing to readers of your
+program.)
-Many `awk' implementations limit the number of pipelines that an `awk'
-program may have open to just one! In `gawk', there is no such limit.
-`gawk' allows a program to open as many pipelines as the underlying
-operating system permits.
+ Many `awk' implementations limit the number of pipelines that an
+`awk' program may have open to just one! In `gawk', there is no such
+limit. `gawk' allows a program to open as many pipelines as the
+underlying operating system permits.
Advanced Notes: Piping into `sh'
--------------------------------
@@ -4988,10 +5008,10 @@ lowercase. The following program is both simple and efficient:
END { close("sh") }
-The `tolower' function returns its argument string with all uppercase
-characters converted to lowercase (*note String Functions::). The
-program builds up a list of command lines, using the `mv' utility to
-rename the files. It then sends the list to the shell for execution.
+ The `tolower' function returns its argument string with all
+uppercase characters converted to lowercase (*note String Functions::).
+The program builds up a list of command lines, using the `mv' utility
+to rename the files. It then sends the list to the shell for execution.

File: gawk.info, Node: Special Files, Next: Close Files And Pipes, Prev: Redirection, Up: Printing
@@ -5025,7 +5045,7 @@ and `|' operators. Standard error is typically used for writing error
messages; the reason there are two separate streams, standard output
and standard error, is so that they can be redirected separately.
-In other implementations of `awk', the only way to write an error
+ In other implementations of `awk', the only way to write an error
message to standard error in an `awk' program is as follows:
print "Serious error detected!" | "cat 1>&2"
@@ -5044,7 +5064,7 @@ happens, writing to the terminal is not correct. In fact, if `awk' is
run from a background job, it may not have a terminal at all. Then
opening `/dev/tty' fails.
-`gawk' provides special file names for accessing the three standard
+ `gawk' provides special file names for accessing the three standard
streams, as well as any other inherited open files. If the file name
matches one of these special names when `gawk' redirects input or
output, then it directly uses the stream that the file name stands for.
@@ -5066,14 +5086,14 @@ been ported to, not just those that are POSIX-compliant:
the shell). Unless special pains are taken in the shell from which
`gawk' is invoked, only descriptors 0, 1, and 2 are available.
-The file names `/dev/stdin', `/dev/stdout', and `/dev/stderr' are
+ The file names `/dev/stdin', `/dev/stdout', and `/dev/stderr' are
aliases for `/dev/fd/0', `/dev/fd/1', and `/dev/fd/2', respectively.
However, they are more self-explanatory. The proper way to write an
error message in a `gawk' program is to use `/dev/stderr', like this:
print "Serious error detected!" > "/dev/stderr"
-Note the use of quotes around the file name. Like any other
+ Note the use of quotes around the file name. Like any other
redirection, the value must be a string. It is a common error to omit
the quotes, which leads to confusing results.
@@ -5126,9 +5146,9 @@ Pipes::). The file names are:
returned by the `getgroups' system call. (Multiple groups may not
be supported on all systems.)
-These special file names may be used on the command line as data files,
-as well as for I/O redirections within an `awk' program. They may not
-be used as source files with the `-f' option.
+ These special file names may be used on the command line as data
+files, as well as for I/O redirections within an `awk' program. They
+may not be used as source files with the `-f' option.
NOTE: The special files that provide process-related information
are now considered obsolete and will disappear entirely in the
@@ -5148,12 +5168,12 @@ using a special file name of the form:
`/inet/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'
-The PROTOCOL is one of `tcp', `udp', or `raw', and the other fields
+ The PROTOCOL is one of `tcp', `udp', or `raw', and the other fields
represent the other essential pieces of information for making a
networking connection. These file names are used with the `|&'
operator for communicating with a coprocess (*note Two-way I/O::).
This is an advanced feature, mentioned here only for completeness.
-Full discussion is delayed until *Note TCP/IP Networking::.
+Full discussion is delayed until *note TCP/IP Networking::.

File: gawk.info, Node: Special Caveats, Prev: Special Network, Up: Special Files
@@ -5181,9 +5201,9 @@ names that `gawk' provides:
any of the files related to file descriptors 0, 1, and 2. Doing
so results in unpredictable behavior.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Older versions of `gawk' would interpret these names internally
+ (1) Older versions of `gawk' would interpret these names internally
only if the system did not actually have a `/dev/fd' directory or any
of the other special files listed earlier. Usually this didn't make a
difference, but sometimes it did; thus, it was decided to make `gawk''s
@@ -5203,15 +5223,15 @@ time only. At that time, the first record of input is read from that
file or command. The next time the same file or command is used with
`getline', another record is read from it, and so on.
-Similarly, when a file or pipe is opened for output, the file name or
+ Similarly, when a file or pipe is opened for output, the file name or
command associated with it is remembered by `awk', and subsequent
writes to the same file or command are appended to the previous writes.
The file or pipe stays open until `awk' exits.
-This implies that special steps are necessary in order to read the same
-file again from the beginning, or to rerun a shell command (rather than
-reading more output from the same command). The `close' function makes
-these things possible:
+ This implies that special steps are necessary in order to read the
+same file again from the beginning, or to rerun a shell command (rather
+than reading more output from the same command). The `close' function
+makes these things possible:
close(FILENAME)
@@ -5219,9 +5239,9 @@ or:
close(COMMAND)
-The argument FILENAME or COMMAND can be any expression. Its value must
-_exactly_ match the string that was used to open the file or start the
-command (spaces and other "irrelevant" characters included). For
+ The argument FILENAME or COMMAND can be any expression. Its value
+must _exactly_ match the string that was used to open the file or start
+the command (spaces and other "irrelevant" characters included). For
example, if you open a pipe with this:
"sort -r names" | getline foo
@@ -5230,13 +5250,13 @@ then you must close it with this:
close("sort -r names")
-Once this function call is executed, the next `getline' from that file
-or command, or the next `print' or `printf' to that file or command,
-reopens the file or reruns the command. Because the expression that
-you use to close a file or pipeline must exactly match the expression
-used to open the file or run the command, it is good practice to use a
-variable to store the file name or command. The previous example
-becomes the following:
+ Once this function call is executed, the next `getline' from that
+file or command, or the next `print' or `printf' to that file or
+command, reopens the file or reruns the command. Because the
+expression that you use to close a file or pipeline must exactly match
+the expression used to open the file or run the command, it is good
+practice to use a variable to store the file name or command. The
+previous example becomes the following:
sortcom = "sort -r names"
sortcom | getline foo
@@ -5271,9 +5291,9 @@ programs. Here are some of the reasons for closing an output file:
the program closes the pipe after each line of output, then each
line makes a separate message.
-If you use more files than the system allows you to have open, `gawk'
-attempts to multiplex the available open files among your data files.
-`gawk''s ability to do this depends upon the facilities of your
+ If you use more files than the system allows you to have open,
+`gawk' attempts to multiplex the available open files among your data
+files. `gawk''s ability to do this depends upon the facilities of your
operating system, so it may not always work. It is therefore both good
practice and good portability advice to always use `close' on your
files when you are done with them. In fact, if you are using a lot of
@@ -5289,32 +5309,32 @@ consider something like this:
# need close(command) here
}
-This example creates a new pipeline based on data in _each_ record.
+ This example creates a new pipeline based on data in _each_ record.
Without the call to `close' indicated in the comment, `awk' creates
child processes to run the commands, until it eventually runs out of
file descriptors for more pipelines.
-Even though each command has finished (as indicated by the end-of-file
-return status from `getline'), the child process is not terminated;(1)
-more importantly, the file descriptor for the pipe is not closed and
-released until `close' is called or `awk' exits.
+ Even though each command has finished (as indicated by the
+end-of-file return status from `getline'), the child process is not
+terminated;(1) more importantly, the file descriptor for the pipe is
+not closed and released until `close' is called or `awk' exits.
-`close' will silently do nothing if given an argument that does not
+ `close' will silently do nothing if given an argument that does not
represent a file, pipe or coprocess that was opened with a redirection.
-Note also that `close(FILENAME)' has no "magic" effects on the implicit
-loop that reads through the files named on the command line. It is,
-more likely, a close of a file that was never opened, so `awk' silently
-does nothing.
+ Note also that `close(FILENAME)' has no "magic" effects on the
+implicit loop that reads through the files named on the command line.
+It is, more likely, a close of a file that was never opened, so `awk'
+silently does nothing.
-When using the `|&' operator to communicate with a coprocess, it is
+ When using the `|&' operator to communicate with a coprocess, it is
occasionally useful to be able to close one end of the two-way pipe
without closing the other. This is done by supplying a second argument
to `close'. As in any other call to `close', the first argument is the
name of the command or special file used to start the coprocess. The
second argument should be a string, with either of the values `"to"' or
`"from"'. Case does not matter. As this is an advanced feature, a
-more complete discussion is delayed until *Note Two-way I/O::, which
+more complete discussion is delayed until *note Two-way I/O::, which
discusses it in more detail and gives an example.
Advanced Notes: Using `close''s Return Value
@@ -5328,30 +5348,32 @@ statement. It is a syntax error to try and use the return value from
command | getline info
retval = close(command) # syntax error in most Unix awks
-`gawk' treats `close' as a function. The return value is -1 if the
+ `gawk' treats `close' as a function. The return value is -1 if the
argument names something that was never opened with a redirection, or
if there is a system problem closing the file or process. In these
cases, `gawk' sets the built-in variable `ERRNO' to a string describing
the problem.
-In `gawk', when closing a pipe or coprocess (input or output), the
+ In `gawk', when closing a pipe or coprocess (input or output), the
return value is the exit status of the command.(2) Otherwise, it is the
return value from the system's `close' or `fclose' C functions when
closing input or output files, respectively. This value is zero if the
close succeeds, or -1 if it fails.
-The POSIX standard is very vague; it says that `close' returns zero on
-success and non-zero otherwise. In general, different implementations
-vary in what they report when closing pipes; thus the return value
-cannot be used portably. (d.c.)
+ The POSIX standard is very vague; it says that `close' returns zero
+on success and non-zero otherwise. In general, different
+implementations vary in what they report when closing pipes; thus the
+return value cannot be used portably. (d.c.)
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The technical terminology is rather morbid. The finished child is
-called a "zombie," and cleaning up after it is referred to as "reaping."
+ (1) The technical terminology is rather morbid. The finished child
+is called a "zombie," and cleaning up after it is referred to as
+"reaping."
-(2) This is a full 16-bit value as returned by the `wait' system call.
-See the system manual pages for information on how to decode this value.
+ (2) This is a full 16-bit value as returned by the `wait' system
+call. See the system manual pages for information on how to decode this
+value.

File: gawk.info, Node: Expressions, Next: Patterns and Actions, Prev: Printing, Up: Top
@@ -5364,7 +5386,7 @@ actions. An expression evaluates to a value that you can print, test,
or pass to a function. Additionally, an expression can assign a new
value to a variable or a field by using an assignment operator.
-An expression can serve as a pattern or action statement on its own.
+ An expression can serve as a pattern or action statement on its own.
Most other kinds of statements contain one or more expressions that
specify the data on which to operate. As in other languages,
expressions in `awk' include variables, array references, constants,
@@ -5406,9 +5428,9 @@ The simplest type of expression is the "constant", which always has the
same value. There are three types of constants: numeric, string, and
regular expression.
-Each is used in the appropriate context when you need a data value that
-isn't going to change. Numeric constants can have different forms, but
-are stored identically internally.
+ Each is used in the appropriate context when you need a data value
+that isn't going to change. Numeric constants can have different
+forms, but are stored identically internally.
* Menu:
@@ -5431,7 +5453,7 @@ the same value:
1.05e+2
1050e-1
-A string constant consists of a sequence of characters enclosed in
+ A string constant consists of a sequence of characters enclosed in
double-quotation marks. For example:
"parrot"
@@ -5442,9 +5464,9 @@ eight-bit ASCII characters including ASCII NUL (character code zero).
Other `awk' implementations may have difficulty with some character
codes.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The internal representation of all numbers, including integers,
+ (1) The internal representation of all numbers, including integers,
uses double-precision floating-point numbers. On most modern systems,
these are in IEEE 754 standard format.
@@ -5466,8 +5488,8 @@ usually irrelevant; hexadecimal `a' and `A' have the same value.)
Thus, `11', in hexadecimal, is 1 times 16 plus 1, which equals 17 in
decimal.
-Just by looking at plain `11', you can't tell what base it's in. So,
-in C, C++, and other languages derived from C, there is a special
+ Just by looking at plain `11', you can't tell what base it's in.
+So, in C, C++, and other languages derived from C, there is a special
notation to help signify the base. Octal numbers start with a leading
`0', and hexadecimal numbers start with a leading `0x' or `0X':
@@ -5480,17 +5502,17 @@ notation to help signify the base. Octal numbers start with a leading
`0x11'
Hexadecimal 11, decimal value 17.
-This example shows the difference:
+ This example shows the difference:
$ gawk 'BEGIN { printf "%d, %d, %d\n", 011, 11, 0x11 }'
-| 9, 11, 17
-Being able to use octal and hexadecimal constants in your programs is
-most useful when working with data that cannot be represented
+ Being able to use octal and hexadecimal constants in your programs
+is most useful when working with data that cannot be represented
conveniently as characters or as regular numbers, such as binary data
of various sorts.
-`gawk' allows the use of octal and hexadecimal constants in your
+ `gawk' allows the use of octal and hexadecimal constants in your
program text. However, such numbers in the input data are not treated
differently; doing so by default would break old programs. (If you
really need to do this, use the `--non-decimal-data' command-line
@@ -5498,18 +5520,18 @@ option; *note Nondecimal Data::.) If you have octal or hexadecimal
data, you can use the `strtonum' function (*note String Functions::) to
convert the data into a number. Most of the time, you will want to use
octal or hexadecimal constants when working with the built-in bit
-manipulation functions; see *Note Bitwise Functions::, for more
+manipulation functions; see *note Bitwise Functions::, for more
information.
-Unlike some early C implementations, `8' and `9' are not valid in octal
-constants; e.g., `gawk' treats `018' as decimal 18:
+ Unlike some early C implementations, `8' and `9' are not valid in
+octal constants; e.g., `gawk' treats `018' as decimal 18:
$ gawk 'BEGIN { print "021 is", 021 ; print 018 }'
-| 021 is 17
-| 18
-Octal and hexadecimal source code constants are a `gawk' extension. If
-`gawk' is in compatibility mode (*note Options::), they are not
+ Octal and hexadecimal source code constants are a `gawk' extension.
+If `gawk' is in compatibility mode (*note Options::), they are not
available.
Advanced Notes: A Constant's Base Does Not Affect Its Value
@@ -5526,7 +5548,7 @@ for conversion of numbers to strings:

File: gawk.info, Node: Regexp Constants, Prev: Nondecimal-numbers, Up: Constants
-5.1.4 Regular Expression Constants
+5.1.3 Regular Expression Constants
----------------------------------
A regexp constant is a regular expression description enclosed in
@@ -5579,7 +5601,7 @@ assigns either zero or one to the variable `matches', depending upon
the contents of the current input record. This feature of the language
has never been well documented until the POSIX specification.
-Constant regular expressions are also used as the first argument for
+ Constant regular expressions are also used as the first argument for
the `gensub', `sub', and `gsub' functions, and as the second argument
of the `match' function (*note String Functions::). Modern
implementations of `awk', including `gawk', allow the third argument of
@@ -5604,8 +5626,8 @@ For example:
...
}
-In this example, the programmer wants to pass a regexp constant to the
-user-defined function `mysub', which in turn passes it on to either
+ In this example, the programmer wants to pass a regexp constant to
+the user-defined function `mysub', which in turn passes it on to either
`sub' or `gsub'. However, what really happens is that the `pat'
parameter is either one or zero, depending upon whether or not `$0'
matches `/hi/'. `gawk' issues a warning when it sees a regexp constant
@@ -5642,20 +5664,20 @@ a variable must be a sequence of letters, digits, or underscores, and
it may not begin with a digit. Case is significant in variable names;
`a' and `A' are distinct variables.
-A variable name is a valid expression by itself; it represents the
+ A variable name is a valid expression by itself; it represents the
variable's current value. Variables are given new values with
"assignment operators", "increment operators", and "decrement
operators". *Note Assignment Ops::.
-A few variables have special built-in meanings, such as `FS' (the field
-separator), and `NF' (the number of fields in the current input
+ A few variables have special built-in meanings, such as `FS' (the
+field separator), and `NF' (the number of fields in the current input
record). *Note Built-in Variables::, for a list of the built-in
variables. These built-in variables can be used and assigned just like
all other variables, but their values are also used or changed
automatically by `awk'. All built-in variables' names are entirely
uppercase.
-Variables in `awk' can be assigned either numeric or string values.
+ Variables in `awk' can be assigned either numeric or string values.
The kind of value a variable holds can change over the life of a
program. By default, variables are initialized to the empty string,
which is zero if converted to a number. There is no need to
@@ -5705,7 +5727,7 @@ second field is printed in lines from `BBS-list':
-| 555-3412
...
-Command-line arguments are made available for explicit examination by
+ Command-line arguments are made available for explicit examination by
the `awk' program in the `ARGV' array (*note ARGC and ARGV::). `awk'
processes the values of command-line assignments for escape sequences
(*note Escape Sequences::). (d.c.)
@@ -5731,7 +5753,7 @@ variables `two' and `three' are converted to strings and concatenated
together. The resulting string is converted back to the number 23, to
which 4 is then added.
-If, for some reason, you need to force a number to be converted to a
+ If, for some reason, you need to force a number to be converted to a
string, concatenate the empty string, `""', with that number. To force
a string to be converted to a number, add zero to that string. A
string is converted to a number by interpreting any numeric prefix of
@@ -5739,24 +5761,24 @@ the string as numerals: `"2.5"' converts to 2.5, `"1e3"' converts to
1000, and `"25fix"' has a numeric value of 25. Strings that can't be
interpreted as valid numbers convert to zero.
-The exact manner in which numbers are converted into strings is
+ The exact manner in which numbers are converted into strings is
controlled by the `awk' built-in variable `CONVFMT' (*note Built-in
Variables::). Numbers are converted using the `sprintf' function with
`CONVFMT' as the format specifier (*note String Functions::).
-`CONVFMT''s default value is `"%.6g"', which prints a value with at
+ `CONVFMT''s default value is `"%.6g"', which prints a value with at
least six significant digits. For some applications, you might want to
change it to specify more precision. On most modern machines, 17
digits is enough to capture a floating-point number's value exactly,
most of the time.(1)
-Strange results can occur if you set `CONVFMT' to a string that doesn't
-tell `sprintf' how to format floating-point numbers in a useful way.
-For example, if you forget the `%' in the format, `awk' converts all
-numbers to the same constant string. As a special case, if a number is
-an integer, then the result of converting it to a string is _always_ an
-integer, no matter what the value of `CONVFMT' may be. Given the
-following code fragment:
+ Strange results can occur if you set `CONVFMT' to a string that
+doesn't tell `sprintf' how to format floating-point numbers in a useful
+way. For example, if you forget the `%' in the format, `awk' converts
+all numbers to the same constant string. As a special case, if a
+number is an integer, then the result of converting it to a string is
+_always_ an integer, no matter what the value of `CONVFMT' may be.
+Given the following code fragment:
CONVFMT = "%2.2f"
a = 12
@@ -5764,7 +5786,7 @@ following code fragment:
`b' has the value `"12"', not `"12.00"'. (d.c.)
-Prior to the POSIX standard, `awk' used the value of `OFMT' for
+ Prior to the POSIX standard, `awk' used the value of `OFMT' for
converting numbers to strings. `OFMT' specifies the output format to
use when printing numbers with `print'. `CONVFMT' was introduced in
order to separate the semantics of conversion from the semantics of
@@ -5776,24 +5798,23 @@ older implementations of `awk'. We recommend that instead of changing
your programs, just port `gawk' itself. *Note Print::, for more
information on the `print' statement.
-Finally, once again, where you are can matter when it comes to
-converting between numbers and strings. In *Note Locales::, we
-mentioned that the local character set and language (the locale) can
-affect how `gawk' matches characters. The locale also affects numeric
-formats. In particular, for `awk' programs, it affects the decimal
-point character. The `"C"' locale, and most English-language locales,
-use the period character (`.') as the decimal point. However, many (if
-not most) European and non-English locales use the comma (`,') as the
-decimal point character.
-
-The POSIX standard says that `awk' always uses the period as the decimal
-point when reading the `awk' program source code, and for command-line
-variable assignments (*note Other Arguments::). However, when
-interpreting input data, for `print' and `printf' output, and for
+ And, once again, where you are can matter when it comes to converting
+between numbers and strings. In *note Locales::, we mentioned that the
+local character set and language (the locale) can affect how `gawk'
+matches characters. The locale also affects numeric formats. In
+particular, for `awk' programs, it affects the decimal point character.
+The `"C"' locale, and most English-language locales, use the period
+character (`.') as the decimal point. However, many (if not most)
+European and non-English locales use the comma (`,') as the decimal
+point character.
+
+ The POSIX standard says that `awk' always uses the period as the
+decimal point when reading the `awk' program source code, and for
+command-line variable assignments (*note Other Arguments::). However,
+when interpreting input data, for `print' and `printf' output, and for
number to string conversion, the local decimal point character is used.
-As of version 3.1.3, `gawk' fully complies with this aspect of the
-standard. Here are some examples indicating the difference in behavior,
-on a GNU/Linux system:
+Here are some examples indicating the difference in behavior, on a
+GNU/Linux system:
$ gawk 'BEGIN { printf "%g\n", 3.1415927 }'
-| 3.14159
@@ -5809,10 +5830,38 @@ the decimal point separator. In the normal `"C"' locale, `gawk' treats
`4,321' as `4', while in the Danish locale, it's treated as the full
number, `4.321'.
----------- Footnotes ----------
+ For version 3.1.3 through 3.1.5, `gawk' fully complied with this
+aspect of the standard. However, many users in non-English locales
+complained about this behavior, since their data used a period as the
+decimal point. Beginning in version 3.1.6, the default behavior was
+restored to use a period as the decimal point character. You can use
+the `--use-lc-numeric' option (*note Options::) to force `gawk' to use
+the locale's decimal point character. (`gawk' also uses the locale's
+decimal point character when in POSIX mode, either via `--posix', or
+the `POSIXLY_CORRECT' environment variable.)
+
+ The following table describes the cases in which the locale's decimal
+point character is used and when a period is used. Some of these
+features have not been described yet.
+
+Feature Default `--posix' or `--use-lc-numeric'
+------------------------------------------------------------
+`%'g' Use locale Use locale
+`%g' Use period Use locale
+Input Use period Use locale
+`strtonum' Use period Use locale
+
+Table 5.1: Locale Decimal Point versus A Period
+
+ Finally, modern day formal standards and IEEE standard floating point
+representation can have an unusual but important effect on the way
+`gawk' converts some special string values to numbers. The details are
+presented in *note POSIX Floating Point Problems::.
+
+ ---------- Footnotes ----------
-(1) Pathological cases can require up to 752 digits (!), but we doubt
-that you need to worry about this.
+ (1) Pathological cases can require up to 752 digits (!), but we
+doubt that you need to worry about this.

File: gawk.info, Node: Arithmetic Ops, Next: Concatenation, Prev: Conversion, Up: Expressions
@@ -5824,9 +5873,9 @@ The `awk' language uses the common arithmetic operators when evaluating
expressions. All of these arithmetic operators follow normal
precedence rules and work as you would expect them to.
-The following example uses a file named `grades', which contains a list
-of student names as well as three test scores per student (it's a small
-class):
+ The following example uses a file named `grades', which contains a
+list of student names as well as three test scores per student (it's a
+small class):
Pat 100 97 58
Sandy 84 72 93
@@ -5841,8 +5890,8 @@ scores:
-| Sandy 83
-| Chris 84.3333
-The following list provides the arithmetic operators in `awk', in order
-from the highest precedence to the lowest:
+ The following list provides the arithmetic operators in `awk', in
+order from the highest precedence to the lowest:
`- X'
Negation.
@@ -5876,24 +5925,24 @@ from the highest precedence to the lowest:
`X - Y'
Subtraction.
-Unary plus and minus have the same precedence, the multiplication
+ Unary plus and minus have the same precedence, the multiplication
operators all have the same precedence, and addition and subtraction
have the same precedence.
-When computing the remainder of `X % Y', the quotient is rounded toward
-zero to an integer and multiplied by Y. This result is subtracted from
-X; this operation is sometimes known as "trunc-mod." The following
-relation always holds:
+ When computing the remainder of `X % Y', the quotient is rounded
+toward zero to an integer and multiplied by Y. This result is
+subtracted from X; this operation is sometimes known as "trunc-mod."
+The following relation always holds:
b * int(a / b) + (a % b) == a
-One possibly undesirable effect of this definition of remainder is that
-`X % Y' is negative if X is negative. Thus:
+ One possibly undesirable effect of this definition of remainder is
+that `X % Y' is negative if X is negative. Thus:
-17 % 8 = -1
-In other `awk' implementations, the signedness of the remainder may be
-machine-dependent.
+ In other `awk' implementations, the signedness of the remainder may
+be machine-dependent.
NOTE: The POSIX standard only specifies the use of `^' for
exponentiation. For maximum portability, do not use the `**'
@@ -5908,39 +5957,40 @@ File: gawk.info, Node: Concatenation, Next: Assignment Ops, Prev: Arithmetic
It seemed like a good idea at the time.
Brian Kernighan
-There is only one string operation: concatenation. It does not have a
-specific operator to represent it. Instead, concatenation is performed
-by writing expressions next to one another, with no operator. For
-example:
+ There is only one string operation: concatenation. It does not have
+a specific operator to represent it. Instead, concatenation is
+performed by writing expressions next to one another, with no operator.
+For example:
$ awk '{ print "Field number one: " $1 }' BBS-list
-| Field number one: aardvark
-| Field number one: alpo-net
...
-Without the space in the string constant after the `:', the line runs
-together. For example:
+ Without the space in the string constant after the `:', the line
+runs together. For example:
$ awk '{ print "Field number one:" $1 }' BBS-list
-| Field number one:aardvark
-| Field number one:alpo-net
...
-Because string concatenation does not have an explicit operator, it is
-often necessary to insure that it happens at the right time by using
-parentheses to enclose the items to concatenate. For example, the
-following code fragment does not concatenate `file' and `name' as you
-might expect:
+ Because string concatenation does not have an explicit operator, it
+is often necessary to insure that it happens at the right time by using
+parentheses to enclose the items to concatenate. For example, you
+might expect that the following code fragment concatenates `file' and
+`name':
file = "file"
name = "name"
print "something meaningful" > file name
-It is necessary to use the following:
+This produces a syntax error with Unix `awk'.(1) It is necessary to use
+the following:
print "something meaningful" > (file name)
-Parentheses should be used around concatenation in all but the most
+ Parentheses should be used around concatenation in all but the most
common contexts, such as on the righthand side of `='. Be careful
about the kinds of expressions used in string concatenation. In
particular, the order of evaluation of expressions used for
@@ -5961,25 +6011,30 @@ counter-intuitive. Consider this example:
$ awk 'BEGIN { print -12 " " -24 }'
-| -12-24
-This "obviously" is concatenating -12, a space, and -24. But where did
-the space disappear to? The answer lies in the combination of operator
-precedences and `awk''s automatic conversion rules. To get the desired
-result, write the program in the following manner:
+ This "obviously" is concatenating -12, a space, and -24. But where
+did the space disappear to? The answer lies in the combination of
+operator precedences and `awk''s automatic conversion rules. To get
+the desired result, write the program in the following manner:
$ awk 'BEGIN { print -12 " " (-24) }'
-| -12 -24
-This forces `awk' to treat the `-' on the `-24' as unary. Otherwise,
-it's parsed as follows:
+ This forces `awk' to treat the `-' on the `-24' as unary.
+Otherwise, it's parsed as follows:
-12 (`" "' - 24)
=> -12 (0 - 24)
=> -12 (-24)
=> -12-24
-As mentioned earlier, when doing concatenation, _parenthesize_.
+ As mentioned earlier, when doing concatenation, _parenthesize_.
Otherwise, you're never quite sure what you'll get.
+ ---------- Footnotes ----------
+
+ (1) It happens that `gawk' and `mawk' "get it right," but you should
+not rely on this.
+

File: gawk.info, Node: Assignment Ops, Next: Increment Ops, Prev: Concatenation, Up: Expressions
@@ -5992,11 +6047,12 @@ variable `z':
z = 1
-After this expression is executed, the variable `z' has the value one.
-Whatever old value `z' had before the assignment is forgotten.
+ After this expression is executed, the variable `z' has the value
+one. Whatever old value `z' had before the assignment is forgotten.
-Assignments can also store string values. For example, the following
-stores the value `"this food is good"' in the variable `message':
+ Assignments can also store string values. For example, the
+following stores the value `"this food is good"' in the variable
+`message':
thing = "food"
predicate = "good"
@@ -6011,7 +6067,7 @@ An assignment operator is different; it does produce a value, but even
if you ignore it, the assignment still makes itself felt through the
alteration of the variable. We call this a "side effect".
-The lefthand operand of an assignment need not be a variable (*note
+ The lefthand operand of an assignment need not be a variable (*note
Variables::); it can also be a field (*note Changing Fields::) or an
array element (*note Arrays::). These are all called "lvalues", which
means they can appear on the lefthand side of an assignment operator.
@@ -6019,7 +6075,7 @@ The righthand operand may be any expression; it produces the new value
that the assignment stores in the specified variable, field, or array
element. (Such values are called "rvalues".)
-It is important to note that variables do _not_ have permanent types.
+ It is important to note that variables do _not_ have permanent types.
A variable's type is simply the type of whatever value it happens to
hold at the moment. In the following program fragment, the variable
`foo' has a numeric value at first, and a string value later on:
@@ -6032,7 +6088,7 @@ hold at the moment. In the following program fragment, the variable
When the second assignment gives `foo' a string value, the fact that it
previously had a numeric value is forgotten.
-String values that do not begin with a digit have a numeric value of
+ String values that do not begin with a digit have a numeric value of
zero. After executing the following code, the value of `foo' is five:
foo = "a string"
@@ -6043,10 +6099,10 @@ zero. After executing the following code, the value of `foo' is five:
examples illustrate how `awk' works, _not_ how you should write
your programs!
-An assignment is an expression, so it has a value--the same value that
-is assigned. Thus, `z = 1' is an expression with the value one. One
-consequence of this is that you can write multiple assignments together,
-such as:
+ An assignment is an expression, so it has a value--the same value
+that is assigned. Thus, `z = 1' is an expression with the value one.
+One consequence of this is that you can write multiple assignments
+together, such as:
x = y = z = 5
@@ -6055,13 +6111,13 @@ and `z'). It does so because the value of `z = 5', which is five, is
stored into `y' and then the value of `y = z = 5', which is five, is
stored into `x'.
-Assignments may be used anywhere an expression is called for. For
+ Assignments may be used anywhere an expression is called for. For
example, it is valid to write `x != (y = 1)' to set `y' to one, and
then test whether `x' equals one. But this style tends to make
programs hard to read; such nesting of assignments should be avoided,
except perhaps in a one-shot program.
-Aside from `=', there are several other assignment operators that do
+ Aside from `=', there are several other assignment operators that do
arithmetic with the old value of the variable. For example, the
operator `+=' computes a new value by adding the righthand value to the
old value of the variable. Thus, the following assignment adds five to
@@ -6075,8 +6131,8 @@ This is equivalent to the following:
Use whichever makes the meaning of your program clearer.
-There are situations where using `+=' (or any assignment operator) is
-_not_ the same as simply repeating the lefthand operand in the
+ There are situations where using `+=' (or any assignment operator)
+is _not_ the same as simply repeating the lefthand operand in the
righthand expression. For example:
# Thanks to Pat Rankin for this example
@@ -6093,7 +6149,7 @@ righthand expression. For example:
The indices of `bar' are practically guaranteed to be different, because
`rand' returns different values each time it is called. (Arrays and
the `rand' function haven't been covered yet. *Note Arrays::, and see
-*Note Numeric Functions::, for more information). This example
+*note Numeric Functions::, for more information). This example
illustrates an important fact about assignment operators: the lefthand
expression is only evaluated _once_. It is up to the implementation as
to which expression is evaluated first, the lefthand or the righthand.
@@ -6104,29 +6160,22 @@ Consider this example:
The value of `a[3]' could be either two or four.
-*Note table-assign-ops:: lists the arithmetic assignment operators. In
-each case, the righthand operand is an expression whose value is
+ *note table-assign-ops:: lists the arithmetic assignment operators.
+In each case, the righthand operand is an expression whose value is
converted to a number.
Operator Effect
---------------------------------------------------------------------------
+--------------------------------------------------------------------------
LVALUE `+=' INCREMENT Adds INCREMENT to the value of LVALUE.
---------------------------------------------------------------------------
LVALUE `-=' DECREMENT Subtracts DECREMENT from the value of LVALUE.
---------------------------------------------------------------------------
LVALUE `*=' Multiplies the value of LVALUE by COEFFICIENT.
-COEFFICIENT
---------------------------------------------------------------------------
+COEFFICIENT
LVALUE `/=' DIVISOR Divides the value of LVALUE by DIVISOR.
---------------------------------------------------------------------------
LVALUE `%=' MODULUS Sets LVALUE to its remainder by MODULUS.
---------------------------------------------------------------------------
-LVALUE `^=' POWER
---------------------------------------------------------------------------
+LVALUE `^=' POWER
LVALUE `**=' POWER Raises LVALUE to the power POWER.
---------------------------------------------------------------------------
-Table 5.1: Arithmetic Assignment Operators
+Table 5.2: Arithmetic Assignment Operators
NOTE: Only the `^=' operator is specified by POSIX. For maximum
portability, do not use the `**=' operator.
@@ -6148,8 +6197,8 @@ A workaround is:
awk '/[=]=/' /dev/null
-`gawk' does not have this problem, nor do the other freely available
-versions described in *Note Other Versions::.
+ `gawk' does not have this problem, nor do the other freely available
+versions described in *note Other Versions::.

File: gawk.info, Node: Increment Ops, Next: Truth Values, Prev: Assignment Ops, Up: Expressions
@@ -6162,7 +6211,7 @@ a variable by one. An assignment operator can do the same thing, so
the increment operators add no power to the `awk' language; however,
they are convenient abbreviations for very common operations.
-The operator used for adding one is written `++'. It can be used to
+ The operator used for adding one is written `++'. It can be used to
increment a variable either before or after taking its value. To
pre-increment a variable `v', write `++v'. This adds one to the value
of `v'--that new value is also the value of the expression. (The
@@ -6175,18 +6224,18 @@ four, but it changes the value of `foo' to five. In other words, the
operator returns the old value of the variable, but with the side
effect of incrementing it.
-The post-increment `foo++' is nearly the same as writing `(foo += 1) -
-1'. It is not perfectly equivalent because all numbers in `awk' are
+ The post-increment `foo++' is nearly the same as writing `(foo += 1)
+- 1'. It is not perfectly equivalent because all numbers in `awk' are
floating-point--in floating-point, `foo + 1 - 1' does not necessarily
equal `foo'. But the difference is minute as long as you stick to
numbers that are fairly small (less than 10e12).
-Fields and array elements are incremented just like variables. (Use
+ Fields and array elements are incremented just like variables. (Use
`$(i++)' when you want to do a field reference and a variable increment
at the same time. The parentheses are necessary because of the
precedence of the field reference operator `$'.)
-The decrement operator `--' works just like `++', except that it
+ The decrement operator `--' works just like `++', except that it
subtracts one instead of adding it. As with `++', it can be used before
the lvalue to pre-decrement or after it to post-decrement. Following
is a summary of increment and decrement expressions:
@@ -6227,15 +6276,15 @@ Or something even stranger?
b += ++b + b++
print b
-In other words, when do the various side effects prescribed by the
+ In other words, when do the various side effects prescribed by the
postfix operators (`b++') take effect? When side effects happen is
"implementation defined". In other words, it is up to the particular
version of `awk'. The result for the first example may be 12 or 13,
and for the second, it may be 22 or 23.
-In short, doing things like this is not recommended and definitely not
-anything that you can rely upon for portability. You should avoid such
-things in your own programs.
+ In short, doing things like this is not recommended and definitely
+not anything that you can rely upon for portability. You should avoid
+such things in your own programs.

File: gawk.info, Node: Truth Values, Next: Typing and Comparison, Prev: Increment Ops, Up: Expressions
@@ -6261,7 +6310,7 @@ value' three times:
print "A strange truth value"
}
-There is a surprising consequence of the "nonzero or non-null" rule:
+ There is a surprising consequence of the "nonzero or non-null" rule:
the string constant `"0"' is actually true, because it is non-null.
(d.c.)
@@ -6274,9 +6323,21 @@ File: gawk.info, Node: Typing and Comparison, Next: Boolean Ops, Prev: Truth
The Guide is definitive. Reality is frequently inaccurate.
The Hitchhiker's Guide to the Galaxy
-Unlike other programming languages, `awk' variables do not have a fixed
-type. Instead, they can be either a number or a string, depending upon
-the value that is assigned to them.
+ Unlike other programming languages, `awk' variables do not have a
+fixed type. Instead, they can be either a number or a string, depending
+upon the value that is assigned to them. We look now at how variables
+are typed, and how `awk' compares variables.
+
+* Menu:
+
+* Variable Typing:: String type versus numeric type.
+* Comparison Operators:: The comparison operators.
+
+
+File: gawk.info, Node: Variable Typing, Next: Comparison Operators, Up: Typing and Comparison
+
+5.10.1 String Type Versus Numeric Type
+--------------------------------------
The 1992 POSIX standard introduced the concept of a "numeric string",
which is simply a string that looks like a number--for example,
@@ -6300,16 +6361,17 @@ these rules:
* Attributes propagate across assignments but are not changed by any
use.
-The last rule is particularly important. In the following program, `a'
-has numeric type, even though it is later used in a string operation:
+ The last rule is particularly important. In the following program,
+`a' has numeric type, even though it is later used in a string
+operation:
BEGIN {
- a = 12.345
- b = a " is a cute number"
- print b
+ a = 12.345
+ b = a " is a cute number"
+ print b
}
-When two operands are compared, either string comparison or numeric
+ When two operands are compared, either string comparison or numeric
comparison may be used. This depends upon the attributes of the
operands, according to the following symmetric matrix:
@@ -6324,45 +6386,75 @@ operands, according to the following symmetric matrix:
STRNUM | string numeric numeric
-------+---------------------------------------------
-The basic idea is that user input that looks numeric--and _only_ user
-input--should be treated as numeric, even though it is actually made of
-characters and is therefore also a string. Thus, for example, the
-string constant `" +3.14"' is a string, even though it looks numeric,
-and is _never_ treated as number for comparison purposes.
+ The basic idea is that user input that looks numeric--and _only_
+user input--should be treated as numeric, even though it is actually
+made of characters and is therefore also a string. Thus, for example,
+the string constant `" +3.14"', when it appears in program source code,
+is a string--even though it looks numeric--and is _never_ treated as
+number for comparison purposes.
-In short, when one operand is a "pure" string, such as a string
+ In short, when one operand is a "pure" string, such as a string
constant, then a string comparison is performed. Otherwise, a numeric
comparison is performed.(1)
+ This point bears additional emphasis: All user input is made of
+characters, and so is first and foremost of STRING type; input strings
+that look numeric are additionally given the STRNUM attribute. Thus,
+the six-character input string ` +3.14' receives the STRNUM attribute.
+In contrast, the eight-character literal `" +3.14"' appearing in
+program text is a string constant. The following examples print `1'
+when the comparison between the two different constants is true, `0'
+otherwise:
+
+ $ echo ' +3.14' | gawk '{ print $0 == " +3.14" }' True
+ -| 1
+ $ echo ' +3.14' | gawk '{ print $0 == "+3.14" }' False
+ -| 0
+ $ echo ' +3.14' | gawk '{ print $0 == "3.14" }' False
+ -| 0
+ $ echo ' +3.14' | gawk '{ print $0 == 3.14 }' True
+ -| 1
+ $ echo ' +3.14' | gawk '{ print $1 == " +3.14" }' False
+ -| 0
+ $ echo ' +3.14' | gawk '{ print $1 == "+3.14" }' True
+ -| 1
+ $ echo ' +3.14' | gawk '{ print $1 == "3.14" }' False
+ -| 0
+ $ echo ' +3.14' | gawk '{ print $1 == 3.14 }' True
+ -| 1
+
+ ---------- Footnotes ----------
+
+ (1) The POSIX standard has been revised. The revised standard's
+rules for typing and comparison are the same as just described for
+`gawk'.
+
+
+File: gawk.info, Node: Comparison Operators, Prev: Variable Typing, Up: Typing and Comparison
+
+5.10.2 Comparison Operators
+---------------------------
+
"Comparison expressions" compare strings or numbers for relationships
such as equality. They are written using "relational operators", which
-are a superset of those in C. *Note table-relational-ops:: describes
+are a superset of those in C. *note table-relational-ops:: describes
them.
Expression Result
---------------------------------------------------------------------------
+--------------------------------------------------------------------------
X `<' Y True if X is less than Y.
---------------------------------------------------------------------------
X `<=' Y True if X is less than or equal to Y.
---------------------------------------------------------------------------
X `>' Y True if X is greater than Y.
---------------------------------------------------------------------------
X `>=' Y True if X is greater than or equal to Y.
---------------------------------------------------------------------------
X `==' Y True if X is equal to Y.
---------------------------------------------------------------------------
X `!=' Y True if X is not equal to Y.
---------------------------------------------------------------------------
X `~' Y True if the string X matches the regexp denoted by Y.
---------------------------------------------------------------------------
X `!~' Y True if the string X does not match the regexp
denoted by Y.
---------------------------------------------------------------------------
SUBSCRIPT `in' True if the array ARRAY has an element with the
ARRAY subscript SUBSCRIPT.
---------------------------------------------------------------------------
-Table 5.2: Relational Operators
+Table 5.3: Relational Operators
Comparison expressions have the value one if true and zero if false.
When comparing operands of mixed types, numeric operands are converted
@@ -6387,7 +6479,7 @@ Unless `b' happens to be zero or the null string, the `if' part of the
test always succeeds. Because the operators are so similar, this kind
of error is very difficult to spot when scanning the source code.
-The following table of expressions illustrates the kind of comparison
+ The following table of expressions illustrates the kind of comparison
`gawk' performs, as well as what the result of the comparison is:
`1.5 <= 2.0'
@@ -6411,7 +6503,7 @@ The following table of expressions illustrates the kind of comparison
`a == b'
string comparison (false)
-In the next example:
+ In the next example:
$ echo 1e2 3 | awk '{ print ($1 < $2) ? "true" : "false" }'
-| false
@@ -6434,26 +6526,21 @@ By contrast:
has the value one if `x' contains `foo', such as `"Oh, what a fool am
I!"'.
-The righthand operand of the `~' and `!~' operators may be either a
+ The righthand operand of the `~' and `!~' operators may be either a
regexp constant (`/.../') or an ordinary expression. In the latter
case, the value of the expression as a string is used as a dynamic
regexp (*note Regexp Usage::; also *note Computed Regexps::).
-In modern implementations of `awk', a constant regular expression in
+ In modern implementations of `awk', a constant regular expression in
slashes by itself is also an expression. The regexp `/REGEXP/' is an
abbreviation for the following comparison expression:
$0 ~ /REGEXP/
-One special place where `/foo/' is _not_ an abbreviation for `$0 ~
+ One special place where `/foo/' is _not_ an abbreviation for `$0 ~
/foo/' is when it is the righthand operand of `~' or `!~'. *Note Using
Constant Regexps::, where this is discussed in more detail.
----------- Footnotes ----------
-
-(1) The POSIX standard is under revision. The revised standard's rules
-for typing and comparison are the same as just described for `gawk'.
-

File: gawk.info, Node: Boolean Ops, Next: Conditional Exp, Prev: Typing and Comparison, Up: Expressions
@@ -6467,14 +6554,14 @@ The truth value of the Boolean expression is computed by combining the
truth values of the component expressions. Boolean expressions are
also referred to as "logical expressions". The terms are equivalent.
-Boolean expressions can be used wherever comparison and matching
+ Boolean expressions can be used wherever comparison and matching
expressions can be used. They can be used in `if', `while', `do', and
`for' statements (*note Statements::). They have numeric values (one
if true, zero if false) that come into play if the result of the
Boolean expression is stored in a variable or used in arithmetic.
-In addition, every Boolean expression is also a valid pattern, so you
-can use one as a pattern to control the execution of rules. The
+ In addition, every Boolean expression is also a valid pattern, so
+you can use one as a pattern to control the execution of rules. The
Boolean operators are:
`BOOLEAN1 && BOOLEAN2'
@@ -6498,8 +6585,8 @@ Boolean operators are:
if ($0 ~ /2400/ || $0 ~ /foo/) print
The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is false.
- This can make a difference when BOOLEAN2 contains expressions
- that have side effects.
+ This can make a difference when BOOLEAN2 contains expressions that
+ have side effects.
`! BOOLEAN'
True if BOOLEAN is false. For example, the following program
@@ -6509,23 +6596,24 @@ Boolean operators are:
BEGIN { if (! ("HOME" in ENVIRON))
print "no home!" }
- (The `in' operator is described in *Note Reference to Elements::.)
+ (The `in' operator is described in *note Reference to Elements::.)
-The `&&' and `||' operators are called "short-circuit" operators
+ The `&&' and `||' operators are called "short-circuit" operators
because of the way they work. Evaluation of the full expression is
"short-circuited" if the result can be determined part way through its
evaluation.
-Statements that use `&&' or `||' can be continued simply by putting a
-newline after them. But you cannot put a newline in front of either of
-these operators without using backslash continuation (*note
+ Statements that use `&&' or `||' can be continued simply by putting
+a newline after them. But you cannot put a newline in front of either
+of these operators without using backslash continuation (*note
Statements/Lines::).
-The actual value of an expression using the `!' operator is either one
-or zero, depending upon the truth value of the expression it is applied
-to. The `!' operator is often useful for changing the sense of a flag
-variable from false to true and back again. For example, the following
-program is one way to print lines in between special bracketing lines:
+ The actual value of an expression using the `!' operator is either
+one or zero, depending upon the truth value of the expression it is
+applied to. The `!' operator is often useful for changing the sense of
+a flag variable from false to true and back again. For example, the
+following program is one way to print lines in between special
+bracketing lines:
$1 == "START" { interested = ! interested; next }
interested == 1 { print }
@@ -6536,14 +6624,19 @@ initialized to zero, which is also false. When a line is seen whose
first field is `START', the value of `interested' is toggled to true,
using `!'. The next rule prints lines as long as `interested' is true.
When a line is seen whose first field is `END', `interested' is toggled
-back to false.
+back to false.(1)
- NOTE: The `next' statement is discussed in *Note Next Statement::.
+ NOTE: The `next' statement is discussed in *note Next Statement::.
`next' tells `awk' to skip the rest of the rules, get the next
record, and start processing the rules over again at the top. The
reason it's there is to avoid printing the bracketing `START' and
`END' lines.
+ ---------- Footnotes ----------
+
+ (1) This program has a bug; it prints lines starting with `END'. How
+would you fix it?
+

File: gawk.info, Node: Conditional Exp, Next: Function Calls, Prev: Boolean Ops, Up: Expressions
@@ -6566,7 +6659,7 @@ following expression produces the absolute value of `x':
x >= 0 ? x : -x
-Each time the conditional expression is computed, only one of
+ Each time the conditional expression is computed, only one of
IF-TRUE-EXP and IF-FALSE-EXP is used; the other is ignored. This is
important when the expressions have side effects. For example, this
conditional expression examines element `i' of either array `a' or
@@ -6578,7 +6671,7 @@ This is guaranteed to increment `i' exactly once, because each time
only one of the two increment expressions is executed and the other is
not. *Note Arrays::, for more information about arrays.
-As a minor `gawk' extension, a statement that uses `?:' can be
+ As a minor `gawk' extension, a statement that uses `?:' can be
continued simply by putting a newline after either character. However,
putting a newline in front of either character does not work without
using backslash continuation (*note Statements/Lines::). If `--posix'
@@ -6594,14 +6687,14 @@ A "function" is a name for a particular calculation. This enables you
to ask for it by name at any point in the program. For example, the
function `sqrt' computes the square root of a number.
-A fixed set of functions are "built-in", which means they are available
-in every `awk' program. The `sqrt' function is one of these. *Note
-Built-in::, for a list of built-in functions and their descriptions.
-In addition, you can define functions for use in your program. *Note
-User-defined::, for instructions on how to do this.
+ A fixed set of functions are "built-in", which means they are
+available in every `awk' program. The `sqrt' function is one of these.
+*Note Built-in::, for a list of built-in functions and their
+descriptions. In addition, you can define functions for use in your
+program. *Note User-defined::, for instructions on how to do this.
-The way to use a function is with a "function call" expression, which
-consists of the function name followed immediately by a list of
+ The way to use a function is with a "function call" expression,
+which consists of the function name followed immediately by a list of
"arguments" in parentheses. The arguments are expressions that provide
the raw materials for the function's calculations. When there is more
than one argument, they are separated by commas. If there are no
@@ -6612,32 +6705,32 @@ examples show function calls with and without arguments:
atan2(y, x) two arguments
rand() no arguments
-*Caution:* Do not put any space between the function name and the
+ *Caution:* Do not put any space between the function name and the
open-parenthesis! A user-defined function name looks just like the
name of a variable--a space would make the expression look like
concatenation of a variable with an expression inside parentheses.
-With built-in functions, space before the parenthesis is harmless, but
-it is best not to get into the habit of using space to avoid mistakes
-with user-defined functions. Each function expects a particular number
-of arguments. For example, the `sqrt' function must be called with a
-single argument, the number of which to take the square root:
+ With built-in functions, space before the parenthesis is harmless,
+but it is best not to get into the habit of using space to avoid
+mistakes with user-defined functions. Each function expects a
+particular number of arguments. For example, the `sqrt' function must
+be called with a single argument, the number of which to take the
+square root:
sqrt(ARGUMENT)
-Some of the built-in functions have one or more optional arguments. If
-those arguments are not supplied, the functions use a reasonable
+ Some of the built-in functions have one or more optional arguments.
+If those arguments are not supplied, the functions use a reasonable
default value. *Note Built-in::, for full details. If arguments are
omitted in calls to user-defined functions, then those arguments are
treated as local variables and initialized to the empty string (*note
User-defined::).
-Like every other expression, the function call has a value, which is
+ Like every other expression, the function call has a value, which is
computed by the function based on the arguments you give it. In this
example, the value of `sqrt(ARGUMENT)' is the square root of ARGUMENT.
-A function can also have side effects, such as assigning values to
-certain variables or doing I/O. The following program reads numbers,
-one number per line, and prints the square root of each one:
+The following program reads numbers, one number per line, and prints the
+square root of each one:
$ awk '{ print "The square root of", $1, "is", sqrt($1) }'
1
@@ -6648,6 +6741,28 @@ one number per line, and prints the square root of each one:
-| The square root of 5 is 2.23607
Ctrl-d
+ A function can also have side effects, such as assigning values to
+certain variables or doing I/O. This program shows how the `match'
+function (*note String Functions::) changes the variables `RSTART' and
+`RLENGTH':
+
+ {
+ if (match($1, $2))
+ print RSTART, RLENGTH
+ else
+ print "no match"
+ }
+
+Here is a sample run:
+
+ $ awk -f matchit.awk
+ aaccdd c+
+ -| 3 2
+ foo bar
+ -| no match
+ abcdefg e
+ -| 5 1
+

File: gawk.info, Node: Precedence, Prev: Function Calls, Up: Expressions
@@ -6659,7 +6774,7 @@ different operators appear close by in one expression. For example,
`*' has higher precedence than `+'; thus, `a + b * c' means to multiply
`b' and `c', and then add `a' to the product (i.e., `a + (b * c)').
-The normal precedence of the operators can be overruled by using
+ The normal precedence of the operators can be overruled by using
parentheses. Think of the precedence rules as saying where the
parentheses are assumed to be. In fact, it is wise to always use
parentheses whenever there is an unusual combination of operators,
@@ -6668,20 +6783,25 @@ precedence is in this case. Even experienced programmers occasionally
forget the exact rules, which leads to mistakes. Explicit parentheses
help prevent any such mistakes.
-When operators of equal precedence are used together, the leftmost
+ When operators of equal precedence are used together, the leftmost
operator groups first, except for the assignment, conditional, and
exponentiation operators, which group in the opposite order. Thus, `a
- b + c' groups as `(a - b) + c' and `a = b = c' groups as `a = (b =
c)'.
-The precedence of prefix unary operators does not matter as long as only
-unary operators are involved, because there is only one way to interpret
-them: innermost first. Thus, `$++i' means `$(++i)' and `++$x' means
-`++($x)'. However, when another operator follows the operand, then the
-precedence of the unary operators can matter. `$x^2' means `($x)^2',
-but `-x^2' means `-(x^2)', because `-' has lower precedence than `^',
-whereas `$' has higher precedence. This table presents `awk''s
-operators, in order of highest to lowest precedence:
+ Normally the precedence of prefix unary operators does not matter,
+because there is only one way to interpret them: innermost first.
+Thus, `$++i' means `$(++i)' and `++$x' means `++($x)'. However, when
+another operator follows the operand, then the precedence of the unary
+operators can matter. `$x^2' means `($x)^2', but `-x^2' means
+`-(x^2)', because `-' has lower precedence than `^', whereas `$' has
+higher precedence. Also, operators cannot be combined in a way that
+violates the precedence rules; for example, `$$0++--' is not a valid
+expression because the first `$' has higher precedence than the `++';
+to avoid the problem the expression can be rewritten as `$($0++)--'.
+
+ This table presents `awk''s operators, in order of highest to lowest
+precedence:
`(...)'
Grouping.
@@ -6699,7 +6819,7 @@ operators, in order of highest to lowest precedence:
Unary plus, minus, logical "not."
`* / %'
- Multiplication, division, modulus.
+ Multiplication, division, remainder.
`+ -'
Addition, subtraction.
@@ -6757,7 +6877,7 @@ with an associated action. This major node describes how you build
patterns and actions, what kinds of things you can do within actions,
and `awk''s built-in variables.
-The pattern-action rules and the statements available for use within
+ The pattern-action rules and the statements available for use within
actions form the core of `awk' programming. In a sense, everything
covered up to here has been the foundation that programs are built on
top of. Now it's time to start building something useful.
@@ -6785,7 +6905,7 @@ File: gawk.info, Node: Pattern Overview, Next: Using Shell Variables, Up: Pat
* BEGIN/END:: Specifying initialization and cleanup rules.
* Empty:: The empty pattern, which matches every record.
-Patterns in `awk' control the execution of rules--a rule is executed
+ Patterns in `awk' control the execution of rules--a rule is executed
when its pattern matches the current input record. The following is a
summary of the types of `awk' patterns:
@@ -6838,8 +6958,8 @@ against a new input record. If the expression uses fields such as
otherwise, it depends on only what has happened so far in the execution
of the `awk' program.
-Comparison expressions, using the comparison operators described in
-*Note Typing and Comparison::, are a very common kind of pattern.
+ Comparison expressions, using the comparison operators described in
+*note Typing and Comparison::, are a very common kind of pattern.
Regexp matching and nonmatching are also very common expressions. The
left operand of the `~' and `!~' operators is a string. The right
operand is either a constant regular expression enclosed in slashes
@@ -6860,12 +6980,12 @@ which accepts any record with a first field that contains `foo':
-| 555-6480
-| 555-2127
-A regexp constant as a pattern is also a special case of an expression
-pattern. The expression `/foo/' has the value one if `foo' appears in
-the current input record. Thus, as a pattern, `/foo/' matches any
-record containing `foo'.
+ A regexp constant as a pattern is also a special case of an
+expression pattern. The expression `/foo/' has the value one if `foo'
+appears in the current input record. Thus, as a pattern, `/foo/'
+matches any record containing `foo'.
-Boolean expressions are also commonly used as patterns. Whether the
+ Boolean expressions are also commonly used as patterns. Whether the
pattern matches an input record depends on whether its subexpressions
match. For example, the following command prints all the records in
`BBS-list' that contain both `2400' and `foo':
@@ -6873,7 +6993,7 @@ match. For example, the following command prints all the records in
$ awk '/2400/ && /foo/' BBS-list
-| fooey 555-1234 2400/1200/300 B
-The following command prints all records in `BBS-list' that contain
+ The following command prints all records in `BBS-list' that contain
_either_ `2400' or `foo' (or both, of course):
$ awk '/2400/ || /foo/' BBS-list
@@ -6885,7 +7005,7 @@ _either_ `2400' or `foo' (or both, of course):
-| sdace 555-3430 2400/1200/300 A
-| sabafoo 555-2127 1200/300 C
-The following command prints all records in `BBS-list' that do _not_
+ The following command prints all records in `BBS-list' that do _not_
contain the string `foo':
$ awk '! /foo/' BBS-list
@@ -6897,12 +7017,12 @@ contain the string `foo':
-| core 555-2912 1200/300 C
-| sdace 555-3430 2400/1200/300 A
-The subexpressions of a Boolean operator in a pattern can be constant
-regular expressions, comparisons, or any other `awk' expressions. Range
-patterns are not expressions, so they cannot appear inside Boolean
-patterns. Likewise, the special patterns `BEGIN' and `END', which
-never match any input record, are not expressions and cannot appear
-inside Boolean patterns.
+ The subexpressions of a Boolean operator in a pattern can be
+constant regular expressions, comparisons, or any other `awk'
+expressions. Range patterns are not expressions, so they cannot appear
+inside Boolean patterns. Likewise, the special patterns `BEGIN' and
+`END', which never match any input record, are not expressions and
+cannot appear inside Boolean patterns.

File: gawk.info, Node: Ranges, Next: BEGIN/END, Prev: Expression Patterns, Up: Pattern Overview
@@ -6920,7 +7040,7 @@ following:
prints every record in `myfile' between `on'/`off' pairs, inclusive.
-A range pattern starts out by matching BEGPAT against every input
+ A range pattern starts out by matching BEGPAT against every input
record. When a record matches BEGPAT, the range pattern is "turned on"
and the range pattern matches this record as well. As long as the
range pattern stays turned on, it automatically matches every input
@@ -6929,12 +7049,12 @@ record; when this succeeds, the range pattern is turned off again for
the following record. Then the range pattern goes back to checking
BEGPAT against each record.
-The record that turns on the range pattern and the one that turns it
+ The record that turns on the range pattern and the one that turns it
off both match the range pattern. If you don't want to operate on
these records, you can write `if' statements in the rule's action to
distinguish them from the records you are interested in.
-It is possible for a pattern to be turned on and off by the same
+ It is possible for a pattern to be turned on and off by the same
record. If the record satisfies both conditions, then the action is
executed for just that record. For example, suppose there is text
between two identical markers (e.g., the `%' symbol), each on its own
@@ -6955,13 +7075,13 @@ a flag:
/^%$/ { skip = ! skip; next }
skip == 1 { next } # skip lines with `skip' set
-In a range pattern, the comma (`,') has the lowest precedence of all
+ In a range pattern, the comma (`,') has the lowest precedence of all
the operators (i.e., it is evaluated last). Thus, the following
program attempts to combine a range pattern with another, simpler test:
echo Yes | awk '/1/,/2/ || /Yes/'
-The intent of this program is `(/1/,/2/) || /Yes/'. However, `awk'
+ The intent of this program is `(/1/,/2/) || /Yes/'. However, `awk'
interprets this as `/1/, (/2/ || /Yes/)'. This cannot be changed or
worked around; range patterns do not combine with other patterns:
@@ -7007,7 +7127,7 @@ input is read. For example:
-| Analysis of "foo"
-| "foo" appears 4 times.
-This program finds the number of records in the input file `BBS-list'
+ This program finds the number of records in the input file `BBS-list'
that contain the string `foo'. The `BEGIN' rule prints a title for the
report. There is no need to use the `BEGIN' rule to initialize the
counter `n' to zero, since `awk' does this automatically (*note
@@ -7015,11 +7135,11 @@ Variables::). The second rule increments the variable `n' every time a
record containing the pattern `foo' is read. The `END' rule prints the
value of `n' at the end of the run.
-The special patterns `BEGIN' and `END' cannot be used in ranges or with
-Boolean operators (indeed, they cannot be used with any operators). An
-`awk' program may have multiple `BEGIN' and/or `END' rules. They are
-executed in the order in which they appear: all the `BEGIN' rules at
-startup and all the `END' rules at termination. `BEGIN' and `END'
+ The special patterns `BEGIN' and `END' cannot be used in ranges or
+with Boolean operators (indeed, they cannot be used with any operators).
+An `awk' program may have multiple `BEGIN' and/or `END' rules. They
+are executed in the order in which they appear: all the `BEGIN' rules
+at startup and all the `END' rules at termination. `BEGIN' and `END'
rules may be intermixed with other rules. This feature was added in
the 1987 version of `awk' and is included in the POSIX standard. The
original (1978) version of `awk' required the `BEGIN' rule to be placed
@@ -7028,7 +7148,7 @@ end, and only allowed one of each. This is no longer required, but it
is a good idea to follow this template in terms of program organization
and readability.
-Multiple `BEGIN' and `END' rules are useful for writing library
+ Multiple `BEGIN' and `END' rules are useful for writing library
functions, because each library file can have its own `BEGIN' and/or
`END' rule to do its own initialization and/or cleanup. The order in
which library functions are named on the command line controls the
@@ -7038,15 +7158,15 @@ the order in which they are executed doesn't matter. *Note Options::,
for more information on using library functions. *Note Library
Functions::, for a number of useful library functions.
-If an `awk' program has only a `BEGIN' rule and no other rules, then
+ If an `awk' program has only a `BEGIN' rule and no other rules, then
the program exits after the `BEGIN' rule is run.(1) However, if an
`END' rule exists, then the input is read, even if there are no other
rules in the program. This is necessary in case the `END' rule checks
the `FNR' and `NR' variables.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The original version of `awk' used to keep reading and ignoring
+ (1) The original version of `awk' used to keep reading and ignoring
input until the end of the file was seen.

@@ -7065,17 +7185,17 @@ give `$0' a real value is to execute a `getline' command without a
variable (*note Getline::). Another way is simply to assign a value to
`$0'.
-The second point is similar to the first but from the other direction.
-Traditionally, due largely to implementation issues, `$0' and `NF' were
-_undefined_ inside an `END' rule. The POSIX standard specifies that
-`NF' is available in an `END' rule. It contains the number of fields
-from the last input record. Most probably due to an oversight, the
-standard does not say that `$0' is also preserved, although logically
-one would think that it should be. In fact, `gawk' does preserve the
-value of `$0' for use in `END' rules. Be aware, however, that Unix
-`awk', and possibly other implementations, do not.
-
-The third point follows from the first two. The meaning of `print'
+ The second point is similar to the first but from the other
+direction. Traditionally, due largely to implementation issues, `$0'
+and `NF' were _undefined_ inside an `END' rule. The POSIX standard
+specifies that `NF' is available in an `END' rule. It contains the
+number of fields from the last input record. Most probably due to an
+oversight, the standard does not say that `$0' is also preserved,
+although logically one would think that it should be. In fact, `gawk'
+does preserve the value of `$0' for use in `END' rules. Be aware,
+however, that Unix `awk', and possibly other implementations, do not.
+
+ The third point follows from the first two. The meaning of `print'
inside a `BEGIN' or `END' rule is the same as always: `print $0'. If
`$0' is the null string, then this prints an empty line. Many long
time `awk' programmers use an unadorned `print' in `BEGIN' and `END'
@@ -7085,11 +7205,11 @@ idea in `END' rules, at least in `gawk'. It is also poor style, since
if an empty line is needed in the output, the program should print one
explicitly.
-Finally, the `next' and `nextfile' statements are not allowed in a
+ Finally, the `next' and `nextfile' statements are not allowed in a
`BEGIN' rule, because the implicit
read-a-record-and-match-against-the-rules loop has not started yet.
Similarly, those statements are not valid in an `END' rule, since all
-the input has been read. (*Note Next Statement::, and see *Note
+the input has been read. (*Note Next Statement::, and see *note
Nextfile Statement::.)

@@ -7117,7 +7237,7 @@ hold a pattern that the `awk' program searches for. There are two ways
to get the value of the shell variable into the body of the `awk'
program.
-The most common method is to use shell quoting to substitute the
+ The most common method is to use shell quoting to substitute the
variable's value into the program inside the script. For example, in
the following program:
@@ -7131,12 +7251,12 @@ concatenated together to form the program. The first part is
double-quoted, which allows substitution of the `pattern' variable
inside the quotes. The second part is single-quoted.
-Variable substitution via quoting works, but can be potentially messy.
-It requires a good understanding of the shell's quoting rules (*note
-Quoting::), and it's often difficult to correctly match up the quotes
-when reading the program.
+ Variable substitution via quoting works, but can be potentially
+messy. It requires a good understanding of the shell's quoting rules
+(*note Quoting::), and it's often difficult to correctly match up the
+quotes when reading the program.
-A better method is to use `awk''s variable assignment feature (*note
+ A better method is to use `awk''s variable assignment feature (*note
Assignment Options::) to assign the shell variable's value to an `awk'
variable's value. Then use dynamic regexps to match the pattern (*note
Computed Regexps::). The following shows how to redo the previous
@@ -7175,8 +7295,8 @@ outline, an `awk' program generally looks like this:
function NAME(ARGS) { ... }
...
-An action consists of one or more `awk' "statements", enclosed in curly
-braces (`{...}'). Each statement specifies one thing to do. The
+ An action consists of one or more `awk' "statements", enclosed in
+curly braces (`{...}'). Each statement specifies one thing to do. The
statements are separated by newlines or semicolons. The curly braces
around an action must be used even if the action contains only one
statement, or if it contains no statements at all. However, if you
@@ -7186,7 +7306,7 @@ action is equivalent to `{ print $0 }':
/foo/ { } match `foo', do nothing -- empty action
/foo/ match `foo', print the record -- omitted action
-The following types of statements are supported in `awk':
+ The following types of statements are supported in `awk':
Expressions
Call functions or assign values to variables (*note
@@ -7225,7 +7345,7 @@ File: gawk.info, Node: Statements, Next: Built-in Variables, Prev: Action Ove
flow of execution in `awk' programs. Most of the control statements in
`awk' are patterned on similar statements in C.
-All the control statements start with special keywords, such as `if'
+ All the control statements start with special keywords, such as `if'
and `while', to distinguish them from simple expressions. Many control
statements contain other statements. For example, the `if' statement
contains another statement that may or may not be executed. The
@@ -7274,7 +7394,7 @@ following:
else
print "x is odd"
-In this example, if the expression `x % 2 == 0' is true (that is, if
+ In this example, if the expression `x % 2 == 0' is true (that is, if
the value of `x' is evenly divisible by two), then the first `print'
statement is executed; otherwise, the second `print' statement is
executed. If the `else' keyword appears on the same line as THEN-BODY
@@ -7331,11 +7451,11 @@ tests whether `i' is less than or equal to three. This is true when
increments the value of `i' and the loop repeats. The loop terminates
when `i' reaches four.
-A newline is not required between the condition and the body; however
-using one makes the program clearer unless the body is a compound
-statement or else is very simple. The newline after the open-brace
-that begins the compound statement is not required either, but the
-program is harder to read without it.
+ A newline is not required between the condition and the body;
+however using one makes the program clearer unless the body is a
+compound statement or else is very simple. The newline after the
+open-brace that begins the compound statement is not required either,
+but the program is harder to read without it.

File: gawk.info, Node: Do Statement, Next: For Statement, Prev: While Statement, Up: Statements
@@ -7351,7 +7471,7 @@ the CONDITION is true. It looks like this:
BODY
while (CONDITION)
-Even if the CONDITION is false at the start, the BODY is executed at
+ Even if the CONDITION is false at the start, the BODY is executed at
least once (and only once, unless executing BODY makes CONDITION true).
Contrast this with the corresponding `while' statement:
@@ -7388,8 +7508,8 @@ loop. The general form of the `for' statement looks like this:
The INITIALIZATION, CONDITION, and INCREMENT parts are arbitrary `awk'
expressions, and BODY stands for any `awk' statement.
-The `for' statement starts by executing INITIALIZATION. Then, as long
-as the CONDITION is true, it repeatedly executes BODY and then
+ The `for' statement starts by executing INITIALIZATION. Then, as
+long as the CONDITION is true, it repeatedly executes BODY and then
INCREMENT. Typically, INITIALIZATION sets a variable to either zero or
one, INCREMENT adds one to it, and CONDITION compares it against the
desired number of iterations. For example:
@@ -7401,18 +7521,19 @@ desired number of iterations. For example:
This prints the first three fields of each input record, with one field
per line.
-It isn't possible to set more than one variable in the INITIALIZATION
-part without using a multiple assignment statement such as `x = y = 0'.
-This makes sense only if all the initial values are equal. (But it is
-possible to initialize additional variables by writing their
-assignments as separate statements preceding the `for' loop.)
+ It isn't possible to set more than one variable in the
+INITIALIZATION part without using a multiple assignment statement such
+as `x = y = 0'. This makes sense only if all the initial values are
+equal. (But it is possible to initialize additional variables by
+writing their assignments as separate statements preceding the `for'
+loop.)
-The same is true of the INCREMENT part. Incrementing additional
+ The same is true of the INCREMENT part. Incrementing additional
variables requires separate statements at the end of the loop. The C
compound expression, using C's comma operator, is useful in this
context but it is not supported in `awk'.
-Most often, INCREMENT is an increment expression, as in the previous
+ Most often, INCREMENT is an increment expression, as in the previous
example. But this is not required; it can be any expression
whatsoever. For example, the following statement prints all the powers
of two between 1 and 100:
@@ -7420,14 +7541,14 @@ of two between 1 and 100:
for (i = 1; i <= 100; i *= 2)
print i
-If there is nothing to be done, any of the three expressions in the
+ If there is nothing to be done, any of the three expressions in the
parentheses following the `for' keyword may be omitted. Thus,
`for (; x > 0;)' is equivalent to `while (x > 0)'. If the CONDITION is
omitted, it is treated as true, effectively yielding an "infinite loop"
(i.e., a loop that never terminates).
-In most cases, a `for' loop is an abbreviation for a `while' loop, as
-shown here:
+ In most cases, a `for' loop is an abbreviation for a `while' loop,
+as shown here:
INITIALIZATION
while (CONDITION) {
@@ -7440,14 +7561,14 @@ Statement::) is used inside the loop. Changing a `for' statement to a
`while' statement in this way can change the effect of the `continue'
statement inside the loop.
-The `awk' language has a `for' statement in addition to a `while'
+ The `awk' language has a `for' statement in addition to a `while'
statement because a `for' loop is often both less work to type and more
natural to think of. Counting the number of iterations is very common
in loops. It can be easier to think of this counting as part of
looping rather than as something to do inside the loop.
-There is an alternate version of the `for' loop, for iterating over all
-the indices of an array:
+ There is an alternate version of the `for' loop, for iterating over
+all the indices of an array:
for (i in array)
DO SOMETHING WITH array[i]
@@ -7467,12 +7588,12 @@ File: gawk.info, Node: Switch Statement, Next: Break Statement, Prev: For Sta
configured and built. *Note Additional Configuration Options::,
for more information.
-The `switch' statement allows the evaluation of an expression and the
-execution of statements based on a `case' match. Case statements are
-checked for a match in the order they are defined. If no suitable
+ The `switch' statement allows the evaluation of an expression and
+the execution of statements based on a `case' match. Case statements
+are checked for a match in the order they are defined. If no suitable
`case' is found, the `default' section is executed, if supplied.
-Each `case' contains a single constant, be it numeric, string, or
+ Each `case' contains a single constant, be it numeric, string, or
regexp. The `switch' expression is evaluated, and then each `case''s
constant is compared against the result in turn. The type of constant
determines the comparison: numeric or string do the usual comparisons.
@@ -7487,7 +7608,7 @@ statement looks like this:
DEFAULT-BODY
}
-Control flow in the `switch' statement works as it does in C. Once a
+ Control flow in the `switch' statement works as it does in C. Once a
match to a given case is made, case statement bodies are executed until
a `break', `continue', `next', `nextfile' or `exit' is encountered, or
the end of the `switch' statement itself. For example:
@@ -7508,9 +7629,9 @@ the end of the `switch' statement itself. For example:
print NR * -1
}
-Note that if none of the statements specified above halt execution of a
-matched `case' statement, execution falls through to the next `case'
-until execution halts. In the above example, for any case value
+ Note that if none of the statements specified above halt execution
+of a matched `case' statement, execution falls through to the next
+`case' until execution halts. In the above example, for any case value
starting with `2' followed by one or more digits, the `print' statement
is executed and then falls through into the `default' section,
executing its `print' statement. In turn, the -1 case will also be
@@ -7538,14 +7659,14 @@ divisor of any integer, and also identifies prime numbers:
printf "%d is prime\n", num
}
-When the remainder is zero in the first `if' statement, `awk'
+ When the remainder is zero in the first `if' statement, `awk'
immediately "breaks out" of the containing `for' loop. This means that
`awk' proceeds immediately to the statement following the loop and
continues processing. (This is very different from the `exit'
statement, which stops the entire `awk' program. *Note Exit
Statement::.)
-Th following program illustrates how the CONDITION of a `for' or
+ Th following program illustrates how the CONDITION of a `for' or
`while' statement could be replaced with a `break' inside an `if':
# find smallest divisor of num
@@ -7563,7 +7684,7 @@ Th following program illustrates how the CONDITION of a `for' or
}
}
-The `break' statement has no meaning when used outside the body of a
+ The `break' statement has no meaning when used outside the body of a
loop. However, although it was never documented, historical
implementations of `awk' treated the `break' statement outside of a
loop as if it were a `next' statement (*note Next Statement::). Recent
@@ -7584,8 +7705,8 @@ As with `break', the `continue' statement is used only inside `for',
causing the next cycle around the loop to begin immediately. Contrast
this with `break', which jumps out of the loop altogether.
-The `continue' statement in a `for' loop directs `awk' to skip the rest
-of the body of the loop and resume execution with the
+ The `continue' statement in a `for' loop directs `awk' to skip the
+rest of the body of the loop and resume execution with the
increment-expression of the `for' statement. The following program
illustrates this fact:
@@ -7616,8 +7737,8 @@ the previous example with the following `while' loop:
This program loops forever once `x' reaches 5.
-The `continue' statement has no meaning when used outside the body of a
-loop. Historical versions of `awk' treated a `continue' statement
+ The `continue' statement has no meaning when used outside the body of
+a loop. Historical versions of `awk' treated a `continue' statement
outside a loop the same way they treated a `break' statement outside a
loop: as if it were a `next' statement (*note Next Statement::).
Recent versions of Unix `awk' no longer work this way, and `gawk'
@@ -7637,20 +7758,20 @@ current record and go on to the next record. This means that no
further rules are executed for the current record, and the rest of the
current rule's action isn't executed.
-Contrast this with the effect of the `getline' function (*note
+ Contrast this with the effect of the `getline' function (*note
Getline::). That also causes `awk' to read the next record
immediately, but it does not alter the flow of control in any way
(i.e., the rest of the current action executes with a new input record).
-At the highest level, `awk' program execution is a loop that reads an
-input record and then tests each rule's pattern against it. If you
+ At the highest level, `awk' program execution is a loop that reads
+an input record and then tests each rule's pattern against it. If you
think of this loop as a `for' statement whose body contains the rules,
then the `next' statement is analogous to a `continue' statement. It
skips to the end of the body of this implicit loop and executes the
increment (which reads another record).
-For example, suppose an `awk' program works only on records with four
-fields, and it shouldn't fail when given bad input. To avoid
+ For example, suppose an `awk' program works only on records with
+four fields, and it shouldn't fail when given bad input. To avoid
complicating the rest of the program, write a "weed out" rule near the
beginning, in the following manner:
@@ -7663,9 +7784,9 @@ beginning, in the following manner:
Because of the `next' statement, the program's subsequent rules won't
see the bad record. The error message is redirected to the standard
error output stream, as error messages should be. For more detail see
-*Note Special Files::.
+*note Special Files::.
-According to the POSIX standard, the behavior is undefined if the
+ According to the POSIX standard, the behavior is undefined if the
`next' statement is used in a `BEGIN' or `END' rule. `gawk' treats it
as a syntax error. Although POSIX permits it, some other `awk'
implementations don't allow the `next' statement inside function bodies
@@ -7686,11 +7807,11 @@ File: gawk.info, Node: Nextfile Statement, Next: Exit Statement, Prev: Next S
current record, the `nextfile' statement instructs `gawk' to stop
processing the current data file.
-The `nextfile' statement is a `gawk' extension. In most other `awk'
+ The `nextfile' statement is a `gawk' extension. In most other `awk'
implementations, or if `gawk' is in compatibility mode (*note
Options::), `nextfile' is not special.
-Upon execution of the `nextfile' statement, `FILENAME' is updated to
+ Upon execution of the `nextfile' statement, `FILENAME' is updated to
the name of the next data file listed on the command line, `FNR' is
reset to one, `ARGIND' is incremented, and processing starts over with
the first rule in the program. (`ARGIND' hasn't been introduced yet.
@@ -7698,30 +7819,30 @@ the first rule in the program. (`ARGIND' hasn't been introduced yet.
end of the input to be reached, then the code in any `END' rules is
executed. *Note BEGIN/END::.
-The `nextfile' statement is useful when there are many data files to
+ The `nextfile' statement is useful when there are many data files to
process but it isn't necessary to process every record in every file.
Normally, in order to move on to the next data file, a program has to
continue scanning the unwanted records. The `nextfile' statement
accomplishes this much more efficiently.
-While one might think that `close(FILENAME)' would accomplish the same
-as `nextfile', this isn't true. `close' is reserved for closing files,
-pipes, and coprocesses that are opened with redirections. It is not
-related to the main processing that `awk' does with the files listed in
-`ARGV'.
+ While one might think that `close(FILENAME)' would accomplish the
+same as `nextfile', this isn't true. `close' is reserved for closing
+files, pipes, and coprocesses that are opened with redirections. It is
+not related to the main processing that `awk' does with the files
+listed in `ARGV'.
-If it's necessary to use an `awk' version that doesn't support
-`nextfile', see *Note Nextfile Function::, for a user-defined function
+ If it's necessary to use an `awk' version that doesn't support
+`nextfile', see *note Nextfile Function::, for a user-defined function
that simulates the `nextfile' statement.
-The current version of the Bell Laboratories `awk' (*note Other
+ The current version of the Bell Laboratories `awk' (*note Other
Versions::) also supports `nextfile'. However, it doesn't allow the
`nextfile' statement inside function bodies (*note User-defined::).
`gawk' does; a `nextfile' inside a function body reads the next record
and starts processing it with the first rule in the program, just as
any other `nextfile' statement.
-*Caution:* Versions of `gawk' prior to 3.0 used two words (`next
+ *Caution:* Versions of `gawk' prior to 3.0 used two words (`next
file') for the `nextfile' statement. In version 3.0, this was changed
to one word, because the treatment of `file' was inconsistent. When it
appeared after `next', `file' was a keyword; otherwise, it was a
@@ -7740,31 +7861,31 @@ ignored. The `exit' statement is written as follows:
exit [RETURN CODE]
-When an `exit' statement is executed from a `BEGIN' rule, the program
-stops processing everything immediately. No input records are read.
-However, if an `END' rule is present, as part of executing the `exit'
-statement, the `END' rule is executed (*note BEGIN/END::). If `exit'
-is used as part of an `END' rule, it causes the program to stop
+ When an `exit' statement is executed from a `BEGIN' rule, the
+program stops processing everything immediately. No input records are
+read. However, if an `END' rule is present, as part of executing the
+`exit' statement, the `END' rule is executed (*note BEGIN/END::). If
+`exit' is used as part of an `END' rule, it causes the program to stop
immediately.
-An `exit' statement that is not part of a `BEGIN' or `END' rule stops
-the execution of any further automatic rules for the current record,
-skips reading any remaining input records, and executes the `END' rule
-if there is one.
+ An `exit' statement that is not part of a `BEGIN' or `END' rule
+stops the execution of any further automatic rules for the current
+record, skips reading any remaining input records, and executes the
+`END' rule if there is one.
-In such a case, if you don't want the `END' rule to do its job, set a
-variable to nonzero before the `exit' statement and check that variable
-in the `END' rule. *Note Assert Function::, for an example that does
-this.
+ In such a case, if you don't want the `END' rule to do its job, set
+a variable to nonzero before the `exit' statement and check that
+variable in the `END' rule. *Note Assert Function::, for an example
+that does this.
-If an argument is supplied to `exit', its value is used as the exit
+ If an argument is supplied to `exit', its value is used as the exit
status code for the `awk' process. If no argument is supplied, `exit'
returns status zero (success). In the case where an argument is
supplied to a first `exit' statement, and then `exit' is called a
second time from an `END' rule with no argument, `awk' uses the
previously supplied exit value. (d.c.)
-For example, suppose an error condition occurs that is difficult or
+ For example, suppose an error condition occurs that is difficult or
impossible to handle. Conventionally, programs report this by exiting
with a nonzero status. An `awk' program can do this using an `exit'
statement with a nonzero argument, as shown in the following example:
@@ -7792,8 +7913,8 @@ of these automatically, so that they enable you to tell `awk' how to do
certain things. Others are set automatically by `awk', so that they
carry information from the internal workings of `awk' to your program.
-This minor node documents all the built-in variables of `gawk', most of
-which are also documented in the chapters describing their areas of
+ This minor node documents all the built-in variables of `gawk', most
+of which are also documented in the chapters describing their areas of
activity.
* Menu:
@@ -7823,7 +7944,7 @@ specific to `gawk' are marked with a pound sign (`#').
use binary I/O. A string value of `"rw"' or `"wr"' indicates that
all files should use binary I/O. Any other string value is
equivalent to `"rw"', but `gawk' generates a warning message.
- `BINMODE' is described in more detail in *Note PC Using::.
+ `BINMODE' is described in more detail in *note PC Using::.
This variable is a `gawk' extension. In other `awk'
implementations (except `mawk', *note Other Versions::), or if
@@ -7954,9 +8075,9 @@ specific to `gawk' are marked with a pound sign (`#').
implementations, or if `gawk' is in compatibility mode (*note
Options::), it is not special.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) In POSIX `awk', newline does not count as whitespace.
+ (1) In POSIX `awk', newline does not count as whitespace.

File: gawk.info, Node: Auto-set, Next: ARGC and ARGV, Prev: User-modified, Up: Built-in Variables
@@ -8165,19 +8286,19 @@ Before `FNR' was added to the `awk' language (*note V7/SVR3.1::), many
`awk' programs used this feature to track the number of records in a
file by resetting `NR' to zero when `FILENAME' changed.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Some early implementations of Unix `awk' initialized `FILENAME' to
-`"-"', even if there were data files to be processed. This behavior was
-incorrect and should not be relied upon in your programs.
+ (1) Some early implementations of Unix `awk' initialized `FILENAME'
+to `"-"', even if there were data files to be processed. This behavior
+was incorrect and should not be relied upon in your programs.

File: gawk.info, Node: ARGC and ARGV, Prev: Auto-set, Up: Built-in Variables
-6.5.4 Using `ARGC' and `ARGV'
+6.5.3 Using `ARGC' and `ARGV'
-----------------------------
-*Note Auto-set::, presented the following program describing the
+*note Auto-set::, presented the following program describing the
information contained in `ARGC' and `ARGV':
$ awk 'BEGIN {
@@ -8210,27 +8331,27 @@ treated as arguments and do show up in the `ARGV' array:
-| ARGV[2] = /dev/null
-| A=1, B=2
-A program can alter `ARGC' and the elements of `ARGV'. Each time `awk'
-reaches the end of an input file, it uses the next element of `ARGV' as
-the name of the next input file. By storing a different string there,
-a program can change which files are read. Use `"-"' to represent the
-standard input. Storing additional elements and incrementing `ARGC'
-causes additional files to be read.
-
-If the value of `ARGC' is decreased, that eliminates input files from
-the end of the list. By recording the old value of `ARGC' elsewhere, a
-program can treat the eliminated arguments as something other than file
-names.
-
-To eliminate a file from the middle of the list, store the null string
-(`""') into `ARGV' in place of the file's name. As a special feature,
-`awk' ignores file names that have been replaced with the null string.
-Another option is to use the `delete' statement to remove elements from
-`ARGV' (*note Delete::).
-
-All of these actions are typically done in the `BEGIN' rule, before
+ A program can alter `ARGC' and the elements of `ARGV'. Each time
+`awk' reaches the end of an input file, it uses the next element of
+`ARGV' as the name of the next input file. By storing a different
+string there, a program can change which files are read. Use `"-"' to
+represent the standard input. Storing additional elements and
+incrementing `ARGC' causes additional files to be read.
+
+ If the value of `ARGC' is decreased, that eliminates input files
+from the end of the list. By recording the old value of `ARGC'
+elsewhere, a program can treat the eliminated arguments as something
+other than file names.
+
+ To eliminate a file from the middle of the list, store the null
+string (`""') into `ARGV' in place of the file's name. As a special
+feature, `awk' ignores file names that have been replaced with the null
+string. Another option is to use the `delete' statement to remove
+elements from `ARGV' (*note Delete::).
+
+ All of these actions are typically done in the `BEGIN' rule, before
actual processing of the input begins. *Note Split Program::, and see
-*Note Tee Program::, for examples of each way of removing elements from
+*note Tee Program::, for examples of each way of removing elements from
`ARGV'. The following fragment processes `ARGV' in order to examine,
and then remove, command-line options:
@@ -8240,9 +8361,9 @@ and then remove, command-line options:
verbose = 1
else if (ARGV[i] == "-d")
debug = 1
- else if (ARGV[i] ~ /^-?/) {
+ else if (ARGV[i] ~ /^-./) {
e = sprintf("%s: unrecognized option -- %c",
- ARGV[0], substr(ARGV[i], 1, ,1))
+ ARGV[0], substr(ARGV[i], 2, 1))
print e > "/dev/stderr"
} else
break
@@ -8250,17 +8371,17 @@ and then remove, command-line options:
}
}
-To actually get the options into the `awk' program, end the `awk'
+ To actually get the options into the `awk' program, end the `awk'
options with `--' and then supply the `awk' program's options, in the
following manner:
awk -f myprog -- -v -d file1 file2 ...
-This is not necessary in `gawk'. Unless `--posix' has been specified,
-`gawk' silently puts any unrecognized options into `ARGV' for the `awk'
-program to deal with. As soon as it sees an unknown option, `gawk'
-stops looking for other options that it might otherwise recognize. The
-previous example with `gawk' would be:
+ This is not necessary in `gawk'. Unless `--posix' has been
+specified, `gawk' silently puts any unrecognized options into `ARGV'
+for the `awk' program to deal with. As soon as it sees an unknown
+option, `gawk' stops looking for other options that it might otherwise
+recognize. The previous example with `gawk' would be:
gawk -f myprog -d -v file1 file2 ...
@@ -8277,14 +8398,14 @@ An "array" is a table of values called "elements". The elements of an
array are distinguished by their indices. "Indices" may be either
numbers or strings.
-This major node describes how arrays work in `awk', how to use array
+ This major node describes how arrays work in `awk', how to use array
elements, how to scan through every element in an array, and how to
remove array elements. It also describes how `awk' simulates
multidimensional arrays, as well as some of the less obvious points
about array usage. The major node finishes with a discussion of
`gawk''s facility for sorting an array based on its indices.
-`awk' maintains a single set of names that may be used for naming
+ `awk' maintains a single set of names that may be used for naming
variables, arrays, and functions (*note User-defined::). Thus, you
cannot have a variable and an array with the same name in the same
`awk' program.
@@ -8320,13 +8441,13 @@ Array names have the same syntax as variable names; any valid variable
name would also be a valid array name. But one name cannot be used in
both ways (as an array and as a variable) in the same `awk' program.
-Arrays in `awk' superficially resemble arrays in other programming
+ Arrays in `awk' superficially resemble arrays in other programming
languages, but there are fundamental differences. In `awk', it isn't
necessary to specify the size of an array before starting to use it.
Additionally, any number or string in `awk', not just consecutive
integers, may be used as an array index.
-In most other languages, arrays must be "declared" before use,
+ In most other languages, arrays must be "declared" before use,
including a specification of how many elements or components they
contain. In such languages, the declaration causes a contiguous block
of memory to be allocated for that many elements. Usually, an index in
@@ -8340,7 +8461,7 @@ languages allow arbitrary starting and ending indices--e.g., `15 ..
27'--but the size of the array is still fixed when the array is
declared.)
-A contiguous array of four elements might look like the following
+ A contiguous array of four elements might look like the following
example, conceptually, if the element values are 8, `"foo"', `""', and
30:
@@ -8353,8 +8474,8 @@ Only the values are stored; the indices are implicit from the order of
the values. Here, 8 is the value at index zero, because 8 appears in the
position with zero elements before it.
-Arrays in `awk' are different--they are "associative". This means that
-each array is a collection of pairs: an index and its corresponding
+ Arrays in `awk' are different--they are "associative". This means
+that each array is a collection of pairs: an index and its corresponding
array element value:
Element 3 Value 30
@@ -8364,8 +8485,8 @@ array element value:
The pairs are shown in jumbled order because their order is irrelevant.
-One advantage of associative arrays is that new pairs can be added at
-any time. For example, suppose a tenth element is added to the array
+ One advantage of associative arrays is that new pairs can be added
+at any time. For example, suppose a tenth element is added to the array
whose value is `"number ten"'. The result is:
Element 10 Value "number ten"
@@ -8378,7 +8499,7 @@ Now the array is "sparse", which just means some indices are missing.
It has elements 0-3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or
9.
-Another consequence of associative arrays is that the indices don't
+ Another consequence of associative arrays is that the indices don't
have to be positive integers. Any number, or even a string, can be an
index. For example, the following is an array that translates words
from English to French:
@@ -8391,17 +8512,17 @@ from English to French:
Here we decided to translate the number one in both spelled-out and
numeric form--thus illustrating that a single array can have both
numbers and strings as indices. In fact, array subscripts are always
-strings; this is discussed in more detail in *Note Numeric Array
+strings; this is discussed in more detail in *note Numeric Array
Subscripts::. Here, the number `1' isn't double-quoted, since `awk'
automatically converts it to a string.
-The value of `IGNORECASE' has no effect upon array subscripting. The
-identical string value used to store an array element must be used to
-retrieve it. When `awk' creates an array (e.g., with the `split'
+ The value of `IGNORECASE' has no effect upon array subscripting.
+The identical string value used to store an array element must be used
+to retrieve it. When `awk' creates an array (e.g., with the `split'
built-in function), that array's indices are consecutive integers
starting at one. (*Note String Functions::.)
-`awk''s arrays are efficient--the time to access an element is
+ `awk''s arrays are efficient--the time to access an element is
independent of the number of elements in the array.

@@ -8418,19 +8539,19 @@ An array reference is an expression as follows:
Here, ARRAY is the name of an array. The expression INDEX is the index
of the desired element of the array.
-The value of the array reference is the current value of that array
+ The value of the array reference is the current value of that array
element. For example, `foo[4.3]' is an expression for the element of
array `foo' at index `4.3'.
-A reference to an array element that has no recorded value yields a
+ A reference to an array element that has no recorded value yields a
value of `""', the null string. This includes elements that have not
been assigned any value as well as elements that have been deleted
(*note Delete::). Such a reference automatically creates that array
element, with the null string as its value. (In some cases, this is
unfortunate, because it might waste memory inside `awk'.)
-To determine whether an element exists in an array at a certain index,
-use the following expression:
+ To determine whether an element exists in an array at a certain
+index, use the following expression:
INDEX in ARRAY
@@ -8443,7 +8564,7 @@ whether the array `frequencies' contains the index `2':
if (2 in frequencies)
print "Subscript 2 is present."
-Note that this is _not_ a test of whether the array `frequencies'
+ Note that this is _not_ a test of whether the array `frequencies'
contains an element whose _value_ is two. There is no way to do that
except to scan all the elements. Also, this _does not_ create
`frequencies[2]', while the following (incorrect) alternative does:
@@ -8491,8 +8612,8 @@ number:
print arr[x]
}
-The first rule keeps track of the largest line number seen so far; it
-also stores each line into the array `arr', at an index that is the
+ The first rule keeps track of the largest line number seen so far;
+it also stores each line into the array `arr', at an index that is the
line's number. The second rule runs after all the input has been read,
to print out all the lines. When this program is run with the
following input:
@@ -8511,7 +8632,7 @@ Its output is:
4 . . . And four on the floor
5 I am the Five man
-If a line number is repeated, the last line with a given number
+ If a line number is repeated, the last line with a given number
overrides the others. Gaps in the line numbers can be handled with an
easy improvement to the program's `END' rule, as follows:
@@ -8541,14 +8662,14 @@ has a special kind of `for' statement for scanning an array:
This loop executes BODY once for each index in ARRAY that the program
has previously used, with the variable VAR set to that index.
-The following program uses this form of the `for' statement. The first
-rule scans the input records and notes which words appear (at least
-once) in the input, by storing a one into the array `used' with the
-word as index. The second rule scans the elements of `used' to find
-all the distinct words that appear in the input. It prints each word
-that is more than 10 characters long and also prints the number of such
-words. *Note String Functions::, for more information on the built-in
-function `length'.
+ The following program uses this form of the `for' statement. The
+first rule scans the input records and notes which words appear (at
+least once) in the input, by storing a one into the array `used' with
+the word as index. The second rule scans the elements of `used' to
+find all the distinct words that appear in the input. It prints each
+word that is more than 10 characters long and also prints the number of
+such words. *Note String Functions::, for more information on the
+built-in function `length'.
# Record a 1 for each word that is used at least once
{
@@ -8568,13 +8689,13 @@ function `length'.
*Note Word Sorting::, for a more detailed example of this type.
-The order in which elements of the array are accessed by this statement
-is determined by the internal arrangement of the array elements within
-`awk' and cannot be controlled or changed. This can lead to problems
-if new elements are added to ARRAY by statements in the loop body; it
-is not predictable whether the `for' loop will reach them. Similarly,
-changing VAR inside the loop may produce strange results. It is best
-to avoid such things.
+ The order in which elements of the array are accessed by this
+statement is determined by the internal arrangement of the array
+elements within `awk' and cannot be controlled or changed. This can
+lead to problems if new elements are added to ARRAY by statements in
+the loop body; it is not predictable whether the `for' loop will reach
+them. Similarly, changing VAR inside the loop may produce strange
+results. It is best to avoid such things.

File: gawk.info, Node: Delete, Next: Numeric Array Subscripts, Prev: Scanning an Array, Up: Arrays
@@ -8586,10 +8707,10 @@ To remove an individual element of an array, use the `delete' statement:
delete ARRAY[INDEX]
-Once an array element has been deleted, any value the element once had
-is no longer available. It is as if the element had never been referred
-to or had been given a value. The following is an example of deleting
-elements in an array:
+ Once an array element has been deleted, any value the element once
+had is no longer available. It is as if the element had never been
+referred to or had been given a value. The following is an example of
+deleting elements in an array:
for (i in frequencies)
delete frequencies[i]
@@ -8603,49 +8724,49 @@ the presence of that element returns zero (i.e., false):
if (4 in foo)
print "This will never be printed"
-It is important to note that deleting an element is _not_ the same as
-assigning it a null value (the empty string, `""'). For example:
+ It is important to note that deleting an element is _not_ the same
+as assigning it a null value (the empty string, `""'). For example:
foo[4] = ""
if (4 in foo)
print "This is printed, even though foo[4] is empty"
-It is not an error to delete an element that does not exist. If
+ It is not an error to delete an element that does not exist. If
`--lint' is provided on the command line (*note Options::), `gawk'
issues a warning message when an element that is not in the array is
deleted.
-All the elements of an array may be deleted with a single statement by
-leaving off the subscript in the `delete' statement, as follows:
+ All the elements of an array may be deleted with a single statement
+by leaving off the subscript in the `delete' statement, as follows:
delete ARRAY
-This ability is a `gawk' extension; it is not available in
+ This ability is a `gawk' extension; it is not available in
compatibility mode (*note Options::).
-Using this version of the `delete' statement is about three times more
-efficient than the equivalent loop that deletes each element one at a
-time.
+ Using this version of the `delete' statement is about three times
+more efficient than the equivalent loop that deletes each element one
+at a time.
-The following statement provides a portable but nonobvious way to clear
-out an array:(1)
+ The following statement provides a portable but nonobvious way to
+clear out an array:(1)
split("", array)
-The `split' function (*note String Functions::) clears out the target
-array first. This call asks it to split apart the null string. Because
-there is no data to split out, the function simply clears the array and
-then returns.
+ The `split' function (*note String Functions::) clears out the
+target array first. This call asks it to split apart the null string.
+Because there is no data to split out, the function simply clears the
+array and then returns.
-*Caution:* Deleting an array does not change its type; you cannot
+ *Caution:* Deleting an array does not change its type; you cannot
delete an array and then use the array's name as a scalar (i.e., a
regular variable). For example, the following does not work:
a[1] = 3; delete a; a = 3
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Thanks to Michael Brennan for pointing this out.
+ (1) Thanks to Michael Brennan for pointing this out.

File: gawk.info, Node: Numeric Array Subscripts, Next: Uninitialized Subscripts, Prev: Delete, Up: Arrays
@@ -8678,7 +8799,7 @@ assigned the value one. The program then changes the value of
two significant digits. This test fails, since `"12.15"' is a
different string from `"12.153"'.
-According to the rules for conversions (*note Conversion::), integer
+ According to the rules for conversions (*note Conversion::), integer
values are always converted to strings as integers, no matter what the
value of `CONVFMT' may happen to be. So the usual case of the
following works:
@@ -8686,17 +8807,17 @@ following works:
for (i = 1; i <= maxsub; i++)
do something with array[i]
-The "integer values always convert to strings as integers" rule has an
-additional consequence for array indexing. Octal and hexadecimal
+ The "integer values always convert to strings as integers" rule has
+an additional consequence for array indexing. Octal and hexadecimal
constants (*note Nondecimal-numbers::) are converted internally into
numbers, and their original form is forgotten. This means, for
example, that `array[17]', `array[021]', and `array[0x11]' all refer to
the same element!
-As with many things in `awk', the majority of the time things work as
-one would expect them to. But it is useful to have a precise knowledge
-of the actual rules which sometimes can have a subtle effect on your
-programs.
+ As with many things in `awk', the majority of the time things work
+as one would expect them to. But it is useful to have a precise
+knowledge of the actual rules which sometimes can have a subtle effect
+on your programs.

File: gawk.info, Node: Uninitialized Subscripts, Next: Multi-dimensional, Prev: Numeric Array Subscripts, Up: Arrays
@@ -8718,14 +8839,14 @@ might look like this:
-| line 3
-| line 2
-Unfortunately, the very first line of input data did not come out in the
-output!
+ Unfortunately, the very first line of input data did not come out in
+the output!
-At first glance, this program should have worked. The variable `lines'
-is uninitialized, and uninitialized variables have the numeric value
-zero. So, `awk' should have printed the value of `l[0]'.
+ At first glance, this program should have worked. The variable
+`lines' is uninitialized, and uninitialized variables have the numeric
+value zero. So, `awk' should have printed the value of `l[0]'.
-The issue here is that subscripts for `awk' arrays are _always_
+ The issue here is that subscripts for `awk' arrays are _always_
strings. Uninitialized variables, when used as strings, have the value
`""', not zero. Thus, `line 1' ends up stored in `l[""]'. The
following version of the program works correctly:
@@ -8736,14 +8857,14 @@ following version of the program works correctly:
print l[i]
}
-Here, the `++' forces `lines' to be numeric, thus making the "old
+ Here, the `++' forces `lines' to be numeric, thus making the "old
value" numeric zero. This is then converted to `"0"' as the array
subscript.
-Even though it is somewhat unusual, the null string (`""') is a valid
-array subscript. (d.c.) `gawk' warns about the use of the null string
-as a subscript if `--lint' is provided on the command line (*note
-Options::).
+ Even though it is somewhat unusual, the null string (`""') is a
+valid array subscript. (d.c.) `gawk' warns about the use of the null
+string as a subscript if `--lint' is provided on the command line
+(*note Options::).

File: gawk.info, Node: Multi-dimensional, Next: Multi-scanning, Prev: Uninitialized Subscripts, Up: Arrays
@@ -8757,40 +8878,41 @@ two-dimensional array requires two indices. The usual way (in most
languages, including `awk') to refer to an element of a two-dimensional
array named `grid' is with `grid[X,Y]'.
-Multidimensional arrays are supported in `awk' through concatenation of
-indices into one string. `awk' converts the indices into strings
+ Multidimensional arrays are supported in `awk' through concatenation
+of indices into one string. `awk' converts the indices into strings
(*note Conversion::) and concatenates them together, with a separator
between them. This creates a single string that describes the values
of the separate indices. The combined string is used as a single index
into an ordinary, one-dimensional array. The separator used is the
value of the built-in variable `SUBSEP'.
-For example, suppose we evaluate the expression `foo[5,12] = "value"'
+ For example, suppose we evaluate the expression `foo[5,12] = "value"'
when the value of `SUBSEP' is `"@"'. The numbers 5 and 12 are
converted to strings and concatenated with an `@' between them,
yielding `"5@12"'; thus, the array element `foo["5@12"]' is set to
`"value"'.
-Once the element's value is stored, `awk' has no record of whether it
-was stored with a single index or a sequence of indices. The two
+ Once the element's value is stored, `awk' has no record of whether
+it was stored with a single index or a sequence of indices. The two
expressions `foo[5,12]' and `foo[5 SUBSEP 12]' are always equivalent.
-The default value of `SUBSEP' is the string `"\034"', which contains a
-nonprinting character that is unlikely to appear in an `awk' program or
-in most input data. The usefulness of choosing an unlikely character
-comes from the fact that index values that contain a string matching
-`SUBSEP' can lead to combined strings that are ambiguous. Suppose that
-`SUBSEP' is `"@"'; then `foo["a@b", "c"]' and `foo["a", "b@c"]' are
-indistinguishable because both are actually stored as `foo["a@b@c"]'.
+ The default value of `SUBSEP' is the string `"\034"', which contains
+a nonprinting character that is unlikely to appear in an `awk' program
+or in most input data. The usefulness of choosing an unlikely
+character comes from the fact that index values that contain a string
+matching `SUBSEP' can lead to combined strings that are ambiguous.
+Suppose that `SUBSEP' is `"@"'; then `foo["a@b", "c"]' and
+`foo["a", "b@c"]' are indistinguishable because both are actually
+stored as `foo["a@b@c"]'.
-To test whether a particular index sequence exists in a
+ To test whether a particular index sequence exists in a
multidimensional array, use the same operator (`in') that is used for
single dimensional arrays. Write the whole sequence of indices in
parentheses, separated by commas, as the left operand:
(SUBSCRIPT1, SUBSCRIPT2, ...) in ARRAY
-The following example treats its input as a two-dimensional array of
+ The following example treats its input as a two-dimensional array of
fields; it rotates this array 90 degrees clockwise and prints the
result. It assumes that all lines have the same number of elements:
@@ -8837,7 +8959,7 @@ array. There cannot be one, because, in truth, there are no
multidimensional arrays or elements--there is only a multidimensional
_way of accessing_ an array.
-However, if your program has an array that is always accessed as
+ However, if your program has an array that is always accessed as
multidimensional, you can get the effect of scanning it by combining
the scanning `for' statement (*note Scanning an Array::) with the
built-in `split' function (*note String Functions::). It works in the
@@ -8853,7 +8975,7 @@ in the array, and splits it into the individual indices by breaking it
apart where the value of `SUBSEP' appears. The individual indices then
become the elements of the array `separate'.
-Thus, if a value is previously stored in `array[1, "foo"]'; then an
+ Thus, if a value is previously stored in `array[1, "foo"]'; then an
element with index `"1\034foo"' exists in `array'. (Recall that the
default value of `SUBSEP' is the character with code 034.) Sooner or
later, the `for' statement finds that index and does an iteration with
@@ -8885,13 +9007,13 @@ example:
for (i = 1; i <= n; i++)
DO SOMETHING WITH data[i]
-After the call to `asort', the array `data' is indexed from 1 to some
-number N, the total number of elements in `data'. (This count is
+ After the call to `asort', the array `data' is indexed from 1 to
+some number N, the total number of elements in `data'. (This count is
`asort''s return value.) `data[1]' <= `data[2]' <= `data[3]', and so
on. The comparison of array elements is done using `gawk''s usual
comparison rules (*note Typing and Comparison::).
-An important side effect of calling `asort' is that _the array's
+ An important side effect of calling `asort' is that _the array's
original indices are irrevocably lost_. As this isn't always
desirable, `asort' accepts a second argument:
@@ -8900,15 +9022,15 @@ desirable, `asort' accepts a second argument:
for (i = 1; i <= n; i++)
DO SOMETHING WITH dest[i]
-In this case, `gawk' copies the `source' array into the `dest' array
+ In this case, `gawk' copies the `source' array into the `dest' array
and then sorts `dest', destroying its indices. However, the `source'
array is not affected.
-Often, what's needed is to sort on the values of the _indices_ instead
-of the values of the elements. To do that, starting with `gawk' 3.1.2,
-use the `asorti' function. The interface is identical to that of
-`asort', except that the index values are used for sorting, and become
-the values of the result array:
+ Often, what's needed is to sort on the values of the _indices_
+instead of the values of the elements. To do that, starting with
+`gawk' 3.1.2, use the `asorti' function. The interface is identical to
+that of `asort', except that the index values are used for sorting, and
+become the values of the result array:
{ source[$0] = some_func($0) }
@@ -8921,9 +9043,10 @@ the values of the result array:
}
}
-If your version of `gawk' is 3.1.0 or 3.1.1, you don't have `asorti'.
-Instead, use a helper array to hold the sorted index values, and then
-access the original array's elements. It works in the following way:
+ If your version of `gawk' is 3.1.0 or 3.1.1, you don't have
+`asorti'. Instead, use a helper array to hold the sorted index values,
+and then access the original array's elements. It works in the
+following way:
POPULATE THE ARRAY data
# copy indices
@@ -8939,18 +9062,19 @@ access the original array's elements. It works in the following way:
DO SOMETHING WITH data[ind[i]] Access original array via sorted indices
}
-Sorting the array by replacing the indices provides maximal flexibility.
-To traverse the elements in decreasing order, use a loop that goes from
-N down to 1, either over the elements or over the indices.
+ Sorting the array by replacing the indices provides maximal
+flexibility. To traverse the elements in decreasing order, use a loop
+that goes from N down to 1, either over the elements or over the
+indices.
-Copying array indices and elements isn't expensive in terms of memory.
-Internally, `gawk' maintains "reference counts" to data. For example,
-when `asort' copies the first array to the second one, there is only
-one copy of the original array elements' data, even though both arrays
-use the values. Similarly, when copying the indices from `data' to
-`ind', there is only one copy of the actual index strings.
+ Copying array indices and elements isn't expensive in terms of
+memory. Internally, `gawk' maintains "reference counts" to data. For
+example, when `asort' copies the first array to the second one, there
+is only one copy of the original array elements' data, even though both
+arrays use the values. Similarly, when copying the indices from `data'
+to `ind', there is only one copy of the actual index strings.
-We said previously that comparisons are done using `gawk''s "usual
+ We said previously that comparisons are done using `gawk''s "usual
comparison rules." Because `IGNORECASE' affects string comparisons,
the value of `IGNORECASE' also affects sorting for both `asort' and
`asorti'. Caveat Emptor.
@@ -8966,7 +9090,7 @@ three categories: numeric, string, and I/O. `gawk' provides additional
groups of functions to work with values that represent time, do bit
manipulation, and internationalize and localize programs.
-Besides the built-in functions, `awk' has provisions for writing new
+ Besides the built-in functions, `awk' has provisions for writing new
functions that the rest of a program can use. The second half of this
major node describes these "user-defined" functions.
@@ -9008,22 +9132,22 @@ To call one of `awk''s built-in functions, write the name of the
function followed by arguments in parentheses. For example, `atan2(y +
z, 1)' is a call to the function `atan2' and has two arguments.
-Whitespace is ignored between the built-in function name and the open
-parenthesis, and it is good practice to avoid using whitespace there.
-User-defined functions do not permit whitespace in this way, and it is
-easier to avoid mistakes by following a simple convention that always
-works--no whitespace after a function name.
+ Whitespace is ignored between the built-in function name and the
+open parenthesis, and it is good practice to avoid using whitespace
+there. User-defined functions do not permit whitespace in this way, and
+it is easier to avoid mistakes by following a simple convention that
+always works--no whitespace after a function name.
-Each built-in function accepts a certain number of arguments. In some
-cases, arguments can be omitted. The defaults for omitted arguments
-vary from function to function and are described under the individual
-functions. In some `awk' implementations, extra arguments given to
-built-in functions are ignored. However, in `gawk', it is a fatal
-error to give extra arguments to a built-in function.
+ Each built-in function accepts a certain number of arguments. In
+some cases, arguments can be omitted. The defaults for omitted
+arguments vary from function to function and are described under the
+individual functions. In some `awk' implementations, extra arguments
+given to built-in functions are ignored. However, in `gawk', it is a
+fatal error to give extra arguments to a built-in function.
-When a function is called, expressions that create the function's actual
-parameters are evaluated completely before the call is performed. For
-example, in the following code fragment:
+ When a function is called, expressions that create the function's
+actual parameters are evaluated completely before the call is performed.
+For example, in the following code fragment:
i = 4
j = sqrt(i++)
@@ -9037,8 +9161,8 @@ are evaluated from left to right or from right to left. For example:
i = 5
j = atan2(i++, i *= 2)
-If the order of evaluation is left to right, then `i' first becomes 6,
-and then 12, and `atan2' is called with the two arguments 6 and 12.
+ If the order of evaluation is left to right, then `i' first becomes
+6, and then 12, and `atan2' is called with the two arguments 6 and 12.
But if the order of evaluation is right to left, `i' first becomes 10,
then 11, and `atan2' is called with the two arguments 11 and 10.
@@ -9142,15 +9266,15 @@ brackets ([ ]):
easy to keep track of the seeds in case you need to consistently
reproduce sequences of random numbers.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The C version of `rand' is known to produce fairly poor sequences
-of random numbers. However, nothing requires that an `awk'
+ (1) The C version of `rand' is known to produce fairly poor
+sequences of random numbers. However, nothing requires that an `awk'
implementation use the C `rand' to implement the `awk' version of
`rand'. In fact, `gawk' uses the BSD `random' function, which is
considerably better than `rand', to produce random numbers.
-(2) Computer-generated random numbers really are not truly random.
+ (2) Computer-generated random numbers really are not truly random.
They are technically known as "pseudorandom." This means that while
the numbers in a sequence appear to be random, you can in fact generate
the same sequence of random numbers over and over again.
@@ -9197,7 +9321,7 @@ with a pound sign (`#'):
a[2] = "de"
a[3] = "sac"
- The `asort' function is described in more detail in *Note Array
+ The `asort' function is described in more detail in *note Array
Sorting::. `asort' is a `gawk' extension; it is not available in
compatibility mode (*note Options::).
@@ -9209,7 +9333,7 @@ with a pound sign (`#'):
always a string comparison. (Here too, `IGNORECASE' affects the
sorting.)
- The `asorti' function is described in more detail in *Note Array
+ The `asorti' function is described in more detail in *note Array
Sorting::. It was added in `gawk' 3.1.2. `asorti' is a `gawk'
extension; it is not available in compatibility mode (*note
Options::).
@@ -9261,7 +9385,7 @@ with a pound sign (`#'):
The REGEXP argument may be either a regexp constant (`/.../') or a
string constant ("..."). In the latter case, the string is
- treated as a regexp to be matched. *Note Computed Regexps::, for a
+ treated as a regexp to be matched. *note Computed Regexps::, for a
discussion of the difference between the two forms, and the
implications for writing your program correctly.
@@ -9377,7 +9501,7 @@ with a pound sign (`#'):
Modern implementations of `awk', including `gawk', allow the third
argument to be a regexp constant (`/abc/') as well as a string.
- (d.c.) The POSIX standard allows this as well. *Note Computed
+ (d.c.) The POSIX standard allows this as well. *note Computed
Regexps::, for a discussion of the difference between using a
string constant or a regexp constant, and the implications for
writing your program correctly.
@@ -9431,7 +9555,7 @@ with a pound sign (`#'):
The REGEXP argument may be either a regexp constant (`/.../') or a
string constant ("..."). In the latter case, the string is
- treated as a regexp to be matched. *Note Computed Regexps::, for a
+ treated as a regexp to be matched. *note Computed Regexps::, for a
discussion of the difference between the two forms, and the
implications for writing your program correctly.
@@ -9620,18 +9744,18 @@ with a pound sign (`#'):
Nonalphabetic characters are left unchanged. For example,
`toupper("MiXeD cAsE 123")' returns `"MIXED CASE 123"'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Unless you use the `--non-decimal-data' option, which isn't
+ (1) Unless you use the `--non-decimal-data' option, which isn't
recommended. *Note Nondecimal Data::, for more information.
-(2) Note that this means that the record will first be regenerated
+ (2) Note that this means that the record will first be regenerated
using the value of `OFS' if any fields have been changed, and that the
-fields will be updated after the substituion, even if the operation is
+fields will be updated after the substitution, even if the operation is
a "no-op" such as `sub(/^/, "")'.
-(3) This is different from C and C++, in which the first character is
-number zero.
+ (3) This is different from C and C++, in which the first character
+is number zero.

File: gawk.info, Node: Gory Details, Up: String Functions
@@ -9643,27 +9767,27 @@ When using `sub', `gsub', or `gensub', and trying to get literal
backslashes and ampersands into the replacement text, you need to
remember that there are several levels of "escape processing" going on.
-First, there is the "lexical" level, which is when `awk' reads your
+ First, there is the "lexical" level, which is when `awk' reads your
program and builds an internal copy of it that can be executed. Then
there is the runtime level, which is when `awk' actually scans the
replacement string to determine what to generate.
-At both levels, `awk' looks for a defined set of characters that can
+ At both levels, `awk' looks for a defined set of characters that can
come after a backslash. At the lexical level, it looks for the escape
-sequences listed in *Note Escape Sequences::. Thus, for every `\' that
+sequences listed in *note Escape Sequences::. Thus, for every `\' that
`awk' processes at the runtime level, type two backslashes at the
lexical level. When a character that is not valid for an escape
sequence follows the `\', Unix `awk' and `gawk' both simply remove the
initial `\' and put the next character into the string. Thus, for
example, `"a\qb"' is treated as `"aqb"'.
-At the runtime level, the various functions handle sequences of `\' and
-`&' differently. The situation is (sadly) somewhat complex.
+ At the runtime level, the various functions handle sequences of `\'
+and `&' differently. The situation is (sadly) somewhat complex.
Historically, the `sub' and `gsub' functions treated the two character
sequence `\&' specially; this sequence was replaced in the generated
text with a single `&'. Any other `\' within the REPLACEMENT string
that did not precede an `&' was passed through unchanged. This is
-illustrated in *Note table-sub-escapes::.
+illustrated in *note table-sub-escapes::.
You type `sub' sees `sub' generates
------- --------- --------------
@@ -9689,7 +9813,7 @@ get a literal `\' followed by the matched text.
The 1992 POSIX standard attempted to fix this problem. That standard
says that `sub' and `gsub' look for either a `\' or an `&' after the
`\'. If either one follows a `\', that character is output literally.
-The interpretation of `\' and `&' then becomes as shown in *Note
+The interpretation of `\' and `&' then becomes as shown in *note
table-sub-posix-92::.
You type `sub' sees `sub' generates
@@ -9717,7 +9841,7 @@ problems:
submitted proposed text for a revised standard that reverts to rules
that correspond more closely to the original existing practice. The
proposed rules have special cases that make it possible to produce a
-`\' preceding the matched text. This is shown in *Note
+`\' preceding the matched text. This is shown in *note
table-sub-proposed::.
You type `sub' sees `sub' generates
@@ -9728,7 +9852,7 @@ table-sub-proposed::.
`\\q' `\q' a literal `\q'
`\\\\' `\\' `\\'
-Table 8.3: Propsosed rules for sub and backslash
+Table 8.3: Proposed rules for sub and backslash
In a nutshell, at the runtime level, there are now three special
sequences of characters (`\\\&', `\\&' and `\&') whereas historically
@@ -9745,7 +9869,7 @@ except for one case.
The 2001 POSIX rules state that `\&' in the replacement string
produces a literal `&', `\\' produces a literal `\', and `\' followed
by anything else is not special; the `\' is placed straight into the
-output. These rules are presented in *Note table-posix-2001-sub::.
+output. These rules are presented in *note table-posix-2001-sub::.
You type `sub' sees `sub' generates
------- --------- --------------
@@ -9773,7 +9897,7 @@ level, whenever `gawk' sees a `\', if the following character is a
digit, then the text that matched the corresponding parenthesized
subexpression is placed in the generated output. Otherwise, no matter
what character follows the `\', it appears in the generated text and
-the `\' does not, as shown in *Note table-gensub-escapes::.
+the `\' does not, as shown in *note table-gensub-escapes::.
You type `gensub' sees `gensub' generates
------- ------------ -----------------
@@ -9802,14 +9926,14 @@ For example:
Although this makes a certain amount of sense, it can be surprising.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This consequence was certainly unintended.
+ (1) This consequence was certainly unintended.

File: gawk.info, Node: I/O Functions, Next: Time Functions, Prev: String Functions, Up: Built-in
-8.1.5 Input/Output Functions
+8.1.4 Input/Output Functions
----------------------------
The following functions relate to input/output (I/O). Optional
@@ -9905,7 +10029,7 @@ As a side point, buffering issues can be even more confusing, depending
upon whether your program is "interactive", i.e., communicating with a
user sitting at a keyboard.(1)
-Interactive programs generally "line buffer" their output; i.e., they
+ Interactive programs generally "line buffer" their output; i.e., they
write out every line. Noninteractive programs wait until they have a
full buffer, which may be many lines of output. Here is an example of
the difference:
@@ -9949,7 +10073,7 @@ unnecessary shell. (Other implementations may only flush the buffer
associated with the standard output and not necessarily all buffered
output.)
-If you think about what a programmer expects, it makes sense that
+ If you think about what a programmer expects, it makes sense that
`system' should flush any pending output. The following program:
BEGIN {
@@ -9970,18 +10094,18 @@ and not:
first print
second print
-If `awk' did not flush its buffers before calling `system', you would
-see the latter (undesirable) output.
+ If `awk' did not flush its buffers before calling `system', you
+would see the latter (undesirable) output.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) A program is interactive if the standard output is connected to a
-terminal device.
+ (1) A program is interactive if the standard output is connected to
+a terminal device.

File: gawk.info, Node: Time Functions, Next: Bitwise Functions, Prev: I/O Functions, Up: Built-in
-8.1.8 Using `gawk''s Timestamp Functions
+8.1.5 Using `gawk''s Timestamp Functions
----------------------------------------
`awk' programs are commonly used to process log files containing
@@ -9995,7 +10119,7 @@ which is sufficient to represent times through 2038-01-19 03:14:07 UTC.
Many systems support a wider range of timestamps, including negative
timestamps that represent times before the epoch.
-In order to make it easier to process such log files and to produce
+ In order to make it easier to process such log files and to produce
useful reports, `gawk' provides the following functions for working
with timestamps. They are `gawk' extensions; they are not specified in
the POSIX standard, nor are they in any other known version of `awk'.(2)
@@ -10030,38 +10154,41 @@ Optional parameters are enclosed in square brackets ([ ]):
If DATESPEC does not contain enough elements or if the resulting
time is out of range, `mktime' returns -1.
-`strftime([FORMAT [, TIMESTAMP]])'
+`strftime([FORMAT [, TIMESTAMP [, UTC-FLAG]]])'
This function returns a string. It is similar to the function of
the same name in ISO C. The time specified by TIMESTAMP is used to
- produce a string, based on the contents of the FORMAT string. The
- TIMESTAMP is in the same format as the value returned by the
- `systime' function. If no TIMESTAMP argument is supplied, `gawk'
- uses the current time of day as the timestamp. If no FORMAT
- argument is supplied, `strftime' uses `"%a %b %d %H:%M:%S %Z %Y"'.
- This format string produces output that is (almost) equivalent to
- that of the `date' utility. (Versions of `gawk' prior to 3.0
- require the FORMAT argument.)
-
-The `systime' function allows you to compare a timestamp from a log
+ produce a string, based on the contents of the FORMAT string. If
+ UTC-FLAG is present and is either non-zero or non-null, the value
+ is formatted as UTC (Coordinated Universal Time, formerly GMT or
+ Greenwich Mean Time). Otherwise, the value is formatted for the
+ local time zone. The TIMESTAMP is in the same format as the value
+ returned by the `systime' function. If no TIMESTAMP argument is
+ supplied, `gawk' uses the current time of day as the timestamp.
+ If no FORMAT argument is supplied, `strftime' uses
+ `"%a %b %d %H:%M:%S %Z %Y"'. This format string produces output
+ that is (almost) equivalent to that of the `date' utility.
+ (Versions of `gawk' prior to 3.0 require the FORMAT argument.)
+
+ The `systime' function allows you to compare a timestamp from a log
file with the current time of day. In particular, it is easy to
determine how long ago a particular record was logged. It also allows
you to produce log records using the "seconds since the epoch" format.
-The `mktime' function allows you to convert a textual representation of
-a date and time into a timestamp. This makes it easy to do
+ The `mktime' function allows you to convert a textual representation
+of a date and time into a timestamp. This makes it easy to do
before/after comparisons of dates and times, particularly when dealing
with date and time data coming from an external source, such as a log
file.
-The `strftime' function allows you to easily turn a timestamp into
+ The `strftime' function allows you to easily turn a timestamp into
human-readable information. It is similar in nature to the `sprintf'
function (*note String Functions::), in that it copies nonformat
specification characters verbatim to the returned string, while
substituting date and time values for format specifications in the
FORMAT string.
-`strftime' is guaranteed by the 1999 ISO C standard(4) to support the
-following date format specifications:
+ `strftime' is guaranteed by the 1999 ISO C standard(4) to support
+the following date format specifications:
`%a'
The locale's abbreviated weekday name.
@@ -10201,10 +10328,10 @@ following date format specifications:
`%%'
A literal `%'.
-If a conversion specifier is not one of the above, the behavior is
+ If a conversion specifier is not one of the above, the behavior is
undefined.(6)
-Informally, a "locale" is the geographic place in which a program is
+ Informally, a "locale" is the geographic place in which a program is
meant to run. For example, a common way to abbreviate the date
September 4, 1991 in the United States is "9/4/91." In many countries
in Europe, however, it is abbreviated "4.9.91." Thus, the `%x'
@@ -10213,9 +10340,9 @@ specification in a `"US"' locale might produce `9/4/91', while in a
defines a default `"C"' locale, which is an environment that is typical
of what most C programmers are used to.
-A public-domain C version of `strftime' is supplied with `gawk' for
-systems that are not yet fully standards-compliant. It supports all of
-the just listed format specifications. If that version is used to
+ For systems that are not yet fully standards-compliant, `gawk'
+supplies a copy of `strftime' from the GNU C Library. It supports all
+of the just listed format specifications. If that version is used to
compile `gawk' (*note Installation::), then the following additional
format specifications are available:
@@ -10227,22 +10354,14 @@ format specifications are available:
The hour (12-hour clock) as a decimal number (1-12). Single-digit
numbers are padded with a space.
-`%N'
- The "Emperor/Era" name. Equivalent to `%C'.
-
-`%o'
- The "Emperor/Era" year. Equivalent to `%y'.
-
`%s'
The time as a decimal timestamp in seconds since the epoch.
-`%v'
- The date in VMS format (e.g., `20-JUN-1991').
-Additionally, the alternate representations are recognized but their
+ Additionally, the alternate representations are recognized but their
normal representations are used.
-This example is an `awk' implementation of the POSIX `date' utility.
+ This example is an `awk' implementation of the POSIX `date' utility.
Normally, the `date' utility prints the current date and time of day in
a well-known format. However, if you provide an argument to it that
begins with a `+', `date' copies nonformat specifier characters to the
@@ -10252,7 +10371,7 @@ specifiers in the string. For example:
$ date '+Today is %A, %B %d, %Y.'
-| Today is Thursday, September 14, 2000.
-Here is the `gawk' version of the `date' utility. It has a shell
+ Here is the `gawk' version of the `date' utility. It has a shell
"wrapper" to handle the `-u' option, which requires that `date' run as
if the time zone is set to UTC:
@@ -10281,26 +10400,26 @@ if the time zone is set to UTC:
exit exitval
}' "$@"
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) *Note Glossary::, especially the entries "Epoch" and "UTC."
+ (1) *Note Glossary::, especially the entries "Epoch" and "UTC."
-(2) The GNU `date' utility can also do many of the things described
+ (2) The GNU `date' utility can also do many of the things described
here. Its use may be preferable for simple time-related operations in
shell scripts.
-(3) Occasionally there are minutes in a year with a leap second, which
-is why the seconds can go up to 60.
+ (3) Occasionally there are minutes in a year with a leap second,
+which is why the seconds can go up to 60.
-(4) As this is a recent standard, not every system's `strftime'
+ (4) As this is a recent standard, not every system's `strftime'
necessarily supports all of the conversions listed here.
-(5) If you don't understand any of this, don't worry about it; these
+ (5) If you don't understand any of this, don't worry about it; these
facilities are meant to make it easier to "internationalize" programs.
-Other internationalization features are described in *Note
+Other internationalization features are described in *note
Internationalization::.
-(6) This is because ISO C leaves the behavior of the C version of
+ (6) This is because ISO C leaves the behavior of the C version of
`strftime' undefined and `gawk' uses the system's version of `strftime'
if it's there. Typically, the conversion specifier either does not
appear in the returned string or appears literally.
@@ -10308,16 +10427,16 @@ appear in the returned string or appears literally.

File: gawk.info, Node: Bitwise Functions, Next: I18N Functions, Prev: Time Functions, Up: Built-in
-8.1.9 Bit-Manipulation Functions of `gawk'
+8.1.6 Bit-Manipulation Functions of `gawk'
------------------------------------------
I can explain it for you, but I can't understand it for you.
Anonymous
-Many languages provide the ability to perform "bitwise" operations on
-two integer numbers. In other words, the operation is performed on
+ Many languages provide the ability to perform "bitwise" operations
+on two integer numbers. In other words, the operation is performed on
each successive pair of bits in the operands. Three common operations
-are bitwise AND, OR, and XOR. The operations are described in *Note
+are bitwise AND, OR, and XOR. The operations are described in *note
table-bitwise-ops::.
Bit Operator
@@ -10404,7 +10523,7 @@ This program produces the following output when run:
-| lshift(0x99, 2) = 0x264 = 0000001001100100
-| rshift(0x99, 2) = 0x26 = 00100110
-The `bits2str' function turns a binary number into a string. The
+ The `bits2str' function turns a binary number into a string. The
number `1' represents a binary value where the rightmost bit is set to
1. Using this mask, the function repeatedly checks the rightmost bit.
ANDing the mask with the value indicates whether the rightmost bit is 1
@@ -10412,26 +10531,26 @@ or not. If so, a `"1"' is concatenated onto the front of the string.
Otherwise, a `"0"' is added. The value is then shifted right by one
bit and the loop continues until there are no more 1 bits.
-If the initial value is zero it returns a simple `"0"'. Otherwise, at
-the end, it pads the value with zeros to represent multiples of 8-bit
-quantities. This is typical in modern computers.
+ If the initial value is zero it returns a simple `"0"'. Otherwise,
+at the end, it pads the value with zeros to represent multiples of
+8-bit quantities. This is typical in modern computers.
-The main code in the `BEGIN' rule shows the difference between the
+ The main code in the `BEGIN' rule shows the difference between the
decimal and octal values for the same numbers (*note
Nondecimal-numbers::), and then demonstrates the results of the
`compl', `lshift', and `rshift' functions.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This example shows that 0's come in on the left side. For `gawk',
-this is always true, but in some languages, it's possible to have the
-left side fill with 1's. Caveat emptor.
+ (1) This example shows that 0's come in on the left side. For
+`gawk', this is always true, but in some languages, it's possible to
+have the left side fill with 1's. Caveat emptor.

File: gawk.info, Node: I18N Functions, Prev: Bitwise Functions, Up: Built-in
-8.1.10 Using `gawk''s String-Translation Functions
---------------------------------------------------
+8.1.7 Using `gawk''s String-Translation Functions
+-------------------------------------------------
`gawk' provides facilities for internationalizing `awk' programs.
These include the functions described in the following list. The
@@ -10496,7 +10615,7 @@ There is no need to put the definition of a function before all uses of
the function. This is because `awk' reads the entire program before
starting to execute any of it.
-The definition of a function named NAME looks like this:
+ The definition of a function named NAME looks like this:
function NAME(PARAMETER-LIST)
{
@@ -10509,58 +10628,58 @@ underscores that doesn't start with a digit. Within a single `awk'
program, any particular name can only be used as a variable, array, or
function.
-PARAMETER-LIST is a list of the function's arguments and local variable
-names, separated by commas. When the function is called, the argument
-names are used to hold the argument values given in the call. The
-local variables are initialized to the empty string. A function cannot
-have two parameters with the same name, nor may it have a parameter
-with the same name as the function itself.
+ PARAMETER-LIST is a list of the function's arguments and local
+variable names, separated by commas. When the function is called, the
+argument names are used to hold the argument values given in the call.
+The local variables are initialized to the empty string. A function
+cannot have two parameters with the same name, nor may it have a
+parameter with the same name as the function itself.
-The BODY-OF-FUNCTION consists of `awk' statements. It is the most
+ The BODY-OF-FUNCTION consists of `awk' statements. It is the most
important part of the definition, because it says what the function
should actually _do_. The argument names exist to give the body a way
to talk about the arguments; local variables exist to give the body
places to keep temporary values.
-Argument names are not distinguished syntactically from local variable
-names. Instead, the number of arguments supplied when the function is
-called determines how many argument variables there are. Thus, if three
-argument values are given, the first three names in PARAMETER-LIST are
-arguments and the rest are local variables.
-
-It follows that if the number of arguments is not the same in all calls
-to the function, some of the names in PARAMETER-LIST may be arguments
-on some occasions and local variables on others. Another way to think
-of this is that omitted arguments default to the null string.
-
-Usually when you write a function, you know how many names you intend to
-use for arguments and how many you intend to use as local variables.
-It is conventional to place some extra space between the arguments and
-the local variables, in order to document how your function is supposed
-to be used.
-
-During execution of the function body, the arguments and local variable
-values hide, or "shadow", any variables of the same names used in the
-rest of the program. The shadowed variables are not accessible in the
-function definition, because there is no way to name them while their
-names have been taken away for the local variables. All other variables
-used in the `awk' program can be referenced or set normally in the
-function's body.
-
-The arguments and local variables last only as long as the function body
-is executing. Once the body finishes, you can once again access the
-variables that were shadowed while the function was running.
-
-The function body can contain expressions that call functions. They
+ Argument names are not distinguished syntactically from local
+variable names. Instead, the number of arguments supplied when the
+function is called determines how many argument variables there are.
+Thus, if three argument values are given, the first three names in
+PARAMETER-LIST are arguments and the rest are local variables.
+
+ It follows that if the number of arguments is not the same in all
+calls to the function, some of the names in PARAMETER-LIST may be
+arguments on some occasions and local variables on others. Another way
+to think of this is that omitted arguments default to the null string.
+
+ Usually when you write a function, you know how many names you
+intend to use for arguments and how many you intend to use as local
+variables. It is conventional to place some extra space between the
+arguments and the local variables, in order to document how your
+function is supposed to be used.
+
+ During execution of the function body, the arguments and local
+variable values hide, or "shadow", any variables of the same names used
+in the rest of the program. The shadowed variables are not accessible
+in the function definition, because there is no way to name them while
+their names have been taken away for the local variables. All other
+variables used in the `awk' program can be referenced or set normally
+in the function's body.
+
+ The arguments and local variables last only as long as the function
+body is executing. Once the body finishes, you can once again access
+the variables that were shadowed while the function was running.
+
+ The function body can contain expressions that call functions. They
can even call this function, either directly or by way of another
function. When this happens, we say the function is "recursive". The
act of a function calling itself is called "recursion".
-In many `awk' implementations, including `gawk', the keyword `function'
-may be abbreviated `func'. However, POSIX only specifies the use of
-the keyword `function'. This actually has some practical implications.
-If `gawk' is in POSIX-compatibility mode (*note Options::), then the
-following statement does _not_ define a function:
+ In many `awk' implementations, including `gawk', the keyword
+`function' may be abbreviated `func'. However, POSIX only specifies
+the use of the keyword `function'. This actually has some practical
+implications. If `gawk' is in POSIX-compatibility mode (*note
+Options::), then the following statement does _not_ define a function:
func foo() { a = sqrt($1) ; print a }
@@ -10571,8 +10690,8 @@ probably not what is desired. (`awk' accepts this input as
syntactically valid, because functions may be used before they are
defined in `awk' programs.)
-To ensure that your `awk' programs are portable, always use the keyword
-`function' when defining a function.
+ To ensure that your `awk' programs are portable, always use the
+keyword `function' when defining a function.

File: gawk.info, Node: Function Example, Next: Function Caveats, Prev: Definition Syntax, Up: User-defined
@@ -10605,7 +10724,7 @@ this program, using our function to format the results, prints:
5.6
21.2
-This function deletes all the elements in an array:
+ This function deletes all the elements in an array:
function delarray(a, i)
{
@@ -10613,15 +10732,15 @@ This function deletes all the elements in an array:
delete a[i]
}
-When working with arrays, it is often necessary to delete all the
+ When working with arrays, it is often necessary to delete all the
elements in an array and start over with a new list of elements (*note
Delete::). Instead of having to repeat this loop everywhere that you
need to clear out an array, your program can just call `delarray'.
(This guarantees portability. The use of `delete ARRAY' to delete the
contents of an entire array is a nonstandard extension.)
-The following is an example of a recursive function. It takes a string
-as an input parameter and returns the string in backwards order.
+ The following is an example of a recursive function. It takes a
+string as an input parameter and returns the string in backwards order.
Recursive functions must always have a test that stops the recursion.
In this case, the recursion terminates when the starting position is
zero, i.e., when there are no more characters left in the string.
@@ -10634,14 +10753,14 @@ zero, i.e., when there are no more characters left in the string.
return (substr(str, start, 1) rev(str, start - 1))
}
-If this function is in a file named `rev.awk', it can be tested this
+ If this function is in a file named `rev.awk', it can be tested this
way:
$ echo "Don't Panic!" |
> gawk --source '{ print rev($0, length($0)) }' -f rev.awk
-| !cinaP t'noD
-The C `ctime' function takes a timestamp and returns it in a string,
+ The C `ctime' function takes a timestamp and returns it in a string,
formatted in a well-known fashion. The following example uses the
built-in `strftime' function (*note Time Functions::) to create an
`awk' version of `ctime':
@@ -10668,23 +10787,23 @@ File: gawk.info, Node: Function Caveats, Next: Return Statement, Prev: Functi
A function call is an expression and its value is the value returned by
the function.
-A function call consists of the function name followed by the arguments
-in parentheses. `awk' expressions are what you write in the call for
-the arguments. Each time the call is executed, these expressions are
-evaluated, and the values are the actual arguments. For example, here
-is a call to `foo' with three arguments (the first being a string
-concatenation):
+ A function call consists of the function name followed by the
+arguments in parentheses. `awk' expressions are what you write in the
+call for the arguments. Each time the call is executed, these
+expressions are evaluated, and the values are the actual arguments. For
+example, here is a call to `foo' with three arguments (the first being
+a string concatenation):
foo(x y, "lose", 4 * z)
-*Caution:* Whitespace characters (spaces and tabs) are not allowed
+ *Caution:* Whitespace characters (spaces and tabs) are not allowed
between the function name and the open-parenthesis of the argument list.
If you write whitespace by mistake, `awk' might think that you mean to
concatenate a variable with an expression in parentheses. However, it
notices that you used a function name and not a variable name, and
reports an error.
-When a function is called, it is given a _copy_ of the values of its
+ When a function is called, it is given a _copy_ of the values of its
arguments. This is known as "call by value". The caller may use a
variable as the expression for the argument, but the called function
does not know this--it only knows what value the argument had. For
@@ -10713,7 +10832,7 @@ outside of `myfunc', the function body cannot alter this outer value,
because it is shadowed during the execution of `myfunc' and cannot be
seen or changed from there.
-However, when arrays are the parameters to functions, they are _not_
+ However, when arrays are the parameters to functions, they are _not_
copied. Instead, the array itself is made available for direct
manipulation by the function. This is usually called "call by
reference". Changes made to an array parameter inside the body of a
@@ -10737,7 +10856,7 @@ function _are_ visible outside that function.
prints `a[1] = 1, a[2] = two, a[3] = 3', because `changeit' stores
`"two"' in the second element of `a'.
-Some `awk' implementations allow you to call a function that has not
+ Some `awk' implementations allow you to call a function that has not
been defined. They only report a problem at runtime when the program
actually tries to call the function. For example:
@@ -10754,10 +10873,10 @@ Because the `if' statement will never be true, it is not really a
problem that `foo' has not been defined. Usually, though, it is a
problem if a program calls an undefined function.
-If `--lint' is specified (*note Options::), `gawk' reports calls to
+ If `--lint' is specified (*note Options::), `gawk' reports calls to
undefined functions.
-Some `awk' implementations generate a runtime error if you use the
+ Some `awk' implementations generate a runtime error if you use the
`next' statement (*note Next Statement::) inside a user-defined
function. `gawk' does not have this limitation.
@@ -10774,22 +10893,22 @@ the `awk' program. It looks like this:
return [EXPRESSION]
-The EXPRESSION part is optional. If it is omitted, then the returned
+ The EXPRESSION part is optional. If it is omitted, then the returned
value is undefined, and therefore, unpredictable.
-A `return' statement with no value expression is assumed at the end of
-every function definition. So if control reaches the end of the
+ A `return' statement with no value expression is assumed at the end
+of every function definition. So if control reaches the end of the
function body, then the function returns an unpredictable value. `awk'
does _not_ warn you if you use the return value of such a function.
-Sometimes, you want to write a function for what it does, not for what
-it returns. Such a function corresponds to a `void' function in C or
-to a `procedure' in Pascal. Thus, it may be appropriate to not return
-any value; simply bear in mind that if you use the return value of such
-a function, you do so at your own risk.
+ Sometimes, you want to write a function for what it does, not for
+what it returns. Such a function corresponds to a `void' function in C
+or to a `procedure' in Pascal. Thus, it may be appropriate to not
+return any value; simply bear in mind that if you use the return value
+of such a function, you do so at your own risk.
-The following is an example of a user-defined function that returns a
-value for the largest number among the elements of an array:
+ The following is an example of a user-defined function that returns
+a value for the largest number among the elements of an array:
function maxelt(vec, i, ret)
{
@@ -10808,8 +10927,9 @@ function parameter list indicates that `i' and `ret' are not supposed
to be arguments. You should follow this convention when defining
functions.
-The following program uses the `maxelt' function. It loads an array,
-calls `maxelt', and then reports the maximum number in that array:
+ The following program uses the `maxelt' function. It loads an
+array, calls `maxelt', and then reports the maximum number in that
+array:
function maxelt(vec, i, ret)
{
@@ -10830,7 +10950,7 @@ calls `maxelt', and then reports the maximum number in that array:
print maxelt(nums)
}
-Given the following input:
+ Given the following input:
1 5 23 8 16
44 3 5 2 8 26
@@ -10864,8 +10984,8 @@ runtime. Here is an annotated sample program:
x = 1 # now not allowed, runtime error
}
-Usually, such things aren't a big issue, but it's worth being aware of
-them.
+ Usually, such things aren't a big issue, but it's worth being aware
+of them.

File: gawk.info, Node: Internationalization, Next: Advanced Features, Prev: Functions, Up: Top
@@ -10880,13 +11000,14 @@ countries, they were able to sell more systems. As a result,
internationalization and localization of programs and software systems
became a common practice.
-Until recently, the ability to provide internationalization was largely
-restricted to programs written in C and C++. This major node describes
-the underlying library `gawk' uses for internationalization, as well as
-how `gawk' makes internationalization features available at the `awk'
-program level. Having internationalization available at the `awk' level
-gives software developers additional flexibility--they are no longer
-required to write in C when internationalization is a requirement.
+ Until recently, the ability to provide internationalization was
+largely restricted to programs written in C and C++. This major node
+describes the underlying library `gawk' uses for internationalization,
+as well as how `gawk' makes internationalization features available at
+the `awk' program level. Having internationalization available at the
+`awk' level gives software developers additional flexibility--they are
+no longer required to write in C when internationalization is a
+requirement.
* Menu:
@@ -10922,13 +11043,13 @@ The facilities in GNU `gettext' focus on messages; strings printed by a
program, either directly or via formatting with `printf' or
`sprintf'.(1)
-When using GNU `gettext', each application has its own "text domain".
-This is a unique name, such as `kpilot' or `gawk', that identifies the
-application. A complete application may have multiple
+ When using GNU `gettext', each application has its own "text
+domain". This is a unique name, such as `kpilot' or `gawk', that
+identifies the application. A complete application may have multiple
components--programs written in C or C++, as well as scripts written in
`sh' or `awk'. All of the components use the same text domain.
-To make the discussion concrete, assume we're writing an application
+ To make the discussion concrete, assume we're writing an application
named `guide'. Internationalization consists of the following steps,
in this order:
@@ -10972,15 +11093,15 @@ in this order:
having to switch the application's default text domain back and
forth.
-In C (or C++), the string marking and dynamic translation lookup are
+ In C (or C++), the string marking and dynamic translation lookup are
accomplished by wrapping each string in a call to `gettext':
printf(gettext("Don't Panic!\n"));
-The tools that extract messages from source code pull out all strings
-enclosed in calls to `gettext'.
+ The tools that extract messages from source code pull out all
+strings enclosed in calls to `gettext'.
-The GNU `gettext' developers, recognizing that typing `gettext' over
+ The GNU `gettext' developers, recognizing that typing `gettext' over
and over again is both painful and ugly to look at, use the macro `_'
(an underscore) to make things easier:
@@ -11031,15 +11152,15 @@ defined locale categories that `gettext' knows about are:
`LC_ALL'
All of the above. (Not too useful in the context of `gettext'.)
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) For some operating systems, the `gawk' port doesn't support GNU
+ (1) For some operating systems, the `gawk' port doesn't support GNU
`gettext'. This applies most notably to the PC operating systems. As
such, these features are not available if you are using one of those
operating systems. Sorry.
-(2) Americans use a comma every three decimal places and a period for
-the decimal point, while many Europeans do exactly the opposite:
+ (2) Americans use a comma every three decimal places and a period
+for the decimal point, while many Europeans do exactly the opposite:
`1,234.56' versus `1.234,56'.

@@ -11068,7 +11189,7 @@ internationalization:
for CATEGORY is `"LC_MESSAGES"'.
If you supply a value for CATEGORY, it must be a string equal to
- one of the known locale categories described in *Note Explaining
+ one of the known locale categories described in *note Explaining
gettext::. You must also supply a text domain. Use `TEXTDOMAIN'
if you want to use the current domain.
@@ -11097,8 +11218,8 @@ internationalization:
the null string (`""'), then `bindtextdomain' returns the current
binding for the given DOMAIN.
-To use these facilities in your `awk' program, follow the steps
-outlined in *Note Explaining gettext::, like so:
+ To use these facilities in your `awk' program, follow the steps
+outlined in *note Explaining gettext::, like so:
1. Set the variable `TEXTDOMAIN' to the text domain of your program.
This is best done in a `BEGIN' rule (*note BEGIN/END::), or it can
@@ -11144,8 +11265,8 @@ outlined in *Note Explaining gettext::, like so:
}
-*Note I18N Example::, for an example program showing the steps to create
-and use translations from `awk'.
+ *Note I18N Example::, for an example program showing the steps to
+create and use translations from `awk'.

File: gawk.info, Node: Translator i18n, Next: I18N Example, Prev: Programmer i18n, Up: Internationalization
@@ -11158,7 +11279,7 @@ extracted to create the initial `.po' file. As part of translation, it
is often helpful to rearrange the order in which arguments to `printf'
are output.
-`gawk''s `--gen-po' command-line option extracts the messages and is
+ `gawk''s `--gen-po' command-line option extracts the messages and is
discussed next. After that, `printf''s ability to rearrange the order
for `printf' arguments at runtime is covered.
@@ -11181,7 +11302,7 @@ to create the initial `.po' file:
$ gawk --gen-po -f guide.awk > guide.po
-When run with `--gen-po', `gawk' does not execute your program.
+ When run with `--gen-po', `gawk' does not execute your program.
Instead, it parses it as usual and prints all marked strings to
standard output in the format of a GNU `gettext' Portable Object file.
Also included in the output are any constant strings that appear as the
@@ -11189,10 +11310,10 @@ first argument to `dcgettext' or as the first and second argument to
`dcngettext'.(1) *Note I18N Example::, for the full list of steps to go
through to create and test translations for `guide'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Starting with `gettext' version 0.11.5, the `xgettext' utility that
-comes with GNU `gettext' can handle `.awk' files.
+ (1) Starting with `gettext' version 0.11.5, the `xgettext' utility
+that comes with GNU `gettext' can handle `.awk' files.

File: gawk.info, Node: Printf Ordering, Next: I18N Portability, Prev: String Extraction, Up: Translator i18n
@@ -11206,22 +11327,22 @@ special problem for translation. Consider the following:(1)
printf(_"String `%s' has %d characters\n",
string, length(string)))
-A possible German translation for this might be:
+ A possible German translation for this might be:
"%d Zeichen lang ist die Zeichenkette `%s'\n"
-The problem should be obvious: the order of the format specifications
-is different from the original! Even though `gettext' can return the
-translated string at runtime, it cannot change the argument order in
-the call to `printf'.
+ The problem should be obvious: the order of the format
+specifications is different from the original! Even though `gettext'
+can return the translated string at runtime, it cannot change the
+argument order in the call to `printf'.
-To solve this problem, `printf' format specificiers may have an
+ To solve this problem, `printf' format specifiers may have an
additional optional element, which we call a "positional specifier".
For example:
"%2$d Zeichen lang ist die Zeichenkette `%1$s'\n"
-Here, the positional specifier consists of an integer count, which
+ Here, the positional specifier consists of an integer count, which
indicates which argument to use, and a `$'. Counts are one-based, and
the format string itself is _not_ included. Thus, in the following
example, `string' is the first argument and `length(string)' is the
@@ -11234,10 +11355,10 @@ second:
> }'
-| 10 characters live in "Dont Panic"
-If present, positional specifiers come first in the format
+ If present, positional specifiers come first in the format
specification, before the flags, the field width, and/or the precision.
-Positional specifiers can be used with the dynamic field width and
+ Positional specifiers can be used with the dynamic field width and
precision capability:
$ gawk 'BEGIN {
@@ -11249,9 +11370,9 @@ precision capability:
NOTE: When using `*' with a positional specifier, the `*' comes
first, then the integer position, and then the `$'. This is
- somewhat counterintutive.
+ somewhat counterintuitive.
-`gawk' does not allow you to mix regular format specifiers and those
+ `gawk' does not allow you to mix regular format specifiers and those
with positional specifiers in the same string:
$ gawk 'BEGIN { printf _"%d %3$s\n", 1, 2, "hi" }'
@@ -11262,14 +11383,14 @@ with positional specifiers in the same string:
It's still a bad idea to try mixing them, even if `gawk' doesn't
detect it.
-Although positional specifiers can be used directly in `awk' programs,
-their primary purpose is to help in producing correct translations of
-format strings into languages different from the one in which the
-program is first written.
+ Although positional specifiers can be used directly in `awk'
+programs, their primary purpose is to help in producing correct
+translations of format strings into languages different from the one in
+which the program is first written.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This example is borrowed from the GNU `gettext' manual.
+ (1) This example is borrowed from the GNU `gettext' manual.

File: gawk.info, Node: I18N Portability, Prev: Printf Ordering, Up: Translator i18n
@@ -11321,19 +11442,19 @@ actually almost portable, requiring very little change:
* The use of positional specifications in `printf' or `sprintf' is
_not_ portable. To support `gettext' at the C level, many
systems' C versions of `sprintf' do support positional specifiers.
- But it works only if enough arguments are supplied in the
- function call. Many versions of `awk' pass `printf' formats and
- arguments unchanged to the underlying C library version of
- `sprintf', but only one format and argument at a time. What
- happens if a positional specification is used is anybody's guess.
- However, since the positional specifications are primarily for use
- in _translated_ format strings, and since non-GNU `awk's never
+ But it works only if enough arguments are supplied in the function
+ call. Many versions of `awk' pass `printf' formats and arguments
+ unchanged to the underlying C library version of `sprintf', but
+ only one format and argument at a time. What happens if a
+ positional specification is used is anybody's guess. However,
+ since the positional specifications are primarily for use in
+ _translated_ format strings, and since non-GNU `awk's never
retrieve the translated string, this should not be a problem in
practice.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This is good fodder for an "Obfuscated `awk'" contest.
+ (1) This is good fodder for an "Obfuscated `awk'" contest.

File: gawk.info, Node: I18N Example, Next: Gawk I18N, Prev: Translator i18n, Up: Internationalization
@@ -11367,14 +11488,14 @@ This produces:
msgid "The Answer Is"
msgstr ""
-This original portable object file is saved and reused for each language
-into which the application is translated. The `msgid' is the original
-string and the `msgstr' is the translation.
+ This original portable object file is saved and reused for each
+language into which the application is translated. The `msgid' is the
+original string and the `msgstr' is the translation.
NOTE: Strings not marked with a leading underscore do not appear
in the `guide.po' file.
-Next, the messages must be translated. Here is a translation to a
+ Next, the messages must be translated. Here is a translation to a
hypothetical dialect of English, called "Mellow":(1)
$ cp guide.po guide-mellow.po
@@ -11390,29 +11511,29 @@ Following are the translations:
msgid "The Answer Is"
msgstr "Like, the scoop is"
-The next step is to make the directory to hold the binary message object
-file and then to create the `guide.mo' file. The directory layout
-shown here is standard for GNU `gettext' on GNU/Linux systems. Other
-versions of `gettext' may use a different layout:
+ The next step is to make the directory to hold the binary message
+object file and then to create the `guide.mo' file. The directory
+layout shown here is standard for GNU `gettext' on GNU/Linux systems.
+Other versions of `gettext' may use a different layout:
$ mkdir en_US en_US/LC_MESSAGES
-The `msgfmt' utility does the conversion from human-readable `.po' file
-to machine-readable `.mo' file. By default, `msgfmt' creates a file
-named `messages'. This file must be renamed and placed in the proper
-directory so that `gawk' can find it:
+ The `msgfmt' utility does the conversion from human-readable `.po'
+file to machine-readable `.mo' file. By default, `msgfmt' creates a
+file named `messages'. This file must be renamed and placed in the
+proper directory so that `gawk' can find it:
$ msgfmt guide-mellow.po
$ mv messages en_US/LC_MESSAGES/guide.mo
-Finally, we run the program to test it:
+ Finally, we run the program to test it:
$ gawk -f guide.awk
-| Hey man, relax!
-| Like, the scoop is 42
-| Pardon me, Zaphod who?
-If the three replacement functions for `dcgettext', `dcngettext' and
+ If the three replacement functions for `dcgettext', `dcngettext' and
`bindtextdomain' (*note I18N Portability::) are in a file named
`libintl.awk', then we can run `guide.awk' unchanged as follows:
@@ -11421,9 +11542,9 @@ If the three replacement functions for `dcgettext', `dcngettext' and
-| The Answer Is 42
-| Pardon me, Zaphod who?
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Perhaps it would be better if it were called "Hippy." Ah, well.
+ (1) Perhaps it would be better if it were called "Hippy." Ah, well.

File: gawk.info, Node: Gawk I18N, Prev: I18N Example, Up: Internationalization
@@ -11433,11 +11554,11 @@ File: gawk.info, Node: Gawk I18N, Prev: I18N Example, Up: Internationalizatio
As of version 3.1, `gawk' itself has been internationalized using the
GNU `gettext' package. (GNU `gettext' is described in complete detail
-in *Note Top::.) As of this writing, the latest version of GNU
+in *note Top::.) As of this writing, the latest version of GNU
`gettext' is version 0.11.5
(ftp://ftp.gnu.org/gnu/gettext/gettext-0.11.5.tar.gz).
-If a translation of `gawk''s messages exists, then `gawk' produces
+ If a translation of `gawk''s messages exists, then `gawk' produces
usage messages, warnings, and fatal errors in the local language.

@@ -11450,16 +11571,16 @@ File: gawk.info, Node: Advanced Features, Next: Invoking Gawk, Prev: Internat
who knows where you live.
Steve English, as quoted by Peter Langston
-This major node discusses advanced features in `gawk'. It's a bit of a
-"grab bag" of items that are otherwise unrelated to each other. First,
-a command-line option allows `gawk' to recognize nondecimal numbers in
-input data, not just in `awk' programs. Next, two-way I/O, discussed
-briefly in earlier parts of this Info file, is described in full
-detail, along with the basics of TCP/IP networking and BSD portal
+ This major node discusses advanced features in `gawk'. It's a bit
+of a "grab bag" of items that are otherwise unrelated to each other.
+First, a command-line option allows `gawk' to recognize nondecimal
+numbers in input data, not just in `awk' programs. Next, two-way I/O,
+discussed briefly in earlier parts of this Info file, is described in
+full detail, along with the basics of TCP/IP networking and BSD portal
files. Finally, `gawk' can "profile" an `awk' program, making it
possible to tune it for performance.
-*Note Dynamic Extensions::, discusses the ability to dynamically add
+ *note Dynamic Extensions::, discusses the ability to dynamically add
new built-in functions to `gawk'. As this feature is still immature
and likely to change, its description is relegated to an appendix.
@@ -11485,8 +11606,8 @@ nondecimal constants in your input data:
> $1, $2, $3 }'
-| 83, 123, 291
-For this feature to work, write your program so that `gawk' treats your
-data as numeric:
+ For this feature to work, write your program so that `gawk' treats
+your data as numeric:
$ echo 0123 123 0x123 | gawk '{ print $1, $2, $3 }'
-| 0123 123 0x123
@@ -11502,12 +11623,12 @@ zero to a field to force it to be treated as a number. For example:
-| 0123 123 0x123
-| 83 123 291
-Because it is common to have decimal data with leading zeros, and
+ Because it is common to have decimal data with leading zeros, and
because using it could lead to surprising results, the default is to
leave this facility disabled. If you want it, you must explicitly
request it.
-*Caution:* _Use of this option is not recommended._ It can break old
+ *Caution:* _Use of this option is not recommended._ It can break old
programs very badly. Instead, use the `strtonum' function to convert
your data (*note Nondecimal-numbers::). This makes your programs
easier to write and easier to read, and leads to less surprising
@@ -11536,7 +11657,7 @@ File: gawk.info, Node: Two-way I/O, Next: TCP/IP Networking, Prev: Nondecimal
--
Mike Brennan
-It is often useful to be able to send data to a separate program for
+ It is often useful to be able to send data to a separate program for
processing and then read the result. This can always be done with
temporary files:
@@ -11557,11 +11678,11 @@ the program be run in a directory that cannot be shared among users;
for example, `/tmp' will not do, as another user might happen to be
using a temporary file with the same name.
-Starting with version 3.1 of `gawk', it is possible to open a _two-way_
-pipe to another process. The second process is termed a "coprocess",
-since it runs in parallel with `gawk'. The two-way connection is
-created using the new `|&' operator (borrowed from the Korn shell,
-`ksh'):(1)
+ Starting with version 3.1 of `gawk', it is possible to open a
+_two-way_ pipe to another process. The second process is termed a
+"coprocess", since it runs in parallel with `gawk'. The two-way
+connection is created using the new `|&' operator (borrowed from the
+Korn shell, `ksh'):(1)
do {
print DATA |& "subprogram"
@@ -11569,7 +11690,7 @@ created using the new `|&' operator (borrowed from the Korn shell,
} while (DATA LEFT TO PROCESS)
close("subprogram")
-The first time an I/O operation is executed using the `|&' operator,
+ The first time an I/O operation is executed using the `|&' operator,
`gawk' creates a two-way pipeline to a child process that runs the
other program. Output created with `print' or `printf' is written to
the program's standard input, and output from the program's standard
@@ -11577,7 +11698,7 @@ output can be read by the `gawk' program using `getline'. As is the
case with processes started by `|', the subprogram can be any program,
or pipeline of programs, that can be started by the shell.
-There are some cautionary items to be aware of:
+ There are some cautionary items to be aware of:
* As the code inside `gawk' currently stands, the coprocess's
standard error goes to the same place that the parent `gawk''s
@@ -11591,19 +11712,19 @@ There are some cautionary items to be aware of:
lead to a situation known as "deadlock", where each process is
waiting for the other one to do something.
-It is possible to close just one end of the two-way pipe to a
+ It is possible to close just one end of the two-way pipe to a
coprocess, by supplying a second argument to the `close' function of
either `"to"' or `"from"' (*note Close Files And Pipes::). These
strings tell `gawk' to close the end of the pipe that sends data to the
process or the end that reads from it, respectively.
-This is particularly necessary in order to use the system `sort'
+ This is particularly necessary in order to use the system `sort'
utility as part of a coprocess; `sort' must read _all_ of its input
data before it can produce any output. The `sort' program does not
receive an end-of-file indication until `gawk' closes the write end of
the pipe.
-When you have finished writing data to the `sort' utility, you can
+ When you have finished writing data to the `sort' utility, you can
close the `"to"' end of the pipe, and then start reading sorted data
via `getline'. For example:
@@ -11620,20 +11741,20 @@ via `getline'. For example:
close(command)
}
-This program writes the letters of the alphabet in reverse order, one
+ This program writes the letters of the alphabet in reverse order, one
per line, down the two-way pipe to `sort'. It then closes the write
end of the pipe, so that `sort' receives an end-of-file indication.
This causes `sort' to sort the data and write the sorted data back to
the `gawk' program. Once all of the data has been read, `gawk'
terminates the coprocess and exits.
-As a side note, the assignment `LC_ALL=C' in the `sort' command ensures
-traditional Unix (ASCII) sorting from `sort'.
+ As a side note, the assignment `LC_ALL=C' in the `sort' command
+ensures traditional Unix (ASCII) sorting from `sort'.
-Beginning with `gawk' 3.1.2, you may use Pseudo-ttys (ptys) for two-way
-communication instead of pipes, if your system supports them. This is
-done on a per-command basis, by setting a special element in the
-`PROCINFO' array (*note Auto-set::), like so:
+ Beginning with `gawk' 3.1.2, you may use Pseudo-ttys (ptys) for
+two-way communication instead of pipes, if your system supports them.
+This is done on a per-command basis, by setting a special element in
+the `PROCINFO' array (*note Auto-set::), like so:
command = "sort -nr" # command, saved in variable for convenience
PROCINFO[command, "pty"] = 1 # update PROCINFO
@@ -11645,9 +11766,10 @@ loss in performance. If your system does not have ptys, or if all the
system's ptys are in use, `gawk' automatically falls back to using
regular pipes.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This is very different from the same operator in the C shell, `csh'.
+ (1) This is very different from the same operator in the C shell,
+`csh'.

File: gawk.info, Node: TCP/IP Networking, Next: Portal Files, Prev: Two-way I/O, Up: Advanced Features
@@ -11660,17 +11782,17 @@ File: gawk.info, Node: TCP/IP Networking, Next: Portal Files, Prev: Two-way I
unless the host that isn't close
is busy hung or dead.
-In addition to being able to open a two-way pipeline to a coprocess on
-the same system (*note Two-way I/O::), it is possible to make a two-way
-connection to another process on another system across an IP networking
-connection.
+ In addition to being able to open a two-way pipeline to a coprocess
+on the same system (*note Two-way I/O::), it is possible to make a
+two-way connection to another process on another system across an IP
+networking connection.
-You can think of this as just a _very long_ two-way pipeline to a
+ You can think of this as just a _very long_ two-way pipeline to a
coprocess. The way `gawk' decides that you want to use TCP/IP
networking is by recognizing special file names that begin with
`/inet/'.
-The full syntax of the special file name is
+ The full syntax of the special file name is
`/inet/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'. The components
are:
@@ -11699,7 +11821,7 @@ REMOTE-PORT
Again, use `0' if you don't care, or else a well-known service
name.
-Consider the following very simple example:
+ Consider the following very simple example:
BEGIN {
Service = "/inet/tcp/0/localhost/daytime"
@@ -11708,11 +11830,11 @@ Consider the following very simple example:
close(Service)
}
-This program reads the current date and time from the local system's
+ This program reads the current date and time from the local system's
TCP `daytime' server. It then prints the results and closes the
connection.
-Because this topic is extensive, the use of `gawk' for TCP/IP
+ Because this topic is extensive, the use of `gawk' for TCP/IP
programming is documented separately. *Note Top::, for a much more
complete introduction and discussion, as well as extensive examples.
@@ -11726,7 +11848,7 @@ Similar to the `/inet' special files, if `gawk' is configured with the
`--enable-portals' option (*note Quick Installation::), then `gawk'
treats files whose pathnames begin with `/p' as 4.4 BSD-style portals.
-When used with the `|&' operator, `gawk' opens the file for two-way
+ When used with the `|&' operator, `gawk' opens the file for two-way
communications. The operating system's portal mechanism then manages
creating the process associated with the portal and the corresponding
communications with the portal's process.
@@ -11741,20 +11863,21 @@ Beginning with version 3.1 of `gawk', you may produce execution traces
of your `awk' programs. This is done with a specially compiled version
of `gawk', called `pgawk' ("profiling `gawk'").
-`pgawk' is identical in every way to `gawk', except that when it has
+ `pgawk' is identical in every way to `gawk', except that when it has
finished running, it creates a profile of your program in a file named
`awkprof.out'. Because it is profiling, it also executes up to 45%
slower than `gawk' normally does.
-As shown in the following example, the `--profile' option can be used
-to change the name of the file where `pgawk' will write the profile:
+ As shown in the following example, the `--profile' option can be
+used to change the name of the file where `pgawk' will write the
+profile:
$ pgawk --profile=myprog.prof -f myprog.awk data1 data2
In the above example, `pgawk' places the profile in `myprog.prof'
instead of in `awkprof.out'.
-Regular `gawk' also accepts this option. When called with just
+ Regular `gawk' also accepts this option. When called with just
`--profile', `gawk' "pretty prints" the program into `awkprof.out',
without any execution counts. You may supply an option to `--profile'
to change the file name. Here is a sample session showing a simple
@@ -11787,7 +11910,7 @@ First, the `awk' program:
print "I gotta be me!"
}
-Following is the input data:
+ Following is the input data:
foo
bar
@@ -11795,7 +11918,7 @@ Following is the input data:
foo
junk
-Here is the `awkprof.out' that results from running `pgawk' on this
+ Here is the `awkprof.out' that results from running `pgawk' on this
program and data (this example also illustrates that `awk' programmers
sometimes have to work late):
@@ -11839,8 +11962,8 @@ sometimes have to work late):
6 print "I gotta be me!"
}
-This example illustrates many of the basic rules for profiling output.
-The rules are as follows:
+ This example illustrates many of the basic rules for profiling
+output. The rules are as follows:
* The program is printed in the order `BEGIN' rule, pattern/action
rules, `END' rule and functions, listed alphabetically. Multiple
@@ -11880,9 +12003,6 @@ The rules are as follows:
by four. However, `3 + 5 * 4' has no parentheses, and means `3 +
(5 * 4)'.
- * All string concatenations are parenthesized too. (This could be
- made a bit smarter.)
-
* Parentheses are used around the arguments to `print' and `printf'
only when the `print' or `printf' statement is followed by a
redirection. Similarly, if the target of a redirection isn't a
@@ -11892,13 +12012,13 @@ The rules are as follows:
`END' rules, the pattern/action rules, and the functions.
-The profiled version of your program may not look exactly like what you
-typed when you wrote it. This is because `pgawk' creates the profiled
-version by "pretty printing" its internal representation of the
-program. The advantage to this is that `pgawk' can produce a standard
-representation. The disadvantage is that all source-code comments are
-lost, as are the distinctions among multiple `BEGIN' and `END' rules.
-Also, things such as:
+ The profiled version of your program may not look exactly like what
+you typed when you wrote it. This is because `pgawk' creates the
+profiled version by "pretty printing" its internal representation of
+the program. The advantage to this is that `pgawk' can produce a
+standard representation. The disadvantage is that all source-code
+comments are lost, as are the distinctions among multiple `BEGIN' and
+`END' rules. Also, things such as:
/foo/
@@ -11910,7 +12030,7 @@ come out as:
which is correct, but possibly surprising.
-Besides creating profiles when a program has completed, `pgawk' can
+ Besides creating profiles when a program has completed, `pgawk' can
produce a profile while it is running. This is useful if your `awk'
program goes into an infinite loop and you want to see what has been
executed. To use this feature, run `pgawk' in the background:
@@ -11926,8 +12046,8 @@ The shell prints a job number and process ID number; in this case,
As usual, the profiled version of the program is written to
`awkprof.out', or to a different file if you use the `--profile' option.
-Along with the regular profile, as shown earlier, the profile includes
-a trace of any active functions:
+ Along with the regular profile, as shown earlier, the profile
+includes a trace of any active functions:
# Function Call Stack:
@@ -11936,18 +12056,18 @@ a trace of any active functions:
# 1. foo
# -- main --
-You may send `pgawk' the `USR1' signal as many times as you like. Each
-time, the profile and function call trace are appended to the output
-profile file.
+ You may send `pgawk' the `USR1' signal as many times as you like.
+Each time, the profile and function call trace are appended to the
+output profile file.
-If you use the `HUP' signal instead of the `USR1' signal, `pgawk'
+ If you use the `HUP' signal instead of the `USR1' signal, `pgawk'
produces the profile and the function call trace and then exits.
-When `pgawk' runs on MS-DOS or MS-Windows, it uses the `INT' and `QUIT'
-signals for producing the profile and, in the case of the `INT' signal,
-`pgawk' exits. This is because these systems don't support the `kill'
-command, so the only signals you can deliver to a program are those
-generated by the keyboard. The `INT' signal is generated by the
+ When `pgawk' runs on MS-DOS or MS-Windows, it uses the `INT' and
+`QUIT' signals for producing the profile and, in the case of the `INT'
+signal, `pgawk' exits. This is because these systems don't support the
+`kill' command, so the only signals you can deliver to a program are
+those generated by the keyboard. The `INT' signal is generated by the
`Ctrl-<C>' or `Ctrl-<BREAK>' key, while the `QUIT' signal is generated
by the `Ctrl-<\>' key.
@@ -11964,7 +12084,7 @@ for source files, obsolete options and/or features, and known bugs in
`gawk'. This major node rounds out the discussion of `awk' as a
program and as a language.
-While a number of the options and features described here were
+ While a number of the options and features described here were
discussed in passing earlier in the book, this major node provides the
full details.
@@ -11992,10 +12112,10 @@ enclosed in [...] in these templates are optional:
awk [OPTIONS] -f progfile [`--'] FILE ...
awk [OPTIONS] [`--'] 'PROGRAM' FILE ...
-Besides traditional one-letter POSIX-style options, `gawk' also
+ Besides traditional one-letter POSIX-style options, `gawk' also
supports GNU long options.
-It is possible to invoke `awk' with an empty program:
+ It is possible to invoke `awk' with an empty program:
awk '' datafile1 datafile2
@@ -12018,7 +12138,7 @@ argument's value, or the keyword and the argument's value are separated
by whitespace. If a particular option with a value is given more than
once, it is the last value that counts.
-Each long option for `gawk' has a corresponding POSIX-style option.
+ Each long option for `gawk' has a corresponding POSIX-style option.
The long and short options are interchangeable in all contexts. The
options and their meanings are as follows:
@@ -12074,8 +12194,8 @@ options and their meanings are as follows:
shell scripts, if you have file names that will be specified by
the user that could start with `-'.
-The previous list described options mandated by the POSIX standard, as
-well as options available in the Bell Laboratories version of `awk'.
+ The previous list described options mandated by the POSIX standard,
+as well as options available in the Bell Laboratories version of `awk'.
The following list describes `gawk'-specific options:
`-W compat'
@@ -12086,7 +12206,7 @@ The following list describes `gawk'-specific options:
`awk' language are disabled, so that `gawk' behaves just like the
Bell Laboratories research version of Unix `awk'. `--traditional'
is the preferred form of this option. *Note POSIX/GNU::, which
- summarizes the extensions. Also see *Note Compatibility Mode::.
+ summarizes the extensions. Also see *note Compatibility Mode::.
`-W copyright'
`--copyright'
@@ -12157,6 +12277,13 @@ The following list describes `gawk'-specific options:
that are actually invalid are issued. (This is not fully
implemented yet.)
+ Some warnings are only printed once, even if the dubious
+ constructs they warn about occur multiple times in your `awk'
+ program. Thus, when eliminating problems pointed out by `--lint',
+ you should take care to search for all occurrences of each
+ inappropriate construct. As `awk' programs are usually short,
+ doing so is not burdensome.
+
`-W lint-old'
`--lint-old'
Warns about constructs that are not available in the original
@@ -12196,6 +12323,9 @@ The following list describes `gawk'-specific options:
of `FS' to be a single TAB character (*note Field
Separators::).
+ * The locale's decimal point character is used for parsing input
+ data (*note Locales::).
+
* The `fflush' built-in function is not supported (*note I/O
Functions::).
@@ -12230,6 +12360,11 @@ The following list describes `gawk'-specific options:
functions that you want to use from your command-line programs
(*note AWKPATH Variable::).
+`-W use-lc-numeric'
+`--use-lc-numeric'
+ This option forces the use of the locale's decimal point character
+ when parsing numeric input data (*note Locales::).
+
`-W version'
`--version'
Prints version information for this particular copy of `gawk'.
@@ -12237,40 +12372,40 @@ The following list describes `gawk'-specific options:
with respect to whatever the Free Software Foundation is currently
distributing. It is also useful for bug reports (*note Bugs::).
-As long as program text has been supplied, any other options are
+ As long as program text has been supplied, any other options are
flagged as invalid with a warning message but are otherwise ignored.
-In compatibility mode, as a special case, if the value of FS supplied
+ In compatibility mode, as a special case, if the value of FS supplied
to the `-F' option is `t', then `FS' is set to the TAB character
(`"\t"'). This is true only for `--traditional' and not for `--posix'
(*note Field Separators::).
-The `-f' option may be used more than once on the command line. If it
-is, `awk' reads its program source from all of the named files, as if
-they had been concatenated together into one big file. This is useful
-for creating libraries of `awk' functions. These functions can be
-written once and then retrieved from a standard place, instead of
+ The `-f' option may be used more than once on the command line. If
+it is, `awk' reads its program source from all of the named files, as
+if they had been concatenated together into one big file. This is
+useful for creating libraries of `awk' functions. These functions can
+be written once and then retrieved from a standard place, instead of
having to be included into each individual program. (As mentioned in
-*Note Definition Syntax::, function names must be unique.)
-
-Library functions can still be used, even if the program is entered at
-the terminal, by specifying `-f /dev/tty'. After typing your program,
-type `Ctrl-d' (the end-of-file character) to terminate it. (You may
-also use `-f -' to read program source from the standard input but then
-you will not be able to also use the standard input as a source of
-data.)
-
-Because it is clumsy using the standard `awk' mechanisms to mix source
-file and command-line `awk' programs, `gawk' provides the `--source'
-option. This does not require you to pre-empt the standard input for
-your source code; it allows you to easily mix command-line and library
-source code (*note AWKPATH Variable::).
-
-If no `-f' or `--source' option is specified, then `gawk' uses the
+*note Definition Syntax::, function names must be unique.)
+
+ Library functions can still be used, even if the program is entered
+at the terminal, by specifying `-f /dev/tty'. After typing your
+program, type `Ctrl-d' (the end-of-file character) to terminate it.
+(You may also use `-f -' to read program source from the standard input
+but then you will not be able to also use the standard input as a
+source of data.)
+
+ Because it is clumsy using the standard `awk' mechanisms to mix
+source file and command-line `awk' programs, `gawk' provides the
+`--source' option. This does not require you to pre-empt the standard
+input for your source code; it allows you to easily mix command-line
+and library source code (*note AWKPATH Variable::).
+
+ If no `-f' or `--source' option is specified, then `gawk' uses the
first non-option command-line argument as the text of the program
source code.
-If the environment variable `POSIXLY_CORRECT' exists, then `gawk'
+ If the environment variable `POSIXLY_CORRECT' exists, then `gawk'
behaves in strict POSIX mode, exactly as if you had supplied the
`--posix' command-line option. Many GNU programs look for this
environment variable to turn on strict POSIX mode. If `--lint' is
@@ -12283,18 +12418,18 @@ you would add these lines to the `.profile' file in your home directory:
POSIXLY_CORRECT=true
export POSIXLY_CORRECT
-For a `csh'-compatible shell,(1) you would add this line to the
+ For a `csh'-compatible shell,(1) you would add this line to the
`.login' file in your home directory:
setenv POSIXLY_CORRECT true
-Having `POSIXLY_CORRECT' set is not recommended for daily use, but it
-is good for testing the portability of your programs to other
+ Having `POSIXLY_CORRECT' set is not recommended for daily use, but
+it is good for testing the portability of your programs to other
environments.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Not recommended.
+ (1) Not recommended.

File: gawk.info, Node: Other Arguments, Next: AWKPATH Variable, Prev: Options, Up: Invoking Gawk
@@ -12306,31 +12441,31 @@ Any additional arguments on the command line are normally treated as
input files to be processed in the order specified. However, an
argument that has the form `VAR=VALUE', assigns the value VALUE to the
variable VAR--it does not specify a file at all. (This was discussed
-earlier in *Note Assignment Options::.)
+earlier in *note Assignment Options::.)
-All these arguments are made available to your `awk' program in the
+ All these arguments are made available to your `awk' program in the
`ARGV' array (*note Built-in Variables::). Command-line options and
the program text (if present) are omitted from `ARGV'. All other
arguments, including variable assignments, are included. As each
element of `ARGV' is processed, `gawk' sets the variable `ARGIND' to
the index in `ARGV' of the current element.
-The distinction between file name arguments and variable-assignment
+ The distinction between file name arguments and variable-assignment
arguments is made when `awk' is about to open the next input file. At
that point in execution, it checks the file name to see whether it is
really a variable assignment; if so, `awk' sets the variable instead of
reading a file.
-Therefore, the variables actually receive the given values after all
+ Therefore, the variables actually receive the given values after all
previously specified files have been read. In particular, the values of
variables assigned in this fashion are _not_ available inside a `BEGIN'
rule (*note BEGIN/END::), because such rules are run before `awk'
begins scanning the argument list.
-The variable values given on the command line are processed for escape
-sequences (*note Escape Sequences::). (d.c.)
+ The variable values given on the command line are processed for
+escape sequences (*note Escape Sequences::). (d.c.)
-In some earlier implementations of `awk', when a variable assignment
+ In some earlier implementations of `awk', when a variable assignment
occurred before any file names, the assignment would happen _before_
the `BEGIN' rule was executed. `awk''s behavior was thus inconsistent;
some command-line assignments were available inside the `BEGIN' rule,
@@ -12339,7 +12474,7 @@ upon this "feature." When `awk' was changed to be more consistent, the
`-v' option was added to accommodate applications that depended upon
the old behavior.
-The variable assignment feature is most useful for assigning to
+ The variable assignment feature is most useful for assigning to
variables such as `RS', `OFS', and `ORS', which control input and
output formats before scanning the data files. It is also useful for
controlling state if multiple passes are needed over a data file. For
@@ -12348,8 +12483,8 @@ example:
awk 'pass == 1 { PASS 1 STUFF }
pass == 2 { PASS 2 STUFF }' pass=1 mydata pass=2 mydata
-Given the variable assignment feature, the `-F' option for setting the
-value of `FS' is not strictly necessary. It remains for historical
+ Given the variable assignment feature, the `-F' option for setting
+the value of `FS' is not strictly necessary. It remains for historical
compatibility.

@@ -12373,14 +12508,14 @@ variable. If that variable does not exist, `gawk' uses a default path,
administrators should use an `AWKPATH' variable that does not include
the current directory, `.'.)
-The search path feature is particularly useful for building libraries
+ The search path feature is particularly useful for building libraries
of useful `awk' functions. The library files can be placed in a
standard directory in the default path and then specified on the
command line with a short file name. Otherwise, the full file name
would have to be typed for each file.
-By using both the `--source' and `-f' options, your command-line `awk'
-programs can use facilities in `awk' library files (*note Library
+ By using both the `--source' and `-f' options, your command-line
+`awk' programs can use facilities in `awk' library files (*note Library
Functions::). Path searching is not done if `gawk' is in compatibility
mode. This is true for both `--traditional' and `--posix'. *Note
Options::.
@@ -12394,20 +12529,20 @@ Options::.
found in the current directory. This path search mechanism is
identical to the shell's.
-Starting with version 3.0, if `AWKPATH' is not defined in the
+ Starting with version 3.0, if `AWKPATH' is not defined in the
environment, `gawk' places its default search path into
`ENVIRON["AWKPATH"]'. This makes it easy to determine the actual search
path that `gawk' will use from within an `awk' program.
-While you can change `ENVIRON["AWKPATH"]' within your `awk' program,
+ While you can change `ENVIRON["AWKPATH"]' within your `awk' program,
this has no effect on the running program's behavior. This makes
sense: the `AWKPATH' environment variable is used to find the program
source files. Once your program is running, all the files have been
found, and `gawk' no longer needs to use `AWKPATH'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Your version of `gawk' may use a different directory; it will
+ (1) Your version of `gawk' may use a different directory; it will
depend upon how `gawk' was built and installed. The actual directory is
the value of `$(datadir)' generated when `gawk' was configured. You
probably don't need to worry about this, though.
@@ -12423,16 +12558,17 @@ previous releases of `gawk' that are either not available in the
current version or that are still supported but deprecated (meaning that
they will _not_ be in the next release).
-For version 3.1 of `gawk', there are no deprecated command-line options
-from the previous version of `gawk'. The use of `next file' (two
-words) for `nextfile' was deprecated in `gawk' 3.0 but still worked.
-Starting with version 3.1, the two-word usage is no longer accepted.
+ For version 3.1 of `gawk', there are no deprecated command-line
+options from the previous version of `gawk'. The use of `next file'
+(two words) for `nextfile' was deprecated in `gawk' 3.0 but still
+worked. Starting with version 3.1, the two-word usage is no longer
+accepted.
-The process-related special files described in *Note Special Process::,
-work as described, but are now considered deprecated. `gawk' prints a
-warning message every time they are used. (Use `PROCINFO' instead; see
-*Note Auto-set::.) They will be removed from the next release of
-`gawk'.
+ The process-related special files described in *note Special
+Process::, work as described, but are now considered deprecated.
+`gawk' prints a warning message every time they are used. (Use
+`PROCINFO' instead; see *note Auto-set::.) They will be removed from
+the next release of `gawk'.

File: gawk.info, Node: Undocumented, Next: Known Bugs, Prev: Obsolete, Up: Invoking Gawk
@@ -12443,7 +12579,7 @@ File: gawk.info, Node: Undocumented, Next: Known Bugs, Prev: Obsolete, Up: I
Use the Source, Luke!
Obi-Wan
-This minor node intentionally left blank.
+ This minor node intentionally left blank.

File: gawk.info, Node: Known Bugs, Prev: Undocumented, Up: Invoking Gawk
@@ -12466,44 +12602,44 @@ File: gawk.info, Node: Library Functions, Next: Sample Programs, Prev: Invoki
12 A Library of `awk' Functions
*******************************
-*Note User-defined::, describes how to write your own `awk' functions.
+*note User-defined::, describes how to write your own `awk' functions.
Writing functions is important, because it allows you to encapsulate
algorithms and program tasks in a single place. It simplifies
programming, making program development more manageable, and making
programs more readable.
-One valuable way to learn a new programming language is to _read_
-programs in that language. To that end, this major node and *Note
+ One valuable way to learn a new programming language is to _read_
+programs in that language. To that end, this major node and *note
Sample Programs::, provide a good-sized body of code for you to read,
and hopefully, to learn from.
-This major node presents a library of useful `awk' functions. Many of
-the sample programs presented later in this Info file use these
+ This major node presents a library of useful `awk' functions. Many
+of the sample programs presented later in this Info file use these
functions. The functions are presented here in a progression from
simple to complex.
-*Note Extract Program::, presents a program that you can use to extract
-the source code for these example library functions and programs from
-the Texinfo source for this Info file. (This has already been done as
-part of the `gawk' distribution.)
+ *note Extract Program::, presents a program that you can use to
+extract the source code for these example library functions and
+programs from the Texinfo source for this Info file. (This has already
+been done as part of the `gawk' distribution.)
-If you have written one or more useful, general-purpose `awk' functions
-and would like to contribute them to the author's collection of `awk'
-programs, see *Note How To Contribute::, for more information.
+ If you have written one or more useful, general-purpose `awk'
+functions and would like to contribute them to the author's collection
+of `awk' programs, see *note How To Contribute::, for more information.
-The programs in this major node and in *Note Sample Programs::, freely
-use features that are `gawk'-specific. Rewriting these programs for
-different implementations of awk is pretty straightforward.
+ The programs in this major node and in *note Sample Programs::,
+freely use features that are `gawk'-specific. Rewriting these programs
+for different implementations of awk is pretty straightforward.
-Diagnostic error messages are sent to `/dev/stderr'. Use `| "cat
+ Diagnostic error messages are sent to `/dev/stderr'. Use `| "cat
1>&2"' instead of `> "/dev/stderr"' if your system does not have a
`/dev/stderr', or if you cannot use `gawk'.
-A number of programs use `nextfile' (*note Nextfile Statement::) to
-skip any remaining input in the input file. *Note Nextfile Function::,
+ A number of programs use `nextfile' (*note Nextfile Statement::) to
+skip any remaining input in the input file. *note Nextfile Function::,
shows you how to write a function that does the same thing.
-Finally, some of the programs choose to ignore upper- and lowercase
+ Finally, some of the programs choose to ignore upper- and lowercase
distinctions in their input. They do so by assigning one to
`IGNORECASE'. You can achieve almost the same effect(1) by adding the
following rule to the beginning of the program:
@@ -12526,9 +12662,9 @@ use only lowercase letters.
* Passwd Functions:: Functions for getting user information.
* Group Functions:: Functions for getting group information.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The effects are not identical. Output of the transformed record
+ (1) The effects are not identical. Output of the transformed record
will be in all lowercase, while `IGNORECASE' preserves the original
contents of the input record.
@@ -12543,25 +12679,25 @@ Due to the way the `awk' language evolved, variables are either
specific function). There is no intermediate state analogous to
`static' variables in C.
-Library functions often need to have global variables that they can use
-to preserve state information between calls to the function--for
+ Library functions often need to have global variables that they can
+use to preserve state information between calls to the function--for
example, `getopt''s variable `_opti' (*note Getopt Function::). Such
variables are called "private", since the only functions that need to
use them are the ones in the library.
-When writing a library function, you should try to choose names for your
-private variables that will not conflict with any variables used by
+ When writing a library function, you should try to choose names for
+your private variables that will not conflict with any variables used by
either another library function or a user's main program. For example,
a name like `i' or `j' is not a good choice, because user programs
often use variable names like these for their own purposes.
-The example programs shown in this major node all start the names of
+ The example programs shown in this major node all start the names of
their private variables with an underscore (`_'). Users generally
don't use leading underscores in their variable names, so this
convention immediately decreases the chances that the variable name
will be accidentally shared with the user's program.
-In addition, several of the library functions use a prefix that helps
+ In addition, several of the library functions use a prefix that helps
indicate what function or set of functions use the variables--for
example, `_pw_byname' in the user database routines (*note Passwd
Functions::). This convention is recommended, since it even further
@@ -12569,18 +12705,18 @@ decreases the chance of inadvertent conflict among variable names.
Note that this convention is used equally well for variable names and
for private function names as well.(1)
-As a final note on variable naming, if a function makes global variables
-available for use by a main program, it is a good convention to start
-that variable's name with a capital letter--for example, `getopt''s
-`Opterr' and `Optind' variables (*note Getopt Function::). The leading
-capital letter indicates that it is global, while the fact that the
-variable name is not all capital letters indicates that the variable is
-not one of `awk''s built-in variables, such as `FS'.
+ As a final note on variable naming, if a function makes global
+variables available for use by a main program, it is a good convention
+to start that variable's name with a capital letter--for example,
+`getopt''s `Opterr' and `Optind' variables (*note Getopt Function::).
+The leading capital letter indicates that it is global, while the fact
+that the variable name is not all capital letters indicates that the
+variable is not one of `awk''s built-in variables, such as `FS'.
-It is also important that _all_ variables in library functions that do
-not need to save state are, in fact, declared local.(2) If this is not
-done, the variable could accidentally be used in the user's program,
-leading to bugs that are very difficult to track down:
+ It is also important that _all_ variables in library functions that
+do not need to save state are, in fact, declared local.(2) If this is
+not done, the variable could accidentally be used in the user's
+program, leading to bugs that are very difficult to track down:
function lib_func(x, y, l1, l2)
{
@@ -12589,26 +12725,27 @@ leading to bugs that are very difficult to track down:
... # but is not by oversight
}
-A different convention, common in the Tcl community, is to use a single
-associative array to hold the values needed by the library function(s),
-or "package." This significantly decreases the number of actual global
-names in use. For example, the functions described in *Note Passwd
-Functions::, might have used array elements `PW_data["inited"]',
-`PW_data["total"]', `PW_data["count"]', and `PW_data["awklib"]',
-instead of `_pw_inited', `_pw_awklib', `_pw_total', and `_pw_count'.
+ A different convention, common in the Tcl community, is to use a
+single associative array to hold the values needed by the library
+function(s), or "package." This significantly decreases the number of
+actual global names in use. For example, the functions described in
+*note Passwd Functions::, might have used array elements
+`PW_data["inited"]', `PW_data["total"]', `PW_data["count"]', and
+`PW_data["awklib"]', instead of `_pw_inited', `_pw_awklib', `_pw_total',
+and `_pw_count'.
-The conventions presented in this minor node are exactly that:
+ The conventions presented in this minor node are exactly that:
conventions. You are not required to write your programs this way--we
merely recommend that you do so.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) While all the library routines could have been rewritten to use
+ (1) While all the library routines could have been rewritten to use
this convention, this was not done, in order to show how my own `awk'
programming style has evolved and to provide some basis for this
discussion.
-(2) `gawk''s `--dump-variables' command-line option is useful for
+ (2) `gawk''s `--dump-variables' command-line option is useful for
verifying this.

@@ -12642,13 +12779,13 @@ File: gawk.info, Node: Nextfile Function, Next: Strtonum Function, Up: Genera
12.2.1 Implementing `nextfile' as a Function
--------------------------------------------
-The `nextfile' statement, presented in *Note Nextfile Statement::, is a
+The `nextfile' statement, presented in *note Nextfile Statement::, is a
`gawk'-specific extension--it is not available in most other
implementations of `awk'. This minor node shows two versions of a
`nextfile' function that you can use to simulate `gawk''s `nextfile'
statement if you cannot use `gawk'.
-A first attempt at writing a `nextfile' function is as follows:
+ A first attempt at writing a `nextfile' function is as follows:
# nextfile --- skip remaining records in current file
# this should be read in before the "main" awk program
@@ -12656,26 +12793,26 @@ A first attempt at writing a `nextfile' function is as follows:
function nextfile() { _abandon_ = FILENAME; next }
_abandon_ == FILENAME { next }
-Because it supplies a rule that must be executed first, this file should
-be included before the main program. This rule compares the current
-data file's name (which is always in the `FILENAME' variable) to a
-private variable named `_abandon_'. If the file name matches, then the
-action part of the rule executes a `next' statement to go on to the
+ Because it supplies a rule that must be executed first, this file
+should be included before the main program. This rule compares the
+current data file's name (which is always in the `FILENAME' variable) to
+a private variable named `_abandon_'. If the file name matches, then
+the action part of the rule executes a `next' statement to go on to the
next record. (The use of `_' in the variable name is a convention. It
-is discussed more fully in *Note Library Names::.)
+is discussed more fully in *note Library Names::.)
-The use of the `next' statement effectively creates a loop that reads
+ The use of the `next' statement effectively creates a loop that reads
all the records from the current data file. The end of the file is
eventually reached and a new data file is opened, changing the value of
`FILENAME'. Once this happens, the comparison of `_abandon_' to
`FILENAME' fails, and execution continues with the first rule of the
"real" program.
-The `nextfile' function itself simply sets the value of `_abandon_' and
-then executes a `next' statement to start the loop.
+ The `nextfile' function itself simply sets the value of `_abandon_'
+and then executes a `next' statement to start the loop.
-This initial version has a subtle problem. If the same data file is
-listed _twice_ on the commandline, one right after the other or even
+ This initial version has a subtle problem. If the same data file is
+listed _twice_ on the command line, one right after the other or even
with just a variable assignment between them, this code skips right
through the file a second time, even though it should stop when it gets
to the end of the first occurrence. A second version of `nextfile'
@@ -12694,24 +12831,24 @@ that remedies this problem is shown here:
next
}
-The `nextfile' function has not changed. It makes `_abandon_' equal to
-the current file name and then executes a `next' statement. The `next'
-statement reads the next record and increments `FNR' so that `FNR' is
-guaranteed to have a value of at least two. However, if `nextfile' is
-called for the last record in the file, then `awk' closes the current
-data file and moves on to the next one. Upon doing so, `FILENAME' is
-set to the name of the new file and `FNR' is reset to one. If this
-next file is the same as the previous one, `_abandon_' is still equal
-to `FILENAME'. However, `FNR' is equal to one, telling us that this is
-a new occurrence of the file and not the one we were reading when the
-`nextfile' function was executed. In that case, `_abandon_' is reset
-to the empty string, so that further executions of this rule fail
-(until the next time that `nextfile' is called).
-
-If `FNR' is not one, then we are still in the original data file and
+ The `nextfile' function has not changed. It makes `_abandon_' equal
+to the current file name and then executes a `next' statement. The
+`next' statement reads the next record and increments `FNR' so that
+`FNR' is guaranteed to have a value of at least two. However, if
+`nextfile' is called for the last record in the file, then `awk' closes
+the current data file and moves on to the next one. Upon doing so,
+`FILENAME' is set to the name of the new file and `FNR' is reset to
+one. If this next file is the same as the previous one, `_abandon_' is
+still equal to `FILENAME'. However, `FNR' is equal to one, telling us
+that this is a new occurrence of the file and not the one we were
+reading when the `nextfile' function was executed. In that case,
+`_abandon_' is reset to the empty string, so that further executions of
+this rule fail (until the next time that `nextfile' is called).
+
+ If `FNR' is not one, then we are still in the original data file and
the program executes a `next' statement to skip through it.
-An important question to ask at this point is: given that the
+ An important question to ask at this point is: given that the
functionality of `nextfile' can be provided with a library file, why is
it built into `gawk'? Adding features for little reason leads to
larger, slower programs that are harder to maintain. The answer is
@@ -12786,25 +12923,25 @@ versions of `awk':
# print a[i], strtonum(a[i]), mystrtonum(a[i])
# }
-The function first looks for C-style octal numbers (base 8). If the
+ The function first looks for C-style octal numbers (base 8). If the
input string matches a regular expression describing octal numbers,
then `mystrtonum' loops through each character in the string. It sets
`k' to the index in `"01234567"' of the current octal digit. Since the
return value is one-based, the `k--' adjusts `k' so it can be used in
computing the return value.
-Similar logic applies to the code that checks for and converts a
+ Similar logic applies to the code that checks for and converts a
hexadecimal value, which starts with `0x' or `0X'. The use of
`tolower' simplifies the computation for finding the correct numeric
value for each hexadecimal digit.
-Finally, if the string matches the (rather complicated) regex for a
-regular decimal integer or floating-point numer, the computation `ret =
-str + 0' lets `awk' convert the value to a number.
+ Finally, if the string matches the (rather complicated) regex for a
+regular decimal integer or floating-point number, the computation `ret
+= str + 0' lets `awk' convert the value to a number.
-A commented-out test program is included, so that the function can be
-tested with `gawk' and the results compared to the built-in `strtonum'
-function.
+ A commented-out test program is included, so that the function can
+be tested with `gawk' and the results compared to the built-in
+`strtonum' function.

File: gawk.info, Node: Assert Function, Next: Round Function, Prev: Strtonum Function, Up: General Functions
@@ -12830,11 +12967,11 @@ not, and then it kills the program. In C, using `assert' looks this:
...
}
-If the assertion fails, the program prints a message similar to this:
+ If the assertion fails, the program prints a message similar to this:
prog.c:5: assertion failed: a <= 5 && b >= 17.1
-The C language makes it possible to turn the condition into a string
+ The C language makes it possible to turn the condition into a string
for use in printing the diagnostic message. This is not possible in
`awk', so this `assert' function also requires a string version of the
condition that is being tested. Following is the function:
@@ -12855,14 +12992,14 @@ condition that is being tested. Following is the function:
exit 1
}
-The `assert' function tests the `condition' parameter. If it is false,
-it prints a message to standard error, using the `string' parameter to
-describe the failed condition. It then sets the variable
+ The `assert' function tests the `condition' parameter. If it is
+false, it prints a message to standard error, using the `string'
+parameter to describe the failed condition. It then sets the variable
`_assert_exit' to one and executes the `exit' statement. The `exit'
statement jumps to the `END' rule. If the `END' rules finds
`_assert_exit' to be true, it exits immediately.
-The purpose of the test in the `END' rule is to keep any other `END'
+ The purpose of the test in the `END' rule is to keep any other `END'
rules from running. When an assertion fails, the program should exit
immediately. If no assertions fail, then `_assert_exit' is still false
when the `END' rule is run normally, and the rest of the program's
@@ -12880,16 +13017,16 @@ If the assertion fails, you see a message similar to the following:
mydata:1357: assertion failed: a <= 5 && b >= 17.1
-There is a small problem with this version of `assert'. An `END' rule
-is automatically added to the program calling `assert'. Normally, if a
-program consists of just a `BEGIN' rule, the input files and/or
+ There is a small problem with this version of `assert'. An `END'
+rule is automatically added to the program calling `assert'. Normally,
+if a program consists of just a `BEGIN' rule, the input files and/or
standard input are not read. However, now that the program has an `END'
rule, `awk' attempts to read the input data files or standard input
(*note Using BEGIN/END::), most likely causing the program to hang as
it waits for input.
-There is a simple workaround to this: make sure the `BEGIN' rule always
-ends with an `exit' statement.
+ There is a simple workaround to this: make sure the `BEGIN' rule
+always ends with an `exit' statement.

File: gawk.info, Node: Round Function, Next: Cliff Random Function, Prev: Assert Function, Up: General Functions
@@ -12904,8 +13041,8 @@ trailing `.5' up, contrary to naive expectations. In unbiased
rounding, `.5' rounds to even, rather than always up, so 1.5 rounds to
2 but 4.5 rounds to 4. This means that if you are using a format that
does rounding (e.g., `"%.0f"'), you should check what your system does.
-The following function does traditional rounding; it might be useful
-if your awk's `printf' does unbiased rounding:
+The following function does traditional rounding; it might be useful if
+your awk's `printf' does unbiased rounding:
# round.awk --- do normal rounding
function round(x, ival, aval, fraction)
@@ -12958,14 +13095,14 @@ code:
return _cliff_seed
}
-This algorithm requires an initial "seed" of 0.1. Each new value uses
-the current seed as input for the calculation. If the built-in `rand'
-function (*note Numeric Functions::) isn't random enough, you might try
-using this function instead.
+ This algorithm requires an initial "seed" of 0.1. Each new value
+uses the current seed as input for the calculation. If the built-in
+`rand' function (*note Numeric Functions::) isn't random enough, you
+might try using this function instead.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) `http://mathworld.wolfram.com/CliffRandomNumberGenerator.hmtl'
+ (1) `http://mathworld.wolfram.com/CliffRandomNumberGenerator.html'

File: gawk.info, Node: Ordinal Functions, Next: Join Function, Prev: Cliff Random Function, Up: General Functions
@@ -12978,7 +13115,7 @@ One commercial implementation of `awk' supplies a built-in function,
character in the machine's character set. If the string passed to
`ord' has more than one character, only the first one is used.
-The inverse of this function is `chr' (from the function of the same
+ The inverse of this function is `chr' (from the function of the same
name in Pascal), which takes a number and returns the corresponding
character. Both functions are written very nicely in `awk'; there is
no real reason to build them into the `awk' interpreter:
@@ -13011,9 +13148,9 @@ no real reason to build them into the `awk' interpreter:
}
}
-Some explanation of the numbers used by `chr' is worthwhile. The most
-prominent character set in use today is ASCII. Although an 8-bit byte
-can hold 256 distinct values (from 0 to 255), ASCII only defines
+ Some explanation of the numbers used by `chr' is worthwhile. The
+most prominent character set in use today is ASCII. Although an 8-bit
+byte can hold 256 distinct values (from 0 to 255), ASCII only defines
characters that use the values from 0 to 127.(1) In the now distant
past, at least one minicomputer manufacturer used ASCII, but with mark
parity, meaning that the leftmost bit in the byte is always 1. This
@@ -13046,15 +13183,15 @@ on some older systems, they are not really worth worrying about:
# }
# }
-An obvious improvement to these functions is to move the code for the
+ An obvious improvement to these functions is to move the code for the
`_ord_init' function into the body of the `BEGIN' rule. It was written
this way initially for ease of development. There is a "test program"
in a `BEGIN' rule, to test the function. It is commented out for
production use.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) ASCII has been extended in many countries to use the values from
+ (1) ASCII has been extended in many countries to use the values from
128 to 255 for country-specific characters. If your system uses these
extensions, you can simplify `_ord_init' to simply loop from 0 to 255.
@@ -13069,7 +13206,7 @@ the strings in an array into one long string. The following function,
`join', accomplishes this task. It is used later in several of the
application programs (*note Sample Programs::).
-Good function design is important; this function needs to be general
+ Good function design is important; this function needs to be general
but it should also have a reasonable default behavior. It is called
with an array as well as the beginning and ending indices of the
elements in the array to be merged. This assumes that the array
@@ -13089,17 +13226,18 @@ created with `split' (*note String Functions::):
return result
}
-An optional additional argument is the separator to use when joining the
-strings back together. If the caller supplies a nonempty value, `join'
-uses it; if it is not supplied, it has a null value. In this case,
-`join' uses a single blank as a default separator for the strings. If
-the value is equal to `SUBSEP', then `join' joins the strings with no
-separator between them. `SUBSEP' serves as a "magic" value to indicate
-that there should be no separation between the component strings.(1)
+ An optional additional argument is the separator to use when joining
+the strings back together. If the caller supplies a nonempty value,
+`join' uses it; if it is not supplied, it has a null value. In this
+case, `join' uses a single blank as a default separator for the
+strings. If the value is equal to `SUBSEP', then `join' joins the
+strings with no separator between them. `SUBSEP' serves as a "magic"
+value to indicate that there should be no separation between the
+component strings.(1)
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) It would be nice if `awk' had an assignment operator for
+ (1) It would be nice if `awk' had an assignment operator for
concatenation. The lack of an explicit operator for concatenation
makes string operations more difficult than they really need to be.
@@ -13109,14 +13247,14 @@ File: gawk.info, Node: Gettimeofday Function, Prev: Join Function, Up: Genera
12.2.8 Managing the Time of Day
-------------------------------
-The `systime' and `strftime' functions described in *Note Time
+The `systime' and `strftime' functions described in *note Time
Functions::, provide the minimum functionality necessary for dealing
with the time of day in human readable form. While `strftime' is
extensive, the control formats are not necessarily easy to remember or
intuitively obvious when reading a program.
-The following function, `gettimeofday', populates a user-supplied array
-with preformatted time information. It returns a string with the
+ The following function, `gettimeofday', populates a user-supplied
+array with preformatted time information. It returns a string with the
current time formatted in the same way as the `date' utility:
# gettimeofday.awk --- get the time of day in a usable format
@@ -13179,9 +13317,9 @@ current time formatted in the same way as the `date' utility:
return ret
}
-The string indices are easier to use and read than the various formats
-required by `strftime'. The `alarm' program presented in *Note Alarm
-Program::, uses this function. A more general design for the
+ The string indices are easier to use and read than the various
+formats required by `strftime'. The `alarm' program presented in *note
+Alarm Program::, uses this function. A more general design for the
`gettimeofday' function would have allowed the user to supply an
optional timestamp value to use instead of the current time.
@@ -13217,8 +13355,8 @@ informed that this was not the case, the user requested that we add new
special patterns to `gawk', named `BEGIN_FILE' and `END_FILE', that
would have the desired behavior. He even supplied us the code to do so.
-Adding these special patterns to `gawk' wasn't necessary; the job can
-be done cleanly in `awk' itself, as illustrated by the following
+ Adding these special patterns to `gawk' wasn't necessary; the job
+can be done cleanly in `awk' itself, as illustrated by the following
library program. It arranges to call two user-supplied functions,
`beginfile' and `endfile', at the beginning and end of each data file.
Besides solving the problem in only nine(!) lines of code, it does so
@@ -13242,10 +13380,10 @@ _portably_; this works with any implementation of `awk':
END { endfile(FILENAME) }
-This file must be loaded before the user's "main" program, so that the
-rule it supplies is executed first.
+ This file must be loaded before the user's "main" program, so that
+the rule it supplies is executed first.
-This rule relies on `awk''s `FILENAME' variable that automatically
+ This rule relies on `awk''s `FILENAME' variable that automatically
changes for each new data file. The current file name is saved in a
private variable, `_oldfilename'. If `FILENAME' does not equal
`_oldfilename', then a new data file is being processed and it is
@@ -13257,16 +13395,16 @@ then assigns the current file name to `_oldfilename' and calls
`_oldfilename' is initialized to the null string, this rule executes
correctly even for the first data file.
-The program also supplies an `END' rule to do the final processing for
-the last file. Because this `END' rule comes before any `END' rules
+ The program also supplies an `END' rule to do the final processing
+for the last file. Because this `END' rule comes before any `END' rules
supplied in the "main" program, `endfile' is called first. Once again
the value of multiple `BEGIN' and `END' rules should be clear.
-This version has same problem as the first version of `nextfile' (*note
-Nextfile Function::). If the same data file occurs twice in a row on
-the command line, then `endfile' and `beginfile' are not executed at
-the end of the first pass and at the beginning of the second pass. The
-following version solves the problem:
+ This version has same problem as the first version of `nextfile'
+(*note Nextfile Function::). If the same data file occurs twice in a
+row on the command line, then `endfile' and `beginfile' are not
+executed at the end of the first pass and at the beginning of the
+second pass. The following version solves the problem:
# ftrans.awk --- handle data file transitions
#
@@ -13280,8 +13418,8 @@ following version solves the problem:
END { endfile(_filename_) }
-*Note Wc Program::, shows how this library function can be used and how
-it simplifies writing the main program.
+ *note Wc Program::, shows how this library function can be used and
+how it simplifies writing the main program.

File: gawk.info, Node: Rewind Function, Next: File Checking, Prev: Filetrans Function, Up: Data File Management
@@ -13294,9 +13432,9 @@ that would make it possible to reread the current file. The requesting
user didn't want to have to use `getline' (*note Getline::) inside a
loop.
-However, as long as you are not in the `END' rule, it is quite easy to
-arrange to immediately close the current input file and then start over
-with it from the top. For lack of a better name, we'll call it
+ However, as long as you are not in the `END' rule, it is quite easy
+to arrange to immediately close the current input file and then start
+over with it from the top. For lack of a better name, we'll call it
`rewind':
# rewind.awk --- rewind the current file and start over
@@ -13316,12 +13454,12 @@ with it from the top. For lack of a better name, we'll call it
nextfile
}
-This code relies on the `ARGIND' variable (*note Auto-set::), which is
-specific to `gawk'. If you are not using `gawk', you can use ideas
-presented in *Note Filetrans Function::, to either update `ARGIND' on
+ This code relies on the `ARGIND' variable (*note Auto-set::), which
+is specific to `gawk'. If you are not using `gawk', you can use ideas
+presented in *note Filetrans Function::, to either update `ARGIND' on
your own or modify this code as appropriate.
-The `rewind' function also relies on the `nextfile' keyword (*note
+ The `rewind' function also relies on the `nextfile' keyword (*note
Nextfile Statement::). *Note Nextfile Function::, for a function
version of `nextfile'.
@@ -13349,9 +13487,9 @@ program to your `awk' program:
}
}
-In `gawk', the `getline' won't be fatal (unless `--posix' is in force).
-Removing the element from `ARGV' with `delete' skips the file (since
-it's no longer in the list).
+ In `gawk', the `getline' won't be fatal (unless `--posix' is in
+force). Removing the element from `ARGV' with `delete' skips the file
+(since it's no longer in the list).

File: gawk.info, Node: Empty Files, Next: Ignoring Assigns, Prev: File Checking, Up: Data File Management
@@ -13367,9 +13505,9 @@ file indication, closes the file, and proceeds on to the next
command-line data file, _without_ executing any user-level `awk'
program code.
-Using `gawk''s `ARGIND' variable (*note Built-in Variables::), it is
+ Using `gawk''s `ARGIND' variable (*note Built-in Variables::), it is
possible to detect when an empty data file has been skipped. Similar
-to the library file presented in *Note Filetrans Function::, the
+to the library file presented in *note Filetrans Function::, the
following library file calls a function named `zerofile' that the user
must provide. The arguments passed are the file name and the position
in `ARGV' where it was found:
@@ -13390,23 +13528,23 @@ in `ARGV' where it was found:
zerofile(ARGV[Argind], Argind)
}
-The user-level variable `Argind' allows the `awk' program to track its
-progress through `ARGV'. Whenever the program detects that `ARGIND' is
-greater than `Argind + 1', it means that one or more empty files were
-skipped. The action then calls `zerofile' for each such file,
-incrementing `Argind' along the way.
+ The user-level variable `Argind' allows the `awk' program to track
+its progress through `ARGV'. Whenever the program detects that
+`ARGIND' is greater than `Argind + 1', it means that one or more empty
+files were skipped. The action then calls `zerofile' for each such
+file, incrementing `Argind' along the way.
-The `Argind != ARGIND' rule simply keeps `Argind' up to date in the
+ The `Argind != ARGIND' rule simply keeps `Argind' up to date in the
normal case.
-Finally, the `END' rule catches the case of any empty files at the end
-of the command-line arguments. Note that the test in the condition of
-the `for' loop uses the `<=' operator, not `<'.
+ Finally, the `END' rule catches the case of any empty files at the
+end of the command-line arguments. Note that the test in the condition
+of the `for' loop uses the `<=' operator, not `<'.
-As an exercise, you might consider whether this same problem can be
+ As an exercise, you might consider whether this same problem can be
solved without relying on `gawk''s `ARGIND' variable.
-As a second exercise, revise this code to handle the case where an
+ As a second exercise, revise this code to handle the case where an
intervening value in `ARGV' is a variable assignment.

@@ -13420,9 +13558,9 @@ assignments (*note Assignment Options::). In particular, if you have
file names that contain an `=' character, `awk' treats the file name as
an assignment, and does not process it.
-Some users have suggested an additional command-line option for `gawk'
-to disable command-line assignments. However, some simple programming
-with a library file does the trick:
+ Some users have suggested an additional command-line option for
+`gawk' to disable command-line assignments. However, some simple
+programming with a library file does the trick:
# noassign.awk --- library file to avoid the need for a
# special option that disables command-line assignments
@@ -13438,15 +13576,15 @@ with a library file does the trick:
disable_assigns(ARGC, ARGV)
}
-You then run your program this way:
+ You then run your program this way:
awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk *
-The function works by looping through the arguments. It prepends `./'
-to any argument that matches the form of a variable assignment, turning
-that argument into a file name.
+ The function works by looping through the arguments. It prepends
+`./' to any argument that matches the form of a variable assignment,
+turning that argument into a file name.
-The use of `No_command_assign' allows you to disable command-line
+ The use of `No_command_assign' allows you to disable command-line
assignments at invocation time, by giving the variable a true value.
When not set, it is initially zero (i.e., false), so the command-line
arguments are left alone.
@@ -13466,22 +13604,22 @@ option requires a string to use as the field separator. The first
occurrence on the command line of either `--' or a string that does not
begin with `-' ends the options.
-Modern Unix systems provide a C function named `getopt' for processing
-command-line arguments. The programmer provides a string describing the
-one-letter options. If an option requires an argument, it is followed
-in the string with a colon. `getopt' is also passed the count and
-values of the command-line arguments and is called in a loop. `getopt'
-processes the command-line arguments for option letters. Each time
-around the loop, it returns a single character representing the next
-option letter that it finds, or `?' if it finds an invalid option.
+ Modern Unix systems provide a C function named `getopt' for
+processing command-line arguments. The programmer provides a string
+describing the one-letter options. If an option requires an argument,
+it is followed in the string with a colon. `getopt' is also passed the
+count and values of the command-line arguments and is called in a loop.
+`getopt' processes the command-line arguments for option letters. Each
+time around the loop, it returns a single character representing the
+next option letter that it finds, or `?' if it finds an invalid option.
When it returns -1, there are no options left on the command line.
-When using `getopt', options that do not take arguments can be grouped
-together. Furthermore, options that take arguments require that the
-argument is present. The argument can immediately follow the option
-letter, or it can be a separate command-line argument.
+ When using `getopt', options that do not take arguments can be
+grouped together. Furthermore, options that take arguments require
+that the argument is present. The argument can immediately follow the
+option letter, or it can be a separate command-line argument.
-Given a hypothetical program that takes three command-line options,
+ Given a hypothetical program that takes three command-line options,
`-a', `-b', and `-c', where `-b' requires an argument, all of the
following are valid ways of invoking the program:
@@ -13489,13 +13627,14 @@ following are valid ways of invoking the program:
prog -ac -bfoo -- data1 data2 data3
prog -acbfoo data1 data2 data3
-Notice that when the argument is grouped with its option, the rest of
+ Notice that when the argument is grouped with its option, the rest of
the argument is considered to be the option's argument. In this
example, `-acbfoo' indicates that all of the `-a', `-b', and `-c'
options were supplied, and that `foo' is the argument to the `-b'
option.
-`getopt' provides four external variables that the programmer can use:
+ `getopt' provides four external variables that the programmer can
+use:
`optind'
The index in the argument value array (`argv') where the first
@@ -13512,8 +13651,8 @@ option.
`optopt'
The letter representing the command-line option.
-The following C fragment shows how `getopt' might process command-line
-arguments for `awk':
+ The following C fragment shows how `getopt' might process
+command-line arguments for `awk':
int
main(int argc, char *argv[])
@@ -13544,17 +13683,17 @@ arguments for `awk':
...
}
-As a side point, `gawk' actually uses the GNU `getopt_long' function to
-process both normal and GNU-style long options (*note Options::).
+ As a side point, `gawk' actually uses the GNU `getopt_long' function
+to process both normal and GNU-style long options (*note Options::).
-The abstraction provided by `getopt' is very useful and is quite handy
-in `awk' programs as well. Following is an `awk' version of `getopt'.
-This function highlights one of the greatest weaknesses in `awk', which
-is that it is very poor at manipulating single characters. Repeated
-calls to `substr' are necessary for accessing individual characters
-(*note String Functions::).(1)
+ The abstraction provided by `getopt' is very useful and is quite
+handy in `awk' programs as well. Following is an `awk' version of
+`getopt'. This function highlights one of the greatest weaknesses in
+`awk', which is that it is very poor at manipulating single characters.
+Repeated calls to `substr' are necessary for accessing individual
+characters (*note String Functions::).(1)
-The discussion that follows walks through the code a bit at a time:
+ The discussion that follows walks through the code a bit at a time:
# getopt.awk --- do C library getopt(3) function in awk
# External variables:
@@ -13571,12 +13710,12 @@ The discussion that follows walks through the code a bit at a time:
# Private Data:
# _opti -- index in multi-flag option, e.g., -abc
-The function starts out with a list of the global variables it uses,
+ The function starts out with a list of the global variables it uses,
what the return values are, what they mean, and any global variables
that are "private" to this library function. Such documentation is
essential for any program, and particularly for library functions.
-The `getopt' function first checks that it was indeed called with a
+ The `getopt' function first checks that it was indeed called with a
string of options (the `options' parameter). If `options' has a zero
length, `getopt' immediately returns -1:
@@ -13594,13 +13733,13 @@ length, `getopt' immediately returns -1:
return -1
}
-The next thing to check for is the end of the options. A `--' ends the
-command-line options, as does any command-line argument that does not
-begin with a `-'. `Optind' is used to step through the array of
+ The next thing to check for is the end of the options. A `--' ends
+the command-line options, as does any command-line argument that does
+not begin with a `-'. `Optind' is used to step through the array of
command-line arguments; it retains its value across calls to `getopt',
because it is a global variable.
-The regular expression that is used, `/^-[^: \t\n\f\r\v\b]/', is
+ The regular expression that is used, `/^-[^: \t\n\f\r\v\b]/', is
perhaps a bit of overkill; it checks for a `-' followed by anything
that is not whitespace and not a colon. If the current command-line
argument does not match this pattern, it is not an option, and it ends
@@ -13623,31 +13762,31 @@ option processing:
return "?"
}
-The `_opti' variable tracks the position in the current command-line
+ The `_opti' variable tracks the position in the current command-line
argument (`argv[Optind]'). If multiple options are grouped together
with one `-' (e.g., `-abx'), it is necessary to return them to the user
one at a time.
-If `_opti' is equal to zero, it is set to two, which is the index in
+ If `_opti' is equal to zero, it is set to two, which is the index in
the string of the next character to look at (we skip the `-', which is
at position one). The variable `thisopt' holds the character, obtained
with `substr'. It is saved in `Optopt' for the main program to use.
-If `thisopt' is not in the `options' string, then it is an invalid
+ If `thisopt' is not in the `options' string, then it is an invalid
option. If `Opterr' is nonzero, `getopt' prints an error message on
the standard error that is similar to the message from the C version of
`getopt'.
-Because the option is invalid, it is necessary to skip it and move on
-to the next option character. If `_opti' is greater than or equal to
-the length of the current command-line argument, it is necessary to
+ Because the option is invalid, it is necessary to skip it and move
+on to the next option character. If `_opti' is greater than or equal
+to the length of the current command-line argument, it is necessary to
move on to the next argument, so `Optind' is incremented and `_opti' is
reset to zero. Otherwise, `Optind' is left alone and `_opti' is merely
incremented.
-In any case, because the option is invalid, `getopt' returns `?'. The
-main program can examine `Optopt' if it needs to know what the invalid
-option letter actually is. Continuing on:
+ In any case, because the option is invalid, `getopt' returns `?'.
+The main program can examine `Optopt' if it needs to know what the
+invalid option letter actually is. Continuing on:
if (substr(options, i + 1, 1) == ":") {
# get option argument
@@ -13659,10 +13798,10 @@ option letter actually is. Continuing on:
} else
Optarg = ""
-If the option requires an argument, the option letter is followed by a
-colon in the `options' string. If there are remaining characters in the
-current command-line argument (`argv[Optind]'), then the rest of that
-string is assigned to `Optarg'. Otherwise, the next command-line
+ If the option requires an argument, the option letter is followed by
+a colon in the `options' string. If there are remaining characters in
+the current command-line argument (`argv[Optind]'), then the rest of
+that string is assigned to `Optarg'. Otherwise, the next command-line
argument is used (`-xFOO' versus `-x FOO'). In either case, `_opti' is
reset to zero, because there are no more characters left to examine in
the current command-line argument. Continuing:
@@ -13675,14 +13814,14 @@ the current command-line argument. Continuing:
return thisopt
}
-Finally, if `_opti' is either zero or greater than the length of the
+ Finally, if `_opti' is either zero or greater than the length of the
current command-line argument, it means this element in `argv' is
through being processed, so `Optind' is incremented to point to the
next element in `argv'. If neither condition is true, then only
`_opti' is incremented, so that the next option letter can be processed
on the next call to `getopt'.
-The `BEGIN' rule initializes both `Opterr' and `Optind' to one.
+ The `BEGIN' rule initializes both `Opterr' and `Optind' to one.
`Opterr' is set to one, since the default behavior is for `getopt' to
print a diagnostic message upon seeing an invalid option. `Optind' is
set to one, since there's no reason to look at the program name, which
@@ -13704,7 +13843,7 @@ is in `ARGV[0]':
}
}
-The rest of the `BEGIN' rule is a simple test program. Here is the
+ The rest of the `BEGIN' rule is a simple test program. Here is the
result of two sample runs of the test program:
$ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x
@@ -13723,14 +13862,20 @@ result of two sample runs of the test program:
-| ARGV[4] = <xyz>
-| ARGV[5] = <abc>
-In both runs, the first `--' terminates the arguments to `awk', so that
-it does not try to interpret the `-a', etc., as its own options.
-Several of the sample programs presented in *Note Sample Programs::,
+ In both runs, the first `--' terminates the arguments to `awk', so
+that it does not try to interpret the `-a', etc., as its own options.
+
+ NOTE: After `getopt' is through, it is the responsibility of the
+ user level code to clear out all the elements of `ARGV' from 1 to
+ `Optind', so that `awk' does not try to process the command-line
+ options as file names.
+
+ Several of the sample programs presented in *note Sample Programs::,
use `getopt' to process their arguments.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This function was written before `gawk' acquired the ability to
+ (1) This function was written before `gawk' acquired the ability to
split strings into single characters using `""' as the separator. We
have left it alone, since using `substr' is more portable.
@@ -13750,16 +13895,16 @@ presents a suite of functions for retrieving information from the user
database. *Note Group Functions::, for a similar suite that retrieves
information from the group database.
-The POSIX standard does not define the file where user information is
+ The POSIX standard does not define the file where user information is
kept. Instead, it provides the `<pwd.h>' header file and several C
language subroutines for obtaining user information. The primary
function is `getpwent', for "get password entry." The "password" comes
from the original user database file, `/etc/passwd', which stores user
information, along with the encrypted passwords (hence the name).
-While an `awk' program could simply read `/etc/passwd' directly, this
-file may not contain complete information about the system's set of
-users.(1) To be sure you are able to produce a readable and complete
+ While an `awk' program could simply read `/etc/passwd' directly,
+this file may not contain complete information about the system's set
+of users.(1) To be sure you are able to produce a readable and complete
version of the user database, it is necessary to write a small C
program that calls `getpwent'. `getpwent' is defined as returning a
pointer to a `struct passwd'. Each time it is called, it returns the
@@ -13792,7 +13937,7 @@ that "cats" the password database:
return 0;
}
-If you don't understand C, don't worry about it. The output from
+ If you don't understand C, don't worry about it. The output from
`pwcat' is the user database, in the traditional `/etc/passwd' format
of colon-separated fields. The fields are:
@@ -13808,7 +13953,7 @@ Home directory The user's login (or "home") directory
Login shell The program that is run when the user logs in.
This is usually a shell, such as `bash'.
-A few lines representative of `pwcat''s output are as follows:
+ A few lines representative of `pwcat''s output are as follows:
$ pwcat
-| root:3Ov02d5VaUPB6:0:1:Operator:/:/bin/sh
@@ -13821,9 +13966,9 @@ A few lines representative of `pwcat''s output are as follows:
-| andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh
...
-With that introduction, following is a group of functions for getting
-user information. There are several functions here, corresponding to
-the C functions of the same names:
+ With that introduction, following is a group of functions for
+getting user information. There are several functions here,
+corresponding to the C functions of the same names:
# passwd.awk --- access password file information
BEGIN {
@@ -13859,40 +14004,40 @@ the C functions of the same names:
$0 = olddol0
}
-The `BEGIN' rule sets a private variable to the directory where `pwcat'
-is stored. Because it is used to help out an `awk' library routine, we
-have chosen to put it in `/usr/local/libexec/awk'; however, you might
-want it to be in a different directory on your system.
+ The `BEGIN' rule sets a private variable to the directory where
+`pwcat' is stored. Because it is used to help out an `awk' library
+routine, we have chosen to put it in `/usr/local/libexec/awk'; however,
+you might want it to be in a different directory on your system.
-The function `_pw_init' keeps three copies of the user information in
-three associative arrays. The arrays are indexed by username
+ The function `_pw_init' keeps three copies of the user information
+in three associative arrays. The arrays are indexed by username
(`_pw_byname'), by user ID number (`_pw_byuid'), and by order of
occurrence (`_pw_bycount'). The variable `_pw_inited' is used for
efficiency; `_pw_init' needs only to be called once.
-Because this function uses `getline' to read information from `pwcat',
-it first saves the values of `FS', `RS', and `$0'. It notes in the
-variable `using_fw' whether field splitting with `FIELDWIDTHS' is in
-effect or not. Doing so is necessary, since these functions could be
-called from anywhere within a user's program, and the user may have his
-or her own way of splitting records and fields.
+ Because this function uses `getline' to read information from
+`pwcat', it first saves the values of `FS', `RS', and `$0'. It notes
+in the variable `using_fw' whether field splitting with `FIELDWIDTHS'
+is in effect or not. Doing so is necessary, since these functions
+could be called from anywhere within a user's program, and the user may
+have his or her own way of splitting records and fields.
-The `using_fw' variable checks `PROCINFO["FS"]', which is
+ The `using_fw' variable checks `PROCINFO["FS"]', which is
`"FIELDWIDTHS"' if field splitting is being done with `FIELDWIDTHS'.
This makes it possible to restore the correct field-splitting mechanism
later. The test can only be true for `gawk'. It is false if using
`FS' or on some other `awk' implementation.
-The main part of the function uses a loop to read database lines, split
-the line into fields, and then store the line into each array as
+ The main part of the function uses a loop to read database lines,
+split the line into fields, and then store the line into each array as
necessary. When the loop is done, `_pw_init' cleans up by closing the
pipeline, setting `_pw_inited' to one, and restoring `FS' (and
`FIELDWIDTHS' if necessary), `RS', and `$0'. The use of `_pw_count' is
explained shortly.
-The `getpwnam' function takes a username as a string argument. If that
-user is in the database, it returns the appropriate line. Otherwise, it
-returns the null string:
+ The `getpwnam' function takes a username as a string argument. If
+that user is in the database, it returns the appropriate line.
+Otherwise, it returns the null string:
function getpwnam(name)
{
@@ -13902,9 +14047,9 @@ returns the null string:
return ""
}
-Similarly, the `getpwuid' function takes a user ID number argument. If
-that user number is in the database, it returns the appropriate line.
-Otherwise, it returns the null string:
+ Similarly, the `getpwuid' function takes a user ID number argument.
+If that user number is in the database, it returns the appropriate
+line. Otherwise, it returns the null string:
function getpwuid(uid)
{
@@ -13914,8 +14059,8 @@ Otherwise, it returns the null string:
return ""
}
-The `getpwent' function simply steps through the database, one entry at
-a time. It uses `_pw_count' to track its current position in the
+ The `getpwent' function simply steps through the database, one entry
+at a time. It uses `_pw_count' to track its current position in the
`_pw_bycount' array:
function getpwent()
@@ -13926,25 +14071,26 @@ a time. It uses `_pw_count' to track its current position in the
return ""
}
-The `endpwent' function resets `_pw_count' to zero, so that subsequent
-calls to `getpwent' start over again:
+ The `endpwent' function resets `_pw_count' to zero, so that
+subsequent calls to `getpwent' start over again:
function endpwent()
{
_pw_count = 0
}
-A conscious design decision in this suite was made that each subroutine
-calls `_pw_init' to initialize the database arrays. The overhead of
-running a separate process to generate the user database, and the I/O
-to scan it, are only incurred if the user's main program actually calls
-one of these functions. If this library file is loaded along with a
-user's program, but none of the routines are ever called, then there is
-no extra runtime overhead. (The alternative is move the body of
-`_pw_init' into a `BEGIN' rule, which always runs `pwcat'. This
-simplifies the code but runs an extra process that may never be needed.)
-
-In turn, calling `_pw_init' is not too expensive, because the
+ A conscious design decision in this suite was made that each
+subroutine calls `_pw_init' to initialize the database arrays. The
+overhead of running a separate process to generate the user database,
+and the I/O to scan it, are only incurred if the user's main program
+actually calls one of these functions. If this library file is loaded
+along with a user's program, but none of the routines are ever called,
+then there is no extra runtime overhead. (The alternative is move the
+body of `_pw_init' into a `BEGIN' rule, which always runs `pwcat'.
+This simplifies the code but runs an extra process that may never be
+needed.)
+
+ In turn, calling `_pw_init' is not too expensive, because the
`_pw_inited' variable keeps the program from reading the data more than
once. If you are worried about squeezing every last cycle out of your
`awk' program, the check of `_pw_inited' could be moved out of
@@ -13952,11 +14098,11 @@ once. If you are worried about squeezing every last cycle out of your
this is not necessary, since most `awk' programs are I/O-bound, and it
clutters up the code.
-The `id' program in *Note Id Program::, uses these functions.
+ The `id' program in *note Id Program::, uses these functions.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) It is often the case that password information is stored in a
+ (1) It is often the case that password information is stored in a
network database.

@@ -13965,7 +14111,7 @@ File: gawk.info, Node: Group Functions, Prev: Passwd Functions, Up: Library F
12.6 Reading the Group Database
===============================
-Much of the discussion presented in *Note Passwd Functions::, applies
+Much of the discussion presented in *note Passwd Functions::, applies
to the group database as well. Although there has traditionally been a
well-known file (`/etc/group') in a well-known format, the POSIX
standard only provides a set of C library routines (`<grp.h>' and
@@ -13974,7 +14120,7 @@ exist, it likely does not have complete information. Therefore, as
with the user database, it is necessary to have a small C program that
generates the group database as its output.
-`grcat', a C program that "cats" the group database, is as follows:
+ `grcat', a C program that "cats" the group database, is as follows:
/*
* grcat.c
@@ -14006,7 +14152,7 @@ generates the group database as its output.
return 0;
}
-Each line in the group database represents one group. The fields are
+ Each line in the group database represents one group. The fields are
separated with colons and represent the following information:
Group name The group's name.
@@ -14015,7 +14161,7 @@ Group password The group's encrypted password. In practice,
or set to `*'.
Group-ID The group's numeric group ID number; this
number should be unique within the file.
-Group member list A comma-separated list of usernames. These
+Group member list A comma-separated list of user names. These
users are members of the group. Modern Unix
systems allow users to be members of several
groups simultaneously. If your system does,
@@ -14024,7 +14170,7 @@ Group member list A comma-separated list of usernames. These
numbers. (Note that `PROCINFO' is a `gawk'
extension; *note Built-in Variables::.)
-Here is what running `grcat' might produce:
+ Here is what running `grcat' might produce:
$ grcat
-| wheel:*:0:arnold
@@ -14035,7 +14181,7 @@ Here is what running `grcat' might produce:
-| other:*:20:
...
-Here are the functions for obtaining information from the group
+ Here are the functions for obtaining information from the group
database. There are several, modeled after the C library functions of
the same names:
@@ -14090,46 +14236,46 @@ the same names:
$0 = olddol0
}
-The `BEGIN' rule sets a private variable to the directory where `grcat'
-is stored. Because it is used to help out an `awk' library routine, we
-have chosen to put it in `/usr/local/libexec/awk'. You might want it
-to be in a different directory on your system.
+ The `BEGIN' rule sets a private variable to the directory where
+`grcat' is stored. Because it is used to help out an `awk' library
+routine, we have chosen to put it in `/usr/local/libexec/awk'. You
+might want it to be in a different directory on your system.
-These routines follow the same general outline as the user database
+ These routines follow the same general outline as the user database
routines (*note Passwd Functions::). The `_gr_inited' variable is used
to ensure that the database is scanned no more than once. The
`_gr_init' function first saves `FS', `FIELDWIDTHS', `RS', and `$0',
and then sets `FS' and `RS' to the correct values for scanning the
group information.
-The group information is stored is several associative arrays. The
+ The group information is stored is several associative arrays. The
arrays are indexed by group name (`_gr_byname'), by group ID number
(`_gr_bygid'), and by position in the database (`_gr_bycount'). There
-is an additional array indexed by username (`_gr_groupsbyuser'), which
+is an additional array indexed by user name (`_gr_groupsbyuser'), which
is a space-separated list of groups to which each user belongs.
-Unlike the user database, it is possible to have multiple records in the
-database for the same group. This is common when a group has a large
-number of members. A pair of such entries might look like the
+ Unlike the user database, it is possible to have multiple records in
+the database for the same group. This is common when a group has a
+large number of members. A pair of such entries might look like the
following:
tvpeople:*:101:johnny,jay,arsenio
tvpeople:*:101:david,conan,tom,joan
-For this reason, `_gr_init' looks to see if a group name or group ID
-number is already seen. If it is, then the usernames are simply
+ For this reason, `_gr_init' looks to see if a group name or group ID
+number is already seen. If it is, then the user names are simply
concatenated onto the previous list of users. (There is actually a
subtle problem with the code just presented. Suppose that the first
time there were no names. This code adds the names with a leading
comma. It also doesn't check that there is a `$4'.)
-Finally, `_gr_init' closes the pipeline to `grcat', restores `FS' (and
-`FIELDWIDTHS' if necessary), `RS', and `$0', initializes `_gr_count' to
-zero (it is used later), and makes `_gr_inited' nonzero.
+ Finally, `_gr_init' closes the pipeline to `grcat', restores `FS'
+(and `FIELDWIDTHS' if necessary), `RS', and `$0', initializes
+`_gr_count' to zero (it is used later), and makes `_gr_inited' nonzero.
-The `getgrnam' function takes a group name as its argument, and if that
-group exists, it is returned. Otherwise, `getgrnam' returns the null
-string:
+ The `getgrnam' function takes a group name as its argument, and if
+that group exists, it is returned. Otherwise, `getgrnam' returns the
+null string:
function getgrnam(group)
{
@@ -14139,7 +14285,7 @@ string:
return ""
}
-The `getgrgid' function is similar, it takes a numeric group ID and
+ The `getgrgid' function is similar, it takes a numeric group ID and
looks up the information associated with that group ID:
function getgrgid(gid)
@@ -14150,8 +14296,8 @@ looks up the information associated with that group ID:
return ""
}
-The `getgruser' function does not have a C counterpart. It takes a
-username and returns the list of groups that have the user as a member:
+ The `getgruser' function does not have a C counterpart. It takes a
+user name and returns the list of groups that have the user as a member:
function getgruser(user)
{
@@ -14161,8 +14307,8 @@ username and returns the list of groups that have the user as a member:
return ""
}
-The `getgrent' function steps through the database one entry at a time.
-It uses `_gr_count' to track its position in the list:
+ The `getgrent' function steps through the database one entry at a
+time. It uses `_gr_count' to track its position in the list:
function getgrent()
{
@@ -14172,24 +14318,24 @@ It uses `_gr_count' to track its position in the list:
return ""
}
-The `endgrent' function resets `_gr_count' to zero so that `getgrent'
-can start over again:
+ The `endgrent' function resets `_gr_count' to zero so that
+`getgrent' can start over again:
function endgrent()
{
_gr_count = 0
}
-As with the user database routines, each function calls `_gr_init' to
+ As with the user database routines, each function calls `_gr_init' to
initialize the arrays. Doing so only incurs the extra overhead of
running `grcat' if these functions are used (as opposed to moving the
body of `_gr_init' into a `BEGIN' rule).
-Most of the work is in scanning the database and building the various
+ Most of the work is in scanning the database and building the various
associative arrays. The functions that the user calls are themselves
very simple, relying on `awk''s associative arrays to do work.
-The `id' program in *Note Id Program::, uses these functions.
+ The `id' program in *note Id Program::, uses these functions.

File: gawk.info, Node: Sample Programs, Next: Language History, Prev: Library Functions, Up: Top
@@ -14197,12 +14343,12 @@ File: gawk.info, Node: Sample Programs, Next: Language History, Prev: Library
13 Practical `awk' Programs
***************************
-*Note Library Functions::, presents the idea that reading programs in a
+*note Library Functions::, presents the idea that reading programs in a
language contributes to learning that language. This major node
continues that theme, presenting a potpourri of `awk' programs for your
reading enjoyment.
-Many of these programs use the library functions presented in *Note
+ Many of these programs use the library functions presented in *note
Library Functions::.
* Menu:
@@ -14225,12 +14371,12 @@ Here, PROGRAM is the name of the `awk' program (such as `cut.awk'),
OPTIONS are any command-line options for the program that start with a
`-', and FILES are the actual data files.
-If your system supports the `#!' executable interpreter mechanism
+ If your system supports the `#!' executable interpreter mechanism
(*note Executable Scripts::), you can instead run your program directly:
cut.awk -c1-8 myfiles > results
-If your `awk' is not `gawk', you may instead need to use this:
+ If your `awk' is not `gawk', you may instead need to use this:
cut.awk -- -c1-8 myfiles > results
@@ -14246,11 +14392,12 @@ enjoyable, because the algorithms can be very clearly expressed, and
the code is usually very concise and simple. This is true because
`awk' does so much for you.
-It should be noted that these programs are not necessarily intended to
-replace the installed versions on your system. Instead, their purpose
-is to illustrate `awk' language programming for "real world" tasks.
+ It should be noted that these programs are not necessarily intended
+to replace the installed versions on your system. Instead, their
+purpose is to illustrate `awk' language programming for "real world"
+tasks.
-The programs are presented in alphabetical order.
+ The programs are presented in alphabetical order.
* Menu:
@@ -14274,13 +14421,13 @@ separated by tabs by default, but you may supply a command-line option
to change the field "delimiter" (i.e., the field-separator character).
`cut''s definition of fields is less general than `awk''s.
-A common use of `cut' might be to pull out just the login name of
+ A common use of `cut' might be to pull out just the login name of
logged-on users from the output of `who'. For example, the following
pipeline generates a sorted, unique list of the logged-on users:
who | cut -c1-8 | sort | uniq
-The options for `cut' are:
+ The options for `cut' are:
`-c LIST'
Use LIST as the list of characters to cut out. Items within the
@@ -14298,11 +14445,11 @@ The options for `cut' are:
`-s'
Suppress printing of lines that do not contain the field delimiter.
-The `awk' implementation of `cut' uses the `getopt' library function
+ The `awk' implementation of `cut' uses the `getopt' library function
(*note Getopt Function::) and the `join' library function (*note Join
Function::).
-The program begins with a comment describing the options, the library
+ The program begins with a comment describing the options, the library
functions needed, and a `usage' function that prints out a usage
message and exits. `usage' is called if invalid arguments are supplied:
@@ -14328,7 +14475,7 @@ message and exits. `usage' is called if invalid arguments are supplied:
The variables `e1' and `e2' are used so that the function fits nicely
on the screen.
-Next comes a `BEGIN' rule that parses the command-line options. It
+ Next comes a `BEGIN' rule that parses the command-line options. It
sets `FS' to a single TAB character, because that is `cut''s default
field separator. The output field separator is also set to be the same
as the input field separator. Then `getopt' is used to step through
@@ -14368,19 +14515,19 @@ the output field separator is set to the null string:
for (i = 1; i < Optind; i++)
ARGV[i] = ""
-Special care is taken when the field delimiter is a space. Using a
+ Special care is taken when the field delimiter is a space. Using a
single space (`" "') for the value of `FS' is incorrect--`awk' would
separate fields with runs of spaces, tabs, and/or newlines, and we want
-them to be separated with individual spaces. Also, note that after
-`getopt' is through, we have to clear out all the elements of `ARGV'
-from 1 to `Optind', so that `awk' does not try to process the
-command-line options as file names.
+them to be separated with individual spaces. Also remember that after
+`getopt' is through (as described in *note Getopt Function::), we have
+to clear out all the elements of `ARGV' from 1 to `Optind', so that
+`awk' does not try to process the command-line options as file names.
-After dealing with the command-line options, the program verifies that
-the options make sense. Only one or the other of `-c' and `-f' should
-be used, and both require a field list. Then the program calls either
-`set_fieldlist' or `set_charlist' to pull apart the list of fields or
-characters:
+ After dealing with the command-line options, the program verifies
+that the options make sense. Only one or the other of `-c' and `-f'
+should be used, and both require a field list. Then the program calls
+either `set_fieldlist' or `set_charlist' to pull apart the list of
+fields or characters:
if (by_fields && by_chars)
usage()
@@ -14399,7 +14546,7 @@ characters:
set_charlist()
}
-`set_fieldlist' is used to split the field list apart at the commas
+ `set_fieldlist' is used to split the field list apart at the commas
and into an array. Then, for each element of the array, it looks to
see if it is actually a range, and if so, splits it apart. The range is
verified to make sure the first number is smaller than the second.
@@ -14427,12 +14574,12 @@ The program lets `awk' handle the job of doing the field splitting:
nfields = j - 1
}
-The `set_charlist' function is more complicated than `set_fieldlist'.
+ The `set_charlist' function is more complicated than `set_fieldlist'.
The idea here is to use `gawk''s `FIELDWIDTHS' variable (*note Constant
Size::), which describes constant-width input. When using a character
list, that is exactly what we have.
-Setting up `FIELDWIDTHS' is more complicated than simply listing the
+ Setting up `FIELDWIDTHS' is more complicated than simply listing the
fields that need to be printed. We have to keep track of the fields to
print and also the intervening characters that have to be skipped. For
example, suppose you wanted characters 1 through 8, 15, and 22 through
@@ -14483,13 +14630,13 @@ filler fields:
nfields = j - 1
}
-Next is the rule that actually processes the data. If the `-s' option
-is given, then `suppress' is true. The first `if' statement makes sure
-that the input record does have the field separator. If `cut' is
-processing fields, `suppress' is true, and the field separator
+ Next is the rule that actually processes the data. If the `-s'
+option is given, then `suppress' is true. The first `if' statement
+makes sure that the input record does have the field separator. If
+`cut' is processing fields, `suppress' is true, and the field separator
character is not in the record, then the record is skipped.
-If the record is valid, then `gawk' has split the data into fields,
+ If the record is valid, then `gawk' has split the data into fields,
either using the character in `FS' or using fixed-length fields and
`FIELDWIDTHS'. The loop goes through the list of fields that should be
printed. The corresponding field is printed if it contains data. If
@@ -14510,8 +14657,8 @@ out between the fields:
print ""
}
-This version of `cut' relies on `gawk''s `FIELDWIDTHS' variable to do
-the character-based cutting. While it is possible in other `awk'
+ This version of `cut' relies on `gawk''s `FIELDWIDTHS' variable to
+do the character-based cutting. While it is possible in other `awk'
implementations to use `substr' (*note String Functions::), it is also
extremely painful. The `FIELDWIDTHS' variable supplies an elegant
solution to the problem of picking the input line apart by characters.
@@ -14528,14 +14675,14 @@ expressions that are almost identical to those available in `awk'
egrep [ OPTIONS ] 'PATTERN' FILES ...
-The PATTERN is a regular expression. In typical usage, the regular
+ The PATTERN is a regular expression. In typical usage, the regular
expression is quoted to prevent the shell from expanding any of the
special characters as file name wildcards. Normally, `egrep' prints
the lines that matched. If multiple file names are provided on the
command line, each output line is preceded by the name of the file and
a colon.
-The options to `egrep' are as follows:
+ The options to `egrep' are as follows:
`-c'
Print out a count of the lines that matched the pattern, instead
@@ -14561,11 +14708,11 @@ The options to `egrep' are as follows:
Use PATTERN as the regexp to match. The purpose of the `-e'
option is to allow patterns that start with a `-'.
-This version uses the `getopt' library function (*note Getopt
+ This version uses the `getopt' library function (*note Getopt
Function::) and the file transition library program (*note Filetrans
Function::).
-The program begins with a descriptive comment and then a `BEGIN' rule
+ The program begins with a descriptive comment and then a `BEGIN' rule
that processes the command-line arguments with `getopt'. The `-i'
(ignore case) option is particularly easy with `gawk'; we just use the
`IGNORECASE' built-in variable (*note Built-in Variables::):
@@ -14599,7 +14746,7 @@ that processes the command-line arguments with `getopt'. The `-i'
usage()
}
-Next comes the code that handles the `egrep'-specific behavior. If no
+ Next comes the code that handles the `egrep'-specific behavior. If no
pattern is supplied with `-e', the first nonoption on the command line
is used. The `awk' command-line arguments up to `ARGV[Optind]' are
cleared, so that `awk' won't try to process them as files. If no files
@@ -14622,11 +14769,11 @@ the matched lines in the output:
# pattern = tolower(pattern)
}
-The last two lines are commented out, since they are not needed in
+ The last two lines are commented out, since they are not needed in
`gawk'. They should be uncommented if you have to use another version
of `awk'.
-The next set of lines should be uncommented if you are not using
+ The next set of lines should be uncommented if you are not using
`gawk'. This rule translates all the characters in the input line into
lowercase if the `-i' option is specified.(1) The rule is commented out
since it is not necessary with `gawk':
@@ -14636,7 +14783,7 @@ since it is not necessary with `gawk':
# $0 = tolower($0)
#}
-The `beginfile' function is called by the rule in `ftrans.awk' when
+ The `beginfile' function is called by the rule in `ftrans.awk' when
each new file is processed. In this case, it is very simple; all it
does is initialize a variable `fcount' to zero. `fcount' tracks how
many lines in the current file matched the pattern (naming the
@@ -14648,7 +14795,7 @@ parameter, but that we're not interested in its value):
fcount = 0
}
-The `endfile' function is called after each file has been processed.
+ The `endfile' function is called after each file has been processed.
It affects the output only when the user wants a count of the number of
lines that matched. `no_print' is true only if the exit status is
desired. `count_only' is true if line counts are desired. `egrep'
@@ -14668,16 +14815,16 @@ total number of lines that matched the pattern:
total += fcount
}
-The following rule does most of the work of matching lines. The variable
-`matches' is true if the line matched the pattern. If the user wants
-lines that did not match, the sense of `matches' is inverted using the
-`!' operator. `fcount' is incremented with the value of `matches',
-which is either one or zero, depending upon a successful or
+ The following rule does most of the work of matching lines. The
+variable `matches' is true if the line matched the pattern. If the user
+wants lines that did not match, the sense of `matches' is inverted
+using the `!' operator. `fcount' is incremented with the value of
+`matches', which is either one or zero, depending upon a successful or
unsuccessful match. If the line does not match, the `next' statement
just moves on to the next record.
-A number of additional tests are made, but they are only done if we are
-not counting lines. First, if the user only wants exit status
+ A number of additional tests are made, but they are only done if we
+are not counting lines. First, if the user only wants exit status
(`no_print' is true), then it is enough to know that _one_ line in this
file matched, and we can skip on to the next file with `nextfile'.
Similarly, if we are only printing file names, we can print the file
@@ -14710,7 +14857,7 @@ line is printed, with a leading file name and colon if necessary:
}
}
-The `END' rule takes care of producing the correct exit status. If
+ The `END' rule takes care of producing the correct exit status. If
there are no matches, the exit status is one; otherwise it is zero:
END \
@@ -14720,8 +14867,8 @@ there are no matches, the exit status is one; otherwise it is zero:
exit 0
}
-The `usage' function prints a usage message in case of invalid options,
-and then exits:
+ The `usage' function prints a usage message in case of invalid
+options, and then exits:
function usage( e)
{
@@ -14731,20 +14878,20 @@ and then exits:
exit 1
}
-The variable `e' is used so that the function fits nicely on the
+ The variable `e' is used so that the function fits nicely on the
printed page.
-Just a note on programming style: you may have noticed that the `END'
+ Just a note on programming style: you may have noticed that the `END'
rule uses backslash continuation, with the open brace on a line by
itself. This is so that it more closely resembles the way functions
are written. Many of the examples in this major node use this style.
You can decide for yourself if you like writing your `BEGIN' and `END'
rules this way or not.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) It also introduces a subtle bug; if a match happens, we output the
-translated line, not the original.
+ (1) It also introduces a subtle bug; if a match happens, we output
+the translated line, not the original.

File: gawk.info, Node: Id Program, Next: Split Program, Prev: Egrep Program, Up: Clones
@@ -14761,15 +14908,15 @@ corresponding user and group names. The output might look like this:
$ id
-| uid=2076(arnold) gid=10(staff) groups=10(staff),4(tty)
-This information is part of what is provided by `gawk''s `PROCINFO'
+ This information is part of what is provided by `gawk''s `PROCINFO'
array (*note Built-in Variables::). However, the `id' utility provides
a more palatable output than just individual numbers.
-Here is a simple version of `id' written in `awk'. It uses the user
+ Here is a simple version of `id' written in `awk'. It uses the user
database library functions (*note Passwd Functions::) and the group
database library functions (*note Group Functions::):
-The program is fairly straightforward. All the work is done in the
+ The program is fairly straightforward. All the work is done in the
`BEGIN' rule. The user and group ID numbers are obtained from
`PROCINFO'. The code is repetitive. The entry in the user database
for the real user ID number is split into parts at the `:'. The name is
@@ -14839,19 +14986,19 @@ and the group numbers:
print ""
}
-The test in the `for' loop is worth noting. Any supplementary groups
-in the `PROCINFO' array have the indices `"group1"' through `"groupN"'
-for some N, i.e., the total number of supplementary groups. However,
-we don't know in advance how many of these groups there are.
+ The test in the `for' loop is worth noting. Any supplementary
+groups in the `PROCINFO' array have the indices `"group1"' through
+`"groupN"' for some N, i.e., the total number of supplementary groups.
+However, we don't know in advance how many of these groups there are.
-This loop works by starting at one, concatenating the value with
+ This loop works by starting at one, concatenating the value with
`"group"', and then using `in' to see if that value is in the array.
Eventually, `i' is incremented past the last group in the array and the
loop exits.
-The loop is also correct if there are _no_ supplementary groups; then
-the condition is false the first time it's tested, and the loop body
-never executes.
+ The loop is also correct if there are _no_ supplementary groups;
+then the condition is false the first time it's tested, and the loop
+body never executes.

File: gawk.info, Node: Split Program, Next: Tee Program, Prev: Id Program, Up: Clones
@@ -14864,7 +15011,7 @@ is as follows:
split [-COUNT] file [ PREFIX ]
-By default, the output files are named `xaa', `xab', and so on. Each
+ By default, the output files are named `xaa', `xab', and so on. Each
file has 1000 lines in it, with the likely exception of the last file.
To change the number of lines in each file, supply a number on the
command line preceded with a minus; e.g., `-500' for files with 500
@@ -14872,13 +15019,13 @@ lines in them instead of 1000. To change the name of the output files
to something like `myfileaa', `myfileab', and so on, supply an
additional argument that specifies the file name prefix.
-Here is a version of `split' in `awk'. It uses the `ord' and `chr'
-functions presented in *Note Ordinal Functions::.
+ Here is a version of `split' in `awk'. It uses the `ord' and `chr'
+functions presented in *note Ordinal Functions::.
-The program first sets its defaults, and then tests to make sure there
-are not too many arguments. It then looks at each argument in turn.
-The first argument could be a minus sign followed by a number. If it
-is, this happens to look like a negative number, so it is made
+ The program first sets its defaults, and then tests to make sure
+there are not too many arguments. It then looks at each argument in
+turn. The first argument could be a minus sign followed by a number.
+If it is, this happens to look like a negative number, so it is made
positive, and that is the count of lines. The data file name is
skipped over and the final argument is used as the prefix for the
output file names:
@@ -14912,12 +15059,13 @@ output file names:
out = (outfile s1 s2)
}
-The next rule does most of the work. `tcount' (temporary count) tracks
-how many lines have been printed to the output file so far. If it is
-greater than `count', it is time to close the current file and start a
-new one. `s1' and `s2' track the current suffixes for the file name. If
-they are both `z', the file is just too big. Otherwise, `s1' moves to
-the next letter in the alphabet and `s2' starts over again at `a':
+ The next rule does most of the work. `tcount' (temporary count)
+tracks how many lines have been printed to the output file so far. If
+it is greater than `count', it is time to close the current file and
+start a new one. `s1' and `s2' track the current suffixes for the file
+name. If they are both `z', the file is just too big. Otherwise, `s1'
+moves to the next letter in the alphabet and `s2' starts over again at
+`a':
{
if (++tcount > count) {
@@ -14950,10 +15098,10 @@ The `usage' function simply prints an error message and exits:
The variable `e' is used so that the function fits nicely on the screen.
-This program is a bit sloppy; it relies on `awk' to automatically close
-the last file instead of doing it in an `END' rule. It also assumes
-that letters are contiguous in the character set, which isn't true for
-EBCDIC systems.
+ This program is a bit sloppy; it relies on `awk' to automatically
+close the last file instead of doing it in an `END' rule. It also
+assumes that letters are contiguous in the character set, which isn't
+true for EBCDIC systems.

File: gawk.info, Node: Tee Program, Next: Uniq Program, Prev: Split Program, Up: Clones
@@ -14967,16 +15115,16 @@ files named on the command line. Its usage is as follows:
tee [-a] file ...
-The `-a' option tells `tee' to append to the named files, instead of
+ The `-a' option tells `tee' to append to the named files, instead of
truncating them and starting over.
-The `BEGIN' rule first makes a copy of all the command-line arguments
+ The `BEGIN' rule first makes a copy of all the command-line arguments
into an array named `copy'. `ARGV[0]' is not copied, since it is not
needed. `tee' cannot use `ARGV' directly, since `awk' attempts to
process each file name in `ARGV' as input data.
-If the first argument is `-a', then the flag variable `append' is set
-to true, and both `ARGV[1]' and `copy[1]' are deleted. If `ARGC' is
+ If the first argument is `-a', then the flag variable `append' is
+set to true, and both `ARGV[1]' and `copy[1]' are deleted. If `ARGC' is
less than two, then no file names were supplied and `tee' prints a
usage message and exits. Finally, `awk' is forced to read the standard
input by setting `ARGV[1]' to `"-"' and `ARGC' to two:
@@ -15001,7 +15149,7 @@ input by setting `ARGV[1]' to `"-"' and `ARGC' to two:
ARGC = 2
}
-The single rule does all the work. Since there is no pattern, it is
+ The single rule does all the work. Since there is no pattern, it is
executed for each line of input. The body of the rule simply prints the
line into each file on the command line, and then to the standard
output:
@@ -15031,7 +15179,7 @@ body, the `if' is only tested once for each input record. If there are
N input records and M output files, the first method only executes N
`if' statements, while the second executes N`*'M `if' statements.
-Finally, the `END' rule cleans up by closing all the output files:
+ Finally, the `END' rule cleans up by closing all the output files:
END \
{
@@ -15052,7 +15200,7 @@ usage is as follows:
uniq [-udc [-N]] [+N] [ INPUT FILE [ OUTPUT FILE ]]
-The options for `uniq' are:
+ The options for `uniq' are:
`-d'
Pnly print only repeated lines.
@@ -15081,14 +15229,14 @@ The options for `uniq' are:
The generated output is sent to the named output file, instead of
to the standard output.
-Normally `uniq' behaves as if both the `-d' and `-u' options are
+ Normally `uniq' behaves as if both the `-d' and `-u' options are
provided.
-`uniq' uses the `getopt' library function (*note Getopt Function::) and
-the `join' library function (*note Join Function::).
+ `uniq' uses the `getopt' library function (*note Getopt Function::)
+and the `join' library function (*note Join Function::).
-The program begins with a `usage' function and then a brief outline of
-the options and their meanings in a comment. The `BEGIN' rule deals
+ The program begins with a `usage' function and then a brief outline
+of the options and their meanings in a comment. The `BEGIN' rule deals
with the command-line arguments and options. It uses a trick to get
`getopt' to handle options of the form `-25', treating such an option
as the option letter `2' with an argument of `5'. If indeed two or more
@@ -15099,7 +15247,7 @@ then `Optarg' is not needed. In this case, `Optind' must be decremented
so that `getopt' processes it next time. This code is admittedly a bit
tricky.
-If no options are supplied, then the default is taken, to print both
+ If no options are supplied, then the default is taken, to print both
repeated and nonrepeated lines. The output file, if provided, is
assigned to `outputfile'. Early on, `outputfile' is initialized to the
standard output, `/dev/stdout':
@@ -15162,8 +15310,8 @@ standard output, `/dev/stdout':
}
}
-The following function, `are_equal', compares the current line, `$0',
-to the previous line, `last'. It handles skipping fields and
+ The following function, `are_equal', compares the current line,
+`$0', to the previous line, `last'. It handles skipping fields and
characters. If no field count and no character count are specified,
`are_equal' simply returns one or zero depending upon the result of a
simple string comparison of `last' and `$0'. Otherwise, things get more
@@ -15198,23 +15346,24 @@ and `are_equal' returns the result:
return (clast == cline)
}
-The following two rules are the body of the program. The first one is
-executed only for the very first line of data. It sets `last' equal to
-`$0', so that subsequent lines of text have something to be compared to.
+ The following two rules are the body of the program. The first one
+is executed only for the very first line of data. It sets `last' equal
+to `$0', so that subsequent lines of text have something to be compared
+to.
-The second rule does the work. The variable `equal' is one or zero,
+ The second rule does the work. The variable `equal' is one or zero,
depending upon the results of `are_equal''s comparison. If `uniq' is
counting repeated lines, and the lines are equal, then it increments
the `count' variable. Otherwise, it prints the line and resets `count',
since the two lines are not equal.
-If `uniq' is not counting, and if the lines are equal, `count' is
+ If `uniq' is not counting, and if the lines are equal, `count' is
incremented. Nothing is printed, since the point is to remove
duplicates. Otherwise, if `uniq' is counting repeated lines and more
than one line is seen, or if `uniq' is counting nonrepeated lines and
only one line is seen, then the line is printed, and `count' is reset.
-Finally, similar logic is used in the `END' rule to print the final
+ Finally, similar logic is used in the `END' rule to print the final
line of input data:
NR == 1 {
@@ -15266,10 +15415,10 @@ one or more input files. Its usage is as follows:
wc [-lwc] [ FILES ... ]
-If no files are specified on the command line, `wc' reads its standard
-input. If there are multiple files, it also prints total counts for all
-the files. The options and their meanings are shown in the following
-list:
+ If no files are specified on the command line, `wc' reads its
+standard input. If there are multiple files, it also prints total
+counts for all the files. The options and their meanings are shown in
+the following list:
`-l'
Count only lines.
@@ -15283,20 +15432,20 @@ list:
`-c'
Count only characters.
-Implementing `wc' in `awk' is particularly elegant, since `awk' does a
-lot of the work for us; it splits lines into words (i.e., fields) and
+ Implementing `wc' in `awk' is particularly elegant, since `awk' does
+a lot of the work for us; it splits lines into words (i.e., fields) and
counts them, it counts lines (i.e., records), and it can easily tell us
how long a line is.
-This uses the `getopt' library function (*note Getopt Function::) and
-the file-transition functions (*note Filetrans Function::).
+ This uses the `getopt' library function (*note Getopt Function::)
+and the file-transition functions (*note Filetrans Function::).
-This version has one notable difference from traditional versions of
+ This version has one notable difference from traditional versions of
`wc': it always prints the counts in the order lines, words, and
characters. Traditional versions note the order of the `-l', `-w', and
`-c' options on the command line, and print the counts in that order.
-The `BEGIN' rule does the argument processing. The variable
+ The `BEGIN' rule does the argument processing. The variable
`print_total' is true if more than one file is named on the command
line:
@@ -15332,8 +15481,8 @@ line:
print_total = (ARGC - i > 2)
}
-The `beginfile' function is simple; it just resets the counts of lines,
-words, and characters to zero, and saves the current file name in
+ The `beginfile' function is simple; it just resets the counts of
+lines, words, and characters to zero, and saves the current file name in
`fname':
function beginfile(file)
@@ -15342,7 +15491,7 @@ words, and characters to zero, and saves the current file name in
fname = FILENAME
}
-The `endfile' function adds the current file's numbers to the running
+ The `endfile' function adds the current file's numbers to the running
totals of lines, words, and characters.(1) It then prints out those
numbers for the file that was just read. It relies on `beginfile' to
reset the numbers for the following data file:
@@ -15361,10 +15510,10 @@ reset the numbers for the following data file:
printf "\t%s\n", fname
}
-There is one rule that is executed for each line. It adds the length of
-the record, plus one, to `chars'. Adding one plus the record length is
-needed because the newline character separating records (the value of
-`RS') is not part of the record itself, and thus not included in its
+ There is one rule that is executed for each line. It adds the length
+of the record, plus one, to `chars'. Adding one plus the record length
+is needed because the newline character separating records (the value
+of `RS') is not part of the record itself, and thus not included in its
length. Next, `lines' is incremented for each line read, and `words'
is incremented by the value of `NF', which is the number of "words" on
this line:
@@ -15376,7 +15525,7 @@ this line:
words += NF
}
-Finally, the `END' rule simply prints the totals for all the files:
+ Finally, the `END' rule simply prints the totals for all the files:
END {
if (print_total) {
@@ -15390,11 +15539,11 @@ Finally, the `END' rule simply prints the totals for all the files:
}
}
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) `wc' can't just use the value of `FNR' in `endfile'. If you examine
-the code in *Note Filetrans Function::, you will see that `FNR' has
-already been reset by the time `endfile' is called.
+ (1) `wc' can't just use the value of `FNR' in `endfile'. If you
+examine the code in *note Filetrans Function::, you will see that `FNR'
+has already been reset by the time `endfile' is called.

File: gawk.info, Node: Miscellaneous Programs, Prev: Clones, Up: Sample Programs
@@ -15432,13 +15581,13 @@ duplicate words. Typically you will see this in text as something like
the duplicated words occur at the end of one line and the beginning of
another, making them very difficult to spot.
-This program, `dupword.awk', scans through a file one line at a time
+ This program, `dupword.awk', scans through a file one line at a time
and looks for adjacent occurrences of the same word. It also saves the
last word on a line (in the variable `prev') for comparison with the
first word on the next line.
-The first two statements make sure that the line is all lowercase, so
-that, for example, "The" and "the" compare equal to each other. The
+ The first two statements make sure that the line is all lowercase,
+so that, for example, "The" and "the" compare equal to each other. The
next statement replaces nonalphanumeric and nonwhitespace characters
with spaces, so that punctuation does not affect the comparison either.
The characters are replaced with spaces so that formatting controls
@@ -15447,7 +15596,7 @@ don't create nonsense words (e.g., the Texinfo `@code{NF}' becomes
into fields, yielding just the actual words on the line, and ensuring
that there are no empty fields.
-If there are no fields left after removing all the punctuation, the
+ If there are no fields left after removing all the punctuation, the
current record is skipped. Otherwise, the program loops through each
word, comparing it to the previous one:
@@ -15477,16 +15626,16 @@ File: gawk.info, Node: Alarm Program, Next: Translate Program, Prev: Dupword
Nothing cures insomnia like a ringing alarm clock.
Arnold Robbins
-The following program is a simple "alarm clock" program. You give it a
-time of day and an optional message. At the specified time, it prints
-the message on the standard output. In addition, you can give it the
-number of times to repeat the message as well as a delay between
+ The following program is a simple "alarm clock" program. You give
+it a time of day and an optional message. At the specified time, it
+prints the message on the standard output. In addition, you can give it
+the number of times to repeat the message as well as a delay between
repetitions.
-This program uses the `gettimeofday' function from *Note Gettimeofday
-Function::.
+ This program uses the `gettimeofday' function from *note
+Gettimeofday Function::.
-All the work is done in the `BEGIN' rule. The first part is argument
+ All the work is done in the `BEGIN' rule. The first part is argument
checking and setting of defaults: the delay, the count, and the message
to print. If the user supplied a message without the ASCII BEL
character (known as the "alert" character, `"\a"'), then it is added to
@@ -15535,11 +15684,12 @@ Here is the program:
else if (index(message, "\a") == 0)
message = "\a" message "\a"
-The next minor node of code turns the alarm time into hours and minutes,
-converts it (if necessary) to a 24-hour clock, and then turns that time
-into a count of the seconds since midnight. Next it turns the current
-time into a count of seconds since midnight. The difference between
-the two is how long to wait before setting off the alarm:
+ The next minor node of code turns the alarm time into hours and
+minutes, converts it (if necessary) to a 24-hour clock, and then turns
+that time into a count of the seconds since midnight. Next it turns
+the current time into a count of seconds since midnight. The
+difference between the two is how long to wait before setting off the
+alarm:
# split up alarm time
split(ARGV[1], atime, ":")
@@ -15569,12 +15719,13 @@ the two is how long to wait before setting off the alarm:
exit 1
}
-Finally, the program uses the `system' function (*note I/O Functions::)
-to call the `sleep' utility. The `sleep' utility simply pauses for the
-given number of seconds. If the exit status is not zero, the program
-assumes that `sleep' was interrupted and exits. If `sleep' exited with
-an OK status (zero), then the program prints the message in a loop,
-again using `sleep' to delay for however many seconds are necessary:
+ Finally, the program uses the `system' function (*note I/O
+Functions::) to call the `sleep' utility. The `sleep' utility simply
+pauses for the given number of seconds. If the exit status is not zero,
+the program assumes that `sleep' was interrupted and exits. If `sleep'
+exited with an OK status (zero), then the program prints the message in
+a loop, again using `sleep' to delay for however many seconds are
+necessary:
# zzzzzz..... go away if interrupted
if (system(sprintf("sleep %d", naptime)) != 0)
@@ -15604,21 +15755,21 @@ processing:
GENERATE DATA | tr 'A-Z' 'a-z' | PROCESS DATA ...
-`tr' requires two lists of characters.(1) When processing the input,
-the first character in the first list is replaced with the first
+ `tr' requires two lists of characters.(1) When processing the
+input, the first character in the first list is replaced with the first
character in the second list, the second character in the first list is
replaced with the second character in the second list, and so on. If
there are more characters in the "from" list than in the "to" list, the
last character of the "to" list is used for the remaining characters in
the "from" list.
-Some time ago, a user proposed that a transliteration function should
+ Some time ago, a user proposed that a transliteration function should
be added to `gawk'. The following program was written to prove that
character transliteration could be done with a user-level function.
This program is not as complete as the system `tr' utility but it does
most of the job.
-The `translate' program demonstrates one of the few weaknesses of
+ The `translate' program demonstrates one of the few weaknesses of
standard `awk': dealing with individual characters is very painful,
requiring repeated use of the `substr', `index', and `gsub' built-in
functions (*note String Functions::).(2) There are two functions. The
@@ -15633,18 +15784,19 @@ first, `stranslate', takes three arguments:
`target'
The string on which to do the translation.
-Associative arrays make the translation part fairly easy. `t_ar' holds
-the "to" characters, indexed by the "from" characters. Then a simple
-loop goes through `from', one character at a time. For each character
-in `from', if the character appears in `target', `gsub' is used to
-change it to the corresponding `to' character.
+ Associative arrays make the translation part fairly easy. `t_ar'
+holds the "to" characters, indexed by the "from" characters. Then a
+simple loop goes through `from', one character at a time. For each
+character in `from', if the character appears in `target', `gsub' is
+used to change it to the corresponding `to' character.
-The `translate' function simply calls `stranslate' using `$0' as the
+ The `translate' function simply calls `stranslate' using `$0' as the
target. The main program sets two global variables, `FROM' and `TO',
from the command line, and then changes `ARGV' so that `awk' reads from
the standard input.
-Finally, the processing rule simply calls `translate' for each record:
+ Finally, the processing rule simply calls `translate' for each
+record:
# translate.awk --- do tr-like stuff
# Bugs: does not handle things like: tr A-Z a-z, it has
@@ -15690,7 +15842,7 @@ Finally, the processing rule simply calls `translate' for each record:
print
}
-While it is possible to do character transliteration in a user-level
+ While it is possible to do character transliteration in a user-level
function, it is not necessarily efficient, and we (the `gawk' authors)
started to consider adding a built-in function. However, shortly after
writing this program, we learned that the System V Release 4 `awk' had
@@ -15699,19 +15851,19 @@ These functions handle the vast majority of the cases where character
transliteration is necessary, and so we chose to simply add those
functions to `gawk' as well and then leave well enough alone.
-An obvious improvement to this program would be to set up the `t_ar'
+ An obvious improvement to this program would be to set up the `t_ar'
array only once, in a `BEGIN' rule. However, this assumes that the
"from" and "to" lists will never change throughout the lifetime of the
program.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) On some older System V systems, `tr' may require that the lists be
-written as range expressions enclosed in square brackets (`[a-z]') and
-quoted, to prevent the shell from attempting a file name expansion.
+ (1) On some older System V systems, `tr' may require that the lists
+be written as range expressions enclosed in square brackets (`[a-z]')
+and quoted, to prevent the shell from attempting a file name expansion.
This is not a feature.
-(2) This program was written before `gawk' acquired the ability to
+ (2) This program was written before `gawk' acquired the ability to
split each character in a string into separate array elements.

@@ -15726,25 +15878,25 @@ labels on it, 2 across and 10 down. The addresses are guaranteed to be
no more than 5 lines of data. Each address is separated from the next
by a blank line.
-The basic idea is to read 20 labels worth of data. Each line of each
-label is stored in the `line' array. The single rule takes care of
-filling the `line' array and printing the page when 20 labels have been
-read.
+ The basic idea is to read 20 labels worth of data. Each line of
+each label is stored in the `line' array. The single rule takes care
+of filling the `line' array and printing the page when 20 labels have
+been read.
-The `BEGIN' rule simply sets `RS' to the empty string, so that `awk'
+ The `BEGIN' rule simply sets `RS' to the empty string, so that `awk'
splits records at blank lines (*note Records::). It sets `MAXLINES' to
100, since 100 is the maximum number of lines on the page (20 * 5 =
100).
-Most of the work is done in the `printpage' function. The label lines
-are stored sequentially in the `line' array. But they have to print
-horizontally; `line[1]' next to `line[6]', `line[2]' next to `line[7]',
-and so on. Two loops are used to accomplish this. The outer loop,
-controlled by `i', steps through every 10 lines of data; this is each
-row of labels. The inner loop, controlled by `j', goes through the
-lines within the row. As `j' goes from 0 to 4, `i+j' is the `j'-th
-line in the row, and `i+j+5' is the entry next to it. The output ends
-up looking something like this:
+ Most of the work is done in the `printpage' function. The label
+lines are stored sequentially in the `line' array. But they have to
+print horizontally; `line[1]' next to `line[6]', `line[2]' next to
+`line[7]', and so on. Two loops are used to accomplish this. The
+outer loop, controlled by `i', steps through every 10 lines of data;
+this is each row of labels. The inner loop, controlled by `j', goes
+through the lines within the row. As `j' goes from 0 to 4, `i+j' is
+the `j'-th line in the row, and `i+j+5' is the entry next to it. The
+output ends up looking something like this:
line 1 line 6
line 2 line 7
@@ -15753,13 +15905,13 @@ up looking something like this:
line 5 line 10
...
-As a final note, an extra blank line is printed at lines 21 and 61, to
-keep the output lined up on the labels. This is dependent on the
+ As a final note, an extra blank line is printed at lines 21 and 61,
+to keep the output lined up on the labels. This is dependent on the
particular brand of labels in use when the program was written. You
will also note that there are 2 blank lines at the top and 2 blank
lines at the bottom.
-The `END' rule arranges to flush the final page of labels; there may
+ The `END' rule arranges to flush the final page of labels; there may
not have been an even multiple of 20 labels in the data:
# labels.awk --- print mailing labels
@@ -15814,9 +15966,9 @@ not have been an even multiple of 20 labels in the data:
printpage()
}
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) "Real world" is defined as "a program actually used to get
+ (1) "Real world" is defined as "a program actually used to get
something done."

@@ -15844,7 +15996,7 @@ program listing:
printf "%s\t%d\n", word, freq[word]
}
-This program has two rules. The first rule, because it has an empty
+ This program has two rules. The first rule, because it has an empty
pattern, is executed for every input line. It uses `awk''s
field-accessing mechanism (*note Fields::) to pick out the individual
words from the line, and the built-in variable `NF' (*note Built-in
@@ -15852,7 +16004,7 @@ Variables::) to know how many fields are available. For each input
word, it increments an element of the array `freq' to reflect that the
word has been seen an additional time.
-The second rule, because it has the pattern `END', is not executed
+ The second rule, because it has the pattern `END', is not executed
until the input has been exhausted. It prints out the contents of the
`freq' table that has been built up inside the first action. This
program has several problems that would prevent it from being useful by
@@ -15873,11 +16025,11 @@ itself on real text files:
likely to be interested in which words occur most frequently or in
having an alphabetized table of how frequently each word occurs.
-The way to solve these problems is to use some of `awk''s more advanced
-features. First, we use `tolower' to remove case distinctions. Next,
-we use `gsub' to remove punctuation characters. Finally, we use the
-system `sort' utility to process the output of the `awk' script. Here
-is the new version of the program:
+ The way to solve these problems is to use some of `awk''s more
+advanced features. First, we use `tolower' to remove case
+distinctions. Next, we use `gsub' to remove punctuation characters.
+Finally, we use the system `sort' utility to process the output of the
+`awk' script. Here is the new version of the program:
# wordfreq.awk --- print list of word frequencies
@@ -15894,8 +16046,8 @@ is the new version of the program:
printf "%s\t%d\n", word, freq[word]
}
-Assuming we have saved this program in a file named `wordfreq.awk', and
-that the data is in `file1', the following pipeline:
+ Assuming we have saved this program in a file named `wordfreq.awk',
+and that the data is in `file1', the following pipeline:
awk -f wordfreq.awk file1 | sort -k 2nr
@@ -15903,15 +16055,15 @@ produces a table of the words appearing in `file1' in order of
decreasing frequency. The `awk' program suitably massages the data and
produces a word frequency table, which is not ordered.
-The `awk' script's output is then sorted by the `sort' utility and
+ The `awk' script's output is then sorted by the `sort' utility and
printed on the terminal. The options given to `sort' specify a sort
that uses the second field of each input line (skipping one field),
that the sort keys should be treated as numeric quantities (otherwise
`15' would come before `5'), and that the sorting should be done in
descending (reverse) order.
-The `sort' could even be done from within the program, by changing the
-`END' action to:
+ The `sort' could even be done from within the program, by changing
+the `END' action to:
END {
sort = "sort -k 2nr"
@@ -15920,10 +16072,10 @@ The `sort' could even be done from within the program, by changing the
close(sort)
}
-This way of sorting must be used on systems that do not have true pipes
-at the command-line (or batch-file) level. See the general operating
-system documentation for more information on how to use the `sort'
-program.
+ This way of sorting must be used on systems that do not have true
+pipes at the command-line (or batch-file) level. See the general
+operating system documentation for more information on how to use the
+`sort' program.

File: gawk.info, Node: History Sorting, Next: Extract Program, Prev: Word Sorting, Up: Miscellaneous Programs
@@ -15934,15 +16086,15 @@ File: gawk.info, Node: History Sorting, Next: Extract Program, Prev: Word Sor
The `uniq' program (*note Uniq Program::), removes duplicate lines from
_sorted_ data.
-Suppose, however, you need to remove duplicate lines from a data file
-but that you want to preserve the order the lines are in. A good
+ Suppose, however, you need to remove duplicate lines from a data
+file but that you want to preserve the order the lines are in. A good
example of this might be a shell history file. The history file keeps
a copy of all the commands you have entered, and it is not unusual to
repeat a command several times in a row. Occasionally you might want
to compact the history by removing duplicate entries. Yet it is
desirable to maintain the order of the original commands.
-This simple program does the job. It uses two arrays. The `data'
+ This simple program does the job. It uses two arrays. The `data'
array is indexed by the text of each line. For each line, `data[$0]'
is incremented. If a particular line has not been seen before, then
`data[$0]' is zero. In this case, the text of the line is stored in
@@ -15962,13 +16114,14 @@ encountered. The `END' rule simply prints out the lines, in order:
print lines[i]
}
-This program also provides a foundation for generating other useful
+ This program also provides a foundation for generating other useful
information. For example, using the following `print' statement in the
`END' rule indicates how often a particular command is used:
print data[lines[i]], lines[i]
-This works because `data[$0]' is incremented each time a line is seen.
+ This works because `data[$0]' is incremented each time a line is
+seen.

File: gawk.info, Node: Extract Program, Next: Simple Sed, Prev: History Sorting, Up: Miscellaneous Programs
@@ -15976,7 +16129,7 @@ File: gawk.info, Node: Extract Program, Next: Simple Sed, Prev: History Sorti
13.3.7 Extracting Programs from Texinfo Source Files
----------------------------------------------------
-The nodes *Note Library Functions::, and *Note Sample Programs::, are
+The nodes *note Library Functions::, and *note Sample Programs::, are
the top level nodes for a large number of `awk' programs. If you want
to experiment with these programs, it is tedious to have to type them
in by hand. Here we present a program that can extract parts of a
@@ -15985,10 +16138,10 @@ Texinfo input file into separate files.
This Info file is written in Texinfo, the GNU project's document
formatting language. A single Texinfo source file can be used to
produce both printed and online documentation. The Texinfo language is
-described fully, starting with *Note Top::.
+described fully, starting with *note Top::.
-For our purposes, it is enough to know three things about Texinfo input
-files:
+ For our purposes, it is enough to know three things about Texinfo
+input files:
* The "at" symbol (`@') is special in Texinfo, much as the backslash
(`\') is in C or `awk'. Literal `@' symbols are represented in
@@ -16003,7 +16156,7 @@ files:
(Unfortunately, TeX isn't always smart enough to do things exactly
right, and we have to give it some help.)
-The following program, `extract.awk', reads through a Texinfo source
+ The following program, `extract.awk', reads through a Texinfo source
file and does two things, based on the special comments. Upon seeing
`@c system ...', it runs a command, by extracting the command text from
the control line and passing it on to the `system' function (*note I/O
@@ -16014,12 +16167,12 @@ rules in `extract.awk' match either `@c' or `@comment' by letting the
are simply removed. `extract.awk' uses the `join' library function
(*note Join Function::).
-The example programs in the online Texinfo source for `GAWK: Effective
-AWK Programming' (`gawk.texi') have all been bracketed inside `file' and
-`endfile' lines. The `gawk' distribution uses a copy of `extract.awk'
-to extract the sample programs and install many of them in a standard
-directory where `gawk' can find them. The Texinfo file looks something
-like this:
+ The example programs in the online Texinfo source for `GAWK:
+Effective AWK Programming' (`gawk.texi') have all been bracketed inside
+`file' and `endfile' lines. The `gawk' distribution uses a copy of
+`extract.awk' to extract the sample programs and install many of them
+in a standard directory where `gawk' can find them. The Texinfo file
+looks something like this:
...
This program has a @code{BEGIN} rule,
@@ -16040,10 +16193,10 @@ like this:
@end example
...
-`extract.awk' begins by setting `IGNORECASE' to one, so that mixed
+ `extract.awk' begins by setting `IGNORECASE' to one, so that mixed
upper- and lowercase letters in the directives won't matter.
-The first rule handles calling `system', checking that a command is
+ The first rule handles calling `system', checking that a command is
given (`NF' is at least three) and also checking that the command exits
with a zero exit status, signifying OK:
@@ -16071,32 +16224,33 @@ with a zero exit status, signifying OK:
The variable `e' is used so that the function fits nicely on the screen.
-The second rule handles moving data into files. It verifies that a
+ The second rule handles moving data into files. It verifies that a
file name is given in the directive. If the file named is not the
current file, then the current file is closed. Keeping the current file
open until a new file is encountered allows the use of the `>'
redirection for printing the contents, keeping open file management
simple.
-The `for' loop does the work. It reads lines using `getline' (*note
+ The `for' loop does the work. It reads lines using `getline' (*note
Getline::). For an unexpected end of file, it calls the
`unexpected_eof' function. If the line is an "endfile" line, then it
breaks out of the loop. If the line is an `@group' or `@end group'
line, then it ignores it and goes on to the next line. Similarly,
comments within examples are also ignored.
-Most of the work is in the following few lines. If the line has no `@'
-symbols, the program can print it directly. Otherwise, each leading
-`@' must be stripped off. To remove the `@' symbols, the line is split
-into separate elements of the array `a', using the `split' function
-(*note String Functions::). The `@' symbol is used as the separator
-character. Each element of `a' that is empty indicates two successive
-`@' symbols in the original line. For each two empty elements (`@@' in
-the original file), we have to add a single `@' symbol back in.
+ Most of the work is in the following few lines. If the line has no
+`@' symbols, the program can print it directly. Otherwise, each
+leading `@' must be stripped off. To remove the `@' symbols, the line
+is split into separate elements of the array `a', using the `split'
+function (*note String Functions::). The `@' symbol is used as the
+separator character. Each element of `a' that is empty indicates two
+successive `@' symbols in the original line. For each two empty
+elements (`@@' in the original file), we have to add a single `@'
+symbol back in.
-When the processing of the array is finished, `join' is called with the
-value of `SUBSEP', to rejoin the pieces back into a single line. That
-line is then printed to the output file:
+ When the processing of the array is finished, `join' is called with
+the value of `SUBSEP', to rejoin the pieces back into a single line.
+That line is then printed to the output file:
/^@c(omment)?[ \t]+file/ \
{
@@ -16138,15 +16292,15 @@ line is then printed to the output file:
}
}
-An important thing to note is the use of the `>' redirection. Output
-done with `>' only opens the file once; it stays open and subsequent
-output is appended to the file (*note Redirection::). This makes it
-easy to mix program text and explanatory prose for the same sample
-source file (as has been done here!) without any hassle. The file is
-only closed when a new data file name is encountered or at the end of
-the input file.
+ An important thing to note is the use of the `>' redirection.
+Output done with `>' only opens the file once; it stays open and
+subsequent output is appended to the file (*note Redirection::). This
+makes it easy to mix program text and explanatory prose for the same
+sample source file (as has been done here!) without any hassle. The
+file is only closed when a new data file name is encountered or at the
+end of the input file.
-Finally, the function `unexpected_eof' prints an appropriate error
+ Finally, the function `unexpected_eof' prints an appropriate error
message and then exits. The `END' rule handles the final cleanup,
closing the open file:
@@ -16176,15 +16330,15 @@ middle of a pipeline:
command1 < orig.data | sed 's/old/new/g' | command2 > result
-Here, `s/old/new/g' tells `sed' to look for the regexp `old' on each
+ Here, `s/old/new/g' tells `sed' to look for the regexp `old' on each
input line and globally replace it with the text `new', i.e., all the
occurrences on a line. This is similar to `awk''s `gsub' function
(*note String Functions::).
-The following program, `awksed.awk', accepts at least two command-line
-arguments: the pattern to look for and the text to replace it with. Any
-additional arguments are treated as data file names to process. If none
-are provided, the standard input is used:
+ The following program, `awksed.awk', accepts at least two
+command-line arguments: the pattern to look for and the text to replace
+it with. Any additional arguments are treated as data file names to
+process. If none are provided, the standard input is used:
# awksed.awk --- do s/foo/bar/g using just print
# Thanks to Michael Brennan for the idea
@@ -16214,32 +16368,32 @@ are provided, the standard input is used:
print
}
-The program relies on `gawk''s ability to have `RS' be a regexp, as
+ The program relies on `gawk''s ability to have `RS' be a regexp, as
well as on the setting of `RT' to the actual text that terminates the
record (*note Records::).
-The idea is to have `RS' be the pattern to look for. `gawk'
+ The idea is to have `RS' be the pattern to look for. `gawk'
automatically sets `$0' to the text between matches of the pattern.
This is text that we want to keep, unmodified. Then, by setting `ORS'
to the replacement text, a simple `print' statement outputs the text we
want to keep, followed by the replacement text.
-There is one wrinkle to this scheme, which is what to do if the last
+ There is one wrinkle to this scheme, which is what to do if the last
record doesn't end with text that matches `RS'. Using a `print'
statement unconditionally prints the replacement text, which is not
correct. However, if the file did not end in text that matches `RS',
`RT' is set to the null string. In this case, we can print `$0' using
`printf' (*note Printf::).
-The `BEGIN' rule handles the setup, checking for the right number of
+ The `BEGIN' rule handles the setup, checking for the right number of
arguments and calling `usage' if there is a problem. Then it sets `RS'
and `ORS' from the command-line arguments and sets `ARGV[1]' and
`ARGV[2]' to the null string, so that they are not treated as file names
(*note ARGC and ARGV::).
-The `usage' function prints an error message and exits. Finally, the
-single rule handles the printing scheme outlined above, using `print'
-or `printf' as appropriate, depending upon the value of `RT'.
+ The `usage' function prints an error message and exits. Finally,
+the single rule handles the printing scheme outlined above, using
+`print' or `printf' as appropriate, depending upon the value of `RT'.

File: gawk.info, Node: Igawk Program, Prev: Simple Sed, Up: Miscellaneous Programs
@@ -16268,19 +16422,19 @@ able to write programs in the following manner:
...
}
-The following program, `igawk.sh', provides this service. It simulates
-`gawk''s searching of the `AWKPATH' variable and also allows "nested"
-includes; i.e., a file that is included with `@include' can contain
-further `@include' statements. `igawk' makes an effort to only include
-files once, so that nested includes don't accidentally include a
-library function twice.
+ The following program, `igawk.sh', provides this service. It
+simulates `gawk''s searching of the `AWKPATH' variable and also allows
+"nested" includes; i.e., a file that is included with `@include' can
+contain further `@include' statements. `igawk' makes an effort to only
+include files once, so that nested includes don't accidentally include
+a library function twice.
-`igawk' should behave just like `gawk' externally. This means it
+ `igawk' should behave just like `gawk' externally. This means it
should accept all of `gawk''s command-line arguments, including the
ability to have multiple source files specified via `-f', and the
ability to mix command-line and library source files.
-The program is written using the POSIX Shell (`sh') command
+ The program is written using the POSIX Shell (`sh') command
language.(1) It works as follows:
1. Loop through the arguments, saving anything that doesn't represent
@@ -16306,18 +16460,18 @@ language.(1) It works as follows:
command-line arguments that the user supplied (such as the data
file names).
-This program uses shell variables extensively; for storing command line
-arguments, the text of the `awk' program that will expand the user's
-program, for the user's original program, and for the expanded program.
-Doing so removes some potential problems that might arise were we to
-use temporary files instead, at the cost of making the script somewhat
-more complicated.
+ This program uses shell variables extensively; for storing command
+line arguments, the text of the `awk' program that will expand the
+user's program, for the user's original program, and for the expanded
+program. Doing so removes some potential problems that might arise
+were we to use temporary files instead, at the cost of making the
+script somewhat more complicated.
-The initial part of the program turns on shell tracing if the first
+ The initial part of the program turns on shell tracing if the first
argument is `debug'.
-The next part loops through all the command-line arguments. There are
-several cases of interest:
+ The next part loops through all the command-line arguments. There
+are several cases of interest:
`--'
This ends the arguments to `igawk'. Anything else should be
@@ -16349,7 +16503,7 @@ several cases of interest:
`igawk' prints its version number, runs `gawk --version' to get
the `gawk' version information, and then exits.
-If none of the `-f', `--file', `-Wfile', `--source', or `-Wsource'
+ If none of the `-f', `--file', `-Wfile', `--source', or `-Wsource'
arguments are supplied, then the first nonoption argument should be the
`awk' program. If there are no command-line arguments left, `igawk'
prints an error message and exits. Otherwise, the first argument is
@@ -16357,7 +16511,7 @@ appended to `program'. In any case, after the arguments have been
processed, `program' contains the complete text of the original `awk'
program.
-The program is as follows:
+ The program is as follows:
#! /bin/sh
# igawk --- like gawk but do @include processing
@@ -16367,7 +16521,7 @@ The program is as follows:
shift
fi
- # A literal newline, so that program text is formmatted correctly
+ # A literal newline, so that program text is formatted correctly
n='
'
@@ -16433,7 +16587,7 @@ The program is as follows:
# At this point, `program' has the program.
-The `awk' program to process `@include' directives is stored in the
+ The `awk' program to process `@include' directives is stored in the
shell variable `expand_prog'. Doing this keeps the shell script
readable. The `awk' program reads through the user's program, one line
at a time, using `getline' (*note Getline::). The input file names and
@@ -16444,8 +16598,8 @@ As each file is finished, the stack is "popped," and the previous input
file becomes the current input file again. The process is started by
making the original file the first one on the stack.
-The `pathto' function does the work of finding the full path to a file.
-It simulates `gawk''s behavior when searching the `AWKPATH'
+ The `pathto' function does the work of finding the full path to a
+file. It simulates `gawk''s behavior when searching the `AWKPATH'
environment variable (*note AWKPATH Variable::). If a file name has a
`/' in it, no path search is done. Otherwise, the file name is
concatenated with the name of each directory in the path, and an
@@ -16472,8 +16626,8 @@ is closed and the file name is returned:
return ""
}
-The main program is contained inside one `BEGIN' rule. The first thing
-it does is set up the `pathlist' array that `pathto' uses. After
+ The main program is contained inside one `BEGIN' rule. The first
+thing it does is set up the `pathlist' array that `pathto' uses. After
splitting the path on `:', null elements are replaced with `"."', which
represents the current directory:
@@ -16485,22 +16639,22 @@ represents the current directory:
pathlist[i] = "."
}
-The stack is initialized with `ARGV[1]', which will be `/dev/stdin'.
+ The stack is initialized with `ARGV[1]', which will be `/dev/stdin'.
The main loop comes next. Input lines are read in succession. Lines
that do not start with `@include' are printed verbatim. If the line
does start with `@include', the file name is in `$2'. `pathto' is
called to generate the full path. If it cannot, then we print an error
message and continue.
-The next thing to check is if the file is included already. The
+ The next thing to check is if the file is included already. The
`processed' array is indexed by the full file name of each included
file and it tracks this information for us. If the file is seen again,
a warning message is printed. Otherwise, the new file name is pushed
onto the stack and processing continues.
-Finally, when `getline' encounters the end of the input file, the file
-is closed and the stack is popped. When `stackptr' is less than zero,
-the program is done:
+ Finally, when `getline' encounters the end of the input file, the
+file is closed and the stack is popped. When `stackptr' is less than
+zero, the program is done:
stackptr = 0
input[stackptr] = ARGV[1] # ARGV[1] is first file
@@ -16534,18 +16688,18 @@ the program is done:
EOF
`
-The shell construct `COMMAND << MARKER' is called a "here document".
+ The shell construct `COMMAND << MARKER' is called a "here document".
Everything in the shell script up to the MARKER is fed to COMMAND as
input. The shell processes the contents of the here document for
variable and command substitution (and possibly other things as well,
depending upon the shell).
-The shell construct ``...`' is called "command substitution". The
+ The shell construct ``...`' is called "command substitution". The
output of the command between the two backquotes (grave accents) is
substituted into the command line. It is saved as a single string,
even if the results contain whitespace.
-The expanded program is saved in the variable `processed_program'.
+ The expanded program is saved in the variable `processed_program'.
It's done in these steps:
1. Run `gawk' with the `@include'-processing program (the value of
@@ -16558,15 +16712,16 @@ It's done in these steps:
3. The results of this processing are saved in the shell variable
`processed_program' by using command substitution.
-The last step is to call `gawk' with the expanded program, along with
-the original options and command-line arguments that the user supplied.
+ The last step is to call `gawk' with the expanded program, along
+with the original options and command-line arguments that the user
+supplied.
eval gawk $opts -- '"$processed_program"' '"$@"'
-The `eval' command is a shell construct that reruns the shell's parsing
-process. This keeps things properly quoted.
+ The `eval' command is a shell construct that reruns the shell's
+parsing process. This keeps things properly quoted.
-This version of `igawk' represents my fourth attempt at this program.
+ This version of `igawk' represents my fourth attempt at this program.
There are four key simplifications that make the program work better:
* Using `@include' even for the files named with `-f' makes building
@@ -16587,19 +16742,19 @@ There are four key simplifications that make the program work better:
more features of the `sh' language, making it harder to follow for
those who aren't familiar with `sh'.
-Also, this program illustrates that it is often worthwhile to combine
+ Also, this program illustrates that it is often worthwhile to combine
`sh' and `awk' programming together. You can usually accomplish quite
a lot, without having to resort to low-level programming in C or C++,
and it is frequently easier to do certain kinds of string and argument
manipulation using the shell than it is in `awk'.
-Finally, `igawk' shows that it is not always necessary to add new
+ Finally, `igawk' shows that it is not always necessary to add new
features to a program; they can often be layered on top. With `igawk',
there is no real reason to build `@include' processing into `gawk'
itself.
-As an additional example of this, consider the idea of having two files
-in a directory in the search path:
+ As an additional example of this, consider the idea of having two
+files in a directory in the search path:
`default.awk'
This file contains a set of default library functions, such as
@@ -16612,20 +16767,20 @@ in a directory in the search path:
releases, without requiring the system administrator to update it
each time by adding the local functions.
-One user suggested that `gawk' be modified to automatically read these
-files upon startup. Instead, it would be very simple to modify `igawk'
-to do this. Since `igawk' can process nested `@include' directives,
-`default.awk' could simply contain `@include' statements for the
-desired library functions.
+ One user suggested that `gawk' be modified to automatically read
+these files upon startup. Instead, it would be very simple to modify
+`igawk' to do this. Since `igawk' can process nested `@include'
+directives, `default.awk' could simply contain `@include' statements
+for the desired library functions.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Fully explaining the `sh' language is beyond the scope of this
+ (1) Fully explaining the `sh' language is beyond the scope of this
book. We provide some minimal explanations, but see a good shell
programming book if you wish to understand things in more depth.
-(2) On some very old versions of `awk', the test `getline junk < t' can
-loop forever if the file exists but is empty. Caveat emptor.
+ (2) On some very old versions of `awk', the test `getline junk < t'
+can loop forever if the file exists but is empty. Caveat emptor.

File: gawk.info, Node: Language History, Next: Installation, Prev: Sample Programs, Up: Top
@@ -16689,9 +16844,14 @@ the changes, with cross-references to further details:
* The `ARGC', `ARGV', `FNR', `RLENGTH', `RSTART', and `SUBSEP'
built-in variables (*note Built-in Variables::).
+ * Assignable `$0'.
+
* The conditional expression using the ternary operator `?:' (*note
Conditional Exp::).
+ * The expression `INDEX in ARRAY' outside of `for' statements (*note
+ Reference to Elements::).
+
* The exponentiation operator `^' (*note Arithmetic Ops::) and its
assignment operator form `^=' (*note Assignment Ops::).
@@ -16699,7 +16859,8 @@ the changes, with cross-references to further details:
programs (*note Precedence::).
* Regexps as the value of `FS' (*note Field Separators::) and as the
- third argument to the `split' function (*note String Functions::).
+ third argument to the `split' function (*note String Functions::),
+ rather than using only the first character of `FS'.
* Dynamic regexps as operands of the `~' and `!~' operators (*note
Regexp Usage::).
@@ -16777,7 +16938,8 @@ introduced the following changes into the language:
* More complete documentation of many of the previously undocumented
features of the language.
-The following common extensions are not permitted by the POSIX standard:
+ The following common extensions are not permitted by the POSIX
+standard:
* `\x' escape sequences are not recognized (*note Escape
Sequences::).
@@ -16792,11 +16954,14 @@ The following common extensions are not permitted by the POSIX standard:
(*note Definition Syntax::).
* The operators `**' and `**=' cannot be used in place of `^' and
- `^=' (*note Arithmetic Ops::, and *Note Assignment Ops::).
+ `^=' (*note Arithmetic Ops::, and *note Assignment Ops::).
* Specifying `-Ft' on the command line does not set the value of
`FS' to be a single TAB character (*note Field Separators::).
+ * The locale's decimal point character is used for parsing input
+ data (*note Locales::).
+
* The `fflush' built-in function is not supported (*note I/O
Functions::).
@@ -16820,15 +16985,15 @@ POSIX `awk':
* The `fflush' built-in function for flushing buffered output (*note
I/O Functions::).
- * The `**' and `**=' operators (*note Arithmetic Ops:: and *Note
+ * The `**' and `**=' operators (*note Arithmetic Ops:: and *note
Assignment Ops::).
* The use of `func' as an abbreviation for `function' (*note
Definition Syntax::).
-The Bell Laboratories `awk' also incorporates the following extensions,
-originally developed for `gawk':
+ The Bell Laboratories `awk' also incorporates the following
+extensions, originally developed for `gawk':
* The `\x' escape sequence (*note Escape Sequences::).
@@ -16854,7 +17019,7 @@ minor node lists them in the order they were added to `gawk'. They can
all be disabled with either the `--traditional' or `--posix' options
(*note Options::).
-Version 2.10 of `gawk' introduced the following features:
+ Version 2.10 of `gawk' introduced the following features:
* The `AWKPATH' environment variable for specifying a path search for
the `-f' command-line option (*note Options::).
@@ -16865,7 +17030,7 @@ Version 2.10 of `gawk' introduced the following features:
* The `/dev/stdin', `/dev/stdout', `/dev/stderr' and `/dev/fd/N'
special file names (*note Special Files::).
-Version 2.13 of `gawk' introduced the following features:
+ Version 2.13 of `gawk' introduced the following features:
* The `FIELDWIDTHS' variable and its effects (*note Constant Size::).
@@ -16880,12 +17045,12 @@ Version 2.13 of `gawk' introduced the following features:
* The `-W posix' option for full POSIX compliance (*note Options::).
-Version 2.14 of `gawk' introduced the following feature:
+ Version 2.14 of `gawk' introduced the following feature:
* The `next file' statement for skipping to the next data file
(*note Nextfile Statement::).
-Version 2.15 of `gawk' introduced the following features:
+ Version 2.15 of `gawk' introduced the following features:
* The `ARGIND' variable, which tracks the movement of `FILENAME'
through `ARGV' (*note Built-in Variables::).
@@ -16905,7 +17070,7 @@ Version 2.15 of `gawk' introduced the following features:
* The `--source' option for mixing command-line and library-file
source code (*note Options::).
-Version 3.0 of `gawk' introduced the following features:
+ Version 3.0 of `gawk' introduced the following features:
* `IGNORECASE' changed, now applying to string comparison as well as
regexp operations (*note Case-sensitivity::).
@@ -16949,7 +17114,7 @@ Version 3.0 of `gawk' introduced the following features:
* Amiga support (*note Amiga Installation::).
-Version 3.1 of `gawk' introduced the following features:
+ Version 3.1 of `gawk' introduced the following features:
* The `BINMODE' special variable for non-POSIX systems, which allows
binary I/O for input and/or output files (*note PC Using::).
@@ -16962,7 +17127,7 @@ Version 3.1 of `gawk' introduced the following features:
* The `TEXTDOMAIN' special variable for setting an application's
internationalization text domain (*note Built-in Variables::, and
- *Note Internationalization::).
+ *note Internationalization::).
* The ability to use octal and hexadecimal constants in `awk'
program source code (*note Nondecimal-numbers::).
@@ -17015,10 +17180,17 @@ Version 3.1 of `gawk' introduced the following features:
`gawk', for producing execution profiles of `awk' programs (*note
Profiling::).
+ * The `--use-lc-numeric' option to force `gawk' to use the locale's
+ decimal point for parsing input data (*note Conversion::).
+
* The `--enable-portals' configuration option to enable special
treatment of pathnames that begin with `/p' as BSD portals (*note
Portal Files::).
+ * The `--disable-directories-fatal' configuration option which
+ causes `gawk' to silently skip directories named on the command
+ line (*note Additional Configuration Options::).
+
* The use of GNU Automake to help in standardizing the configuration
process (*note Quick Installation::).
@@ -17040,12 +17212,15 @@ Version 3.1 of `gawk' introduced the following features:
* POSIX compliance for `sub' and `gsub' (*note Gory Details::).
- * The `--exec' option, for use in CGI scripts. (*note Options::).
+ * The `--exec' option, for use in CGI scripts (*note Options::).
* The `length' function was extended to accept an array argument and
return the number of elements in the array (*note String
Functions::).
+ * The `strftime' function acquired a third argument to enable
+ printing times as UTC (*note Time Functions::).
+

File: gawk.info, Node: Contributors, Prev: POSIX/GNU, Up: Language History
@@ -17056,7 +17231,7 @@ A.6 Major Contributors to `gawk'
Always give credit where credit is due.
Anonymous
-This minor node names the major contributors to `gawk' and/or this
+ This minor node names the major contributors to `gawk' and/or this
Info file, in approximate chronological order:
* Dr. Alfred V. Aho, Dr. Peter J. Weinberger, and Dr. Brian W.
@@ -17115,8 +17290,9 @@ Info file, in approximate chronological order:
networking code and documentation, and motivated the inclusion of
the `|&' operator.
- * Stephen Davies provided the port to Tandem systems and its
- documentation.
+ * Stephen Davies provided the initial port to Tandem systems and its
+ documentation. Matthew Woehlke provided improvements for Tandem's
+ POSIX-compliant systems.
* Martin Brown provided the port to BeOS and its documentation.
@@ -17208,8 +17384,8 @@ There are three ways to get GNU software:
* Retrieve `gawk' by using anonymous `ftp' to the Internet host
`ftp.gnu.org', in the directory `/gnu/gawk'.
-The GNU software archive is mirrored around the world. The up-to-date
-list of mirror sites is available from the main FSF web site
+ The GNU software archive is mirrored around the world. The
+up-to-date list of mirror sites is available from the main FSF web site
(http://www.gnu.org/order/ftp.html). Try to use one of the mirrors;
they will be less busy, and you can usually find one closer to your
site.
@@ -17223,20 +17399,20 @@ B.1.2 Extracting the Distribution
`gawk' is distributed as a `tar' file compressed with the GNU Zip
program, `gzip'.
-Once you have the distribution (for example, `gawk-3.1.5.tar.gz'), use
-`gzip' to expand the file and then use `tar' to extract it. You can
-use the following pipeline to produce the `gawk' distribution:
+ Once you have the distribution (for example, `gawk-3.1.6.tar.gz'),
+use `gzip' to expand the file and then use `tar' to extract it. You
+can use the following pipeline to produce the `gawk' distribution:
# Under System V, add 'o' to the tar options
- gzip -d -c gawk-3.1.5.tar.gz | tar -xvpf -
+ gzip -d -c gawk-3.1.6.tar.gz | tar -xvpf -
-This creates a directory named `gawk-3.1.5' in the current directory.
+This creates a directory named `gawk-3.1.6' in the current directory.
-The distribution file name is of the form `gawk-V.R.P.tar.gz'. The V
-represents the major version of `gawk', the R represents the current
+ The distribution file name is of the form `gawk-V.R.P.tar.gz'. The
+V represents the major version of `gawk', the R represents the current
release of version V, and the P represents a "patch level", meaning
that minor bugs have been fixed in the release. The current patch
-level is 5, but when retrieving distributions, you should get the
+level is 6, but when retrieving distributions, you should get the
version with the highest version, release, and patch level. (Note,
however, that patch levels greater than or equal to 80 denote "beta" or
nonproduction software; you might not want to retrieve such a version
@@ -17330,7 +17506,7 @@ Various `.c', `.y', and `.h' files
`doc/igawk.1'
The `troff' source for a manual page describing the `igawk'
- program presented in *Note Igawk Program::.
+ program presented in *note Igawk Program::.
`doc/Makefile.in'
The input file used during the configuration process to generate
@@ -17352,7 +17528,7 @@ Various `.c', `.y', and `.h' files
`missing_d/*'
`m4/*'
These files and subdirectories are used when configuring `gawk'
- for various Unix systems. They are explained in *Note Unix
+ for various Unix systems. They are explained in *note Unix
Installation::.
`po/*'
@@ -17367,8 +17543,8 @@ Various `.c', `.y', and `.h' files
programs from the Texinfo source file for this Info file. It also
contains a `Makefile.in' file, which `configure' uses to generate
a `Makefile'. `Makefile.am' is used by GNU Automake to create
- `Makefile.in'. The library functions from *Note Library
- Functions::, and the `igawk' program from *Note Igawk Program::,
+ `Makefile.in'. The library functions from *note Library
+ Functions::, and the `igawk' program from *note Igawk Program::,
are included as ready-to-use files in the `gawk' distribution.
They are installed as part of the installation process. The rest
of the programs in this Info file are available in appropriate
@@ -17422,30 +17598,32 @@ B.2.1 Compiling `gawk' for Unix
-------------------------------
After you have extracted the `gawk' distribution, `cd' to
-`gawk-3.1.5'. Like most GNU software, `gawk' is configured
+`gawk-3.1.6'. Like most GNU software, `gawk' is configured
automatically for your Unix system by running the `configure' program.
This program is a Bourne shell script that is generated automatically
using GNU `autoconf'. (The `autoconf' software is described fully
-starting with *Note Top::.)
+starting with *note Top::.)
-To configure `gawk', simply run `configure':
+ To configure `gawk', simply run `configure':
sh ./configure
-This produces a `Makefile' and `config.h' tailored to your system. The
-`config.h' file describes various facts about your system. You might
-want to edit the `Makefile' to change the `CFLAGS' variable, which
-controls the command-line options that are passed to the C compiler
-(such as optimization levels or compiling for debugging).
+ This produces a `Makefile' and `config.h' tailored to your system.
+The `config.h' file describes various facts about your system. You
+might want to edit the `Makefile' to change the `CFLAGS' variable,
+which controls the command-line options that are passed to the C
+compiler (such as optimization levels or compiling for debugging).
-Alternatively, you can add your own values for most `make' variables on
-the command line, such as `CC' and `CFLAGS', when running `configure':
+ Alternatively, you can add your own values for most `make' variables
+on the command line, such as `CC' and `CFLAGS', when running
+`configure':
CC=cc CFLAGS=-g sh ./configure
See the file `INSTALL' in the `gawk' distribution for all the details.
-After you have run `configure' and possibly edited the `Makefile', type:
+ After you have run `configure' and possibly edited the `Makefile',
+type:
make
@@ -17494,9 +17672,13 @@ command line when compiling `gawk' from scratch, including:
desirable, but it may bring you some slight performance
improvement.
-As of version 3.1.5, the `--with-included-gettext' configuration option
-is no longer available, since `gawk' expects the GNU `gettext' library
-to be installed as an external library.
+`--disable-directories-fatal'
+ Causes `gawk' to silently skip directories named on the command
+ line.
+
+ As of version 3.1.5, the `--with-included-gettext' configuration
+option is no longer available, since `gawk' expects the GNU `gettext'
+library to be installed as an external library.

File: gawk.info, Node: Configuration Philosophy, Prev: Additional Configuration Options, Up: Unix Installation
@@ -17507,19 +17689,19 @@ B.2.3 The Configuration Process
This minor node is of interest only if you know something about using
the C language and the Unix operating system.
-The source code for `gawk' generally attempts to adhere to formal
+ The source code for `gawk' generally attempts to adhere to formal
standards wherever possible. This means that `gawk' uses library
routines that are specified by the ISO C standard and by the POSIX
operating system interface standard. When using an ISO C compiler,
function prototypes are used to help improve the compile-time checking.
-Many Unix systems do not support all of either the ISO or the POSIX
+ Many Unix systems do not support all of either the ISO or the POSIX
standards. The `missing_d' subdirectory in the `gawk' distribution
contains replacement versions of those functions that are most likely
to be missing.
-The `config.h' file that `configure' creates contains definitions that
-describe features of the particular operating system where you are
+ The `config.h' file that `configure' creates contains definitions
+that describe features of the particular operating system where you are
attempting to compile `gawk'. The three things described by this file
are: what header files are available, so that they can be correctly
included, what (supposedly) standard functions are actually available
@@ -17527,15 +17709,15 @@ in your C libraries, and various miscellaneous facts about your variant
of Unix. For example, there may not be an `st_blksize' element in the
`stat' structure. In this case, `HAVE_ST_BLKSIZE' is undefined.
-It is possible for your C compiler to lie to `configure'. It may do so
-by not exiting with an error when a library function is not available.
-To get around this, edit the file `custom.h'. Use an `#ifdef' that is
-appropriate for your system, and either `#define' any constants that
-`configure' should have defined but didn't, or `#undef' any constants
-that `configure' defined and should not have. `custom.h' is
-automatically included by `config.h'.
+ It is possible for your C compiler to lie to `configure'. It may do
+so by not exiting with an error when a library function is not
+available. To get around this, edit the file `custom.h'. Use an
+`#ifdef' that is appropriate for your system, and either `#define' any
+constants that `configure' should have defined but didn't, or `#undef'
+any constants that `configure' defined and should not have. `custom.h'
+is automatically included by `config.h'.
-It is also possible that the `configure' program generated by
+ It is also possible that the `configure' program generated by
`autoconf' will not work on your system in some other fashion. If you
do have a problem, the file `configure.in' is the input for `autoconf'.
You may be able to change this file and generate a new version of
@@ -17572,7 +17754,7 @@ the directory `pub/ade/current'. This includes a shell based on
`pdksh'. The primary component of this environment is a Unix emulation
library, `ixemul.lib'.
-A more complete distribution for the Amiga is available on the Geek
+ A more complete distribution for the Amiga is available on the Geek
Gadgets CD-ROM, available from:
CRONUS
@@ -17585,13 +17767,13 @@ Gadgets CD-ROM, available from:
WWW: `http://www.ninemoons.com'
Anonymous `ftp' site: `ftp.ninemoons.com'
-Once you have the distribution, you can configure `gawk' simply by
+ Once you have the distribution, you can configure `gawk' simply by
running `configure':
configure -v m68k-amigaos
-Then run `make' and you should be all set! If these steps do not work,
-please send in a bug report (*note Bugs::).
+ Then run `make' and you should be all set! If these steps do not
+work, please send in a bug report (*note Bugs::).

File: gawk.info, Node: BeOS Installation, Next: PC Installation, Prev: Amiga Installation, Up: Non-Unix Installation
@@ -17604,24 +17786,24 @@ included with BeOS. The process is basically identical to the Unix
process of running `configure' and then `make'. Full instructions are
given below.
-You can compile `gawk' under BeOS by extracting the standard sources
+ You can compile `gawk' under BeOS by extracting the standard sources
and running `configure'. You _must_ specify the location prefix for the
installation directory. For BeOS DR9 and beyond, the best directory to
use is `/boot/home/config', so the `configure' command is:
configure --prefix=/boot/home/config
-This installs the compiled application into `/boot/home/config/bin',
+ This installs the compiled application into `/boot/home/config/bin',
which is already specified in the standard `PATH'.
-Once the configuration process is completed, you can run `make', and
+ Once the configuration process is completed, you can run `make', and
then `make install':
$ make
...
$ make install
-BeOS uses `bash' as its shell; thus, you use `gawk' the same way you
+ BeOS uses `bash' as its shell; thus, you use `gawk' the same way you
would under Unix. If these steps do not work, please send in a bug
report (*note Bugs::).
@@ -17635,8 +17817,8 @@ This minor node covers installation and usage of `gawk' on x86 machines
running DOS, any version of Windows, or OS/2. In this minor node, the
term "Windows32" refers to any of Windows-95/98/ME/NT/2000.
-The limitations of DOS (and DOS shells under Windows or OS/2) has meant
-that various "DOS extenders" are often used with programs such as
+ The limitations of DOS (and DOS shells under Windows or OS/2) has
+meant that various "DOS extenders" are often used with programs such as
`gawk'. The varying capabilities of Microsoft Windows 3.1 and
Windows32 can add to the confusion. For an overview of the
considerations, please refer to `README_d/README.pc' in the
@@ -17668,11 +17850,11 @@ files can be installed anywhere provided `AWKPATH' is set properly.
Regardless of the installation directory, the first line of `igawk.cmd'
and `igawk.bat' (in `gnu/bin') may need to be edited.
-The binary distribution contains a separate file describing the
+ The binary distribution contains a separate file describing the
contents. In particular, it may include more than one version of the
`gawk' executable.
-OS/2 (32 bit, EMX) binary distributions are prepared for the `/usr'
+ OS/2 (32 bit, EMX) binary distributions are prepared for the `/usr'
directory of your preferred drive. Set `UNIXROOT' to your installation
drive (e.g., `e:') if you want to install `gawk' onto another drive
than the hardcoded default `c:'. Executables appear in `/usr/bin',
@@ -17685,10 +17867,10 @@ commands at your prompt (replace `x:' by your installation drive):
install-info --info-dir=x:/usr/info x:/usr/info/gawk.info
install-info --info-dir=x:/usr/info x:/usr/info/gawkinet.info
-However, the files can be installed anywhere provided `AWKPATH' is set
-properly.
+ However, the files can be installed anywhere provided `AWKPATH' is
+set properly.
-The binary distribution may contain a separate file containing
+ The binary distribution may contain a separate file containing
additional or more detailed installation instructions.

@@ -17707,38 +17889,38 @@ it.) The file `README_d/README.pc' in the `gawk' distribution contains
additional notes, and `pc/Makefile' contains important information on
compilation options.
-To build `gawk' for MS-DOS, Windows32, and OS/2 (16 bit only; for 32 bit
-(EMX) you can use the `configure' script and skip the following
+ To build `gawk' for MS-DOS, Windows32, and OS/2 (16 bit only; for 32
+bit (EMX) you can use the `configure' script and skip the following
paragraphs; for details see below), copy the files in the `pc'
directory (_except_ for `ChangeLog') to the directory with the rest of
the `gawk' sources. The `Makefile' contains a configuration section
with comments and may need to be edited in order to work with your
`make' utility.
-The `Makefile' contains a number of targets for building various MS-DOS,
-Windows32, and OS/2 versions. A list of targets is printed if the `make'
-command is given without a target. As an example, to build `gawk' using
-the DJGPP tools, enter `make djgpp'. (The DJGPP tools may be found at
-`ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/'.)
-
-Using `make' to run the standard tests and to install `gawk' requires
-additional Unix-like tools, including `sh', `sed', and `cp'. In order
-to run the tests, the `test/*.ok' files may need to be converted so
-that they have the usual DOS-style end-of-line markers. Most of the
-tests work properly with Stewartson's shell along with the companion
-utilities or appropriate GNU utilities. However, some editing of
-`test/Makefile' is required. It is recommended that you copy the file
-`pc/Makefile.tst' over the file `test/Makefile' as a replacement.
-Details can be found in `README_d/README.pc' and in the file
-`pc/Makefile.tst'.
-
-The 32 bit EMX version of `gawk' works "out of the box" under OS/2. In
-principle, it is possible to compile `gawk' the following way:
+ The `Makefile' contains a number of targets for building various
+MS-DOS, Windows32, and OS/2 versions. A list of targets is printed if
+the `make' command is given without a target. As an example, to build
+`gawk' using the DJGPP tools, enter `make djgpp'. (The DJGPP tools may
+be found at `ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/'.)
+
+ Using `make' to run the standard tests and to install `gawk'
+requires additional Unix-like tools, including `sh', `sed', and `cp'.
+In order to run the tests, the `test/*.ok' files may need to be
+converted so that they have the usual DOS-style end-of-line markers.
+Most of the tests work properly with Stewartson's shell along with the
+companion utilities or appropriate GNU utilities. However, some
+editing of `test/Makefile' is required. It is recommended that you copy
+the file `pc/Makefile.tst' over the file `test/Makefile' as a
+replacement. Details can be found in `README_d/README.pc' and in the
+file `pc/Makefile.tst'.
+
+ The 32 bit EMX version of `gawk' works "out of the box" under OS/2.
+In principle, it is possible to compile `gawk' the following way:
$ ./configure
$ make
-This is not recommended, though. To get an OMF executable you should
+ This is not recommended, though. To get an OMF executable you should
use the following commands at your `sh' prompt:
$ CPPFLAGS="-D__ST_MT_ERRNO__"
@@ -17752,19 +17934,19 @@ use the following commands at your `sh' prompt:
$ ./configure --prefix=c:/usr --without-included-gettext
$ make AR=emxomfar
-These are just suggestions. You may use any other set of
+ These are just suggestions. You may use any other set of
(self-consistent) environment variables and compiler flags.
-To get an FHS-compliant file hierarchy it is recommended to use the
+ To get an FHS-compliant file hierarchy it is recommended to use the
additional `configure' options `--infodir=c:/usr/share/info',
`--mandir=c:/usr/share/man' and `--libexecdir=c:/usr/lib'.
-If you use GCC 2.95 it is recommended to use also:
+ If you use GCC 2.95 it is recommended to use also:
$ LIBS="-lgcc"
$ export LIBS
-You can also get an `a.out' executable if you prefer:
+ You can also get an `a.out' executable if you prefer:
$ CPPFLAGS="-D__ST_MT_ERRNO__"
$ export CPPFLAGS
@@ -17785,12 +17967,12 @@ You can also get an `a.out' executable if you prefer:
added to `CPPFLAGS'. But then some nonstandard extensions of
`gawk' (e.g., `|&') do not work!
-After compilation the internal tests can be performed. Enter `make
+ After compilation the internal tests can be performed. Enter `make
check CMP="diff -a"' at your command prompt. All tests except for the
`pid' test are expected to work properly. The `pid' test fails because
child processes are not started by `fork()'.
-`make install' works as expected.
+ `make install' works as expected.
NOTE: Most OS/2 ports of GNU `make' are not able to handle the
Makefiles of this package. If you encounter any problems with
@@ -17809,22 +17991,22 @@ definitions of `DYN_FLAGS', `DYN_EXP', `DYN_OBJ', and `DYN_MAKEXP' in
the configuration section of the `Makefile'. There are two definitions
for `DYN_MAKEXP': pick the one that matches your target.
-To build some of the example extension libraries, `cd' to the extension
-directory and copy `Makefile.pc' to `Makefile'. You can then build
-using the same two targets. To run the example `awk' scripts, you'll
-need to either change the call to the `extension' function to match the
-name of the library (for instance, change `"./ordchr.so"' to
+ To build some of the example extension libraries, `cd' to the
+extension directory and copy `Makefile.pc' to `Makefile'. You can then
+build using the same two targets. To run the example `awk' scripts,
+you'll need to either change the call to the `extension' function to
+match the name of the library (for instance, change `"./ordchr.so"' to
`"ordchr.dll"' or simply `"ordchr"'), or rename the library to match
the call (for instance, rename `ordchr.dll' to `ordchr.so').
-If you build `gawk.exe' with one compiler but want to build an
+ If you build `gawk.exe' with one compiler but want to build an
extension library with the other, you need to copy the import library.
Visual C uses a library called `gawk.lib', while MinGW uses a library
called `libgawk.a'. These files are equivalent and will interoperate if
you give them the correct name. The resulting shared libraries are
also interoperable.
-To create your own extension library, you can use the examples as
+ To create your own extension library, you can use the examples as
models, but you're essentially on your own. Post to `comp.lang.awk' or
send electronic mail to <ptjm@interlog.com> if you have problems getting
started. If you need to access functions or variables which are not
@@ -17832,7 +18014,7 @@ exported by `gawk.exe', add them to `gawkw32.def' and rebuild. You
should also add `ATTRIBUTE_EXPORTED' to the declaration in `awk.h' of
any variables you add to `gawkw32.def'.
-Note that extension libraries have the name of the `awk' executable
+ Note that extension libraries have the name of the `awk' executable
embedded in them at link time, so they will work only with `gawk.exe'.
In particular, they won't work if you rename `gawk.exe' to `awk.exe' or
if you try to use `pgawk.exe'. You can perform profiling by temporarily
@@ -17840,9 +18022,9 @@ renaming `pgawk.exe' to `gawk.exe'. You can resolve this problem by
changing the program name in the definition of `DYN_MAKEXP' for your
compiler.
-On Windows32, libraries are sought first in the current directory, then
-in the directory containing `gawk.exe', and finally through the `PATH'
-environment variable.
+ On Windows32, libraries are sought first in the current directory,
+then in the directory containing `gawk.exe', and finally through the
+`PATH' environment variable.

File: gawk.info, Node: PC Using, Next: Cygwin, Prev: PC Dynamic, Up: PC Installation
@@ -17855,13 +18037,13 @@ TCP/IP networking (*note TCP/IP Networking::) are not supported for
MS-DOS or MS-Windows. EMX (OS/2 only) does support at least the `|&'
operator.
-The OS/2 and MS-DOS versions of `gawk' search for program files as
-described in *Note AWKPATH Variable::. However, semicolons (rather
+ The OS/2 and MS-DOS versions of `gawk' search for program files as
+described in *note AWKPATH Variable::. However, semicolons (rather
than colons) separate elements in the `AWKPATH' variable. If `AWKPATH'
is not set or is empty, then the default search path for OS/2 (16 bit)
and MS-DOS versions is `".;c:/lib/awk;c:/gnu/lib/awk"'.
-The search path for OS/2 (32 bit, EMX) is determined by the prefix
+ The search path for OS/2 (32 bit, EMX) is determined by the prefix
directory (most likely `/usr' or `c:/usr') that has been specified as
an option of the `configure' script like it is the case for the Unix
versions. If `c:/usr' is the prefix directory then the default search
@@ -17873,7 +18055,7 @@ specific drive is also searched for program files. E.g., if `UNIXROOT'
is set to `e:' the complete default search path is
`".;c:/usr/share/awk;e:/usr/share/awk"'.
-An `sh'-like shell (as opposed to `command.com' under MS-DOS or
+ An `sh'-like shell (as opposed to `command.com' under MS-DOS or
`cmd.exe' under OS/2) may be useful for `awk' programming. Ian
Stewartson has written an excellent shell for MS-DOS and OS/2, Daisuke
Aoyama has ported GNU `bash' to MS-DOS using the DJGPP tools, and
@@ -17884,7 +18066,7 @@ documentation for handling command lines; in particular, the setting
for `gawk' in the shell configuration may need to be changed and the
`ignoretype' option may also be of interest.
-Under OS/2 and DOS, `gawk' (and many other text programs) silently
+ Under OS/2 and DOS, `gawk' (and many other text programs) silently
translate end-of-line `"\r\n"' to `"\n"' on input and `"\n"' to
`"\r\n"' on output. A special `BINMODE' variable allows control over
these translations and is interpreted as follows:
@@ -17909,18 +18091,18 @@ accomplished by using an appropriate `-v BINMODE=N' option on the
command line. `BINMODE' is set at the time a file or pipe is opened
and cannot be changed mid-stream.
-The name `BINMODE' was chosen to match `mawk' (*note Other Versions::).
-Both `mawk' and `gawk' handle `BINMODE' similarly; however, `mawk' adds
-a `-W BINMODE=N' option and an environment variable that can set
-`BINMODE', `RS', and `ORS'. The files `binmode[1-3].awk' (under
-`gnu/lib/awk' in some of the prepared distributions) have been chosen
-to match `mawk''s `-W BINMODE=N' option. These can be changed or
-discarded; in particular, the setting of `RS' giving the fewest
-"surprises" is open to debate. `mawk' uses `RS = "\r\n"' if binary
-mode is set on read, which is appropriate for files with the DOS-style
-end-of-line.
-
-To illustrate, the following examples set binary mode on writes for
+ The name `BINMODE' was chosen to match `mawk' (*note Other
+Versions::). Both `mawk' and `gawk' handle `BINMODE' similarly;
+however, `mawk' adds a `-W BINMODE=N' option and an environment
+variable that can set `BINMODE', `RS', and `ORS'. The files
+`binmode[1-3].awk' (under `gnu/lib/awk' in some of the prepared
+distributions) have been chosen to match `mawk''s `-W BINMODE=N'
+option. These can be changed or discarded; in particular, the setting
+of `RS' giving the fewest "surprises" is open to debate. `mawk' uses
+`RS = "\r\n"' if binary mode is set on read, which is appropriate for
+files with the DOS-style end-of-line.
+
+ To illustrate, the following examples set binary mode on writes for
standard output and other files, and set `ORS' as the "usual" DOS-style
end-of-line:
@@ -17955,22 +18137,22 @@ simulation of Unix, using the GNU tools, such as `bash', the GNU
Compiler Collection (GCC), GNU Make, and other GNU tools. Compilation
and installation for Cygwin is the same as for a Unix system:
- tar -xvpzf gawk-3.1.5.tar.gz
- cd gawk-3.1.5
+ tar -xvpzf gawk-3.1.6.tar.gz
+ cd gawk-3.1.6
./configure
make
-When compared to GNU/Linux on the same system, the `configure' step on
-Cygwin takes considerably longer. However, it does finish, and then
+ When compared to GNU/Linux on the same system, the `configure' step
+on Cygwin takes considerably longer. However, it does finish, and then
the `make' proceeds as usual.
NOTE: The `|&' operator and TCP/IP networking (*note TCP/IP
Networking::) are fully supported in the Cygwin environment. This
is not true for any other environment for MS-DOS or MS-Windows.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) `http://www.cygwin.com'
+ (1) `http://www.cygwin.com'

File: gawk.info, Node: VMS Installation, Prev: PC Installation, Up: Non-Unix Installation
@@ -17986,6 +18168,7 @@ This node describes how to compile and install `gawk' under VMS.
* VMS Installation Details:: How to install `gawk' under VMS.
* VMS Running:: How to run `gawk' under VMS.
* VMS POSIX:: Alternate instructions for VMS POSIX.
+* VMS Old Gawk:: An old version comes with some VMS systems.

File: gawk.info, Node: VMS Compilation, Next: VMS Installation Details, Up: VMS Installation
@@ -18004,7 +18187,7 @@ or:
$ MMS/DESCRIPTION=[.VMS]DESCRIP.MMS GAWK
-Depending upon which C compiler you are using, follow one of the sets
+ Depending upon which C compiler you are using, follow one of the sets
of instructions in this table:
VAX C V3.x
@@ -18028,8 +18211,9 @@ DEC C
Edit `vmsbuild.com' or `descrip.mms' according to their comments.
No changes to `config.h' are needed.
-`gawk' has been tested under VAX/VMS 5.5-1 using VAX C V3.2, and GNU C
-1.40 and 2.3. It should work without modifications for VMS V4.6 and up.
+ `gawk' has been tested under VAX/VMS 5.5-1 using VAX C V3.2, and GNU
+C 1.40 and 2.3. It should work without modifications for VMS V4.6 and
+up.

File: gawk.info, Node: VMS Installation Details, Next: VMS Running, Prev: VMS Compilation, Up: VMS Installation
@@ -18048,7 +18232,7 @@ symbol should be placed in the `login.com' of any user who wants to run
Alternatively, the symbol may be placed in the system-wide
`sylogin.com' procedure, which allows all users to run `gawk'.
-Optionally, the help entry can be loaded into a VMS help library:
+ Optionally, the help entry can be loaded into a VMS help library:
$ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP
@@ -18061,7 +18245,7 @@ command:
provides information about both the `gawk' implementation and the `awk'
programming language.
-The logical name `AWK_LIBRARY' can designate a default location for
+ The logical name `AWK_LIBRARY' can designate a default location for
`awk' program files. For the `-f' option, if the specified file name
has no device or directory path information in it, `gawk' looks in the
current directory first, then in the directory specified by the
@@ -18082,7 +18266,7 @@ on VMS, so examples in this Info file or from other sources often need
minor changes. They _are_ minor though, and all `awk' programs should
run correctly.
-Here are a couple of trivial tests:
+ Here are a couple of trivial tests:
$ gawk -- "BEGIN {print ""Hello, World!""}"
$ gawk -"W" version
@@ -18090,8 +18274,8 @@ Here are a couple of trivial tests:
Note that uppercase and mixed-case text must be quoted.
-The VMS port of `gawk' includes a `DCL'-style interface in addition to
-the original shell-style interface (see the help entry for details).
+ The VMS port of `gawk' includes a `DCL'-style interface in addition
+to the original shell-style interface (see the help entry for details).
One side effect of dual command-line parsing is that if there is only a
single parameter (as in the quoted string program above), the command
becomes ambiguous. To work around this, the normally optional `--'
@@ -18099,15 +18283,15 @@ flag is required to force Unix style rather than `DCL' parsing. If any
other dash-type options (or multiple parameters such as data files to
process) are present, there is no ambiguity and `--' can be omitted.
-The default search path, when looking for `awk' program files specified
-by the `-f' option, is `"SYS$DISK:[],AWK_LIBRARY:"'. The logical name
-`AWKPATH' can be used to override this default. The format of
-`AWKPATH' is a comma-separated list of directory specifications. When
-defining it, the value should be quoted so that it retains a single
+ The default search path, when looking for `awk' program files
+specified by the `-f' option, is `"SYS$DISK:[],AWK_LIBRARY:"'. The
+logical name `AWKPATH' can be used to override this default. The format
+of `AWKPATH' is a comma-separated list of directory specifications.
+When defining it, the value should be quoted so that it retains a single
translation and not a multitranslation `RMS' searchlist.

-File: gawk.info, Node: VMS POSIX, Prev: VMS Running, Up: VMS Installation
+File: gawk.info, Node: VMS POSIX, Next: VMS Old Gawk, Prev: VMS Running, Up: VMS Installation
B.3.4.4 Building and Using `gawk' on VMS POSIX
..............................................
@@ -18129,13 +18313,28 @@ compiler directly; ignore any warnings from `make' about being unable
to redefine `CC'. `configure' takes a very long time to execute, but
at least it provides incremental feedback as it runs.
-This has been tested with VAX/VMS V6.2, VMS POSIX V2.0, and DEC C V5.2.
+ This has been tested with VAX/VMS V6.2, VMS POSIX V2.0, and DEC C
+V5.2.
-Once built, `gawk' works like any other shell utility. Unlike the
+ Once built, `gawk' works like any other shell utility. Unlike the
normal VMS port of `gawk', no special command-line manipulation is
needed in the VMS POSIX environment.

+File: gawk.info, Node: VMS Old Gawk, Prev: VMS POSIX, Up: VMS Installation
+
+B.3.4.5 Some VMS Systems Have An Old Version of `gawk'
+......................................................
+
+Some versions of VMS have an old version of `gawk'. To access it,
+define a symbol, as follows:
+
+ $ gawk :== $ sys$common:[syshlp.examples.tcpip.snmp]gawk.exe
+
+ This is apparently version 2.15.6, which is quite old. We recommend
+compiling and using the current version.
+
+
File: gawk.info, Node: Unsupported, Next: Bugs, Prev: Non-Unix Installation, Up: Installation
B.4 Unsupported Operating System Ports
@@ -18158,13 +18357,13 @@ B.4.1 Installing `gawk' on the Atari ST
The Atari port is no longer supported. It is included for those who
might want to use it but it is no longer being actively maintained.
-There are no substantial differences when installing `gawk' on various
-Atari models. Compiled `gawk' executables do not require a large
-amount of memory with most `awk' programs, and should run on all
+ There are no substantial differences when installing `gawk' on
+various Atari models. Compiled `gawk' executables do not require a
+large amount of memory with most `awk' programs, and should run on all
Motorola processor-based models (called further ST, even if that is not
exactly right).
-In order to use `gawk', you need to have a shell, either text or
+ In order to use `gawk', you need to have a shell, either text or
graphics, that does not map all the characters of a command line to
uppercase. Maintaining case distinction in option flags is very
important (*note Options::). These days this is the default and it may
@@ -18190,28 +18389,28 @@ A proper compilation of `gawk' sources when `sizeof(int)' differs from
with `gcc'. You may actually prefer executables where `int's are four
bytes wide but the other variant works as well.
-You may need quite a bit of memory when trying to recompile the `gawk'
-sources, as some source files (`regex.c' in particular) are quite big.
-If you run out of memory compiling such a file, try reducing the
+ You may need quite a bit of memory when trying to recompile the
+`gawk' sources, as some source files (`regex.c' in particular) are quite
+big. If you run out of memory compiling such a file, try reducing the
optimization level for this particular file, which may help.
-With a reasonable shell (`bash' will do), you have a pretty good chance
-that the `configure' utility will succeed, and in particular if you run
-GNU/Linux, MiNT or a similar operating system. Otherwise sample
-versions of `config.h' and `Makefile.st' are given in the `atari'
-subdirectory and can be edited and copied to the corresponding files in
-the main source directory. Even if `configure' produces something, it
-might be advisable to compare its results with the sample versions and
-possibly make adjustments.
+ With a reasonable shell (`bash' will do), you have a pretty good
+chance that the `configure' utility will succeed, and in particular if
+you run GNU/Linux, MiNT or a similar operating system. Otherwise
+sample versions of `config.h' and `Makefile.st' are given in the
+`atari' subdirectory and can be edited and copied to the corresponding
+files in the main source directory. Even if `configure' produces
+something, it might be advisable to compare its results with the sample
+versions and possibly make adjustments.
-Some `gawk' source code fragments depend on a preprocessor define
+ Some `gawk' source code fragments depend on a preprocessor define
`atarist'. This basically assumes the TOS environment with `gcc'.
Modify these sections as appropriate if they are not right for your
environment. Also see the remarks about `AWKPATH' and `envsep' in
-*Note Atari Using::.
+*note Atari Using::.
-As shipped, the sample `config.h' claims that the `system' function is
-missing from the libraries, which is not true, and an alternative
+ As shipped, the sample `config.h' claims that the `system' function
+is missing from the libraries, which is not true, and an alternative
implementation of this function is provided in
`unsupported/atari/system.c'. Depending upon your particular
combination of shell and operating system, you might want to change the
@@ -18226,7 +18425,7 @@ B.4.1.2 Running `gawk' on the Atari ST
An executable version of `gawk' should be placed, as usual, anywhere in
your `PATH' where your shell can find it.
-While executing, the Atari version of `gawk' creates a number of
+ While executing, the Atari version of `gawk' creates a number of
temporary files. When using `gcc' libraries for TOS, `gawk' looks for
either of the environment variables, `TEMP' or `TMPDIR', in that order.
If either one is found, its value is assumed to be a directory for
@@ -18235,20 +18434,21 @@ memory, it is a good idea to put it on a RAM drive. If neither `TEMP'
nor `TMPDIR' are found, then `gawk' uses the current directory for its
temporary files.
-The ST version of `gawk' searches for its program files, as described in
-*Note AWKPATH Variable::. The default value for the `AWKPATH' variable
-is taken from `DEFPATH' defined in `Makefile'. The sample `gcc'/TOS
-`Makefile' for the ST in the distribution sets `DEFPATH' to
-`".,c:\lib\awk,c:\gnu\lib\awk"'. The search path can be modified by
-explicitly setting `AWKPATH' to whatever you want. Note that colons
-cannot be used on the ST to separate elements in the `AWKPATH'
-variable, since they have another reserved meaning. Instead, you must
-use a comma to separate elements in the path. When recompiling, the
-separating character can be modified by initializing the `envsep'
-variable in `unsupported/atari/gawkmisc.atr' to another value.
-
-Although `awk' allows great flexibility in doing I/O redirections from
-within a program, this facility should be used with care on the ST
+ The ST version of `gawk' searches for its program files, as
+described in *note AWKPATH Variable::. The default value for the
+`AWKPATH' variable is taken from `DEFPATH' defined in `Makefile'. The
+sample `gcc'/TOS `Makefile' for the ST in the distribution sets
+`DEFPATH' to `".,c:\lib\awk,c:\gnu\lib\awk"'. The search path can be
+modified by explicitly setting `AWKPATH' to whatever you want. Note
+that colons cannot be used on the ST to separate elements in the
+`AWKPATH' variable, since they have another reserved meaning. Instead,
+you must use a comma to separate elements in the path. When
+recompiling, the separating character can be modified by initializing
+the `envsep' variable in `unsupported/atari/gawkmisc.atr' to another
+value.
+
+ Although `awk' allows great flexibility in doing I/O redirections
+from within a program, this facility should be used with care on the ST
running under TOS. In some circumstances, the OS routines for
file-handle pool processing lose track of certain events, causing the
computer to crash and requiring a reboot. Often a warm reboot is
@@ -18258,7 +18458,7 @@ program using `print' statements explicitly redirected to
`/dev/stdout', while other `print' statements use the default standard
output, and a calling shell has redirected standard output to a file.
-When `gawk' is compiled with the ST version of `gcc' and its usual
+ When `gawk' is compiled with the ST version of `gcc' and its usual
libraries, it accepts both `/' and `\' as path separators. While this
is convenient, it should be remembered that this removes one
technically valid character (`/') from your file name. It may also
@@ -18278,29 +18478,30 @@ B.4.2 Installing `gawk' on a Tandem
The Tandem port is only minimally supported. The port's contributor no
longer has access to a Tandem system.
-The Tandem port was done on a Cyclone machine running D20. The port is
-pretty clean and all facilities seem to work except for the I/O piping
-facilities (*note Getline/Pipe::, *Note Getline/Variable/Pipe::, and
-*Note Redirection::), which is just too foreign a concept for Tandem.
+ The Tandem port was done on a Cyclone machine running D20. The port
+is pretty clean and all facilities seem to work except for the I/O
+piping facilities (*note Getline/Pipe::, *note Getline/Variable/Pipe::,
+and *note Redirection::), which is just too foreign a concept for
+Tandem.
-To build a Tandem executable from source, download all of the files so
-that the file names on the Tandem box conform to the restrictions of
+ To build a Tandem executable from source, download all of the files
+so that the file names on the Tandem box conform to the restrictions of
D20. For example, `array.c' becomes `ARRAYC', and `awk.h' becomes
`AWKH'. The totally Tandem-specific files are in the `tandem'
"subvolume" (`unsupported/tandem' in the `gawk' distribution) and
should be copied to the main source directory before building `gawk'.
-The file `compit' can then be used to compile and bind an executable.
+ The file `compit' can then be used to compile and bind an executable.
Alas, there is no `configure' or `make'.
-Usage is the same as for Unix, except that D20 requires all `{' and `}'
-characters to be escaped with `~' on the command line (but _not_ in
+ Usage is the same as for Unix, except that D20 requires all `{' and
+`}' characters to be escaped with `~' on the command line (but _not_ in
script files). Also, the standard Tandem syntax for `/in filename,out
filename/' must be used instead of the usual Unix `<' and `>' for file
redirection. (Redirection options on `getline', `print' etc., are
supported.)
-The `-mr VAL' option (*note Options::) has been "stolen" to enable
+ The `-mr VAL' option (*note Options::) has been "stolen" to enable
Tandem users to process fixed-length records with no "end-of-line"
character. That is, `-mr 74' tells `gawk' to read the input file as
fixed 74-byte records.
@@ -18314,56 +18515,57 @@ B.5 Reporting Problems and Bugs
There is nothing more dangerous than a bored archeologist.
The Hitchhiker's Guide to the Galaxy
-If you have problems with `gawk' or think that you have found a bug,
+ If you have problems with `gawk' or think that you have found a bug,
please report it to the developers; we cannot promise to do anything
but we might well want to fix it.
-Before reporting a bug, make sure you have actually found a real bug.
+ Before reporting a bug, make sure you have actually found a real bug.
Carefully reread the documentation and see if it really says you can do
what you're trying to do. If it's not clear whether you should be able
to do something or not, report that too; it's a bug in the
documentation!
-Before reporting a bug or trying to fix it yourself, try to isolate it
-to the smallest possible `awk' program and input data file that
+ Before reporting a bug or trying to fix it yourself, try to isolate
+it to the smallest possible `awk' program and input data file that
reproduces the problem. Then send us the program and data file, some
idea of what kind of Unix system you're using, the compiler you used to
compile `gawk', and the exact results `gawk' gave you. Also say what
you expected to occur; this helps us decide whether the problem is
really in the documentation.
-Once you have a precise problem, send email to <bug-gawk@gnu.org>.
+ Once you have a precise problem, send email to <bug-gawk@gnu.org>.
-Please include the version number of `gawk' you are using. You can get
-this information with the command `gawk --version'. Using this address
-automatically sends a carbon copy of your mail to me. If necessary, I
-can be reached directly at <arnold@gnu.org>. The bug reporting address
-is preferred since the email list is archived at the GNU Project. _All
-email should be in English, since that is my native language._
+ Please include the version number of `gawk' you are using. You can
+get this information with the command `gawk --version'. Using this
+address automatically sends a carbon copy of your mail to me. If
+necessary, I can be reached directly at <arnold@skeeve.com>. The bug
+reporting address is preferred since the email list is archived at the
+GNU Project. _All email should be in English, since that is my native
+language._
-*Caution:* Do _not_ try to report bugs in `gawk' by posting to the
+ *Caution:* Do _not_ try to report bugs in `gawk' by posting to the
Usenet/Internet newsgroup `comp.lang.awk'. While the `gawk' developers
do occasionally read this newsgroup, there is no guarantee that we will
see your posting. The steps described above are the official
recognized ways for reporting bugs.
-Non-bug suggestions are always welcome as well. If you have questions
-about things that are unclear in the documentation or are just obscure
-features, ask me; I will try to help you out, although I may not have
-the time to fix the problem. You can send me electronic mail at the
-Internet address noted previously.
+ Non-bug suggestions are always welcome as well. If you have
+questions about things that are unclear in the documentation or are
+just obscure features, ask me; I will try to help you out, although I
+may not have the time to fix the problem. You can send me electronic
+mail at the Internet address noted previously.
-If you find bugs in one of the non-Unix ports of `gawk', please send an
-electronic mail message to the person who maintains that port. They
+ If you find bugs in one of the non-Unix ports of `gawk', please send
+an electronic mail message to the person who maintains that port. They
are named in the following list, as well as in the `README' file in the
`gawk' distribution. Information in the `README' file should be
considered authoritative if it conflicts with this Info file.
-The people maintaining the non-Unix ports of `gawk' are as follows:
+ The people maintaining the non-Unix ports of `gawk' are as follows:
Amiga Fred Fish, <fnf@ninemoons.com>.
BeOS Martin Brown, <mc@whoever.com>.
-MS-DOS Scott Deifik, <scottd@amgen.com> and Darrel
+MS-DOS Scott Deifik, <scottd.mail@sbcglobal.net> and Darrel
Hankerson, <hankedr@mail.auburn.edu>.
MS-Windows Juan Grigera, <juan@biophnet.unlp.edu.ar>.
OS/2 The Unix for OS/2 team,
@@ -18371,8 +18573,8 @@ OS/2 The Unix for OS/2 team,
Tandem Stephen Davies, <scldad@sdc.com.au>.
VMS Pat Rankin, <rankin@pactechdata.com>.
-If your bug is also reproducible under Unix, please send a copy of your
-report to the <bug-gawk@gnu.org> email list as well.
+ If your bug is also reproducible under Unix, please send a copy of
+your report to the <bug-gawk@gnu.org> email list as well.

File: gawk.info, Node: Other Versions, Prev: Bugs, Up: Installation
@@ -18384,8 +18586,8 @@ B.6 Other Freely Available `awk' Implementations
`// Do C++ comments work? answer: yes! of course'
Michael Brennan
-There are three other freely available `awk' implementations. This
-minor node briefly describes where to get them:
+ There are a number of other freely available `awk' implementations.
+This minor node briefly describes where to get them:
Unix `awk'
Brian Kernighan has made his implementation of `awk' freely
@@ -18426,7 +18628,7 @@ Unix `awk'
(*note I/O Functions::).
* The `**' and `**=' operators (*note Arithmetic Ops:: and also
- see *Note Assignment Ops::).
+ see *note Assignment Ops::).
* The use of `func' as an abbreviation for `function' (*note
Definition Syntax::).
@@ -18470,10 +18672,30 @@ Unix `awk'
either `ftp://ftp.math.utah.edu/pub/pawk/pawk-20020210.tar.gz' or
`http://www.math.utah.edu/pub/pawk/pawk-20020210.tar.gz'.
+The OpenSolaris POSIX `awk'
+ The version of `awk' in `/usr/xpg4/bin' on Solaris is POSIX
+ compliant. It is based on the `awk' from Mortice Kern Systems for
+ PCs. The source code can be downloaded from the OpenSolaris web
+ site.(2) This author was able to make it compile and work under
+ GNU/Linux with 1-2 hours of work. Making it more generally
+ portable (using GNU Autoconf and/or Automake) would take more
+ work, and this has not been done, at least to our knowledge.
+
+`jawk'
+ This is an interpreter for `awk' written in Java. It claims to be
+ a full interpreter, although because it uses Java facilities for
+ I/O and for regexp matching, the language it supports is different
+ from POSIX `awk'. More information is available on the project's
+ home page.(3).
+
+
+ ---------- Footnotes ----------
----------- Footnotes ----------
+ (1) `http://cm.bell-labs.com/who/bwk'
-(1) `http://cm.bell-labs.com/who/bwk'
+ (2) `http://www.opensolaris.org'
+
+ (3) `http://jawk.sourceforge.net'

File: gawk.info, Node: Notes, Next: Basic Concepts, Prev: Installation, Up: Top
@@ -18505,16 +18727,16 @@ language and program. All of these features can be turned off by
invoking `gawk' with the `--traditional' option or with the `--posix'
option.
-If `gawk' is compiled for debugging with `-DDEBUG', then there is one
-more option available on the command line:
+ If `gawk' is compiled for debugging with `-DDEBUG', then there is
+one more option available on the command line:
`-W parsedebug'
`--parsedebug'
Prints out the parse stack information as the program is being
parsed.
-This option is intended only for serious `gawk' developers and not for
-the casual user. It probably has not even been compiled into your
+ This option is intended only for serious `gawk' developers and not
+for the casual user. It probably has not even been compiled into your
version of `gawk', since it slows down execution.

@@ -18528,8 +18750,8 @@ you are perfectly free to do so. That is the point of having free
software; the source code is available and you are free to change it as
you want (*note Copying::).
-This minor node discusses the ways you might want to change `gawk' as
-well as any considerations you should bear in mind.
+ This minor node discusses the ways you might want to change `gawk'
+as well as any considerations you should bear in mind.
* Menu:
@@ -18666,8 +18888,8 @@ possible for me to include your changes:
This helps further minimize the amount of work I have to do,
making it easier for me to accept patches.
-Although this sounds like a lot of work, please remember that while you
-may write the new code, I have to maintain it and support it. If it
+ Although this sounds like a lot of work, please remember that while
+you may write the new code, I have to maintain it and support it. If it
isn't possible for me to do that with a minimum of extra work, then I
probably will not.
@@ -18680,7 +18902,7 @@ C.2.2 Porting `gawk' to a New Operating System
If you want to port `gawk' to a new operating system, there are several
steps:
- 1. Follow the guidelines in *Note Adding Code::, concerning coding
+ 1. Follow the guidelines in *note Adding Code::, concerning coding
style, submission of diffs, and so on.
2. When doing a port, bear in mind that your code must coexist
@@ -18698,9 +18920,10 @@ steps:
people at the Free Software Foundation. Thus, you should not
change them unless it is for a very good reason; i.e., changes are
not out of the question, but changes to these files are
- scrutinized extra carefully. The files are `getopt.h', `getopt.c',
- `getopt1.c', `regex.h', `regex.c', `dfa.h', `dfa.c', `install-sh',
- and `mkinstalldirs'.
+ scrutinized extra carefully. The files are `getopt.h',
+ `getopt.c', `getopt1.c', `regex.h', `regex.c', `regcomp.c',
+ `regex_internal.c', `regex_internal.h', `regexec.c', `dfa.h',
+ `dfa.c', `install-sh', and `mkinstalldirs'.
4. Be willing to continue to maintain the port. Non-Unix operating
systems are supported by volunteers who maintain the code needed
@@ -18745,11 +18968,11 @@ steps:
actions are easy to do and _many_ people have done so already. If
you have questions, please contact me, or <gnu@gnu.org>.
-Following these steps makes it much easier to integrate your changes
+ Following these steps makes it much easier to integrate your changes
into `gawk' and have them coexist happily with other operating systems'
code that is already there.
-In the code that you supply and maintain, feel free to use a coding
+ In the code that you supply and maintain, feel free to use a coding
style and brace layout that suits your taste.

@@ -18762,21 +18985,21 @@ C.3 Adding New Built-in Functions to `gawk'
Warning! Warning!
The Robot
-Beginning with `gawk' 3.1, it is possible to add new built-in functions
-to `gawk' using dynamically loaded libraries. This facility is
-available on systems (such as GNU/Linux) that support the `dlopen' and
-`dlsym' functions. This minor node describes how to write and use
+ Beginning with `gawk' 3.1, it is possible to add new built-in
+functions to `gawk' using dynamically loaded libraries. This facility
+is available on systems (such as GNU/Linux) that support the `dlopen'
+and `dlsym' functions. This minor node describes how to write and use
dynamically loaded extensions for `gawk'. Experience with programming
in C or C++ is necessary when reading this minor node.
-*Caution:* The facilities described in this minor node are very much
+ *Caution:* The facilities described in this minor node are very much
subject to change in a future `gawk' release. Be aware that you may
have to re-do everything, perhaps from scratch, at some future time.
-*Caution:* If you have written your own dynamic extensions, be sure to
-recompile them for each new `gawk' release. There is no guarantee of
-binary compatibility between different releases, no will there ever be
-such a guarantee.
+ *Caution:* If you have written your own dynamic extensions, be sure
+to recompile them for each new `gawk' release. There is no guarantee
+of binary compatibility between different releases, nor will there ever
+be such a guarantee.
* Menu:
@@ -18798,7 +19021,7 @@ material presented here. Of particular note are the files `awk.h',
`builtin.c', and `eval.c'. Reading `awkgram.y' in order to see how the
parse tree is built would also be of use.
-With the disclaimers out of the way, the following types, structure
+ With the disclaimers out of the way, the following types, structure
members, functions, and macros are declared in `awk.h' and are of use
when writing extensions. The next minor node shows how they are used:
@@ -18994,11 +19217,11 @@ when writing extensions. The next minor node shows how they are used:
*Caution:* This function is new as of `gawk' 3.1.5.
-An argument that is supposed to be an array needs to be handled with
+ An argument that is supposed to be an array needs to be handled with
some extra code, in case the array being passed in is actually from a
function parameter.
-In versions of `gawk' up to and including 3.1.2, the following
+ In versions of `gawk' up to and including 3.1.2, the following
boilerplate code shows how to do this:
NODE *the_arg;
@@ -19021,7 +19244,7 @@ boilerplate code shows how to do this:
the_arg->type = Node_var_array;
assoc_clear(the_arg);
-For versions 3.1.3 and later, the internals changed. In particular,
+ For versions 3.1.3 and later, the internals changed. In particular,
the interface was actually _simplified_ drastically. The following
boilerplate code now suffices:
@@ -19035,15 +19258,15 @@ boilerplate code now suffices:
/* if necessary, clear it: */
assoc_clear(the_arg);
-As of version 3.1.4, the internals improved again, and became even
+ As of version 3.1.4, the internals improved again, and became even
simpler:
NODE *the_arg;
the_arg = get_array_argument(tree, 2, FALSE); /* assume need 3rd arg, 0-based */
-Again, you should spend time studying the `gawk' internals; don't just
-blindly copy this code.
+ Again, you should spend time studying the `gawk' internals; don't
+just blindly copy this code.

File: gawk.info, Node: Sample Library, Prev: Internals, Up: Dynamic Extensions
@@ -19083,11 +19306,11 @@ directory to change to:
}
...
-The return value is negative if the `chdir' failed, and `ERRNO' (*note
-Built-in Variables::) is set to a string indicating the error.
+ The return value is negative if the `chdir' failed, and `ERRNO'
+(*note Built-in Variables::) is set to a string indicating the error.
-Using `stat' is a bit more complicated. The C `stat' function fills in
-a structure that has a fair amount of information. The right way to
+ Using `stat' is a bit more complicated. The C `stat' function fills
+in a structure that has a fair amount of information. The right way to
model this in `awk' is to fill in an associative array with the
appropriate information:
@@ -19101,7 +19324,7 @@ appropriate information:
}
printf("size of %s is %d bytes\n", file, fdata["size"])
-The `stat' function always clears the data array, even if the `stat'
+ The `stat' function always clears the data array, even if the `stat'
fails. It fills in the following elements:
`"name"'
@@ -19165,9 +19388,10 @@ fails. It fills in the following elements:
`"symlink"'
The file is a symbolic link.
-Several additional elements may be present depending upon the operating
-system and the type of the file. You can test for them in your `awk'
-program by using the `in' operator (*note Reference to Elements::):
+ Several additional elements may be present depending upon the
+operating system and the type of the file. You can test for them in
+your `awk' program by using the `in' operator (*note Reference to
+Elements::):
`"blksize"'
The preferred block size for I/O to the file. This field is not
@@ -19213,18 +19437,18 @@ other POSIX-compliant systems:(1)
newdir = get_scalar_argument(tree, 0);
-The file includes the `"awk.h"' header file for definitions for the
+ The file includes the `"awk.h"' header file for definitions for the
`gawk' internals. It includes `<sys/sysmacros.h>' for access to the
`major' and `minor' macros.
-By convention, for an `awk' function `foo', the function that
+ By convention, for an `awk' function `foo', the function that
implements it is called `do_foo'. The function should take a `NODE *'
argument, usually called `tree', that represents the argument list to
the function. The `newdir' variable represents the new directory to
change to, retrieved with `get_argument'. Note that the first argument
is numbered zero.
-This code actually accomplishes the `chdir'. It first forces the
+ This code actually accomplishes the `chdir'. It first forces the
argument to be a string and passes the string value to the `chdir'
system call. If the `chdir' fails, `ERRNO' is updated. The result of
`force_string' has to be freed with `free_temp':
@@ -19235,7 +19459,7 @@ system call. If the `chdir' fails, `ERRNO' is updated. The result of
update_ERRNO();
free_temp(newdir);
-Finally, the function returns the return value to the `awk' level,
+ Finally, the function returns the return value to the `awk' level,
using `set_value'. Then it must return a value from the call to the new
built-in (this value ignored by the interpreter):
@@ -19246,7 +19470,7 @@ built-in (this value ignored by the interpreter):
return tmp_number((AWKNUM) 0);
}
-The `stat' built-in is more involved. First comes a function that
+ The `stat' built-in is more involved. First comes a function that
turns a numeric mode into a printable representation (e.g., 644 becomes
`-rw-r--r--'). This is omitted here for brevity:
@@ -19260,7 +19484,7 @@ turns a numeric mode into a printable representation (e.g., 644 becomes
...
}
-Next comes the actual `do_stat' function itself. First come the
+ Next comes the actual `do_stat' function itself. First come the
variable declarations and argument checking:
/* do_stat --- provide a stat() function for gawk */
@@ -19280,7 +19504,7 @@ variable declarations and argument checking:
if (do_lint && get_curfunc_arg_count() > 2)
lintwarn("stat: called with too many arguments");
-Then comes the actual work. First, we get the arguments. Then, we
+ Then comes the actual work. First, we get the arguments. Then, we
always clear the array. To get the file information, we use `lstat',
in case the file is a symbolic link. If there's an error, we set
`ERRNO' and return:
@@ -19304,7 +19528,7 @@ in case the file is a symbolic link. If there's an error, we set
return tmp_number((AWKNUM) 0);
}
-Now comes the tedious part: filling in the array. Only a few of the
+ Now comes the tedious part: filling in the array. Only a few of the
calls are shown here, since they all follow the same pattern:
/* fill in the array */
@@ -19318,7 +19542,7 @@ calls are shown here, since they all follow the same pattern:
pmode = format_mode(sbuf.st_mode);
*aptr = make_string(pmode, strlen(pmode));
-When done, we free the temporary value containing the file name, set
+ When done, we free the temporary value containing the file name, set
the return value, and return:
free_temp(file);
@@ -19330,7 +19554,7 @@ the return value, and return:
return tmp_number((AWKNUM) 0);
}
-Finally, it's necessary to provide the "glue" that loads the new
+ Finally, it's necessary to provide the "glue" that loads the new
function(s) into `gawk'. By convention, each library has a routine
named `dlload' that does the job:
@@ -19346,12 +19570,12 @@ named `dlload' that does the job:
return tmp_number((AWKNUM) 0);
}
-And that's it! As an exercise, consider adding functions to implement
-system calls such as `chown', `chmod', and `umask'.
+ And that's it! As an exercise, consider adding functions to
+implement system calls such as `chown', `chmod', and `umask'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This version is edited slightly for presentation. The complete
+ (1) This version is edited slightly for presentation. The complete
version can be found in `extension/filefuncs.c' in the `gawk'
distribution.
@@ -19370,7 +19594,7 @@ a GNU/Linux shared library:
$ gcc -shared -DHAVE_CONFIG_H -c -O -g -IIDIR filefuncs.c
$ ld -o filefuncs.so -shared filefuncs.o
-Once the library exists, it is loaded by calling the `extension'
+ Once the library exists, it is loaded by calling the `extension'
built-in function. This function takes two arguments: the name of the
library to load and the name of a function to call when the library is
first loaded. This function adds the new functions to `gawk'. It
@@ -19393,7 +19617,7 @@ shared library:
strftime("%m %d %y %H:%M:%S", data["mtime"])
}
-Here are the results of running the program:
+ Here are the results of running the program:
$ gawk -f testff.awk
-| Info for testff.awk
@@ -19427,12 +19651,12 @@ C.4 Probable Future Extensions
Hey!
Larry Wall
-This minor node briefly lists extensions and possible improvements that
-indicate the directions we are currently considering for `gawk'. The
-file `FUTURES' in the `gawk' distribution lists these extensions as
+ This minor node briefly lists extensions and possible improvements
+that indicate the directions we are currently considering for `gawk'.
+The file `FUTURES' in the `gawk' distribution lists these extensions as
well.
-Following is a list of probable future changes visible at the `awk'
+ Following is a list of probable future changes visible at the `awk'
language level:
Loadable module interface
@@ -19460,7 +19684,7 @@ Databases
More `lint' warnings
There are more things that could be checked for portability.
-Following is a list of probable improvements that will make `gawk''s
+ Following is a list of probable improvements that will make `gawk''s
source code easier to work with:
Loadable module mechanics
@@ -19486,7 +19710,7 @@ Integrating the DBUG library
Integrating Fred Fish's DBUG library would be helpful during
development, but it's a lot of work to do.
-Following is a list of probable improvements that will make `gawk'
+ Following is a list of probable improvements that will make `gawk'
perform better:
Compilation of `awk' programs
@@ -19509,10 +19733,10 @@ Compilation of `awk' programs
intermediate in speed between running a compiled program and doing
what `gawk' does now.
-Finally, the programs in the test suite could use documenting in this
-Info file.
+ Finally, the programs in the test suite could use documenting in
+this Info file.
-*Note Additions::, if you are interested in tackling any of these
+ *Note Additions::, if you are interested in tackling any of these
projects.

@@ -19548,12 +19772,12 @@ data and produce results.
| Data | -----> < Program > -----> | Results |
+------+ \_______/ +---------+
-The "program" in the figure can be either a compiled program(1) (such
-as `ls'), or it may be "interpreted". In the latter case, a
+ The "program" in the figure can be either a compiled program(1)
+(such as `ls'), or it may be "interpreted". In the latter case, a
machine-executable program such as `awk' reads your program, and then
uses the instructions in your program to process the data.
-When you write a program, it usually consists of the following, very
+ When you write a program, it usually consists of the following, very
basic set of steps:
______
@@ -19600,33 +19824,33 @@ Clean Up
plastic wrap to keep anyone from tasting it, as well as wash the
mixing bowls and utensils.
-An "algorithm" is a detailed set of instructions necessary to accomplish
-a task, or process data. It is much the same as a recipe for baking a
-cake. Programs implement algorithms. Often, it is up to you to design
-the algorithm and implement it, simultaneously.
+ An "algorithm" is a detailed set of instructions necessary to
+accomplish a task, or process data. It is much the same as a recipe
+for baking a cake. Programs implement algorithms. Often, it is up to
+you to design the algorithm and implement it, simultaneously.
-The "logical chunks" we talked about previously are called "records",
+ The "logical chunks" we talked about previously are called "records",
similar to the records a company keeps on employees, a school keeps for
students, or a doctor keeps for patients. Each record has many
component parts, such as first and last names, date of birth, address,
and so on. The component parts are referred to as the "fields" of the
record.
-The act of reading data is termed "input", and that of generating
+ The act of reading data is termed "input", and that of generating
results, not too surprisingly, is termed "output". They are often
referred to together as "input/output," and even more often, as "I/O"
for short. (You will also see "input" and "output" used as verbs.)
-`awk' manages the reading of data for you, as well as the breaking it
-up into records and fields. Your program's job is to tell `awk' what
-to with the data. You do this by describing "patterns" in the data to
-look for, and "actions" to execute when those patterns are seen. This
-"data-driven" nature of `awk' programs usually makes them both easier
-to write and easier to read.
+ `awk' manages the reading of data for you, as well as the breaking
+it up into records and fields. Your program's job is to tell `awk'
+what to with the data. You do this by describing "patterns" in the
+data to look for, and "actions" to execute when those patterns are
+seen. This "data-driven" nature of `awk' programs usually makes them
+both easier to write and easier to read.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Compiled programs are typically written in lower-level languages
+ (1) Compiled programs are typically written in lower-level languages
such as C, C++, Fortran, or Ada, and then translated, or "compiled",
into a form that the computer can execute directly.
@@ -19643,75 +19867,75 @@ predefined variables, and it has special names to refer to the current
input record and the fields of the record. You may also group multiple
associated values under one name, as an array.
-Data, particularly in `awk', consists of either numeric values, such as
-42 or 3.1415927, or string values. String values are essentially
+ Data, particularly in `awk', consists of either numeric values, such
+as 42 or 3.1415927, or string values. String values are essentially
anything that's not a number, such as a name. Strings are sometimes
referred to as "character data", since they store the individual
characters that comprise them. Individual variables, as well as
numeric and string variables, are referred to as "scalar" values.
Groups of values, such as arrays, are not scalars.
-Within computers, there are two kinds of numeric values: "integers" and
-"floating-point". In school, integer values were referred to as
+ Within computers, there are two kinds of numeric values: "integers"
+and "floating-point". In school, integer values were referred to as
"whole" numbers--that is, numbers without any fractional part, such as
1, 42, or -17. The advantage to integer numbers is that they represent
values exactly. The disadvantage is that their range is limited. On
most modern systems, this range is -2,147,483,648 to 2,147,483,647.
-Integer values come in two flavors: "signed" and "unsigned". Signed
+ Integer values come in two flavors: "signed" and "unsigned". Signed
values may be negative or positive, with the range of values just
described. Unsigned values are always positive. On most modern
systems, the range is from 0 to 4,294,967,295.
-Floating-point numbers represent what are called "real" numbers; i.e.,
-those that do have a fractional part, such as 3.1415927. The advantage
-to floating-point numbers is that they can represent a much larger
-range of values. The disadvantage is that there are numbers that they
-cannot represent exactly. `awk' uses "double-precision" floating-point
-numbers, which can hold more digits than "single-precision"
-floating-point numbers. Floating-point issues are discussed more fully
-in *Note Floating Point Issues::.
+ Floating-point numbers represent what are called "real" numbers;
+i.e., those that do have a fractional part, such as 3.1415927. The
+advantage to floating-point numbers is that they can represent a much
+larger range of values. The disadvantage is that there are numbers
+that they cannot represent exactly. `awk' uses "double-precision"
+floating-point numbers, which can hold more digits than
+"single-precision" floating-point numbers. Floating-point issues are
+discussed more fully in *note Floating Point Issues::.
-At the very lowest level, computers store values as groups of binary
+ At the very lowest level, computers store values as groups of binary
digits, or "bits". Modern computers group bits into groups of eight,
called "bytes". Advanced applications sometimes have to manipulate
bits directly, and `gawk' provides functions for doing so.
-While you are probably used to the idea of a number without a value
+ While you are probably used to the idea of a number without a value
(i.e., zero), it takes a bit more getting used to the idea of
zero-length character data. Nevertheless, such a thing exists. It is
called the "null string". The null string is character data that has
no value. In other words, it is empty. It is written in `awk' programs
like this: `""'.
-Humans are used to working in decimal; i.e., base 10. In base 10,
+ Humans are used to working in decimal; i.e., base 10. In base 10,
numbers go from 0 to 9, and then "roll over" into the next column.
(Remember grade school? 42 is 4 times 10 plus 2.)
-There are other number bases though. Computers commonly use base 2 or
-"binary", base 8 or "octal", and base 16 or "hexadecimal". In binary,
-each column represents two times the value in the column to its right.
-Each column may contain either a 0 or a 1. Thus, binary 1010
+ There are other number bases though. Computers commonly use base 2
+or "binary", base 8 or "octal", and base 16 or "hexadecimal". In
+binary, each column represents two times the value in the column to its
+right. Each column may contain either a 0 or a 1. Thus, binary 1010
represents 1 times 8, plus 0 times 4, plus 1 times 2, plus 0 times 1,
-or decimal 10. Octal and hexadecimal are discussed more in *Note
+or decimal 10. Octal and hexadecimal are discussed more in *note
Nondecimal-numbers::.
-Programs are written in programming languages. Hundreds, if not
+ Programs are written in programming languages. Hundreds, if not
thousands, of programming languages exist. One of the most popular is
the C programming language. The C language had a very strong influence
on the design of the `awk' language.
-There have been several versions of C. The first is often referred to
-as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie,
+ There have been several versions of C. The first is often referred
+to as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie,
the authors of the first book on C. (Dennis Ritchie created the
language, and Brian Kernighan was one of the creators of `awk'.)
-In the mid-1980s, an effort began to produce an international standard
-for C. This work culminated in 1989, with the production of the ANSI
-standard for C. This standard became an ISO standard in 1990. Where
-it makes sense, POSIX `awk' is compatible with 1990 ISO C.
+ In the mid-1980s, an effort began to produce an international
+standard for C. This work culminated in 1989, with the production of
+the ANSI standard for C. This standard became an ISO standard in 1990.
+Where it makes sense, POSIX `awk' is compatible with 1990 ISO C.
-In 1999, a revised ISO C standard was approved and released. Future
+ In 1999, a revised ISO C standard was approved and released. Future
versions of `gawk' will be as compatible as possible with this standard.

@@ -19726,19 +19950,36 @@ double-precision floating-point numbers to represent all numeric
values. This minor node describes some of the issues involved in using
floating-point numbers.
-There is a very nice paper on floating-point arithmetic by David
+ There is a very nice paper on floating-point arithmetic by David
Goldberg, "What Every Computer Scientist Should Know About
Floating-point Arithmetic," `ACM Computing Surveys' *23*, 1 (1991-03),
5-48.(1) This is worth reading if you are interested in the details,
but it does require a background in computer science.
+* Menu:
+
+* String Conversion Precision:: The String Value Can Lie.
+* Unexpected Results:: Floating Point Numbers Are Not
+ Abstract Numbers.
+* POSIX Floating Point Problems:: Standards Versus Existing Practice.
+
+ ---------- Footnotes ----------
+
+ (1) `http://www.validlab.com/goldberg/paper.ps'.
+
+
+File: gawk.info, Node: String Conversion Precision, Next: Unexpected Results, Up: Floating Point Issues
+
+D.3.1 The String Value Can Lie
+------------------------------
+
Internally, `awk' keeps both the numeric value (double-precision
floating-point) and the string value for a variable. Separately, `awk'
keeps track of what type the variable has (*note Typing and
Comparison::), which plays a role in how variables are used in
comparisons.
-It is important to note that the string value for a number may not
+ It is important to note that the string value for a number may not
reflect the full value (all the digits) that the numeric value actually
contains. The following program (`values.awk') illustrates this:
@@ -19757,21 +19998,32 @@ This program shows the full value of the sum of `$2' and `$3' using
`printf', and then prints the string values obtained from both
automatic conversion (via `CONVFMT') and from printing (via `OFMT').
-Here is what happens when the program is run:
+ Here is what happens when the program is run:
$ echo 2 3.654321 1.2345678 | awk -f values.awk
-| $1 = 4.8888888
-| a = <4.88889>
-| $1 = 4.88889
-This makes it clear that the full numeric value is different from what
-the default string representations show.
+ This makes it clear that the full numeric value is different from
+what the default string representations show.
-`CONVFMT''s default value is `"%.6g"', which yields a value with at
+ `CONVFMT''s default value is `"%.6g"', which yields a value with at
least six significant digits. For some applications, you might want to
change it to specify more precision. On most modern machines, most of
the time, 17 digits is enough to capture a floating-point number's
-value exactly.(2)
+value exactly.(1)
+
+ ---------- Footnotes ----------
+
+ (1) Pathological cases can require up to 752 digits (!), but we
+doubt that you need to worry about this.
+
+
+File: gawk.info, Node: Unexpected Results, Next: POSIX Floating Point Problems, Prev: String Conversion Precision, Up: Floating Point Issues
+
+D.3.2 Floating Point Numbers Are Not Abstract Numbers
+-----------------------------------------------------
Unlike numbers in the abstract sense (such as what you studied in high
school or college math), numbers stored in computers are limited in
@@ -19795,14 +20047,14 @@ This shows that some values can be represented exactly, whereas others
are only approximated. This is not a "bug" in `awk', but simply an
artifact of how computers represent numbers.
-Another peculiarity of floating-point numbers on modern systems is that
-they often have more than one representation for the number zero! In
-particular, it is possible to represent "minus zero" as well as
+ Another peculiarity of floating-point numbers on modern systems is
+that they often have more than one representation for the number zero!
+In particular, it is possible to represent "minus zero" as well as
regular, or "positive" zero.
-This example shows that negative and positive zero are distinct values
-when stored internally, but that they are in fact equal to each other,
-as well as to "regular" zero:
+ This example shows that negative and positive zero are distinct
+values when stored internally, but that they are in fact equal to each
+other, as well as to "regular" zero:
$ gawk 'BEGIN { mz = -0 ; pz = 0
> printf "-0 = %g, +0 = %g, (-0 == +0) -> %d\n", mz, pz, mz == pz
@@ -19811,16 +20063,88 @@ as well as to "regular" zero:
-| -0 = -0, +0 = 0, (-0 == +0) -> 1
-| mz == 0 -> 1, pz == 0 -> 1
-It helps to keep this in mind should you process numeric data that
+ It helps to keep this in mind should you process numeric data that
contains negative zero values; the fact that the zero is negative is
noted and can affect comparisons.
----------- Footnotes ----------
+
+File: gawk.info, Node: POSIX Floating Point Problems, Prev: Unexpected Results, Up: Floating Point Issues
+
+D.3.3 Standards Versus Existing Practice
+----------------------------------------
+
+Historically, `awk' has converted any non-numeric looking string to the
+numeric value zero, when required. Furthermore, the original
+definition of the language and the original POSIX standards specified
+that `awk' only understands decimal numbers (base 10), and not octal
+(base 8) or hexadecimal numbers (base 16).
+
+ As of this writing (February, 2007), changes in the language of the
+current POSIX standard can be interpreted to imply that `awk' should
+support additional features. These features are:
+
+ * Interpretation of floating point data values specified in
+ hexadecimal notation (`0xDEADBEEF'). (Note: data values, _not_
+ source code constants.)
+
+ * Support for the special IEEE 754 floating point values "Not A
+ Number" (NaN), positive Infinity ("inf") and negative Infinity
+ ("-inf"). In particular, the format for these values is as
+ specified by the ISO C99 standard, which ignores case and can
+ allow machine-dependent additional characters after the `nan' and
+ allow either `inf' or `infinity'.
+
+ The first problem is that both of these are clear changes to
+historical practice:
-(1) `http://www.validlab.com/goldberg/paper.ps'.
+ * The `gawk' maintainer feels that hexadecimal floating point
+ values, in particular, is ugly, and was never intended by the
+ original designers to be part of the language.
-(2) Pathological cases can require up to 752 digits (!), but we doubt
-that you need to worry about this.
+ * Allowing completely alphabetic strings to have valid numeric
+ values is also a very severe departure from historical practice.
+
+ The second problem is that the `gawk' maintainer feels that this
+interpretation of the standard, which requires a certain amount of
+"language lawyering" to arrive at in the first place, was not intended
+by the standard developers, either. In other words, "we see how you
+got where you are, but we don't think that that's where you want to be."
+
+ Nevertheless, on systems that support IEEE floating point, it seems
+reasonable to provide _some_ way to support NaN and Infinity values.
+The solution implemented in `gawk', as of version 3.1.6, is as follows:
+
+ 1. With the `--posix' command-line option, `gawk' becomes "hands
+ off." String values are passed directly to the system library's
+ `strtod()' function, and if it successfuly returns a numeric value,
+ that is what's used. By definition, the results are not portable
+ across different systems.(1) They are also a little surprising:
+
+ $ echo nanny | gawk --posix '{ print $1 + 0 }'
+ -| nan
+ $ echo 0xDeadBeef | gawk --posix '{ print $1 + 0 }'
+ -| 3735928559
+
+ 2. Without `--posix', `gawk' interprets the four strings `+inf',
+ `-inf', `+nan', and `-nan' specially, producing the corresponding
+ special numeric values. The leading sign acts a signal to `gawk'
+ (and the user) that the value is really numeric. Hexadecimal
+ floating point is not supported (unless you also use
+ `--non-decimal-data', which is _not_ recommended). For example:
+
+ $ echo nanny | gawk '{ print $1 + 0 }'
+ -| 0
+ $ echo +nan | gawk '{ print $1 + 0 }'
+ -| nan
+ $ echo 0xDeadBeef | gawk '{ print $1 + 0 }'
+ -| 0
+
+ `gawk' does ignore case distinction in the four special values.
+ Thus `+nan' and `+NaN' are the same.
+
+ ---------- Footnotes ----------
+
+ (1) You asked for it, you got it.

File: gawk.info, Node: Glossary, Next: Copying, Prev: Basic Concepts, Up: Top
@@ -19904,7 +20228,7 @@ Bit
floating-point numbers, character data, addresses of other memory
objects, or other data. `awk' lets you work with floating-point
numbers and strings. `gawk' lets you manipulate bit values with
- the built-in functions described in *Note Bitwise Functions::.
+ the built-in functions described in *note Bitwise Functions::.
Computers are often defined by how many bits they use to represent
integer values. Typical systems are 32-bit systems, but 64-bit
@@ -20075,7 +20399,7 @@ Field
change by setting the built-in variable `FS'). Such pieces are
called fields. If the pieces are of fixed length, you can use the
built-in variable `FIELDWIDTHS' to describe their lengths. (*Note
- Field Separators::, and *Note Constant Size::.)
+ Field Separators::, and *note Constant Size::.)
Flag
A variable whose truth value indicates the existence or
@@ -20190,7 +20514,10 @@ Keyword
`gawk''s keywords are: `BEGIN', `END', `if', `else', `while',
`do...while', `for', `for...in', `break', `continue', `delete',
- `next', `nextfile', `function', `func', and `exit'.
+ `next', `nextfile', `function', `func', and `exit'. If `gawk' was
+ configured with the `--enable-switch' option (*note Switch
+ Statement::), then `switch', `case', and `default' are also
+ keywords.
Lesser General Public License
This document describes the terms under which binary library
@@ -20294,7 +20621,7 @@ Redirection
You can redirect the output of the `print' and `printf' statements
to a file or a system command, using the `>', `>>', `|', and `|&'
operators. You can redirect input to the `getline' statement using
- the `<', `|', and `|&' operators. (*Note Redirection::, and *Note
+ the `<', `|', and `|&' operators. (*Note Redirection::, and *note
Getline::.)
Regexp
@@ -20426,294 +20753,665 @@ File: gawk.info, Node: Copying, Next: GNU Free Documentation License, Prev: G
GNU General Public License
**************************
- Version 2, June 1991
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
- 51 Franklin Street, Fifth Floor, Boston, MA 02111, USA
+ Version 3, 29 June 2007
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
+ Copyright (C) 2007 Free Software Foundation, Inc. `http://fsf.org/'
+
+ Everyone is permitted to copy and distribute verbatim copies of this
+ license document, but changing it is not allowed.
Preamble
========
-The licenses for most software are designed to take away your freedom
-to share and change it. By contrast, the GNU General Public License is
-intended to guarantee your freedom to share and change free
-software--to make sure the software is free for all its users. This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it. (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.) You can apply it to
-your programs, too.
-
-When we speak of free software, we are referring to freedom, not price.
-Our General Public Licenses are designed to make sure that you have
-the freedom to distribute copies of free software (and charge for this
-service if you wish), that you receive source code or can get it if you
+The GNU General Public License is a free, copyleft license for software
+and other kinds of works.
+
+ The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works. By contrast,
+the GNU General Public License is intended to guarantee your freedom to
+share and change all versions of a program--to make sure it remains
+free software for all its users. We, the Free Software Foundation, use
+the GNU General Public License for most of our software; it applies
+also to any other work released this way by its authors. You can apply
+it to your programs, too.
+
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+them if you wish), that you receive source code or can get it if you
want it, that you can change the software or use pieces of it in new
-free programs; and that you know you can do these things.
-
-To protect your rights, we need to make restrictions that forbid anyone
-to deny you these rights or to ask you to surrender the rights. These
-restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
-
-For example, if you distribute copies of such a program, whether gratis
-or for a fee, you must give the recipients all the rights that you
-have. You must make sure that they, too, receive or can get the source
-code. And you must show them these terms so they know their rights.
-
-We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
-
-Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software. If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
-
-Finally, any free program is threatened constantly by software patents.
-We wish to avoid the danger that redistributors of a free program will
-individually obtain patent licenses, in effect making the program
-proprietary. To prevent this, we have made it clear that any patent
-must be licensed for everyone's free use or not licensed at all.
-
-The precise terms and conditions for copying, distribution and
+free programs, and that you know you can do these things.
+
+ To protect your rights, we need to prevent others from denying you
+these rights or asking you to surrender the rights. Therefore, you
+have certain responsibilities if you distribute copies of the software,
+or if you modify it: responsibilities to respect the freedom of others.
+
+ For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must pass on to the recipients the same
+freedoms that you received. You must make sure that they, too, receive
+or can get the source code. And you must show them these terms so they
+know their rights.
+
+ Developers that use the GNU GPL protect your rights with two steps:
+(1) assert copyright on the software, and (2) offer you this License
+giving you legal permission to copy, distribute and/or modify it.
+
+ For the developers' and authors' protection, the GPL clearly explains
+that there is no warranty for this free software. For both users' and
+authors' sake, the GPL requires that modified versions be marked as
+changed, so that their problems will not be attributed erroneously to
+authors of previous versions.
+
+ Some devices are designed to deny users access to install or run
+modified versions of the software inside them, although the
+manufacturer can do so. This is fundamentally incompatible with the
+aim of protecting users' freedom to change the software. The
+systematic pattern of such abuse occurs in the area of products for
+individuals to use, which is precisely where it is most unacceptable.
+Therefore, we have designed this version of the GPL to prohibit the
+practice for those products. If such problems arise substantially in
+other domains, we stand ready to extend this provision to those domains
+in future versions of the GPL, as needed to protect the freedom of
+users.
+
+ Finally, every program is threatened constantly by software patents.
+States should not allow patents to restrict development and use of
+software on general-purpose computers, but in those that do, we wish to
+avoid the special danger that patents applied to a free program could
+make it effectively proprietary. To prevent this, the GPL assures that
+patents cannot be used to render the program non-free.
+
+ The precise terms and conditions for copying, distribution and
modification follow.
- TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
- 0. This License applies to any program or other work which contains a
- notice placed by the copyright holder saying it may be distributed
- under the terms of this General Public License. The "Program",
- below, refers to any such program or work, and a "work based on
- the Program" means either the Program or any derivative work under
- copyright law: that is to say, a work containing the Program or a
- portion of it, either verbatim or with modifications and/or
- translated into another language. (Hereinafter, translation is
- included without limitation in the term "modification".) Each
- licensee is addressed as "you".
-
- Activities other than copying, distribution and modification are
- not covered by this License; they are outside its scope. The act
- of running the Program is not restricted, and the output from the
- Program is covered only if its contents constitute a work based on
- the Program (independent of having been made by running the
- Program). Whether that is true depends on what the Program does.
-
- 1. You may copy and distribute verbatim copies of the Program's
- source code as you receive it, in any medium, provided that you
- conspicuously and appropriately publish on each copy an appropriate
- copyright notice and disclaimer of warranty; keep intact all the
- notices that refer to this License and to the absence of any
- warranty; and give any other recipients of the Program a copy of
- this License along with the Program.
-
- You may charge a fee for the physical act of transferring a copy,
- and you may at your option offer warranty protection in exchange
- for a fee.
-
- 2. You may modify your copy or copies of the Program or any portion
- of it, thus forming a work based on the Program, and copy and
- distribute such modifications or work under the terms of Section 1
- above, provided that you also meet all of these conditions:
-
- a. You must cause the modified files to carry prominent notices
- stating that you changed the files and the date of any change.
-
- b. You must cause any work that you distribute or publish, that
- in whole or in part contains or is derived from the Program
- or any part thereof, to be licensed as a whole at no charge
- to all third parties under the terms of this License.
-
- c. If the modified program normally reads commands interactively
- when run, you must cause it, when started running for such
- interactive use in the most ordinary way, to print or display
- an announcement including an appropriate copyright notice and
- a notice that there is no warranty (or else, saying that you
- provide a warranty) and that users may redistribute the
- program under these conditions, and telling the user how to
- view a copy of this License. (Exception: if the Program
- itself is interactive but does not normally print such an
- announcement, your work based on the Program is not required
- to print an announcement.)
-
- These requirements apply to the modified work as a whole. If
- identifiable sections of that work are not derived from the
- Program, and can be reasonably considered independent and separate
- works in themselves, then this License, and its terms, do not
- apply to those sections when you distribute them as separate
- works. But when you distribute the same sections as part of a
- whole which is a work based on the Program, the distribution of
- the whole must be on the terms of this License, whose permissions
- for other licensees extend to the entire whole, and thus to each
- and every part regardless of who wrote it.
-
- Thus, it is not the intent of this section to claim rights or
- contest your rights to work written entirely by you; rather, the
- intent is to exercise the right to control the distribution of
- derivative or collective works based on the Program.
-
- In addition, mere aggregation of another work not based on the
- Program with the Program (or with a work based on the Program) on
- a volume of a storage or distribution medium does not bring the
- other work under the scope of this License.
-
- 3. You may copy and distribute the Program (or a work based on it,
- under Section 2) in object code or executable form under the terms
- of Sections 1 and 2 above provided that you also do one of the
- following:
-
- a. Accompany it with the complete corresponding machine-readable
- source code, which must be distributed under the terms of
- Sections 1 and 2 above on a medium customarily used for
- software interchange; or,
-
- b. Accompany it with a written offer, valid for at least three
- years, to give any third party, for a charge no more than your
- cost of physically performing source distribution, a complete
- machine-readable copy of the corresponding source code, to be
- distributed under the terms of Sections 1 and 2 above on a
- medium customarily used for software interchange; or,
-
- c. Accompany it with the information you received as to the offer
- to distribute corresponding source code. (This alternative is
- allowed only for noncommercial distribution and only if you
- received the program in object code or executable form with
- such an offer, in accord with Subsection b above.)
-
- The source code for a work means the preferred form of the work for
- making modifications to it. For an executable work, complete
- source code means all the source code for all modules it contains,
- plus any associated interface definition files, plus the scripts
- used to control compilation and installation of the executable.
- However, as a special exception, the source code distributed need
- not include anything that is normally distributed (in either
- source or binary form) with the major components (compiler,
- kernel, and so on) of the operating system on which the executable
- runs, unless that component itself accompanies the executable.
-
- If distribution of executable or object code is made by offering
- access to copy from a designated place, then offering equivalent
- access to copy the source code from the same place counts as
- distribution of the source code, even though third parties are not
- compelled to copy the source along with the object code.
-
- 4. You may not copy, modify, sublicense, or distribute the Program
- except as expressly provided under this License. Any attempt
- otherwise to copy, modify, sublicense or distribute the Program is
- void, and will automatically terminate your rights under this
- License. However, parties who have received copies, or rights,
- from you under this License will not have their licenses
- terminated so long as such parties remain in full compliance.
+TERMS AND CONDITIONS
+====================
- 5. You are not required to accept this License, since you have not
- signed it. However, nothing else grants you permission to modify
- or distribute the Program or its derivative works. These actions
- are prohibited by law if you do not accept this License.
- Therefore, by modifying or distributing the Program (or any work
- based on the Program), you indicate your acceptance of this
- License to do so, and all its terms and conditions for copying,
- distributing or modifying the Program or works based on it.
-
- 6. Each time you redistribute the Program (or any work based on the
- Program), the recipient automatically receives a license from the
- original licensor to copy, distribute or modify the Program
- subject to these terms and conditions. You may not impose any
- further restrictions on the recipients' exercise of the rights
- granted herein. You are not responsible for enforcing compliance
- by third parties to this License.
-
- 7. If, as a consequence of a court judgment or allegation of patent
- infringement or for any other reason (not limited to patent
- issues), conditions are imposed on you (whether by court order,
+ 0. Definitions.
+
+ "This License" refers to version 3 of the GNU General Public
+ License.
+
+ "Copyright" also means copyright-like laws that apply to other
+ kinds of works, such as semiconductor masks.
+
+ "The Program" refers to any copyrightable work licensed under this
+ License. Each licensee is addressed as "you". "Licensees" and
+ "recipients" may be individuals or organizations.
+
+ To "modify" a work means to copy from or adapt all or part of the
+ work in a fashion requiring copyright permission, other than the
+ making of an exact copy. The resulting work is called a "modified
+ version" of the earlier work or a work "based on" the earlier work.
+
+ A "covered work" means either the unmodified Program or a work
+ based on the Program.
+
+ To "propagate" a work means to do anything with it that, without
+ permission, would make you directly or secondarily liable for
+ infringement under applicable copyright law, except executing it
+ on a computer or modifying a private copy. Propagation includes
+ copying, distribution (with or without modification), making
+ available to the public, and in some countries other activities as
+ well.
+
+ To "convey" a work means any kind of propagation that enables other
+ parties to make or receive copies. Mere interaction with a user
+ through a computer network, with no transfer of a copy, is not
+ conveying.
+
+ An interactive user interface displays "Appropriate Legal Notices"
+ to the extent that it includes a convenient and prominently visible
+ feature that (1) displays an appropriate copyright notice, and (2)
+ tells the user that there is no warranty for the work (except to
+ the extent that warranties are provided), that licensees may
+ convey the work under this License, and how to view a copy of this
+ License. If the interface presents a list of user commands or
+ options, such as a menu, a prominent item in the list meets this
+ criterion.
+
+ 1. Source Code.
+
+ The "source code" for a work means the preferred form of the work
+ for making modifications to it. "Object code" means any
+ non-source form of a work.
+
+ A "Standard Interface" means an interface that either is an
+ official standard defined by a recognized standards body, or, in
+ the case of interfaces specified for a particular programming
+ language, one that is widely used among developers working in that
+ language.
+
+ The "System Libraries" of an executable work include anything,
+ other than the work as a whole, that (a) is included in the normal
+ form of packaging a Major Component, but which is not part of that
+ Major Component, and (b) serves only to enable use of the work
+ with that Major Component, or to implement a Standard Interface
+ for which an implementation is available to the public in source
+ code form. A "Major Component", in this context, means a major
+ essential component (kernel, window system, and so on) of the
+ specific operating system (if any) on which the executable work
+ runs, or a compiler used to produce the work, or an object code
+ interpreter used to run it.
+
+ The "Corresponding Source" for a work in object code form means all
+ the source code needed to generate, install, and (for an executable
+ work) run the object code and to modify the work, including
+ scripts to control those activities. However, it does not include
+ the work's System Libraries, or general-purpose tools or generally
+ available free programs which are used unmodified in performing
+ those activities but which are not part of the work. For example,
+ Corresponding Source includes interface definition files
+ associated with source files for the work, and the source code for
+ shared libraries and dynamically linked subprograms that the work
+ is specifically designed to require, such as by intimate data
+ communication or control flow between those subprograms and other
+ parts of the work.
+
+ The Corresponding Source need not include anything that users can
+ regenerate automatically from other parts of the Corresponding
+ Source.
+
+ The Corresponding Source for a work in source code form is that
+ same work.
+
+ 2. Basic Permissions.
+
+ All rights granted under this License are granted for the term of
+ copyright on the Program, and are irrevocable provided the stated
+ conditions are met. This License explicitly affirms your unlimited
+ permission to run the unmodified Program. The output from running
+ a covered work is covered by this License only if the output,
+ given its content, constitutes a covered work. This License
+ acknowledges your rights of fair use or other equivalent, as
+ provided by copyright law.
+
+ You may make, run and propagate covered works that you do not
+ convey, without conditions so long as your license otherwise
+ remains in force. You may convey covered works to others for the
+ sole purpose of having them make modifications exclusively for
+ you, or provide you with facilities for running those works,
+ provided that you comply with the terms of this License in
+ conveying all material for which you do not control copyright.
+ Those thus making or running the covered works for you must do so
+ exclusively on your behalf, under your direction and control, on
+ terms that prohibit them from making any copies of your
+ copyrighted material outside their relationship with you.
+
+ Conveying under any other circumstances is permitted solely under
+ the conditions stated below. Sublicensing is not allowed; section
+ 10 makes it unnecessary.
+
+ 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+ No covered work shall be deemed part of an effective technological
+ measure under any applicable law fulfilling obligations under
+ article 11 of the WIPO copyright treaty adopted on 20 December
+ 1996, or similar laws prohibiting or restricting circumvention of
+ such measures.
+
+ When you convey a covered work, you waive any legal power to forbid
+ circumvention of technological measures to the extent such
+ circumvention is effected by exercising rights under this License
+ with respect to the covered work, and you disclaim any intention
+ to limit operation or modification of the work as a means of
+ enforcing, against the work's users, your or third parties' legal
+ rights to forbid circumvention of technological measures.
+
+ 4. Conveying Verbatim Copies.
+
+ You may convey verbatim copies of the Program's source code as you
+ receive it, in any medium, provided that you conspicuously and
+ appropriately publish on each copy an appropriate copyright notice;
+ keep intact all notices stating that this License and any
+ non-permissive terms added in accord with section 7 apply to the
+ code; keep intact all notices of the absence of any warranty; and
+ give all recipients a copy of this License along with the Program.
+
+ You may charge any price or no price for each copy that you convey,
+ and you may offer support or warranty protection for a fee.
+
+ 5. Conveying Modified Source Versions.
+
+ You may convey a work based on the Program, or the modifications to
+ produce it from the Program, in the form of source code under the
+ terms of section 4, provided that you also meet all of these
+ conditions:
+
+ a. The work must carry prominent notices stating that you
+ modified it, and giving a relevant date.
+
+ b. The work must carry prominent notices stating that it is
+ released under this License and any conditions added under
+ section 7. This requirement modifies the requirement in
+ section 4 to "keep intact all notices".
+
+ c. You must license the entire work, as a whole, under this
+ License to anyone who comes into possession of a copy. This
+ License will therefore apply, along with any applicable
+ section 7 additional terms, to the whole of the work, and all
+ its parts, regardless of how they are packaged. This License
+ gives no permission to license the work in any other way, but
+ it does not invalidate such permission if you have separately
+ received it.
+
+ d. If the work has interactive user interfaces, each must display
+ Appropriate Legal Notices; however, if the Program has
+ interactive interfaces that do not display Appropriate Legal
+ Notices, your work need not make them do so.
+
+ A compilation of a covered work with other separate and independent
+ works, which are not by their nature extensions of the covered
+ work, and which are not combined with it such as to form a larger
+ program, in or on a volume of a storage or distribution medium, is
+ called an "aggregate" if the compilation and its resulting
+ copyright are not used to limit the access or legal rights of the
+ compilation's users beyond what the individual works permit.
+ Inclusion of a covered work in an aggregate does not cause this
+ License to apply to the other parts of the aggregate.
+
+ 6. Conveying Non-Source Forms.
+
+ You may convey a covered work in object code form under the terms
+ of sections 4 and 5, provided that you also convey the
+ machine-readable Corresponding Source under the terms of this
+ License, in one of these ways:
+
+ a. Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by the
+ Corresponding Source fixed on a durable physical medium
+ customarily used for software interchange.
+
+ b. Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by a
+ written offer, valid for at least three years and valid for
+ as long as you offer spare parts or customer support for that
+ product model, to give anyone who possesses the object code
+ either (1) a copy of the Corresponding Source for all the
+ software in the product that is covered by this License, on a
+ durable physical medium customarily used for software
+ interchange, for a price no more than your reasonable cost of
+ physically performing this conveying of source, or (2) access
+ to copy the Corresponding Source from a network server at no
+ charge.
+
+ c. Convey individual copies of the object code with a copy of
+ the written offer to provide the Corresponding Source. This
+ alternative is allowed only occasionally and noncommercially,
+ and only if you received the object code with such an offer,
+ in accord with subsection 6b.
+
+ d. Convey the object code by offering access from a designated
+ place (gratis or for a charge), and offer equivalent access
+ to the Corresponding Source in the same way through the same
+ place at no further charge. You need not require recipients
+ to copy the Corresponding Source along with the object code.
+ If the place to copy the object code is a network server, the
+ Corresponding Source may be on a different server (operated
+ by you or a third party) that supports equivalent copying
+ facilities, provided you maintain clear directions next to
+ the object code saying where to find the Corresponding Source.
+ Regardless of what server hosts the Corresponding Source, you
+ remain obligated to ensure that it is available for as long
+ as needed to satisfy these requirements.
+
+ e. Convey the object code using peer-to-peer transmission,
+ provided you inform other peers where the object code and
+ Corresponding Source of the work are being offered to the
+ general public at no charge under subsection 6d.
+
+
+ A separable portion of the object code, whose source code is
+ excluded from the Corresponding Source as a System Library, need
+ not be included in conveying the object code work.
+
+ A "User Product" is either (1) a "consumer product", which means
+ any tangible personal property which is normally used for personal,
+ family, or household purposes, or (2) anything designed or sold for
+ incorporation into a dwelling. In determining whether a product
+ is a consumer product, doubtful cases shall be resolved in favor of
+ coverage. For a particular product received by a particular user,
+ "normally used" refers to a typical or common use of that class of
+ product, regardless of the status of the particular user or of the
+ way in which the particular user actually uses, or expects or is
+ expected to use, the product. A product is a consumer product
+ regardless of whether the product has substantial commercial,
+ industrial or non-consumer uses, unless such uses represent the
+ only significant mode of use of the product.
+
+ "Installation Information" for a User Product means any methods,
+ procedures, authorization keys, or other information required to
+ install and execute modified versions of a covered work in that
+ User Product from a modified version of its Corresponding Source.
+ The information must suffice to ensure that the continued
+ functioning of the modified object code is in no case prevented or
+ interfered with solely because modification has been made.
+
+ If you convey an object code work under this section in, or with,
+ or specifically for use in, a User Product, and the conveying
+ occurs as part of a transaction in which the right of possession
+ and use of the User Product is transferred to the recipient in
+ perpetuity or for a fixed term (regardless of how the transaction
+ is characterized), the Corresponding Source conveyed under this
+ section must be accompanied by the Installation Information. But
+ this requirement does not apply if neither you nor any third party
+ retains the ability to install modified object code on the User
+ Product (for example, the work has been installed in ROM).
+
+ The requirement to provide Installation Information does not
+ include a requirement to continue to provide support service,
+ warranty, or updates for a work that has been modified or
+ installed by the recipient, or for the User Product in which it
+ has been modified or installed. Access to a network may be denied
+ when the modification itself materially and adversely affects the
+ operation of the network or violates the rules and protocols for
+ communication across the network.
+
+ Corresponding Source conveyed, and Installation Information
+ provided, in accord with this section must be in a format that is
+ publicly documented (and with an implementation available to the
+ public in source code form), and must require no special password
+ or key for unpacking, reading or copying.
+
+ 7. Additional Terms.
+
+ "Additional permissions" are terms that supplement the terms of
+ this License by making exceptions from one or more of its
+ conditions. Additional permissions that are applicable to the
+ entire Program shall be treated as though they were included in
+ this License, to the extent that they are valid under applicable
+ law. If additional permissions apply only to part of the Program,
+ that part may be used separately under those permissions, but the
+ entire Program remains governed by this License without regard to
+ the additional permissions.
+
+ When you convey a copy of a covered work, you may at your option
+ remove any additional permissions from that copy, or from any part
+ of it. (Additional permissions may be written to require their own
+ removal in certain cases when you modify the work.) You may place
+ additional permissions on material, added by you to a covered work,
+ for which you have or can give appropriate copyright permission.
+
+ Notwithstanding any other provision of this License, for material
+ you add to a covered work, you may (if authorized by the copyright
+ holders of that material) supplement the terms of this License
+ with terms:
+
+ a. Disclaiming warranty or limiting liability differently from
+ the terms of sections 15 and 16 of this License; or
+
+ b. Requiring preservation of specified reasonable legal notices
+ or author attributions in that material or in the Appropriate
+ Legal Notices displayed by works containing it; or
+
+ c. Prohibiting misrepresentation of the origin of that material,
+ or requiring that modified versions of such material be
+ marked in reasonable ways as different from the original
+ version; or
+
+ d. Limiting the use for publicity purposes of names of licensors
+ or authors of the material; or
+
+ e. Declining to grant rights under trademark law for use of some
+ trade names, trademarks, or service marks; or
+
+ f. Requiring indemnification of licensors and authors of that
+ material by anyone who conveys the material (or modified
+ versions of it) with contractual assumptions of liability to
+ the recipient, for any liability that these contractual
+ assumptions directly impose on those licensors and authors.
+
+ All other non-permissive additional terms are considered "further
+ restrictions" within the meaning of section 10. If the Program as
+ you received it, or any part of it, contains a notice stating that
+ it is governed by this License along with a term that is a further
+ restriction, you may remove that term. If a license document
+ contains a further restriction but permits relicensing or
+ conveying under this License, you may add to a covered work
+ material governed by the terms of that license document, provided
+ that the further restriction does not survive such relicensing or
+ conveying.
+
+ If you add terms to a covered work in accord with this section, you
+ must place, in the relevant source files, a statement of the
+ additional terms that apply to those files, or a notice indicating
+ where to find the applicable terms.
+
+ Additional terms, permissive or non-permissive, may be stated in
+ the form of a separately written license, or stated as exceptions;
+ the above requirements apply either way.
+
+ 8. Termination.
+
+ You may not propagate or modify a covered work except as expressly
+ provided under this License. Any attempt otherwise to propagate or
+ modify it is void, and will automatically terminate your rights
+ under this License (including any patent licenses granted under
+ the third paragraph of section 11).
+
+ However, if you cease all violation of this License, then your
+ license from a particular copyright holder is reinstated (a)
+ provisionally, unless and until the copyright holder explicitly
+ and finally terminates your license, and (b) permanently, if the
+ copyright holder fails to notify you of the violation by some
+ reasonable means prior to 60 days after the cessation.
+
+ Moreover, your license from a particular copyright holder is
+ reinstated permanently if the copyright holder notifies you of the
+ violation by some reasonable means, this is the first time you have
+ received notice of violation of this License (for any work) from
+ that copyright holder, and you cure the violation prior to 30 days
+ after your receipt of the notice.
+
+ Termination of your rights under this section does not terminate
+ the licenses of parties who have received copies or rights from
+ you under this License. If your rights have been terminated and
+ not permanently reinstated, you do not qualify to receive new
+ licenses for the same material under section 10.
+
+ 9. Acceptance Not Required for Having Copies.
+
+ You are not required to accept this License in order to receive or
+ run a copy of the Program. Ancillary propagation of a covered work
+ occurring solely as a consequence of using peer-to-peer
+ transmission to receive a copy likewise does not require
+ acceptance. However, nothing other than this License grants you
+ permission to propagate or modify any covered work. These actions
+ infringe copyright if you do not accept this License. Therefore,
+ by modifying or propagating a covered work, you indicate your
+ acceptance of this License to do so.
+
+ 10. Automatic Licensing of Downstream Recipients.
+
+ Each time you convey a covered work, the recipient automatically
+ receives a license from the original licensors, to run, modify and
+ propagate that work, subject to this License. You are not
+ responsible for enforcing compliance by third parties with this
+ License.
+
+ An "entity transaction" is a transaction transferring control of an
+ organization, or substantially all assets of one, or subdividing an
+ organization, or merging organizations. If propagation of a
+ covered work results from an entity transaction, each party to that
+ transaction who receives a copy of the work also receives whatever
+ licenses to the work the party's predecessor in interest had or
+ could give under the previous paragraph, plus a right to
+ possession of the Corresponding Source of the work from the
+ predecessor in interest, if the predecessor has it or can get it
+ with reasonable efforts.
+
+ You may not impose any further restrictions on the exercise of the
+ rights granted or affirmed under this License. For example, you
+ may not impose a license fee, royalty, or other charge for
+ exercise of rights granted under this License, and you may not
+ initiate litigation (including a cross-claim or counterclaim in a
+ lawsuit) alleging that any patent claim is infringed by making,
+ using, selling, offering for sale, or importing the Program or any
+ portion of it.
+
+ 11. Patents.
+
+ A "contributor" is a copyright holder who authorizes use under this
+ License of the Program or a work on which the Program is based.
+ The work thus licensed is called the contributor's "contributor
+ version".
+
+ A contributor's "essential patent claims" are all patent claims
+ owned or controlled by the contributor, whether already acquired or
+ hereafter acquired, that would be infringed by some manner,
+ permitted by this License, of making, using, or selling its
+ contributor version, but do not include claims that would be
+ infringed only as a consequence of further modification of the
+ contributor version. For purposes of this definition, "control"
+ includes the right to grant patent sublicenses in a manner
+ consistent with the requirements of this License.
+
+ Each contributor grants you a non-exclusive, worldwide,
+ royalty-free patent license under the contributor's essential
+ patent claims, to make, use, sell, offer for sale, import and
+ otherwise run, modify and propagate the contents of its
+ contributor version.
+
+ In the following three paragraphs, a "patent license" is any
+ express agreement or commitment, however denominated, not to
+ enforce a patent (such as an express permission to practice a
+ patent or covenant not to sue for patent infringement). To
+ "grant" such a patent license to a party means to make such an
+ agreement or commitment not to enforce a patent against the party.
+
+ If you convey a covered work, knowingly relying on a patent
+ license, and the Corresponding Source of the work is not available
+ for anyone to copy, free of charge and under the terms of this
+ License, through a publicly available network server or other
+ readily accessible means, then you must either (1) cause the
+ Corresponding Source to be so available, or (2) arrange to deprive
+ yourself of the benefit of the patent license for this particular
+ work, or (3) arrange, in a manner consistent with the requirements
+ of this License, to extend the patent license to downstream
+ recipients. "Knowingly relying" means you have actual knowledge
+ that, but for the patent license, your conveying the covered work
+ in a country, or your recipient's use of the covered work in a
+ country, would infringe one or more identifiable patents in that
+ country that you have reason to believe are valid.
+
+ If, pursuant to or in connection with a single transaction or
+ arrangement, you convey, or propagate by procuring conveyance of, a
+ covered work, and grant a patent license to some of the parties
+ receiving the covered work authorizing them to use, propagate,
+ modify or convey a specific copy of the covered work, then the
+ patent license you grant is automatically extended to all
+ recipients of the covered work and works based on it.
+
+ A patent license is "discriminatory" if it does not include within
+ the scope of its coverage, prohibits the exercise of, or is
+ conditioned on the non-exercise of one or more of the rights that
+ are specifically granted under this License. You may not convey a
+ covered work if you are a party to an arrangement with a third
+ party that is in the business of distributing software, under
+ which you make payment to the third party based on the extent of
+ your activity of conveying the work, and under which the third
+ party grants, to any of the parties who would receive the covered
+ work from you, a discriminatory patent license (a) in connection
+ with copies of the covered work conveyed by you (or copies made
+ from those copies), or (b) primarily for and in connection with
+ specific products or compilations that contain the covered work,
+ unless you entered into that arrangement, or that patent license
+ was granted, prior to 28 March 2007.
+
+ Nothing in this License shall be construed as excluding or limiting
+ any implied license or other defenses to infringement that may
+ otherwise be available to you under applicable patent law.
+
+ 12. No Surrender of Others' Freedom.
+
+ If conditions are imposed on you (whether by court order,
agreement or otherwise) that contradict the conditions of this
License, they do not excuse you from the conditions of this
- License. If you cannot distribute so as to satisfy simultaneously
- your obligations under this License and any other pertinent
- obligations, then as a consequence you may not distribute the
- Program at all. For example, if a patent license would not permit
- royalty-free redistribution of the Program by all those who
- receive copies directly or indirectly through you, then the only
- way you could satisfy both it and this License would be to refrain
- entirely from distribution of the Program.
-
- If any portion of this section is held invalid or unenforceable
- under any particular circumstance, the balance of the section is
- intended to apply and the section as a whole is intended to apply
- in other circumstances.
-
- It is not the purpose of this section to induce you to infringe any
- patents or other property right claims or to contest validity of
- any such claims; this section has the sole purpose of protecting
- the integrity of the free software distribution system, which is
- implemented by public license practices. Many people have made
- generous contributions to the wide range of software distributed
- through that system in reliance on consistent application of that
- system; it is up to the author/donor to decide if he or she is
- willing to distribute software through any other system and a
- licensee cannot impose that choice.
-
- This section is intended to make thoroughly clear what is believed
- to be a consequence of the rest of this License.
-
- 8. If the distribution and/or use of the Program is restricted in
- certain countries either by patents or by copyrighted interfaces,
- the original copyright holder who places the Program under this
- License may add an explicit geographical distribution limitation
- excluding those countries, so that distribution is permitted only
- in or among countries not thus excluded. In such case, this
- License incorporates the limitation as if written in the body of
- this License.
-
- 9. The Free Software Foundation may publish revised and/or new
- versions of the General Public License from time to time. Such
- new versions will be similar in spirit to the present version, but
- may differ in detail to address new problems or concerns.
+ License. If you cannot convey a covered work so as to satisfy
+ simultaneously your obligations under this License and any other
+ pertinent obligations, then as a consequence you may not convey it
+ at all. For example, if you agree to terms that obligate you to
+ collect a royalty for further conveying from those to whom you
+ convey the Program, the only way you could satisfy both those
+ terms and this License would be to refrain entirely from conveying
+ the Program.
+
+ 13. Use with the GNU Affero General Public License.
+
+ Notwithstanding any other provision of this License, you have
+ permission to link or combine any covered work with a work licensed
+ under version 3 of the GNU Affero General Public License into a
+ single combined work, and to convey the resulting work. The terms
+ of this License will continue to apply to the part which is the
+ covered work, but the special requirements of the GNU Affero
+ General Public License, section 13, concerning interaction through
+ a network will apply to the combination as such.
+
+ 14. Revised Versions of this License.
+
+ The Free Software Foundation may publish revised and/or new
+ versions of the GNU General Public License from time to time.
+ Such new versions will be similar in spirit to the present
+ version, but may differ in detail to address new problems or
+ concerns.
Each version is given a distinguishing version number. If the
- Program specifies a version number of this License which applies
- to it and "any later version", you have the option of following
- the terms and conditions either of that version or of any later
- version published by the Free Software Foundation. If the Program
- does not specify a version number of this License, you may choose
+ Program specifies that a certain numbered version of the GNU
+ General Public License "or any later version" applies to it, you
+ have the option of following the terms and conditions either of
+ that numbered version or of any later version published by the
+ Free Software Foundation. If the Program does not specify a
+ version number of the GNU General Public License, you may choose
any version ever published by the Free Software Foundation.
- 10. If you wish to incorporate parts of the Program into other free
- programs whose distribution conditions are different, write to the
- author to ask for permission. For software which is copyrighted
- by the Free Software Foundation, write to the Free Software
- Foundation; we sometimes make exceptions for this. Our decision
- will be guided by the two goals of preserving the free status of
- all derivatives of our free software and of promoting the sharing
- and reuse of software generally.
-
- NO WARRANTY
-
- 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO
- WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE
- LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
- HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT
- WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT
- NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND
- FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE
- QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE
- PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY
- SERVICING, REPAIR OR CORRECTION.
-
- 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
- WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY
- MODIFY AND/OR REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE
- LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL,
- INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR
- INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
- DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU
- OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY
- OTHER PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN
- ADVISED OF THE POSSIBILITY OF SUCH DAMAGES.
-
- END OF TERMS AND CONDITIONS
+ If the Program specifies that a proxy can decide which future
+ versions of the GNU General Public License can be used, that
+ proxy's public statement of acceptance of a version permanently
+ authorizes you to choose that version for the Program.
+
+ Later license versions may give you additional or different
+ permissions. However, no additional obligations are imposed on any
+ author or copyright holder as a result of your choosing to follow a
+ later version.
+
+ 15. Disclaimer of Warranty.
+
+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+ APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE
+ COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS"
+ WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED,
+ INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+ MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE
+ RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.
+ SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL
+ NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. Limitation of Liability.
+
+ IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
+ WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES
+ AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU
+ FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
+ CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE
+ THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA
+ BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
+ PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+ PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF
+ THE POSSIBILITY OF SUCH DAMAGES.
+
+ 17. Interpretation of Sections 15 and 16.
+
+ If the disclaimer of warranty and limitation of liability provided
+ above cannot be given local legal effect according to their terms,
+ reviewing courts shall apply local law that most closely
+ approximates an absolute waiver of all civil liability in
+ connection with the Program, unless a warranty or assumption of
+ liability accompanies a copy of the Program in return for a fee.
+
+
+END OF TERMS AND CONDITIONS
+===========================
How to Apply These Terms to Your New Programs
=============================================
@@ -20723,62 +21421,54 @@ possible use to the public, the best way to achieve this is to make it
free software which everyone can redistribute and change under these
terms.
-To do so, attach the following notices to the program. It is safest to
-attach them to the start of each source file to most effectively convey
-the exclusion of warranty; and each file should have at least the
+ To do so, attach the following notices to the program. It is safest
+to attach them to the start of each source file to most effectively
+state the exclusion of warranty; and each file should have at least the
"copyright" line and a pointer to where the full notice is found.
- ONE LINE TO GIVE THE PROGRAM'S NAME AND AN IDEA OF WHAT IT DOES.
- Copyright (C) YEAR NAME OF AUTHOR
+ ONE LINE TO GIVE THE PROGRAM'S NAME AND A BRIEF IDEA OF WHAT IT DOES.
+ Copyright (C) YEAR NAME OF AUTHOR
- This program is free software; you can redistribute it and/or
- modify it under the terms of the GNU General Public License
- as published by the Free Software Foundation; either version 2
- of the License, or (at your option) any later version.
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or (at
+ your option) any later version.
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
+ This program is distributed in the hope that it will be useful, but
+ WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ General Public License for more details.
You should have received a copy of the GNU General Public License
- along with this program; if not, write to the Free Software
- Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02111, USA.
+ along with this program. If not, see `http://www.gnu.org/licenses/'.
-Also add information on how to contact you by electronic and paper mail.
+ Also add information on how to contact you by electronic and paper
+mail.
-If the program is interactive, make it output a short notice like this
-when it starts in an interactive mode:
+ If the program does terminal interaction, make it output a short
+notice like this when it starts in an interactive mode:
- Gnomovision version 69, Copyright (C) YEAR NAME OF AUTHOR
- Gnomovision comes with ABSOLUTELY NO WARRANTY; for details
- type `show w'. This is free software, and you are welcome
- to redistribute it under certain conditions; type `show c'
- for details.
+ PROGRAM Copyright (C) YEAR NAME OF AUTHOR
+ This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+ This is free software, and you are welcome to redistribute it
+ under certain conditions; type `show c' for details.
-The hypothetical commands `show w' and `show c' should show the
-appropriate parts of the General Public License. Of course, the
-commands you use may be called something other than `show w' and `show
-c'; they could even be mouse-clicks or menu items--whatever suits your
-program.
+ The hypothetical commands `show w' and `show c' should show the
+appropriate parts of the General Public License. Of course, your
+program's commands might be different; for a GUI interface, you would
+use an "about box".
-You should also get your employer (if you work as a programmer) or your
+ You should also get your employer (if you work as a programmer) or
school, if any, to sign a "copyright disclaimer" for the program, if
-necessary. Here is a sample; alter the names:
-
- Yoyodyne, Inc., hereby disclaims all copyright
- interest in the program `Gnomovision'
- (which makes passes at compilers) written
- by James Hacker.
+necessary. For more information on this, and how to apply and follow
+the GNU GPL, see `http://www.gnu.org/licenses/'.
- SIGNATURE OF TY COON, 1 April 1989
- Ty Coon, President of Vice
-
-This General Public License does not permit incorporating your program
-into proprietary programs. If your program is a subroutine library,
-you may consider it more useful to permit linking proprietary
+ The GNU General Public License does not permit incorporating your
+program into proprietary programs. If your program is a subroutine
+library, you may consider it more useful to permit linking proprietary
applications with the library. If this is what you want to do, use the
-GNU Lesser General Public License instead of this License.
+GNU Lesser General Public License instead of this License. But first,
+please read `http://www.gnu.org/philosophy/why-not-lgpl.html'.

File: gawk.info, Node: GNU Free Documentation License, Next: Index, Prev: Copying, Up: Top
@@ -20787,6 +21477,7 @@ GNU Free Documentation License
******************************
Version 1.2, November 2002
+
Copyright (C) 2000,2001,2002 Free Software Foundation, Inc.
51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA
@@ -21140,7 +21831,7 @@ GNU Free Documentation License
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License, and all the license notices in the
- Document, and any Warrany Disclaimers, provided that you also
+ Document, and any Warranty Disclaimers, provided that you also
include the original English version of this License and the
original versions of those notices and disclaimers. In case of a
disagreement between the translation and the original version of
@@ -21195,18 +21886,18 @@ notices just after the title page:
A copy of the license is included in the section entitled ``GNU
Free Documentation License''.
-If you have Invariant Sections, Front-Cover Texts and Back-Cover Texts,
-replace the "with...Texts." line with this:
+ If you have Invariant Sections, Front-Cover Texts and Back-Cover
+Texts, replace the "with...Texts." line with this:
with the Invariant Sections being LIST THEIR TITLES, with
the Front-Cover Texts being LIST, and with the Back-Cover Texts
being LIST.
-If you have Invariant Sections without Cover Texts, or some other
+ If you have Invariant Sections without Cover Texts, or some other
combination of the three, merge those two alternatives to suit the
situation.
-If your document contains nontrivial examples of program code, we
+ If your document contains nontrivial examples of program code, we
recommend releasing these examples in parallel under your choice of
free software license, such as the GNU General Public License, to
permit their use in free software.
@@ -21217,2895 +21908,2777 @@ File: gawk.info, Node: Index, Prev: GNU Free Documentation License, Up: Top
Index
*****
+
* Menu:
-* ! (exclamation point), ! operator: Boolean Ops. (line 6524)
-* ! (exclamation point), ! operator <1>: Egrep Program. (line 14679)
-* ! (exclamation point), ! operator: Precedence. (line 6698)
-* ! (exclamation point), != operator <1>: Precedence. (line 6711)
-* ! (exclamation point), != operator: Typing and Comparison.
- (line 6342)
+* ! (exclamation point), ! operator: Boolean Ops. (line 67)
+* ! (exclamation point), ! operator <1>: Egrep Program. (line 160)
+* ! (exclamation point), ! operator: Precedence. (line 52)
+* ! (exclamation point), != operator <1>: Precedence. (line 65)
+* ! (exclamation point), != operator: Comparison Operators.
+ (line 11)
* ! (exclamation point), !~ operator <1>: Expression Patterns.
- (line 6851)
-* ! (exclamation point), !~ operator <2>: Precedence. (line 6727)
-* ! (exclamation point), !~ operator <3>: Typing and Comparison.
- (line 6342)
-* ! (exclamation point), !~ operator <4>: Regexp Constants. (line 5532)
-* ! (exclamation point), !~ operator <5>: Computed Regexps. (line 2656)
-* ! (exclamation point), !~ operator <6>: Case-sensitivity. (line 2569)
-* ! (exclamation point), !~ operator: Regexp Usage. (line 1989)
-* ! operator <1>: Egrep Program. (line 14687)
-* ! operator: Ranges. (line 6955)
-* " (double quote) <1>: Quoting. (line 1376)
-* " (double quote): Read Terminal. (line 1165)
-* " (double quote), regexp constants: Computed Regexps. (line 2677)
+ (line 24)
+* ! (exclamation point), !~ operator <2>: Precedence. (line 81)
+* ! (exclamation point), !~ operator <3>: Comparison Operators.
+ (line 11)
+* ! (exclamation point), !~ operator <4>: Regexp Constants. (line 6)
+* ! (exclamation point), !~ operator <5>: Computed Regexps. (line 6)
+* ! (exclamation point), !~ operator <6>: Case-sensitivity. (line 26)
+* ! (exclamation point), !~ operator: Regexp Usage. (line 19)
+* ! operator <1>: Egrep Program. (line 168)
+* ! operator: Ranges. (line 48)
+* " (double quote) <1>: Quoting. (line 33)
+* " (double quote): Read Terminal. (line 25)
+* " (double quote), regexp constants: Computed Regexps. (line 28)
* # (number sign), #! (executable scripts): Executable Scripts.
- (line 1233)
+ (line 6)
* # (number sign), #! (executable scripts), portability issues with: Executable Scripts.
- (line 1233)
-* # (number sign), commenting: Comments. (line 1296)
-* $ (dollar sign): Regexp Operators. (line 2210)
-* $ (dollar sign), $ field operator <1>: Precedence. (line 6689)
-* $ (dollar sign), $ field operator: Fields. (line 3027)
+ (line 6)
+* # (number sign), commenting: Comments. (line 6)
+* $ (dollar sign): Regexp Operators. (line 35)
+* $ (dollar sign), $ field operator <1>: Precedence. (line 43)
+* $ (dollar sign), $ field operator: Fields. (line 19)
* $ (dollar sign), incrementing fields and arrays: Increment Ops.
- (line 6184)
-* $ field operator: Fields. (line 3027)
-* % (percent sign), % operator: Precedence. (line 6701)
-* % (percent sign), %= operator <1>: Precedence. (line 6742)
-* % (percent sign), %= operator: Assignment Ops. (line 6111)
-* & (ampersand), && operator <1>: Precedence. (line 6733)
-* & (ampersand), && operator: Boolean Ops. (line 6514)
-* & (ampersand), gsub/gensub/sub functions and: Gory Details.
- (line 9642)
-* ' (single quote) <1>: Quoting. (line 1370)
-* ' (single quote) <2>: Long. (line 1223)
-* ' (single quote): One-shot. (line 1126)
-* ' (single quote), vs. apostrophe: Comments. (line 1317)
-* ' (single quote), with double quotes: Quoting. (line 1392)
-* () (parentheses): Regexp Operators. (line 2253)
-* () (parentheses), pgawk program: Profiling. (line 11877)
+ (line 30)
+* $ field operator: Fields. (line 19)
+* % (percent sign), % operator: Precedence. (line 55)
+* % (percent sign), %= operator <1>: Precedence. (line 96)
+* % (percent sign), %= operator: Assignment Ops. (line 129)
+* & (ampersand), && operator <1>: Precedence. (line 87)
+* & (ampersand), && operator: Boolean Ops. (line 57)
+* & (ampersand), gsub/gensub/sub functions and: Gory Details. (line 6)
+* ' (single quote) <1>: Quoting. (line 27)
+* ' (single quote) <2>: Long. (line 33)
+* ' (single quote): One-shot. (line 15)
+* ' (single quote), vs. apostrophe: Comments. (line 27)
+* ' (single quote), with double quotes: Quoting. (line 49)
+* () (parentheses): Regexp Operators. (line 78)
+* () (parentheses), pgawk program: Profiling. (line 144)
* * (asterisk), * operator, as multiplication operator: Precedence.
- (line 6701)
+ (line 55)
* * (asterisk), * operator, as regexp operator: Regexp Operators.
- (line 2261)
+ (line 86)
* * (asterisk), * operator, null strings, matching: Gory Details.
- (line 9796)
-* * (asterisk), ** operator <1>: Options. (line 12191)
-* * (asterisk), ** operator <2>: Precedence. (line 6695)
-* * (asterisk), ** operator: Arithmetic Ops. (line 5898)
-* * (asterisk), **= operator <1>: Options. (line 12191)
-* * (asterisk), **= operator <2>: Precedence. (line 6742)
-* * (asterisk), **= operator: Assignment Ops. (line 6111)
-* * (asterisk), *= operator <1>: Precedence. (line 6742)
-* * (asterisk), *= operator: Assignment Ops. (line 6111)
-* + (plus sign): Regexp Operators. (line 2276)
-* + (plus sign), + operator: Precedence. (line 6698)
-* + (plus sign), ++ operator <1>: Precedence. (line 6692)
-* + (plus sign), ++ operator: Increment Ops. (line 6194)
-* + (plus sign), += operator <1>: Precedence. (line 6742)
-* + (plus sign), += operator: Assignment Ops. (line 6064)
+ (line 160)
+* * (asterisk), ** operator <1>: Options. (line 192)
+* * (asterisk), ** operator <2>: Precedence. (line 49)
+* * (asterisk), ** operator: Arithmetic Ops. (line 81)
+* * (asterisk), **= operator <1>: Options. (line 192)
+* * (asterisk), **= operator <2>: Precedence. (line 96)
+* * (asterisk), **= operator: Assignment Ops. (line 129)
+* * (asterisk), *= operator <1>: Precedence. (line 96)
+* * (asterisk), *= operator: Assignment Ops. (line 129)
+* + (plus sign): Regexp Operators. (line 101)
+* + (plus sign), + operator: Precedence. (line 52)
+* + (plus sign), ++ operator <1>: Precedence. (line 46)
+* + (plus sign), ++ operator: Increment Ops. (line 40)
+* + (plus sign), += operator <1>: Precedence. (line 96)
+* + (plus sign), += operator: Assignment Ops. (line 82)
* + (plus sign), decrement/increment operators: Increment Ops.
- (line 6165)
-* , (comma), in range patterns: Ranges. (line 6913)
-* - (hyphen), - operator: Precedence. (line 6698)
-* - (hyphen), -- (decrement/increment) operator: Precedence.
- (line 6692)
-* - (hyphen), -- operator: Increment Ops. (line 6202)
-* - (hyphen), -= operator <1>: Precedence. (line 6742)
-* - (hyphen), -= operator: Assignment Ops. (line 6111)
-* - (hyphen), filenames beginning with: Options. (line 12073)
-* - (hyphen), in character lists: Character Lists. (line 2364)
-* --assign option: Options. (line 12036)
-* --compat option: Options. (line 12085)
-* --copyleft option: Options. (line 12098)
-* --copyright option: Options. (line 12093)
+ (line 11)
+* , (comma), in range patterns: Ranges. (line 6)
+* - (hyphen), - operator: Precedence. (line 52)
+* - (hyphen), -- (decrement/increment) operator: Precedence. (line 46)
+* - (hyphen), -- operator: Increment Ops. (line 48)
+* - (hyphen), -= operator <1>: Precedence. (line 96)
+* - (hyphen), -= operator: Assignment Ops. (line 129)
+* - (hyphen), filenames beginning with: Options. (line 67)
+* - (hyphen), in character lists: Character Lists. (line 17)
+* --assign option: Options. (line 30)
+* --compat option: Options. (line 79)
+* --copyleft option: Options. (line 92)
+* --copyright option: Options. (line 87)
+* --disable-directories-fatal configuration option: Additional Configuration Options.
+ (line 37)
* --disable-lint configuration option: Additional Configuration Options.
- (line 17477)
+ (line 17)
* --disable-nls configuration option: Additional Configuration Options.
- (line 17492)
-* --dump-variables option <1>: Library Names. (line 12580)
-* --dump-variables option: Options. (line 12101)
+ (line 32)
+* --dump-variables option <1>: Library Names. (line 45)
+* --dump-variables option: Options. (line 95)
* --enable-portals configuration option <1>: Additional Configuration Options.
- (line 17469)
-* --enable-portals configuration option: Portal Files. (line 11725)
+ (line 9)
+* --enable-portals configuration option: Portal Files. (line 6)
* --enable-switch configuration option: Additional Configuration Options.
- (line 17473)
-* --exec option: Options. (line 12117)
-* --field-separator option: Options. (line 12027)
-* --file option: Options. (line 12031)
-* --gen-po option <1>: Options. (line 12136)
-* --gen-po option: String Extraction. (line 11177)
-* --help option: Options. (line 12145)
-* --lint option <1>: Options. (line 12150)
-* --lint option: Command Line. (line 12002)
-* --lint-old option: Options. (line 12162)
-* --non-decimal-data option <1>: Options. (line 12167)
-* --non-decimal-data option: Nondecimal Data. (line 11480)
+ (line 13)
+* --exec option: Options. (line 111)
+* --field-separator option: Options. (line 21)
+* --file option: Options. (line 25)
+* --gen-po option <1>: Options. (line 130)
+* --gen-po option: String Extraction. (line 6)
+* --help option: Options. (line 139)
+* --lint option <1>: Options. (line 144)
+* --lint option: Command Line. (line 20)
+* --lint-old option: Options. (line 163)
+* --non-decimal-data option <1>: Options. (line 168)
+* --non-decimal-data option: Nondecimal Data. (line 6)
* --non-decimal-data option, strtonum function and: Nondecimal Data.
- (line 11510)
-* --posix option: Options. (line 12175)
-* --posix option, --traditional option and: Options. (line 12202)
-* --profile option <1>: Options. (line 12208)
-* --profile option: Profiling. (line 11749)
-* --re-interval option: Options. (line 12220)
-* --source option: Options. (line 12227)
-* --traditional option: Options. (line 12085)
-* --traditional option, --posix option and: Options. (line 12202)
-* --usage option: Options. (line 12145)
-* --version option: Options. (line 12235)
-* -f option: Options. (line 12031)
-* -F option <1>: Options. (line 12027)
+ (line 36)
+* --posix option: Options. (line 176)
+* --posix option, --traditional option and: Options. (line 206)
+* --profile option <1>: Options. (line 212)
+* --profile option: Profiling. (line 15)
+* --re-interval option: Options. (line 224)
+* --source option: Options. (line 231)
+* --traditional option: Options. (line 79)
+* --traditional option, --posix option and: Options. (line 206)
+* --usage option: Options. (line 139)
+* --use-lc-numeric option: Options. (line 239)
+* --version option: Options. (line 244)
+* -f option: Options. (line 25)
+* -F option <1>: Options. (line 21)
* -F option: Command Line Field Separator.
- (line 3427)
-* -f option: Long. (line 1202)
-* -F option, -Ft sets FS to TAB: Options. (line 12243)
-* -f option, on command line: Options. (line 12248)
-* -F option, troubleshooting: Known Bugs. (line 12454)
-* -mf/-mr options: Options. (line 12051)
-* -v option: Options. (line 12036)
-* -v option, variables, assigning: Assignment Options.
- (line 5677)
-* -W option: Options. (line 12061)
-* . (period): Regexp Operators. (line 2218)
-* .mo files: Explaining gettext.
- (line 10954)
-* .mo files, converting from .po: I18N Example. (line 11400)
-* .mo files, specifying directory of <1>: Programmer i18n. (line 11090)
-* .mo files, specifying directory of: Explaining gettext.
- (line 10966)
-* .po files <1>: Translator i18n. (line 11156)
-* .po files: Explaining gettext.
- (line 10951)
-* .po files, converting to .mo: I18N Example. (line 11400)
-* / (forward slash): Regexp. (line 1949)
-* / (forward slash), / operator: Precedence. (line 6701)
-* / (forward slash), /= operator <1>: Precedence. (line 6742)
-* / (forward slash), /= operator: Assignment Ops. (line 6111)
+ (line 6)
+* -f option: Long. (line 12)
+* -F option, -Ft sets FS to TAB: Options. (line 252)
+* -f option, on command line: Options. (line 257)
+* -F option, troubleshooting: Known Bugs. (line 6)
+* -mf/-mr options: Options. (line 45)
+* -v option: Options. (line 30)
+* -v option, variables, assigning: Assignment Options. (line 12)
+* -W option: Options. (line 55)
+* . (period): Regexp Operators. (line 43)
+* .mo files: Explaining gettext. (line 39)
+* .mo files, converting from .po: I18N Example. (line 62)
+* .mo files, specifying directory of <1>: Programmer i18n. (line 45)
+* .mo files, specifying directory of: Explaining gettext. (line 51)
+* .po files <1>: Translator i18n. (line 6)
+* .po files: Explaining gettext. (line 36)
+* .po files, converting to .mo: I18N Example. (line 62)
+* / (forward slash): Regexp. (line 10)
+* / (forward slash), / operator: Precedence. (line 55)
+* / (forward slash), /= operator <1>: Precedence. (line 96)
+* / (forward slash), /= operator: Assignment Ops. (line 129)
* / (forward slash), /= operator, vs. /=.../ regexp constant: Assignment Ops.
- (line 6137)
-* / (forward slash), patterns and: Expression Patterns.
- (line 6851)
-* /= operator vs. /=.../ regexp constant: Assignment Ops. (line 6137)
-* /dev/... special files (gawk): Special FD. (line 5054)
-* /inet/ files (gawk): TCP/IP Networking. (line 11658)
-* /p files (gawk): Portal Files. (line 11725)
-* ; (semicolon): Statements/Lines. (line 1853)
-* ; (semicolon), AWKPATH variable and: PC Using. (line 17858)
+ (line 148)
+* / (forward slash), patterns and: Expression Patterns. (line 24)
+* /= operator vs. /=.../ regexp constant: Assignment Ops. (line 148)
+* /dev/... special files (gawk): Special FD. (line 41)
+* /inet/ files (gawk): TCP/IP Networking. (line 6)
+* /p files (gawk): Portal Files. (line 6)
+* ; (semicolon): Statements/Lines. (line 90)
+* ; (semicolon), AWKPATH variable and: PC Using. (line 11)
* ; (semicolon), separating statements in actions <1>: Statements.
- (line 7228)
+ (line 10)
* ; (semicolon), separating statements in actions: Action Overview.
- (line 7178)
-* < (left angle bracket), < operator <1>: Precedence. (line 6711)
-* < (left angle bracket), < operator: Typing and Comparison.
- (line 6342)
-* < (left angle bracket), < operator (I/O): Getline/File. (line 3979)
-* < (left angle bracket), <= operator <1>: Precedence. (line 6711)
-* < (left angle bracket), <= operator: Typing and Comparison.
- (line 6342)
-* = (equals sign), = operator: Assignment Ops. (line 5989)
-* = (equals sign), == operator <1>: Precedence. (line 6711)
-* = (equals sign), == operator: Typing and Comparison.
- (line 6342)
-* > (right angle bracket), > operator <1>: Precedence. (line 6711)
-* > (right angle bracket), > operator: Typing and Comparison.
- (line 6342)
-* > (right angle bracket), > operator (I/O): Redirection. (line 4864)
-* > (right angle bracket), >= operator <1>: Precedence. (line 6711)
-* > (right angle bracket), >= operator: Typing and Comparison.
- (line 6342)
-* > (right angle bracket), >> operator (I/O) <1>: Precedence.
- (line 6711)
-* > (right angle bracket), >> operator (I/O): Redirection. (line 4892)
+ (line 19)
+* < (left angle bracket), < operator <1>: Precedence. (line 65)
+* < (left angle bracket), < operator: Comparison Operators.
+ (line 11)
+* < (left angle bracket), < operator (I/O): Getline/File. (line 6)
+* < (left angle bracket), <= operator <1>: Precedence. (line 65)
+* < (left angle bracket), <= operator: Comparison Operators.
+ (line 11)
+* = (equals sign), = operator: Assignment Ops. (line 6)
+* = (equals sign), == operator <1>: Precedence. (line 65)
+* = (equals sign), == operator: Comparison Operators.
+ (line 11)
+* > (right angle bracket), > operator <1>: Precedence. (line 65)
+* > (right angle bracket), > operator: Comparison Operators.
+ (line 11)
+* > (right angle bracket), > operator (I/O): Redirection. (line 19)
+* > (right angle bracket), >= operator <1>: Precedence. (line 65)
+* > (right angle bracket), >= operator: Comparison Operators.
+ (line 11)
+* > (right angle bracket), >> operator (I/O) <1>: Precedence. (line 65)
+* > (right angle bracket), >> operator (I/O): Redirection. (line 47)
* ? (question mark) <1>: GNU Regexp Operators.
- (line 2506)
-* ? (question mark): Regexp Operators. (line 2285)
-* ? (question mark), ?: operator: Precedence. (line 6739)
-* [] (square brackets): Regexp Operators. (line 2230)
-* \ (backslash) <1>: Regexp Operators. (line 2193)
-* \ (backslash) <2>: Quoting. (line 1370)
-* \ (backslash) <3>: Comments. (line 1339)
-* \ (backslash): Read Terminal. (line 1165)
-* \ (backslash), \" escape sequence: Escape Sequences. (line 2108)
+ (line 51)
+* ? (question mark): Regexp Operators. (line 110)
+* ? (question mark), ?: operator: Precedence. (line 93)
+* [] (square brackets): Regexp Operators. (line 55)
+* \ (backslash) <1>: Regexp Operators. (line 18)
+* \ (backslash) <2>: Quoting. (line 27)
+* \ (backslash) <3>: Comments. (line 50)
+* \ (backslash): Read Terminal. (line 25)
+* \ (backslash), \" escape sequence: Escape Sequences. (line 76)
* \ (backslash), \' operator (gawk): GNU Regexp Operators.
- (line 2503)
-* \ (backslash), \/ escape sequence: Escape Sequences. (line 2101)
+ (line 48)
+* \ (backslash), \/ escape sequence: Escape Sequences. (line 69)
* \ (backslash), \< operator (gawk): GNU Regexp Operators.
- (line 2477)
+ (line 22)
* \ (backslash), \> operator (gawk): GNU Regexp Operators.
- (line 2481)
+ (line 26)
* \ (backslash), \` operator (gawk): GNU Regexp Operators.
- (line 2501)
-* \ (backslash), \a escape sequence: Escape Sequences. (line 2066)
-* \ (backslash), \b escape sequence: Escape Sequences. (line 2070)
+ (line 46)
+* \ (backslash), \a escape sequence: Escape Sequences. (line 34)
+* \ (backslash), \b escape sequence: Escape Sequences. (line 38)
* \ (backslash), \B operator (gawk): GNU Regexp Operators.
- (line 2490)
-* \ (backslash), \f escape sequence: Escape Sequences. (line 2073)
-* \ (backslash), \n escape sequence: Escape Sequences. (line 2076)
-* \ (backslash), \NNN escape sequence: Escape Sequences. (line 2088)
-* \ (backslash), \r escape sequence: Escape Sequences. (line 2079)
-* \ (backslash), \t escape sequence: Escape Sequences. (line 2082)
-* \ (backslash), \v escape sequence: Escape Sequences. (line 2085)
+ (line 35)
+* \ (backslash), \f escape sequence: Escape Sequences. (line 41)
+* \ (backslash), \n escape sequence: Escape Sequences. (line 44)
+* \ (backslash), \NNN escape sequence: Escape Sequences. (line 56)
+* \ (backslash), \r escape sequence: Escape Sequences. (line 47)
+* \ (backslash), \t escape sequence: Escape Sequences. (line 50)
+* \ (backslash), \v escape sequence: Escape Sequences. (line 53)
* \ (backslash), \W operator (gawk): GNU Regexp Operators.
- (line 2473)
+ (line 18)
* \ (backslash), \w operator (gawk): GNU Regexp Operators.
- (line 2468)
-* \ (backslash), \x escape sequence: Escape Sequences. (line 2093)
+ (line 13)
+* \ (backslash), \x escape sequence: Escape Sequences. (line 61)
* \ (backslash), \y operator (gawk): GNU Regexp Operators.
- (line 2485)
+ (line 30)
* \ (backslash), as field separators: Command Line Field Separator.
- (line 3448)
-* \ (backslash), continuing lines and <1>: Egrep Program. (line 14737)
-* \ (backslash), continuing lines and: Statements/Lines. (line 1783)
+ (line 27)
+* \ (backslash), continuing lines and <1>: Egrep Program. (line 218)
+* \ (backslash), continuing lines and: Statements/Lines. (line 19)
* \ (backslash), continuing lines and, comments and: Statements/Lines.
- (line 1838)
+ (line 75)
* \ (backslash), continuing lines and, in csh <1>: Statements/Lines.
- (line 1807)
-* \ (backslash), continuing lines and, in csh: More Complex.
- (line 1708)
-* \ (backslash), gsub/gensub/sub functions and: Gory Details.
- (line 9642)
-* \ (backslash), in character lists: Character Lists. (line 2364)
-* \ (backslash), in escape sequences: Escape Sequences. (line 2038)
+ (line 44)
+* \ (backslash), continuing lines and, in csh: More Complex. (line 15)
+* \ (backslash), gsub/gensub/sub functions and: Gory Details. (line 6)
+* \ (backslash), in character lists: Character Lists. (line 17)
+* \ (backslash), in escape sequences: Escape Sequences. (line 6)
* \ (backslash), in escape sequences, POSIX and: Escape Sequences.
- (line 2145)
-* \ (backslash), regexp constants: Computed Regexps. (line 2677)
+ (line 113)
+* \ (backslash), regexp constants: Computed Regexps. (line 28)
* ^ (caret) <1>: GNU Regexp Operators.
- (line 2506)
-* ^ (caret): Regexp Operators. (line 2197)
-* ^ (caret), ^ operator <1>: Options. (line 12191)
-* ^ (caret), ^ operator: Precedence. (line 6695)
-* ^ (caret), ^= operator <1>: Options. (line 12191)
-* ^ (caret), ^= operator <2>: Precedence. (line 6742)
-* ^ (caret), ^= operator: Assignment Ops. (line 6111)
-* ^ (caret), in character lists: Character Lists. (line 2364)
-* _ (underscore), _ C macro: Explaining gettext.
- (line 10983)
+ (line 51)
+* ^ (caret): Regexp Operators. (line 22)
+* ^ (caret), ^ operator <1>: Options. (line 192)
+* ^ (caret), ^ operator: Precedence. (line 49)
+* ^ (caret), ^= operator <1>: Options. (line 192)
+* ^ (caret), ^= operator <2>: Precedence. (line 96)
+* ^ (caret), ^= operator: Assignment Ops. (line 129)
+* ^ (caret), in character lists: Character Lists. (line 17)
+* _ (underscore), _ C macro: Explaining gettext. (line 68)
* _ (underscore), in names of private variables: Library Names.
- (line 12564)
-* _ (underscore), translatable string: Programmer i18n. (line 11112)
-* _gr_init user-defined function: Group Functions. (line 14042)
-* _pw_init user-defined function: Passwd Functions. (line 13828)
-* accessing fields: Fields. (line 3014)
-* account information <1>: Group Functions. (line 13968)
-* account information: Passwd Functions. (line 13753)
-* actions: Action Overview. (line 7165)
-* actions, control statements in: Statements. (line 7224)
-* actions, default: Very Simple. (line 1559)
-* actions, empty: Very Simple. (line 1564)
-* adding, features to gawk: Adding Code. (line 18547)
-* adding, fields: Changing Fields. (line 3177)
-* adding, functions to gawk: Dynamic Extensions.
- (line 18765)
-* advanced features, buffering: I/O Functions. (line 9904)
+ (line 29)
+* _ (underscore), translatable string: Programmer i18n. (line 67)
+* _gr_init user-defined function: Group Functions. (line 80)
+* _pw_init user-defined function: Passwd Functions. (line 91)
+* accessing fields: Fields. (line 6)
+* account information <1>: Group Functions. (line 6)
+* account information: Passwd Functions. (line 16)
+* actions: Action Overview. (line 6)
+* actions, control statements in: Statements. (line 6)
+* actions, default: Very Simple. (line 34)
+* actions, empty: Very Simple. (line 39)
+* adding, features to gawk: Adding Code. (line 6)
+* adding, fields: Changing Fields. (line 53)
+* adding, functions to gawk: Dynamic Extensions. (line 10)
+* advanced features, buffering: I/O Functions. (line 95)
* advanced features, close function: Close Files And Pipes.
- (line 5323)
+ (line 130)
* advanced features, constants, values of: Nondecimal-numbers.
- (line 5518)
-* advanced features, data files as single record: Records. (line 2979)
-* advanced features, fixed-width data: Constant Size. (line 3605)
-* advanced features, FNR/NR variables: Auto-set. (line 8148)
-* advanced features, gawk: Advanced Features. (line 11449)
-* advanced features, gawk, BSD portals: Portal Files. (line 11725)
+ (line 67)
+* advanced features, data files as single record: Records. (line 170)
+* advanced features, fixed-width data: Constant Size. (line 9)
+* advanced features, FNR/NR variables: Auto-set. (line 187)
+* advanced features, gawk: Advanced Features. (line 6)
+* advanced features, gawk, BSD portals: Portal Files. (line 6)
* advanced features, gawk, network programming: TCP/IP Networking.
- (line 11658)
+ (line 6)
* advanced features, gawk, nondecimal input data: Nondecimal Data.
- (line 11480)
+ (line 6)
* advanced features, gawk, processes, communicating with: Two-way I/O.
- (line 11539)
+ (line 23)
* advanced features, network connections, See Also networks, connections: Advanced Features.
- (line 11449)
-* advanced features, null strings, matching: Gory Details. (line 9796)
-* advanced features, operators, precedence: Increment Ops. (line 6215)
-* advanced features, piping into sh: Redirection. (line 4981)
-* advanced features, regexp constants: Assignment Ops. (line 6137)
-* Aho, Alfred <1>: Contributors. (line 17062)
-* Aho, Alfred: History. (line 640)
-* alarm clock example program: Alarm Program. (line 15480)
-* alarm.awk program: Alarm Program. (line 15498)
-* algorithms: Basic High Level. (line 19603)
-* Alpha (DEC): Manual History. (line 886)
-* amazing awk assembler (aaa): Glossary. (line 19837)
-* amazingly workable formatter (awf): Glossary. (line 19845)
+ (line 6)
+* advanced features, null strings, matching: Gory Details. (line 160)
+* advanced features, operators, precedence: Increment Ops. (line 61)
+* advanced features, piping into sh: Redirection. (line 140)
+* advanced features, regexp constants: Assignment Ops. (line 148)
+* Aho, Alfred <1>: Contributors. (line 12)
+* Aho, Alfred: History. (line 17)
+* alarm clock example program: Alarm Program. (line 9)
+* alarm.awk program: Alarm Program. (line 27)
+* algorithms: Basic High Level. (line 66)
+* Alpha (DEC): Manual History. (line 28)
+* amazing awk assembler (aaa): Glossary. (line 12)
+* amazingly workable formatter (awf): Glossary. (line 20)
* ambiguity, syntactic: /= operator vs. /=.../ regexp constant: Assignment Ops.
- (line 6137)
-* amiga: Amiga Installation.
- (line 17569)
-* ampersand (&), && operator: Boolean Ops. (line 6514)
-* ampersand (&), &&operator: Precedence. (line 6733)
-* ampersand (&), gsub/gensub/sub functions and: Gory Details.
- (line 9642)
-* AND bitwise operation: Bitwise Functions. (line 10314)
-* and Boolean-logic operator: Boolean Ops. (line 6463)
-* and function (gawk): Bitwise Functions. (line 10347)
-* ANSI: Glossary. (line 19856)
-* archeologists: Bugs. (line 18314)
-* ARGC/ARGV variables <1>: ARGC and ARGV. (line 8180)
-* ARGC/ARGV variables: Auto-set. (line 7972)
+ (line 148)
+* amiga: Amiga Installation. (line 6)
+* ampersand (&), && operator: Boolean Ops. (line 57)
+* ampersand (&), &&operator: Precedence. (line 87)
+* ampersand (&), gsub/gensub/sub functions and: Gory Details. (line 6)
+* AND bitwise operation: Bitwise Functions. (line 6)
+* and Boolean-logic operator: Boolean Ops. (line 6)
+* and function (gawk): Bitwise Functions. (line 39)
+* ANSI: Glossary. (line 31)
+* archeologists: Bugs. (line 6)
+* ARGC/ARGV variables <1>: ARGC and ARGV. (line 6)
+* ARGC/ARGV variables: Auto-set. (line 11)
* ARGC/ARGV variables, command-line arguments: Other Arguments.
- (line 12311)
-* ARGC/ARGV variables, portability and: Executable Scripts.
- (line 1270)
-* ARGIND variable: Auto-set. (line 8001)
-* ARGIND variable, command-line arguments: Other Arguments. (line 12311)
-* arguments, command-line <1>: Other Arguments. (line 12305)
-* arguments, command-line <2>: ARGC and ARGV. (line 8180)
-* arguments, command-line: Auto-set. (line 7972)
-* arguments, command-line, invoking awk: Command Line. (line 11988)
-* arguments, in function calls: Function Calls. (line 6603)
-* arguments, processing: Getopt Function. (line 13460)
-* arguments, retrieving: Internals. (line 18907)
-* arithmetic operators: Arithmetic Ops. (line 5823)
-* arrays: Arrays. (line 8276)
-* arrays, as parameters to functions: Function Caveats. (line 10716)
-* arrays, associative: Array Intro. (line 8356)
-* arrays, associative, clearing: Internals. (line 18852)
-* arrays, associative, library functions and: Library Names.
- (line 12592)
-* arrays, deleting entire contents: Delete. (line 8618)
-* arrays, elements, assigning: Assigning Elements.
- (line 8460)
-* arrays, elements, deleting: Delete. (line 8585)
-* arrays, elements, installing: Internals. (line 18856)
-* arrays, elements, order of: Scanning an Array. (line 8571)
+ (line 12)
+* ARGC/ARGV variables, portability and: Executable Scripts. (line 43)
+* ARGIND variable: Auto-set. (line 40)
+* ARGIND variable, command-line arguments: Other Arguments. (line 12)
+* arguments, command-line <1>: Other Arguments. (line 6)
+* arguments, command-line <2>: ARGC and ARGV. (line 6)
+* arguments, command-line: Auto-set. (line 11)
+* arguments, command-line, invoking awk: Command Line. (line 6)
+* arguments, in function calls: Function Calls. (line 16)
+* arguments, processing: Getopt Function. (line 6)
+* arguments, retrieving: Internals. (line 121)
+* arithmetic operators: Arithmetic Ops. (line 6)
+* arrays: Arrays. (line 6)
+* arrays, as parameters to functions: Function Caveats. (line 55)
+* arrays, associative: Array Intro. (line 45)
+* arrays, associative, clearing: Internals. (line 66)
+* arrays, associative, library functions and: Library Names. (line 57)
+* arrays, deleting entire contents: Delete. (line 39)
+* arrays, elements, assigning: Assigning Elements. (line 6)
+* arrays, elements, deleting: Delete. (line 6)
+* arrays, elements, installing: Internals. (line 70)
+* arrays, elements, order of: Scanning an Array. (line 47)
* arrays, elements, referencing: Reference to Elements.
- (line 8413)
-* arrays, elements, retrieving number of: String Functions. (line 9176)
-* arrays, for statement and: Scanning an Array. (line 8544)
-* arrays, IGNORECASE variable and: Array Intro. (line 8398)
-* arrays, indexing: Array Intro. (line 8356)
-* arrays, merging into strings: Join Function. (line 13067)
-* arrays, multidimensional: Multi-dimensional. (line 8754)
-* arrays, multidimensional, scanning: Multi-scanning. (line 8840)
-* arrays, names of: Arrays. (line 8287)
-* arrays, scanning: Scanning an Array. (line 8530)
-* arrays, sorting: Array Sorting. (line 8875)
-* arrays, sorting, IGNORECASE variable and: Array Sorting. (line 8953)
-* arrays, sparse: Array Intro. (line 8377)
+ (line 6)
+* arrays, elements, retrieving number of: String Functions. (line 18)
+* arrays, for statement and: Scanning an Array. (line 20)
+* arrays, IGNORECASE variable and: Array Intro. (line 87)
+* arrays, indexing: Array Intro. (line 45)
+* arrays, merging into strings: Join Function. (line 6)
+* arrays, multidimensional: Multi-dimensional. (line 6)
+* arrays, multidimensional, scanning: Multi-scanning. (line 11)
+* arrays, names of: Arrays. (line 17)
+* arrays, scanning: Scanning an Array. (line 6)
+* arrays, sorting: Array Sorting. (line 6)
+* arrays, sorting, IGNORECASE variable and: Array Sorting. (line 86)
+* arrays, sparse: Array Intro. (line 66)
* arrays, subscripts: Numeric Array Subscripts.
- (line 8656)
+ (line 6)
* arrays, subscripts, uninitialized variables as: Uninitialized Subscripts.
- (line 8707)
+ (line 6)
* artificial intelligence, gawk and: Distribution contents.
- (line 17294)
-* ASCII: Ordinal Functions. (line 13014)
-* asort function (gawk) <1>: String Functions. (line 9176)
-* asort function (gawk): Array Sorting. (line 8875)
-* asort function (gawk), arrays, sorting: Array Sorting. (line 8875)
-* asorti function (gawk): String Functions. (line 9205)
-* assert function (C library): Assert Function. (line 12815)
-* assert user-defined function: Assert Function. (line 12837)
-* assertions: Assert Function. (line 12815)
-* assignment operators: Assignment Ops. (line 5989)
-* assignment operators, evaluation order: Assignment Ops. (line 6093)
-* assignment operators, lvalues/rvalues: Assignment Ops. (line 6014)
-* assignments as filenames: Ignoring Assigns. (line 13418)
-* assoc_clear internal function: Internals. (line 18852)
-* assoc_lookup internal function: Internals. (line 18856)
-* associative arrays: Array Intro. (line 8356)
+ (line 47)
+* ASCII: Ordinal Functions. (line 44)
+* asort function (gawk) <1>: String Functions. (line 18)
+* asort function (gawk): Array Sorting. (line 6)
+* asort function (gawk), arrays, sorting: Array Sorting. (line 6)
+* asorti function (gawk): String Functions. (line 47)
+* assert function (C library): Assert Function. (line 6)
+* assert user-defined function: Assert Function. (line 28)
+* assertions: Assert Function. (line 6)
+* assignment operators: Assignment Ops. (line 6)
+* assignment operators, evaluation order: Assignment Ops. (line 111)
+* assignment operators, lvalues/rvalues: Assignment Ops. (line 32)
+* assignments as filenames: Ignoring Assigns. (line 6)
+* assoc_clear internal function: Internals. (line 66)
+* assoc_lookup internal function: Internals. (line 70)
+* associative arrays: Array Intro. (line 45)
* asterisk (*), * operator, as multiplication operator: Precedence.
- (line 6701)
+ (line 55)
* asterisk (*), * operator, as regexp operator: Regexp Operators.
- (line 2261)
+ (line 86)
* asterisk (*), * operator, null strings, matching: Gory Details.
- (line 9796)
-* asterisk (*), ** operator <1>: Options. (line 12191)
-* asterisk (*), ** operator <2>: Precedence. (line 6695)
-* asterisk (*), ** operator: Arithmetic Ops. (line 5898)
-* asterisk (*), **= operator <1>: Options. (line 12191)
-* asterisk (*), **= operator <2>: Precedence. (line 6742)
-* asterisk (*), **= operator: Assignment Ops. (line 6111)
-* asterisk (*), *= operator <1>: Precedence. (line 6742)
-* asterisk (*), *= operator: Assignment Ops. (line 6111)
-* atan2 function: Numeric Functions. (line 9082)
-* atari: Atari Installation.
- (line 18161)
-* awf (amazingly workable formatter) program: Glossary. (line 19845)
-* awk language, POSIX version: Assignment Ops. (line 6122)
-* awk programs <1>: Two Rules. (line 1647)
-* awk programs <2>: Executable Scripts.
- (line 1233)
-* awk programs: Getting Started. (line 1038)
-* awk programs, complex: When. (line 1923)
-* awk programs, documenting <1>: Library Names. (line 12541)
-* awk programs, documenting: Comments. (line 1296)
-* awk programs, examples of: Sample Programs. (line 14200)
-* awk programs, execution of: Next Statement. (line 7645)
-* awk programs, internationalizing <1>: Programmer i18n. (line 11051)
-* awk programs, internationalizing: I18N Functions. (line 10436)
-* awk programs, lengthy: Long. (line 1196)
-* awk programs, lengthy, assertions: Assert Function. (line 12815)
-* awk programs, location of: Options. (line 12031)
-* awk programs, one-line examples: Very Simple. (line 1570)
-* awk programs, profiling: Profiling. (line 11740)
-* awk programs, profiling, enabling: Options. (line 12208)
-* awk programs, running <1>: Long. (line 1196)
-* awk programs, running: Running gawk. (line 1084)
-* awk programs, running, from shell scripts: One-shot. (line 1133)
-* awk programs, running, without input files: Read Terminal.
- (line 1157)
+ (line 160)
+* asterisk (*), ** operator <1>: Options. (line 192)
+* asterisk (*), ** operator <2>: Precedence. (line 49)
+* asterisk (*), ** operator: Arithmetic Ops. (line 81)
+* asterisk (*), **= operator <1>: Options. (line 192)
+* asterisk (*), **= operator <2>: Precedence. (line 96)
+* asterisk (*), **= operator: Assignment Ops. (line 129)
+* asterisk (*), *= operator <1>: Precedence. (line 96)
+* asterisk (*), *= operator: Assignment Ops. (line 129)
+* atan2 function: Numeric Functions. (line 37)
+* atari: Atari Installation. (line 9)
+* awf (amazingly workable formatter) program: Glossary. (line 20)
+* awk language, POSIX version: Assignment Ops. (line 136)
+* awk programs <1>: Two Rules. (line 6)
+* awk programs <2>: Executable Scripts. (line 6)
+* awk programs: Getting Started. (line 12)
+* awk programs, complex: When. (line 30)
+* awk programs, documenting <1>: Library Names. (line 6)
+* awk programs, documenting: Comments. (line 6)
+* awk programs, examples of: Sample Programs. (line 6)
+* awk programs, execution of: Next Statement. (line 16)
+* awk programs, internationalizing <1>: Programmer i18n. (line 6)
+* awk programs, internationalizing: I18N Functions. (line 6)
+* awk programs, lengthy: Long. (line 6)
+* awk programs, lengthy, assertions: Assert Function. (line 6)
+* awk programs, location of: Options. (line 25)
+* awk programs, one-line examples: Very Simple. (line 45)
+* awk programs, profiling: Profiling. (line 6)
+* awk programs, profiling, enabling: Options. (line 212)
+* awk programs, running <1>: Long. (line 6)
+* awk programs, running: Running gawk. (line 6)
+* awk programs, running, from shell scripts: One-shot. (line 22)
+* awk programs, running, without input files: Read Terminal. (line 17)
* awk programs, shell variables in: Using Shell Variables.
- (line 7114)
-* awk, function of: Getting Started. (line 1032)
-* awk, gawk and <1>: This Manual. (line 718)
-* awk, gawk and: Preface. (line 569)
-* awk, history of: History. (line 640)
-* awk, implementation issues, pipes: Redirection. (line 4973)
-* awk, implementations: Other Versions. (line 18383)
-* awk, implementations, limits: Getline Notes. (line 4193)
-* awk, invoking: Command Line. (line 11988)
-* awk, new vs. old: Names. (line 677)
-* awk, new vs. old, OFMT variable: Conversion. (line 5767)
-* awk, POSIX and: Preface. (line 569)
-* awk, POSIX and, See Also POSIX awk: Preface. (line 569)
-* awk, regexp constants and: Typing and Comparison.
- (line 6442)
-* awk, See Also gawk: Preface. (line 582)
-* awk, terms describing: This Manual. (line 711)
-* awk, uses for <1>: When. (line 1899)
-* awk, uses for <2>: Getting Started. (line 1038)
-* awk, uses for: Preface. (line 569)
-* awk, versions of <1>: V7/SVR3.1. (line 16665)
-* awk, versions of: Names. (line 681)
-* awk, versions of, changes between SVR3.1 and SVR4: SVR4. (line 16724)
+ (line 6)
+* awk, function of: Getting Started. (line 6)
+* awk, gawk and <1>: This Manual. (line 13)
+* awk, gawk and: Preface. (line 22)
+* awk, history of: History. (line 17)
+* awk, implementation issues, pipes: Redirection. (line 132)
+* awk, implementations: Other Versions. (line 6)
+* awk, implementations, limits: Getline Notes. (line 14)
+* awk, invoking: Command Line. (line 6)
+* awk, new vs. old: Names. (line 6)
+* awk, new vs. old, OFMT variable: Conversion. (line 54)
+* awk, POSIX and: Preface. (line 22)
+* awk, POSIX and, See Also POSIX awk: Preface. (line 22)
+* awk, regexp constants and: Comparison Operators.
+ (line 102)
+* awk, See Also gawk: Preface. (line 35)
+* awk, terms describing: This Manual. (line 6)
+* awk, uses for <1>: When. (line 6)
+* awk, uses for <2>: Getting Started. (line 12)
+* awk, uses for: Preface. (line 22)
+* awk, versions of <1>: V7/SVR3.1. (line 6)
+* awk, versions of: Names. (line 10)
+* awk, versions of, changes between SVR3.1 and SVR4: SVR4. (line 6)
* awk, versions of, changes between SVR4 and POSIX awk: POSIX.
- (line 16765)
-* awk, versions of, changes between V7 and SVR3.1: V7/SVR3.1.
- (line 16665)
-* awk, versions of, See Also Bell Laboratories awk: BTL. (line 16809)
-* awk.h file (internal): Internals. (line 18801)
-* awka compiler for awk: Other Versions. (line 18453)
-* AWKNUM internal type: Internals. (line 18805)
-* AWKPATH environment variable <1>: PC Using. (line 17858)
-* AWKPATH environment variable: AWKPATH Variable. (line 12361)
-* awkprof.out file: Profiling. (line 11744)
-* awksed.awk program: Simple Sed. (line 16189)
-* awkvars.out file: Options. (line 12101)
-* backslash (\) <1>: Regexp Operators. (line 2193)
-* backslash (\) <2>: Quoting. (line 1370)
-* backslash (\) <3>: Comments. (line 1339)
-* backslash (\): Read Terminal. (line 1165)
-* backslash (\), \" escape sequence: Escape Sequences. (line 2108)
+ (line 6)
+* awk, versions of, changes between V7 and SVR3.1: V7/SVR3.1. (line 6)
+* awk, versions of, See Also Bell Laboratories awk: BTL. (line 6)
+* awk.h file (internal): Internals. (line 15)
+* awka compiler for awk: Other Versions. (line 76)
+* AWKNUM internal type: Internals. (line 19)
+* AWKPATH environment variable <1>: PC Using. (line 11)
+* AWKPATH environment variable: AWKPATH Variable. (line 6)
+* awkprof.out file: Profiling. (line 10)
+* awksed.awk program: Simple Sed. (line 25)
+* awkvars.out file: Options. (line 95)
+* backslash (\) <1>: Regexp Operators. (line 18)
+* backslash (\) <2>: Quoting. (line 27)
+* backslash (\) <3>: Comments. (line 50)
+* backslash (\): Read Terminal. (line 25)
+* backslash (\), \" escape sequence: Escape Sequences. (line 76)
* backslash (\), \' operator (gawk): GNU Regexp Operators.
- (line 2503)
-* backslash (\), \/ escape sequence: Escape Sequences. (line 2101)
+ (line 48)
+* backslash (\), \/ escape sequence: Escape Sequences. (line 69)
* backslash (\), \< operator (gawk): GNU Regexp Operators.
- (line 2477)
+ (line 22)
* backslash (\), \> operator (gawk): GNU Regexp Operators.
- (line 2481)
+ (line 26)
* backslash (\), \` operator (gawk): GNU Regexp Operators.
- (line 2501)
-* backslash (\), \a escape sequence: Escape Sequences. (line 2066)
-* backslash (\), \b escape sequence: Escape Sequences. (line 2070)
+ (line 46)
+* backslash (\), \a escape sequence: Escape Sequences. (line 34)
+* backslash (\), \b escape sequence: Escape Sequences. (line 38)
* backslash (\), \B operator (gawk): GNU Regexp Operators.
- (line 2490)
-* backslash (\), \f escape sequence: Escape Sequences. (line 2073)
-* backslash (\), \n escape sequence: Escape Sequences. (line 2076)
-* backslash (\), \NNN escape sequence: Escape Sequences. (line 2088)
-* backslash (\), \r escape sequence: Escape Sequences. (line 2079)
-* backslash (\), \t escape sequence: Escape Sequences. (line 2082)
-* backslash (\), \v escape sequence: Escape Sequences. (line 2085)
+ (line 35)
+* backslash (\), \f escape sequence: Escape Sequences. (line 41)
+* backslash (\), \n escape sequence: Escape Sequences. (line 44)
+* backslash (\), \NNN escape sequence: Escape Sequences. (line 56)
+* backslash (\), \r escape sequence: Escape Sequences. (line 47)
+* backslash (\), \t escape sequence: Escape Sequences. (line 50)
+* backslash (\), \v escape sequence: Escape Sequences. (line 53)
* backslash (\), \W operator (gawk): GNU Regexp Operators.
- (line 2473)
+ (line 18)
* backslash (\), \w operator (gawk): GNU Regexp Operators.
- (line 2468)
-* backslash (\), \x escape sequence: Escape Sequences. (line 2093)
+ (line 13)
+* backslash (\), \x escape sequence: Escape Sequences. (line 61)
* backslash (\), \y operator (gawk): GNU Regexp Operators.
- (line 2485)
+ (line 30)
* backslash (\), as field separators: Command Line Field Separator.
- (line 3448)
-* backslash (\), continuing lines and <1>: Egrep Program. (line 14737)
-* backslash (\), continuing lines and: Statements/Lines. (line 1783)
+ (line 27)
+* backslash (\), continuing lines and <1>: Egrep Program. (line 218)
+* backslash (\), continuing lines and: Statements/Lines. (line 19)
* backslash (\), continuing lines and, comments and: Statements/Lines.
- (line 1838)
+ (line 75)
* backslash (\), continuing lines and, in csh <1>: Statements/Lines.
- (line 1807)
-* backslash (\), continuing lines and, in csh: More Complex.
- (line 1708)
-* backslash (\), gsub/gensub/sub functions and: Gory Details.
- (line 9642)
-* backslash (\), in character lists: Character Lists. (line 2364)
-* backslash (\), in escape sequences: Escape Sequences. (line 2038)
+ (line 44)
+* backslash (\), continuing lines and, in csh: More Complex. (line 15)
+* backslash (\), gsub/gensub/sub functions and: Gory Details. (line 6)
+* backslash (\), in character lists: Character Lists. (line 17)
+* backslash (\), in escape sequences: Escape Sequences. (line 6)
* backslash (\), in escape sequences, POSIX and: Escape Sequences.
- (line 2145)
-* backslash (\), regexp constants: Computed Regexps. (line 2677)
-* BBS-list file: Sample Data Files. (line 1461)
-* Beebe, Nelson: Acknowledgments. (line 995)
-* Beebe, Nelson H.F.: Other Versions. (line 18465)
-* BEGIN pattern <1>: BEGIN/END. (line 6980)
-* BEGIN pattern <2>: Field Separators. (line 3300)
-* BEGIN pattern: Records. (line 2839)
+ (line 113)
+* backslash (\), regexp constants: Computed Regexps. (line 28)
+* BBS-list file: Sample Data Files. (line 6)
+* Beebe, Nelson: Acknowledgments. (line 53)
+* Beebe, Nelson H.F.: Other Versions. (line 88)
+* BEGIN pattern <1>: BEGIN/END. (line 6)
+* BEGIN pattern <2>: Field Separators. (line 43)
+* BEGIN pattern: Records. (line 29)
* BEGIN pattern, assert user-defined function and: Assert Function.
- (line 12891)
-* BEGIN pattern, Boolean patterns and: Expression Patterns.
- (line 6900)
-* BEGIN pattern, exit statement and: Exit Statement. (line 7743)
-* BEGIN pattern, getline and: Getline Notes. (line 4198)
-* BEGIN pattern, headings, adding: Print Examples. (line 4350)
+ (line 82)
+* BEGIN pattern, Boolean patterns and: Expression Patterns. (line 73)
+* BEGIN pattern, exit statement and: Exit Statement. (line 12)
+* BEGIN pattern, getline and: Getline Notes. (line 19)
+* BEGIN pattern, headings, adding: Print Examples. (line 43)
* BEGIN pattern, next/nextfile statements and <1>: Next Statement.
- (line 7668)
+ (line 39)
* BEGIN pattern, next/nextfile statements and: I/O And BEGIN/END.
- (line 7088)
+ (line 36)
* BEGIN pattern, OFS/ORS variables, assigning values to: Output Separators.
- (line 4407)
-* BEGIN pattern, operators and: Using BEGIN/END. (line 7010)
-* BEGIN pattern, pgawk program: Profiling. (line 11802)
-* BEGIN pattern, print statement and: I/O And BEGIN/END. (line 7068)
-* BEGIN pattern, pwcat program: Passwd Functions. (line 13862)
-* BEGIN pattern, running awk programs and: Cut Program. (line 14331)
-* BEGIN pattern, TEXTDOMAIN variable and: Programmer i18n. (line 11103)
-* beginfile user-defined function: Filetrans Function.
- (line 13265)
-* Bell Laboratories awk extensions: BTL. (line 16809)
-* Benzinger, Michael: Contributors. (line 17135)
-* BeOS: BeOS Installation. (line 17602)
-* Berry, Karl: Acknowledgments. (line 972)
-* binary input/output: User-modified. (line 7817)
-* bindtextdomain function (C library): Explaining gettext.
- (line 10962)
-* bindtextdomain function (gawk) <1>: Programmer i18n. (line 11090)
-* bindtextdomain function (gawk): I18N Functions. (line 10456)
+ (line 20)
+* BEGIN pattern, operators and: Using BEGIN/END. (line 17)
+* BEGIN pattern, pgawk program: Profiling. (line 69)
+* BEGIN pattern, print statement and: I/O And BEGIN/END. (line 16)
+* BEGIN pattern, pwcat program: Passwd Functions. (line 125)
+* BEGIN pattern, running awk programs and: Cut Program. (line 66)
+* BEGIN pattern, TEXTDOMAIN variable and: Programmer i18n. (line 58)
+* beginfile user-defined function: Filetrans Function. (line 60)
+* Bell Laboratories awk extensions: BTL. (line 6)
+* Benzinger, Michael: Contributors. (line 86)
+* BeOS: BeOS Installation. (line 6)
+* Berry, Karl: Acknowledgments. (line 30)
+* binary input/output: User-modified. (line 10)
+* bindtextdomain function (C library): Explaining gettext. (line 47)
+* bindtextdomain function (gawk) <1>: Programmer i18n. (line 45)
+* bindtextdomain function (gawk): I18N Functions. (line 26)
* bindtextdomain function (gawk), portability and: I18N Portability.
- (line 11306)
-* BINMODE variable <1>: PC Using. (line 17887)
-* BINMODE variable: User-modified. (line 7817)
-* bits2str user-defined function: Bitwise Functions. (line 10368)
-* bitwise, complement: Bitwise Functions. (line 10333)
-* bitwise, operations: Bitwise Functions. (line 10314)
-* bitwise, shift: Bitwise Functions. (line 10340)
-* body, in actions: Statements. (line 7228)
-* body, in loops: While Statement. (line 7307)
-* Boolean expressions: Boolean Ops. (line 6463)
-* Boolean expressions, as patterns: Expression Patterns.
- (line 6868)
-* Boolean operators, See Boolean expressions: Boolean Ops. (line 6463)
-* Bourne shell, quoting rules for: Quoting. (line 1357)
-* braces ({}), actions and: Action Overview. (line 7178)
-* braces ({}), pgawk program: Profiling. (line 11873)
-* braces ({}), statements, grouping: Statements. (line 7228)
-* bracket expressions, See character lists: Regexp Operators.
- (line 2230)
-* break statement: Break Statement. (line 7525)
-* Brennan, Michael <1>: Other Versions. (line 18383)
-* Brennan, Michael <2>: Simple Sed. (line 16189)
-* Brennan, Michael <3>: Two-way I/O. (line 11522)
-* Brennan, Michael: Delete. (line 8630)
-* Broder, Alan J.: Contributors. (line 17126)
-* Brown, Martin <1>: Bugs. (line 18364)
-* Brown, Martin <2>: Contributors. (line 17121)
-* Brown, Martin: Acknowledgments. (line 995)
-* BSD portals: Portal Files. (line 11725)
-* BSD-based operating systems: Glossary. (line 20404)
-* Buening, Andreas <1>: Contributors. (line 17130)
-* Buening, Andreas: Acknowledgments. (line 995)
-* buffering, input/output <1>: Two-way I/O. (line 11587)
-* buffering, input/output: I/O Functions. (line 9936)
-* buffering, interactive vs. noninteractive: I/O Functions. (line 9904)
-* buffers, flushing: I/O Functions. (line 9838)
+ (line 32)
+* BINMODE variable <1>: PC Using. (line 40)
+* BINMODE variable: User-modified. (line 10)
+* bits2str user-defined function: Bitwise Functions. (line 60)
+* bitwise, complement: Bitwise Functions. (line 25)
+* bitwise, operations: Bitwise Functions. (line 6)
+* bitwise, shift: Bitwise Functions. (line 32)
+* body, in actions: Statements. (line 10)
+* body, in loops: While Statement. (line 14)
+* Boolean expressions: Boolean Ops. (line 6)
+* Boolean expressions, as patterns: Expression Patterns. (line 41)
+* Boolean operators, See Boolean expressions: Boolean Ops. (line 6)
+* Bourne shell, quoting rules for: Quoting. (line 14)
+* braces ({}), actions and: Action Overview. (line 19)
+* braces ({}), pgawk program: Profiling. (line 140)
+* braces ({}), statements, grouping: Statements. (line 10)
+* bracket expressions, See character lists: Regexp Operators. (line 55)
+* break statement: Break Statement. (line 6)
+* Brennan, Michael <1>: Other Versions. (line 6)
+* Brennan, Michael <2>: Simple Sed. (line 25)
+* Brennan, Michael <3>: Two-way I/O. (line 6)
+* Brennan, Michael: Delete. (line 51)
+* Broder, Alan J.: Contributors. (line 77)
+* Brown, Martin <1>: Bugs. (line 57)
+* Brown, Martin <2>: Contributors. (line 72)
+* Brown, Martin: Acknowledgments. (line 53)
+* BSD portals: Portal Files. (line 6)
+* BSD-based operating systems: Glossary. (line 582)
+* Buening, Andreas <1>: Contributors. (line 81)
+* Buening, Andreas: Acknowledgments. (line 53)
+* buffering, input/output <1>: Two-way I/O. (line 71)
+* buffering, input/output: I/O Functions. (line 127)
+* buffering, interactive vs. noninteractive: I/O Functions. (line 95)
+* buffers, flushing: I/O Functions. (line 29)
* buffers, operators for: GNU Regexp Operators.
- (line 2495)
-* bug reports, email address, bug-gawk@gnu.org: Bugs. (line 18335)
-* bug-gawk@gnu.org bug reporting address: Bugs. (line 18335)
-* built-in functions: Functions. (line 8964)
-* built-in functions, evaluation order: Calling Built-in. (line 9031)
-* built-in variables: Built-in Variables.
- (line 7787)
-* built-in variables, -v option, setting with: Options. (line 12044)
-* built-in variables, conveying information: Auto-set. (line 7967)
-* built-in variables, user-modifiable: User-modified. (line 7813)
-* call by reference: Function Caveats. (line 10716)
-* call by value: Function Caveats. (line 10687)
+ (line 40)
+* bug reports, email address, bug-gawk@gnu.org: Bugs. (line 27)
+* bug-gawk@gnu.org bug reporting address: Bugs. (line 27)
+* built-in functions: Functions. (line 6)
+* built-in functions, evaluation order: Calling Built-in. (line 30)
+* built-in variables: Built-in Variables. (line 6)
+* built-in variables, -v option, setting with: Options. (line 38)
+* built-in variables, conveying information: Auto-set. (line 6)
+* built-in variables, user-modifiable: User-modified. (line 6)
+* call by reference: Function Caveats. (line 55)
+* call by value: Function Caveats. (line 26)
* caret (^) <1>: GNU Regexp Operators.
- (line 2506)
-* caret (^): Regexp Operators. (line 2197)
-* caret (^), ^ operator <1>: Options. (line 12191)
-* caret (^), ^ operator: Precedence. (line 6695)
-* caret (^), ^= operator <1>: Options. (line 12191)
-* caret (^), ^= operator <2>: Precedence. (line 6742)
-* caret (^), ^= operator: Assignment Ops. (line 6111)
-* caret (^), in character lists: Character Lists. (line 2364)
-* case keyword: Switch Statement. (line 7464)
-* case sensitivity, array indices and: Array Intro. (line 8398)
-* case sensitivity, converting case: String Functions. (line 9611)
-* case sensitivity, example programs: Library Functions. (line 12506)
-* case sensitivity, gawk: Case-sensitivity. (line 2569)
-* case sensitivity, regexps and <1>: User-modified. (line 7875)
-* case sensitivity, regexps and: Case-sensitivity. (line 2549)
-* case sensitivity, string comparisons and: User-modified. (line 7875)
-* CGI, awk scripts for: Options. (line 12117)
-* character encodings: Ordinal Functions. (line 13014)
-* character lists <1>: Character Lists. (line 2353)
-* character lists: Regexp Operators. (line 2230)
-* character lists, character classes: Character Lists. (line 2377)
-* character lists, collating elements: Character Lists. (line 2430)
-* character lists, collating symbols: Character Lists. (line 2437)
-* character lists, complemented: Regexp Operators. (line 2237)
-* character lists, equivalence classes: Character Lists. (line 2443)
-* character lists, non-ASCII: Character Lists. (line 2430)
-* character lists, range expressions: Character Lists. (line 2353)
-* character sets: Ordinal Functions. (line 13014)
-* character sets (machine character encodings): Glossary. (line 19963)
-* character sets, See Also character lists: Regexp Operators.
- (line 2230)
-* characters, counting: Wc Program. (line 15264)
-* characters, transliterating: Translate Program. (line 15601)
-* characters, values of as numbers: Ordinal Functions. (line 12976)
-* Chassell, Robert J.: Acknowledgments. (line 972)
-* chdir function, implementing in gawk: Sample Library. (line 19054)
-* chem utility: Glossary. (line 19971)
-* chr user-defined function: Ordinal Functions. (line 12986)
+ (line 51)
+* caret (^): Regexp Operators. (line 22)
+* caret (^), ^ operator <1>: Options. (line 192)
+* caret (^), ^ operator: Precedence. (line 49)
+* caret (^), ^= operator <1>: Options. (line 192)
+* caret (^), ^= operator <2>: Precedence. (line 96)
+* caret (^), ^= operator: Assignment Ops. (line 129)
+* caret (^), in character lists: Character Lists. (line 17)
+* case keyword: Switch Statement. (line 6)
+* case sensitivity, array indices and: Array Intro. (line 87)
+* case sensitivity, converting case: String Functions. (line 453)
+* case sensitivity, example programs: Library Functions. (line 43)
+* case sensitivity, gawk: Case-sensitivity. (line 26)
+* case sensitivity, regexps and <1>: User-modified. (line 68)
+* case sensitivity, regexps and: Case-sensitivity. (line 6)
+* case sensitivity, string comparisons and: User-modified. (line 68)
+* CGI, awk scripts for: Options. (line 111)
+* character encodings: Ordinal Functions. (line 44)
+* character lists <1>: Character Lists. (line 6)
+* character lists: Regexp Operators. (line 55)
+* character lists, character classes: Character Lists. (line 30)
+* character lists, collating elements: Character Lists. (line 71)
+* character lists, collating symbols: Character Lists. (line 78)
+* character lists, complemented: Regexp Operators. (line 62)
+* character lists, equivalence classes: Character Lists. (line 84)
+* character lists, non-ASCII: Character Lists. (line 71)
+* character lists, range expressions: Character Lists. (line 6)
+* character sets: Ordinal Functions. (line 44)
+* character sets (machine character encodings): Glossary. (line 138)
+* character sets, See Also character lists: Regexp Operators. (line 55)
+* characters, counting: Wc Program. (line 6)
+* characters, transliterating: Translate Program. (line 6)
+* characters, values of as numbers: Ordinal Functions. (line 6)
+* Chassell, Robert J.: Acknowledgments. (line 30)
+* chdir function, implementing in gawk: Sample Library. (line 6)
+* chem utility: Glossary. (line 146)
+* chr user-defined function: Ordinal Functions. (line 16)
* Cliff random numbers: Cliff Random Function.
- (line 12945)
+ (line 6)
* cliff_rand user-defined function: Cliff Random Function.
- (line 12950)
-* close function <1>: I/O Functions. (line 9819)
+ (line 11)
+* close function <1>: I/O Functions. (line 10)
* close function <2>: Close Files And Pipes.
- (line 5211)
-* close function <3>: Getline/Pipe. (line 4069)
+ (line 18)
+* close function <3>: Getline/Pipe. (line 24)
* close function: Getline/Variable/File.
- (line 4036)
+ (line 30)
* close function, return values: Close Files And Pipes.
- (line 5323)
-* close function, two-way pipes and: Two-way I/O. (line 11594)
-* Close, Diane <1>: Contributors. (line 17071)
-* Close, Diane: Manual History. (line 898)
-* close_func input method: Internals. (line 18964)
-* collating elements: Character Lists. (line 2430)
-* collating symbols: Character Lists. (line 2437)
-* columns, aligning: Print Examples. (line 4377)
-* columns, cutting: Cut Program. (line 14271)
-* comma (,), in range patterns: Ranges. (line 6913)
-* command line, arguments <1>: Other Arguments. (line 12305)
-* command line, arguments <2>: ARGC and ARGV. (line 8180)
-* command line, arguments: Auto-set. (line 7972)
-* command line, formats: Running gawk. (line 1090)
+ (line 130)
+* close function, two-way pipes and: Two-way I/O. (line 78)
+* Close, Diane <1>: Contributors. (line 21)
+* Close, Diane: Manual History. (line 40)
+* close_func input method: Internals. (line 178)
+* collating elements: Character Lists. (line 71)
+* collating symbols: Character Lists. (line 78)
+* columns, aligning: Print Examples. (line 70)
+* columns, cutting: Cut Program. (line 6)
+* comma (,), in range patterns: Ranges. (line 6)
+* command line, arguments <1>: Other Arguments. (line 6)
+* command line, arguments <2>: ARGC and ARGV. (line 6)
+* command line, arguments: Auto-set. (line 11)
+* command line, formats: Running gawk. (line 12)
* command line, FS on, setting: Command Line Field Separator.
- (line 3427)
-* command line, invoking awk from: Command Line. (line 11988)
-* command line, options <1>: Options. (line 12012)
+ (line 6)
+* command line, invoking awk from: Command Line. (line 6)
+* command line, options <1>: Options. (line 6)
* command line, options <2>: Command Line Field Separator.
- (line 3427)
-* command line, options: Long. (line 1202)
-* command line, options, end of: Options. (line 12068)
-* command line, variables, assigning on: Assignment Options.
- (line 5671)
-* command-line options, processing: Getopt Function. (line 13460)
-* command-line options, string extraction: String Extraction.
- (line 11177)
-* commenting: Comments. (line 1296)
-* commenting, backslash continuation and: Statements/Lines. (line 1838)
-* comp.lang.awk newsgroup: Bugs. (line 18344)
+ (line 6)
+* command line, options: Long. (line 12)
+* command line, options, end of: Options. (line 62)
+* command line, variables, assigning on: Assignment Options. (line 6)
+* command-line options, processing: Getopt Function. (line 6)
+* command-line options, string extraction: String Extraction. (line 6)
+* commenting: Comments. (line 6)
+* commenting, backslash continuation and: Statements/Lines. (line 75)
+* comp.lang.awk newsgroup: Bugs. (line 37)
* comparison expressions: Typing and Comparison.
- (line 6277)
-* comparison expressions, as patterns: Expression Patterns.
- (line 6841)
-* comparison expressions, string vs. regexp: Typing and Comparison.
- (line 6419)
-* compatibility mode (gawk), extensions: POSIX/GNU. (line 16852)
-* compatibility mode (gawk), file names: Special Caveats. (line 5167)
+ (line 9)
+* comparison expressions, as patterns: Expression Patterns. (line 14)
+* comparison expressions, string vs. regexp: Comparison Operators.
+ (line 79)
+* compatibility mode (gawk), extensions: POSIX/GNU. (line 6)
+* compatibility mode (gawk), file names: Special Caveats. (line 9)
* compatibility mode (gawk), hexadecimal numbers: Nondecimal-numbers.
- (line 5511)
+ (line 60)
* compatibility mode (gawk), octal numbers: Nondecimal-numbers.
- (line 5511)
-* compatibility mode (gawk), specifying: Options. (line 12085)
-* compiled programs <1>: Glossary. (line 19981)
-* compiled programs: Basic High Level. (line 19551)
-* compl function (gawk): Bitwise Functions. (line 10351)
-* complement, bitwise: Bitwise Functions. (line 10333)
-* compound statements, control statements and: Statements. (line 7228)
-* concatenating: Concatenation. (line 5911)
-* conditional expressions: Conditional Exp. (line 6553)
+ (line 60)
+* compatibility mode (gawk), specifying: Options. (line 79)
+* compiled programs <1>: Glossary. (line 156)
+* compiled programs: Basic High Level. (line 14)
+* compl function (gawk): Bitwise Functions. (line 43)
+* complement, bitwise: Bitwise Functions. (line 25)
+* compound statements, control statements and: Statements. (line 10)
+* concatenating: Concatenation. (line 9)
+* conditional expressions: Conditional Exp. (line 6)
+* configuration option, --disable-directories-fatal: Additional Configuration Options.
+ (line 37)
* configuration option, --disable-lint: Additional Configuration Options.
- (line 17477)
+ (line 17)
* configuration option, --disable-nls: Additional Configuration Options.
- (line 17492)
+ (line 32)
* configuration option, --enable-portals: Additional Configuration Options.
- (line 17469)
+ (line 9)
* configuration option, --enable-switch: Additional Configuration Options.
- (line 17473)
+ (line 13)
* configuration options, gawk: Additional Configuration Options.
- (line 17466)
-* constants, nondecimal: Nondecimal Data. (line 11480)
-* constants, types of: Constants. (line 5405)
-* continue statement: Continue Statement.
- (line 7582)
-* control statements: Statements. (line 7224)
-* converting, case: String Functions. (line 9611)
-* converting, dates to timestamps: Time Functions. (line 10050)
+ (line 6)
+* constants, nondecimal: Nondecimal Data. (line 6)
+* constants, types of: Constants. (line 6)
+* continue statement: Continue Statement. (line 6)
+* control statements: Statements. (line 6)
+* converting, case: String Functions. (line 453)
+* converting, dates to timestamps: Time Functions. (line 72)
* converting, during subscripting: Numeric Array Subscripts.
- (line 8681)
-* converting, numbers: Conversion. (line 5719)
-* converting, numbers, to strings: Bitwise Functions. (line 10407)
-* converting, strings to numbers: Conversion. (line 5719)
-* CONVFMT variable <1>: User-modified. (line 7833)
-* CONVFMT variable: Conversion. (line 5742)
+ (line 31)
+* converting, numbers: Conversion. (line 6)
+* converting, numbers, to strings: Bitwise Functions. (line 99)
+* converting, strings to numbers: Conversion. (line 6)
+* CONVFMT variable <1>: User-modified. (line 26)
+* CONVFMT variable: Conversion. (line 29)
* CONVFMT variable, array subscripts and: Numeric Array Subscripts.
- (line 8656)
-* coprocesses <1>: Two-way I/O. (line 11560)
-* coprocesses: Redirection. (line 4944)
+ (line 6)
+* coprocesses <1>: Two-way I/O. (line 44)
+* coprocesses: Redirection. (line 99)
* coprocesses, closing: Close Files And Pipes.
- (line 5199)
-* coprocesses, getline from: Getline/Coprocess. (line 4137)
-* cos function: Numeric Functions. (line 9079)
-* counting: Wc Program. (line 15264)
-* csh utility: Statements/Lines. (line 1807)
-* csh utility, backslash continuation and: More Complex. (line 1708)
-* csh utility, POSIXLY_CORRECT environment variable: Options.
- (line 12286)
-* csh utility, |& operator, comparison with: Two-way I/O. (line 11560)
-* ctime user-defined function: Function Example. (line 10649)
-* currency symbols, localization: Explaining gettext.
- (line 11014)
+ (line 6)
+* coprocesses, getline from: Getline/Coprocess. (line 6)
+* cos function: Numeric Functions. (line 34)
+* counting: Wc Program. (line 6)
+* csh utility: Statements/Lines. (line 44)
+* csh utility, backslash continuation and: More Complex. (line 15)
+* csh utility, POSIXLY_CORRECT environment variable: Options. (line 295)
+* csh utility, |& operator, comparison with: Two-way I/O. (line 44)
+* ctime user-defined function: Function Example. (line 72)
+* currency symbols, localization: Explaining gettext. (line 99)
* custom.h file: Configuration Philosophy.
- (line 17530)
-* cut utility: Cut Program. (line 14271)
-* cut.awk program: Cut Program. (line 14309)
-* d.c., See dark corner: Conventions. (line 850)
-* dark corner <1>: Glossary. (line 20013)
-* dark corner <2>: Truth Values. (line 6264)
-* dark corner <3>: Assignment Ops. (line 6137)
-* dark corner <4>: Format Modifiers. (line 4667)
-* dark corner: Conventions. (line 850)
+ (line 29)
+* cut utility: Cut Program. (line 6)
+* cut.awk program: Cut Program. (line 44)
+* d.c., See dark corner: Conventions. (line 37)
+* dark corner <1>: Glossary. (line 188)
+* dark corner <2>: Truth Values. (line 24)
+* dark corner <3>: Assignment Ops. (line 148)
+* dark corner <4>: Format Modifiers. (line 59)
+* dark corner: Conventions. (line 37)
* dark corner, array subscripts: Uninitialized Subscripts.
- (line 8743)
-* dark corner, break statement: Break Statement. (line 7566)
+ (line 42)
+* dark corner, break statement: Break Statement. (line 47)
* dark corner, close function: Close Files And Pipes.
- (line 5323)
-* dark corner, command-line arguments: Assignment Options.
- (line 5708)
-* dark corner, continue statement: Continue Statement.
- (line 7619)
-* dark corner, CONVFMT variable: Conversion. (line 5753)
-* dark corner, escape sequences: Other Arguments. (line 12330)
+ (line 130)
+* dark corner, command-line arguments: Assignment Options. (line 43)
+* dark corner, continue statement: Continue Statement. (line 43)
+* dark corner, CONVFMT variable: Conversion. (line 40)
+* dark corner, escape sequences: Other Arguments. (line 31)
* dark corner, escape sequences, for metacharacters: Escape Sequences.
- (line 2168)
-* dark corner, exit statement: Exit Statement. (line 7760)
+ (line 136)
+* dark corner, exit statement: Exit Statement. (line 29)
* dark corner, field separators: Field Splitting Summary.
- (line 3555)
-* dark corner, FILENAME variable <1>: Auto-set. (line 8049)
-* dark corner, FILENAME variable: Getline Notes. (line 4198)
-* dark corner, FNR/NR variables: Auto-set. (line 8148)
-* dark corner, format-control characters: Control Letters. (line 4601)
+ (line 47)
+* dark corner, FILENAME variable <1>: Auto-set. (line 88)
+* dark corner, FILENAME variable: Getline Notes. (line 19)
+* dark corner, FNR/NR variables: Auto-set. (line 187)
+* dark corner, format-control characters: Control Letters. (line 80)
* dark corner, FS as null string: Single Character Fields.
- (line 3415)
-* dark corner, input files: Records. (line 2908)
-* dark corner, invoking awk: Command Line. (line 11998)
-* dark corner, multiline records: Multiple Line. (line 3734)
-* dark corner, NF variable, decrementing: Changing Fields. (line 3231)
-* dark corner, OFMT variable: OFMT. (line 4455)
+ (line 20)
+* dark corner, input files: Records. (line 98)
+* dark corner, invoking awk: Command Line. (line 16)
+* dark corner, multiline records: Multiple Line. (line 35)
+* dark corner, NF variable, decrementing: Changing Fields. (line 107)
+* dark corner, OFMT variable: OFMT. (line 27)
* dark corner, regexp constants: Using Constant Regexps.
- (line 5544)
+ (line 6)
* dark corner, regexp constants, /= operator and: Assignment Ops.
- (line 6137)
+ (line 148)
* dark corner, regexp constants, as arguments to user-defined functions: Using Constant Regexps.
- (line 5582)
-* dark corner, split function: String Functions. (line 9378)
-* dark corner, strings, storing: Records. (line 2995)
-* data, fixed-width: Constant Size. (line 3605)
-* data-driven languages: Basic High Level. (line 19620)
-* database, group, reading: Group Functions. (line 13968)
-* database, users, reading: Passwd Functions. (line 13743)
-* date utility, GNU: Time Functions. (line 9998)
-* date utility, POSIX: Time Functions. (line 10245)
-* dates, converting to timestamps: Time Functions. (line 10050)
+ (line 44)
+* dark corner, split function: String Functions. (line 220)
+* dark corner, strings, storing: Records. (line 186)
+* data, fixed-width: Constant Size. (line 9)
+* data-driven languages: Basic High Level. (line 83)
+* database, group, reading: Group Functions. (line 6)
+* database, users, reading: Passwd Functions. (line 6)
+* date utility, GNU: Time Functions. (line 17)
+* date utility, POSIX: Time Functions. (line 259)
+* dates, converting to timestamps: Time Functions. (line 72)
* dates, information related to, localization: Explaining gettext.
- (line 11026)
-* Davies, Stephen <1>: Bugs. (line 18369)
-* Davies, Stephen: Contributors. (line 17118)
-* dcgettext function (gawk) <1>: Programmer i18n. (line 11064)
-* dcgettext function (gawk): I18N Functions. (line 10442)
+ (line 111)
+* Davies, Stephen <1>: Bugs. (line 62)
+* Davies, Stephen: Contributors. (line 68)
+* dcgettext function (gawk) <1>: Programmer i18n. (line 19)
+* dcgettext function (gawk): I18N Functions. (line 12)
* dcgettext function (gawk), portability and: I18N Portability.
- (line 11306)
-* dcngettext function (gawk) <1>: Programmer i18n. (line 11080)
-* dcngettext function (gawk): I18N Functions. (line 10448)
+ (line 32)
+* dcngettext function (gawk) <1>: Programmer i18n. (line 35)
+* dcngettext function (gawk): I18N Functions. (line 18)
* dcngettext function (gawk), portability and: I18N Portability.
- (line 11306)
-* deadlocks: Two-way I/O. (line 11587)
-* debugging gawk: Known Bugs. (line 12454)
-* debugging gawk, bug reports: Bugs. (line 18317)
-* decrement operators: Increment Ops. (line 6189)
-* default keyword: Switch Statement. (line 7464)
-* Deifik, Scott <1>: Bugs. (line 18365)
-* Deifik, Scott <2>: Contributors. (line 17102)
-* Deifik, Scott: Acknowledgments. (line 995)
-* delete statement: Delete. (line 8585)
-* deleting elements in arrays: Delete. (line 8585)
-* deleting entire arrays: Delete. (line 8618)
-* differences between gawk and awk: String Functions. (line 9246)
+ (line 32)
+* deadlocks: Two-way I/O. (line 71)
+* debugging gawk: Known Bugs. (line 6)
+* debugging gawk, bug reports: Bugs. (line 9)
+* decimal point character, locale specific: Options. (line 200)
+* decrement operators: Increment Ops. (line 35)
+* default keyword: Switch Statement. (line 6)
+* Deifik, Scott <1>: Bugs. (line 58)
+* Deifik, Scott <2>: Contributors. (line 52)
+* Deifik, Scott: Acknowledgments. (line 53)
+* delete statement: Delete. (line 6)
+* deleting elements in arrays: Delete. (line 6)
+* deleting entire arrays: Delete. (line 39)
+* differences between gawk and awk: String Functions. (line 88)
* differences in awk and gawk, ARGC/ARGV variables: ARGC and ARGV.
- (line 8259)
-* differences in awk and gawk, ARGIND variable: Auto-set. (line 8001)
+ (line 85)
+* differences in awk and gawk, ARGIND variable: Auto-set. (line 40)
* differences in awk and gawk, array elements, deleting: Delete.
- (line 8618)
+ (line 39)
* differences in awk and gawk, AWKPATH environment variable: AWKPATH Variable.
- (line 12361)
+ (line 6)
* differences in awk and gawk, BEGIN/END patterns: I/O And BEGIN/END.
- (line 7068)
+ (line 16)
* differences in awk and gawk, BINMODE variable <1>: PC Using.
- (line 17887)
+ (line 40)
* differences in awk and gawk, BINMODE variable: User-modified.
- (line 7828)
+ (line 21)
* differences in awk and gawk, close function: Close Files And Pipes.
- (line 5274)
-* differences in awk and gawk, ERRNO variable: Auto-set. (line 8033)
-* differences in awk and gawk, error messages: Special FD. (line 5028)
+ (line 81)
+* differences in awk and gawk, ERRNO variable: Auto-set. (line 72)
+* differences in awk and gawk, error messages: Special FD. (line 15)
* differences in awk and gawk, FIELDWIDTHS variable: User-modified.
- (line 7840)
+ (line 33)
* differences in awk and gawk, function arguments (gawk): Calling Built-in.
- (line 9017)
-* differences in awk and gawk, getline command: Getline. (line 3856)
+ (line 16)
+* differences in awk and gawk, getline command: Getline. (line 19)
* differences in awk and gawk, IGNORECASE variable: User-modified.
- (line 7875)
+ (line 68)
* differences in awk and gawk, implementation limitations <1>: Redirection.
- (line 4973)
+ (line 132)
* differences in awk and gawk, implementation limitations: Getline Notes.
- (line 4193)
+ (line 14)
* differences in awk and gawk, input/output operators <1>: Redirection.
- (line 4944)
+ (line 99)
* differences in awk and gawk, input/output operators: Getline/Coprocess.
- (line 4137)
+ (line 6)
* differences in awk and gawk, line continuations: Conditional Exp.
- (line 6581)
-* differences in awk and gawk, LINT variable: User-modified.
- (line 7890)
+ (line 34)
+* differences in awk and gawk, LINT variable: User-modified. (line 83)
* differences in awk and gawk, match function: String Functions.
- (line 9309)
+ (line 151)
* differences in awk and gawk, next/nextfile statements: Nextfile Statement.
- (line 7684)
+ (line 6)
* differences in awk and gawk, print/printf statements: Format Modifiers.
- (line 4621)
-* differences in awk and gawk, PROCINFO array: Auto-set. (line 8080)
-* differences in awk and gawk, record separators: Records. (line 2921)
+ (line 13)
+* differences in awk and gawk, PROCINFO array: Auto-set. (line 119)
+* differences in awk and gawk, record separators: Records. (line 112)
* differences in awk and gawk, regexp constants: Using Constant Regexps.
- (line 5582)
+ (line 44)
* differences in awk and gawk, regular expressions: Case-sensitivity.
- (line 2569)
-* differences in awk and gawk, RS/RT variables: Records. (line 2971)
-* differences in awk and gawk, RT variable: Auto-set. (line 8137)
+ (line 26)
+* differences in awk and gawk, RS/RT variables: Records. (line 162)
+* differences in awk and gawk, RT variable: Auto-set. (line 176)
* differences in awk and gawk, single-character fields: Single Character Fields.
- (line 3401)
+ (line 6)
* differences in awk and gawk, split function: String Functions.
- (line 9367)
-* differences in awk and gawk, strings: Scalar Constants. (line 5439)
-* differences in awk and gawk, strings, storing: Records. (line 2991)
+ (line 209)
+* differences in awk and gawk, strings: Scalar Constants. (line 20)
+* differences in awk and gawk, strings, storing: Records. (line 182)
* differences in awk and gawk, strtonum function (gawk): String Functions.
- (line 9405)
+ (line 247)
* differences in awk and gawk, TEXTDOMAIN variable: User-modified.
- (line 7945)
+ (line 138)
* differences in awk and gawk, trunc-mod operation: Arithmetic Ops.
- (line 5883)
-* directories, changing: Sample Library. (line 19054)
-* directories, searching <1>: Igawk Program. (line 16601)
-* directories, searching: AWKPATH Variable. (line 12361)
-* division: Arithmetic Ops. (line 5861)
-* do-while statement <1>: Do Statement. (line 7346)
-* do-while statement: Regexp Usage. (line 1989)
-* documentation, of awk programs: Library Names. (line 12541)
-* documentation, online: Manual History. (line 870)
-* documents, searching: Dupword Program. (line 15429)
-* dollar sign ($): Regexp Operators. (line 2210)
-* dollar sign ($), $ field operator <1>: Precedence. (line 6689)
-* dollar sign ($), $ field operator: Fields. (line 3027)
+ (line 66)
+* directories, changing: Sample Library. (line 6)
+* directories, searching <1>: Igawk Program. (line 358)
+* directories, searching: AWKPATH Variable. (line 6)
+* division: Arithmetic Ops. (line 44)
+* do-while statement <1>: Do Statement. (line 6)
+* do-while statement: Regexp Usage. (line 19)
+* documentation, of awk programs: Library Names. (line 6)
+* documentation, online: Manual History. (line 11)
+* documents, searching: Dupword Program. (line 6)
+* dollar sign ($): Regexp Operators. (line 35)
+* dollar sign ($), $ field operator <1>: Precedence. (line 43)
+* dollar sign ($), $ field operator: Fields. (line 19)
* dollar sign ($), incrementing fields and arrays: Increment Ops.
- (line 6184)
-* double quote (") <1>: Quoting. (line 1376)
-* double quote ("): Read Terminal. (line 1165)
-* double quote ("), regexp constants: Computed Regexps. (line 2677)
-* double-precision floating-point: Basic Data Typing. (line 19666)
-* Drepper, Ulrich: Acknowledgments. (line 991)
-* dupnode internal function: Internals. (line 18883)
-* dupword.awk program: Dupword Program. (line 15454)
-* EBCDIC: Ordinal Functions. (line 13014)
-* egrep utility <1>: Egrep Program. (line 14525)
-* egrep utility: Character Lists. (line 2371)
-* egrep.awk program: Egrep Program. (line 14573)
+ (line 30)
+* double quote (") <1>: Quoting. (line 33)
+* double quote ("): Read Terminal. (line 25)
+* double quote ("), regexp constants: Computed Regexps. (line 28)
+* double-precision floating-point: Basic Data Typing. (line 33)
+* Drepper, Ulrich: Acknowledgments. (line 49)
+* dupnode internal function: Internals. (line 97)
+* dupword.awk program: Dupword Program. (line 31)
+* EBCDIC: Ordinal Functions. (line 44)
+* egrep utility <1>: Egrep Program. (line 6)
+* egrep utility: Character Lists. (line 24)
+* egrep.awk program: Egrep Program. (line 54)
* elements in arrays: Reference to Elements.
- (line 8413)
-* elements in arrays, assigning: Assigning Elements.
- (line 8460)
-* elements in arrays, deleting: Delete. (line 8585)
-* elements in arrays, order of: Scanning an Array. (line 8571)
-* elements in arrays, scanning: Scanning an Array. (line 8530)
-* email address for bug reports, bug-gawk@gnu.org: Bugs. (line 18335)
-* EMISTERED: TCP/IP Networking. (line 11658)
-* empty pattern: Empty. (line 7101)
+ (line 6)
+* elements in arrays, assigning: Assigning Elements. (line 6)
+* elements in arrays, deleting: Delete. (line 6)
+* elements in arrays, order of: Scanning an Array. (line 47)
+* elements in arrays, scanning: Scanning an Array. (line 6)
+* email address for bug reports, bug-gawk@gnu.org: Bugs. (line 27)
+* EMISTERED: TCP/IP Networking. (line 6)
+* empty pattern: Empty. (line 6)
* empty strings, See null strings: Regexp Field Splitting.
- (line 3379)
-* END pattern: BEGIN/END. (line 6980)
+ (line 43)
+* END pattern: BEGIN/END. (line 6)
* END pattern, assert user-defined function and: Assert Function.
- (line 12883)
-* END pattern, backslash continuation and: Egrep Program. (line 14737)
-* END pattern, Boolean patterns and: Expression Patterns.
- (line 6900)
-* END pattern, exit statement and: Exit Statement. (line 7743)
+ (line 74)
+* END pattern, backslash continuation and: Egrep Program. (line 218)
+* END pattern, Boolean patterns and: Expression Patterns. (line 73)
+* END pattern, exit statement and: Exit Statement. (line 12)
* END pattern, next/nextfile statements and <1>: Next Statement.
- (line 7668)
+ (line 39)
* END pattern, next/nextfile statements and: I/O And BEGIN/END.
- (line 7088)
-* END pattern, operators and: Using BEGIN/END. (line 7010)
-* END pattern, pgawk program: Profiling. (line 11802)
-* END pattern, print statement and: I/O And BEGIN/END. (line 7068)
-* endfile user-defined function: Filetrans Function.
- (line 13265)
-* endgrent function (C library): Group Functions. (line 14175)
-* endgrent user-defined function: Group Functions. (line 14178)
-* endpwent function (C library): Passwd Functions. (line 13929)
-* endpwent user-defined function: Passwd Functions. (line 13932)
-* ENVIRON variable <1>: Internals. (line 18951)
-* ENVIRON variable: Auto-set. (line 8021)
-* environment variables: Auto-set. (line 8021)
-* epoch, definition of: Glossary. (line 20055)
-* equals sign (=), = operator: Assignment Ops. (line 5989)
-* equals sign (=), == operator <1>: Precedence. (line 6711)
-* equals sign (=), == operator: Typing and Comparison.
- (line 6342)
-* EREs (Extended Regular Expressions): Character Lists. (line 2371)
-* ERRNO variable <1>: Internals. (line 18938)
-* ERRNO variable <2>: Auto-set. (line 8033)
-* ERRNO variable: Getline. (line 3856)
-* error handling: Special FD. (line 5028)
-* error handling, ERRNO variable and: Auto-set. (line 8033)
-* error output: Special FD. (line 5019)
-* escape processing, gsub/gensub/sub functions: Gory Details.
- (line 9642)
-* escape sequences: Escape Sequences. (line 2038)
-* escape sequences, unrecognized: Options. (line 12179)
-* evaluation order: Increment Ops. (line 6215)
-* evaluation order, concatenation: Concatenation. (line 5943)
-* evaluation order, functions: Calling Built-in. (line 9031)
-* examining fields: Fields. (line 3014)
-* exclamation point (!), ! operator <1>: Egrep Program. (line 14679)
-* exclamation point (!), ! operator <2>: Precedence. (line 6698)
-* exclamation point (!), ! operator: Boolean Ops. (line 6524)
-* exclamation point (!), != operator <1>: Precedence. (line 6711)
-* exclamation point (!), != operator: Typing and Comparison.
- (line 6342)
+ (line 36)
+* END pattern, operators and: Using BEGIN/END. (line 17)
+* END pattern, pgawk program: Profiling. (line 69)
+* END pattern, print statement and: I/O And BEGIN/END. (line 16)
+* endfile user-defined function: Filetrans Function. (line 60)
+* endgrent function (C library): Group Functions. (line 213)
+* endgrent user-defined function: Group Functions. (line 216)
+* endpwent function (C library): Passwd Functions. (line 192)
+* endpwent user-defined function: Passwd Functions. (line 195)
+* ENVIRON variable <1>: Internals. (line 165)
+* ENVIRON variable: Auto-set. (line 60)
+* environment variables: Auto-set. (line 60)
+* epoch, definition of: Glossary. (line 230)
+* equals sign (=), = operator: Assignment Ops. (line 6)
+* equals sign (=), == operator <1>: Precedence. (line 65)
+* equals sign (=), == operator: Comparison Operators.
+ (line 11)
+* EREs (Extended Regular Expressions): Character Lists. (line 24)
+* ERRNO variable <1>: Internals. (line 152)
+* ERRNO variable <2>: Auto-set. (line 72)
+* ERRNO variable: Getline. (line 19)
+* error handling: Special FD. (line 15)
+* error handling, ERRNO variable and: Auto-set. (line 72)
+* error output: Special FD. (line 6)
+* escape processing, gsub/gensub/sub functions: Gory Details. (line 6)
+* escape sequences: Escape Sequences. (line 6)
+* escape sequences, unrecognized: Options. (line 180)
+* evaluation order: Increment Ops. (line 61)
+* evaluation order, concatenation: Concatenation. (line 42)
+* evaluation order, functions: Calling Built-in. (line 30)
+* examining fields: Fields. (line 6)
+* exclamation point (!), ! operator <1>: Egrep Program. (line 160)
+* exclamation point (!), ! operator <2>: Precedence. (line 52)
+* exclamation point (!), ! operator: Boolean Ops. (line 67)
+* exclamation point (!), != operator <1>: Precedence. (line 65)
+* exclamation point (!), != operator: Comparison Operators.
+ (line 11)
* exclamation point (!), !~ operator <1>: Expression Patterns.
- (line 6851)
-* exclamation point (!), !~ operator <2>: Precedence. (line 6727)
-* exclamation point (!), !~ operator <3>: Typing and Comparison.
- (line 6342)
-* exclamation point (!), !~ operator <4>: Regexp Constants. (line 5532)
-* exclamation point (!), !~ operator <5>: Computed Regexps. (line 2656)
-* exclamation point (!), !~ operator <6>: Case-sensitivity. (line 2569)
-* exclamation point (!), !~ operator: Regexp Usage. (line 1989)
-* exit statement: Exit Statement. (line 7737)
-* exp function: Numeric Functions. (line 9067)
-* expand utility: Very Simple. (line 1594)
-* expressions: Expressions. (line 5362)
-* expressions, as patterns: Expression Patterns.
- (line 6833)
-* expressions, assignment: Assignment Ops. (line 5989)
-* expressions, Boolean: Boolean Ops. (line 6463)
+ (line 24)
+* exclamation point (!), !~ operator <2>: Precedence. (line 81)
+* exclamation point (!), !~ operator <3>: Comparison Operators.
+ (line 11)
+* exclamation point (!), !~ operator <4>: Regexp Constants. (line 6)
+* exclamation point (!), !~ operator <5>: Computed Regexps. (line 6)
+* exclamation point (!), !~ operator <6>: Case-sensitivity. (line 26)
+* exclamation point (!), !~ operator: Regexp Usage. (line 19)
+* exit statement: Exit Statement. (line 6)
+* exp function: Numeric Functions. (line 22)
+* expand utility: Very Simple. (line 69)
+* expressions: Expressions. (line 6)
+* expressions, as patterns: Expression Patterns. (line 6)
+* expressions, assignment: Assignment Ops. (line 6)
+* expressions, Boolean: Boolean Ops. (line 6)
* expressions, comparison: Typing and Comparison.
- (line 6277)
-* expressions, conditional: Conditional Exp. (line 6553)
+ (line 9)
+* expressions, conditional: Conditional Exp. (line 6)
* expressions, matching, See comparison expressions: Typing and Comparison.
- (line 6277)
-* expressions, selecting: Conditional Exp. (line 6553)
-* Extended Regular Expressions (EREs): Character Lists. (line 2371)
+ (line 9)
+* expressions, selecting: Conditional Exp. (line 6)
+* Extended Regular Expressions (EREs): Character Lists. (line 24)
* extension function (gawk): Using Internal File Ops.
- (line 19373)
-* extensions, Bell Laboratories awk: BTL. (line 16809)
-* extensions, in gawk, not in POSIX awk: POSIX/GNU. (line 16852)
-* extensions, mawk: Other Versions. (line 18423)
-* extract.awk program: Extract Program. (line 16050)
+ (line 15)
+* extensions, Bell Laboratories awk: BTL. (line 6)
+* extensions, in gawk, not in POSIX awk: POSIX/GNU. (line 6)
+* extensions, mawk: Other Versions. (line 46)
+* extract.awk program: Extract Program. (line 77)
* extraction, of marked strings (internationalization): String Extraction.
- (line 11177)
-* false, logical: Truth Values. (line 6246)
+ (line 6)
+* false, logical: Truth Values. (line 6)
* FDL (Free Documentation License): GNU Free Documentation License.
- (line 20789)
-* features, adding to gawk: Adding Code. (line 18547)
-* features, advanced, See advanced features: Obsolete. (line 12421)
-* features, deprecated: Obsolete. (line 12421)
-* features, undocumented: Undocumented. (line 12443)
-* Fenlason, Jay <1>: Contributors. (line 17069)
-* Fenlason, Jay: History. (line 653)
-* fflush function: I/O Functions. (line 9834)
-* fflush function, unsupported: Options. (line 12199)
-* field numbers: Nonconstant Fields.
- (line 3085)
-* field operator $: Fields. (line 3027)
-* field operators, dollar sign as: Fields. (line 3027)
-* field separators <1>: User-modified. (line 7850)
-* field separators: Field Separators. (line 3271)
-* field separators, choice of: Field Separators. (line 3306)
-* field separators, FIELDWIDTHS variable and: User-modified.
- (line 7840)
-* field separators, in multiline records: Multiple Line. (line 3740)
+ (line 6)
+* features, adding to gawk: Adding Code. (line 6)
+* features, advanced, See advanced features: Obsolete. (line 6)
+* features, deprecated: Obsolete. (line 6)
+* features, undocumented: Undocumented. (line 6)
+* Fenlason, Jay <1>: Contributors. (line 19)
+* Fenlason, Jay: History. (line 30)
+* fflush function: I/O Functions. (line 25)
+* fflush function, unsupported: Options. (line 203)
+* field numbers: Nonconstant Fields. (line 6)
+* field operator $: Fields. (line 19)
+* field operators, dollar sign as: Fields. (line 19)
+* field separators <1>: User-modified. (line 43)
+* field separators: Field Separators. (line 13)
+* field separators, choice of: Field Separators. (line 49)
+* field separators, FIELDWIDTHS variable and: User-modified. (line 33)
+* field separators, in multiline records: Multiple Line. (line 41)
* field separators, on command line: Command Line Field Separator.
- (line 3427)
+ (line 6)
* field separators, POSIX and <1>: Field Splitting Summary.
- (line 3549)
-* field separators, POSIX and: Fields. (line 3014)
+ (line 41)
+* field separators, POSIX and: Fields. (line 6)
* field separators, regular expressions as <1>: Regexp Field Splitting.
- (line 3343)
-* field separators, regular expressions as: Field Separators.
- (line 3306)
-* field separators, See Also OFS: Changing Fields. (line 3188)
-* field separators, spaces as: Cut Program. (line 14371)
-* fields <1>: Basic High Level. (line 19608)
-* fields <2>: Fields. (line 3014)
-* fields: Reading Files. (line 2788)
-* fields, adding: Changing Fields. (line 3177)
-* fields, changing contents of: Changing Fields. (line 3130)
-* fields, cutting: Cut Program. (line 14271)
-* fields, examining: Fields. (line 3014)
-* fields, number of: Fields. (line 3041)
-* fields, numbers: Nonconstant Fields.
- (line 3085)
-* fields, printing: Print Examples. (line 4329)
-* fields, separating: Field Separators. (line 3271)
+ (line 6)
+* field separators, regular expressions as: Field Separators. (line 49)
+* field separators, See Also OFS: Changing Fields. (line 64)
+* field separators, spaces as: Cut Program. (line 106)
+* fields <1>: Basic High Level. (line 71)
+* fields <2>: Fields. (line 6)
+* fields: Reading Files. (line 14)
+* fields, adding: Changing Fields. (line 53)
+* fields, changing contents of: Changing Fields. (line 6)
+* fields, cutting: Cut Program. (line 6)
+* fields, examining: Fields. (line 6)
+* fields, number of: Fields. (line 33)
+* fields, numbers: Nonconstant Fields. (line 6)
+* fields, printing: Print Examples. (line 21)
+* fields, separating: Field Separators. (line 13)
* fields, single-character: Single Character Fields.
- (line 3401)
-* FIELDWIDTHS variable <1>: User-modified. (line 7840)
-* FIELDWIDTHS variable: Constant Size. (line 3618)
-* file descriptors: Special FD. (line 5019)
-* file names, distinguishing: Auto-set. (line 8013)
-* file names, in compatibility mode: Special Caveats. (line 5167)
-* file names, standard streams in gawk: Special FD. (line 5054)
-* FILENAME variable <1>: Auto-set. (line 8049)
-* FILENAME variable: Reading Files. (line 2780)
-* FILENAME variable, getline, setting with: Getline Notes. (line 4198)
-* filenames, assignments as: Ignoring Assigns. (line 13418)
-* files, .mo: Explaining gettext.
- (line 10954)
-* files, .mo, converting from .po: I18N Example. (line 11400)
-* files, .mo, specifying directory of <1>: Programmer i18n. (line 11090)
-* files, .mo, specifying directory of: Explaining gettext.
- (line 10966)
-* files, .po <1>: Translator i18n. (line 11156)
-* files, .po: Explaining gettext.
- (line 10951)
-* files, .po, converting to .mo: I18N Example. (line 11400)
-* files, /dev/... special files: Special FD. (line 5054)
-* files, /inet/ (gawk): TCP/IP Networking. (line 11658)
-* files, /p (gawk): Portal Files. (line 11725)
-* files, as single records: Records. (line 3000)
-* files, awk programs in: Long. (line 1196)
-* files, awkprof.out: Profiling. (line 11744)
-* files, awkvars.out: Options. (line 12101)
-* files, closing: I/O Functions. (line 9819)
-* files, descriptors, See file descriptors: Special FD. (line 5019)
-* files, for process information: Special Process. (line 5086)
-* files, group: Group Functions. (line 13968)
-* files, information about, retrieving: Sample Library. (line 19054)
-* files, initialization and cleanup: Filetrans Function.
- (line 13211)
-* files, input, See input files: Read Terminal. (line 1157)
-* files, log, timestamps in: Time Functions. (line 9987)
+ (line 6)
+* FIELDWIDTHS variable <1>: User-modified. (line 33)
+* FIELDWIDTHS variable: Constant Size. (line 22)
+* file descriptors: Special FD. (line 6)
+* file names, distinguishing: Auto-set. (line 52)
+* file names, in compatibility mode: Special Caveats. (line 9)
+* file names, standard streams in gawk: Special FD. (line 41)
+* FILENAME variable <1>: Auto-set. (line 88)
+* FILENAME variable: Reading Files. (line 6)
+* FILENAME variable, getline, setting with: Getline Notes. (line 19)
+* filenames, assignments as: Ignoring Assigns. (line 6)
+* files, .mo: Explaining gettext. (line 39)
+* files, .mo, converting from .po: I18N Example. (line 62)
+* files, .mo, specifying directory of <1>: Programmer i18n. (line 45)
+* files, .mo, specifying directory of: Explaining gettext. (line 51)
+* files, .po <1>: Translator i18n. (line 6)
+* files, .po: Explaining gettext. (line 36)
+* files, .po, converting to .mo: I18N Example. (line 62)
+* files, /dev/... special files: Special FD. (line 41)
+* files, /inet/ (gawk): TCP/IP Networking. (line 6)
+* files, /p (gawk): Portal Files. (line 6)
+* files, as single records: Records. (line 191)
+* files, awk programs in: Long. (line 6)
+* files, awkprof.out: Profiling. (line 10)
+* files, awkvars.out: Options. (line 95)
+* files, closing: I/O Functions. (line 10)
+* files, descriptors, See file descriptors: Special FD. (line 6)
+* files, for process information: Special Process. (line 6)
+* files, group: Group Functions. (line 6)
+* files, information about, retrieving: Sample Library. (line 6)
+* files, initialization and cleanup: Filetrans Function. (line 6)
+* files, input, See input files: Read Terminal. (line 17)
+* files, log, timestamps in: Time Functions. (line 6)
* files, managing: Data File Management.
- (line 13194)
-* files, managing, data file boundaries: Filetrans Function.
- (line 13211)
-* files, message object: Explaining gettext.
- (line 10954)
+ (line 6)
+* files, managing, data file boundaries: Filetrans Function. (line 6)
+* files, message object: Explaining gettext. (line 39)
* files, message object, converting from portable object files: I18N Example.
- (line 11400)
+ (line 62)
* files, message object, specifying directory of <1>: Programmer i18n.
- (line 11090)
+ (line 45)
* files, message object, specifying directory of: Explaining gettext.
- (line 10966)
-* files, multiple passes over: Other Arguments. (line 12348)
-* files, multiple, duplicating output into: Tee Program. (line 14964)
+ (line 51)
+* files, multiple passes over: Other Arguments. (line 49)
+* files, multiple, duplicating output into: Tee Program. (line 6)
* files, output, See output files: Close Files And Pipes.
- (line 5199)
-* files, password: Passwd Functions. (line 13753)
-* files, portable object <1>: Translator i18n. (line 11156)
-* files, portable object: Explaining gettext.
- (line 10951)
+ (line 6)
+* files, password: Passwd Functions. (line 16)
+* files, portable object <1>: Translator i18n. (line 6)
+* files, portable object: Explaining gettext. (line 36)
* files, portable object, converting to message object files: I18N Example.
- (line 11400)
-* files, portable object, generating: Options. (line 12136)
-* files, portal: Portal Files. (line 11725)
-* files, processing, ARGIND variable and: Auto-set. (line 8008)
-* files, reading: Rewind Function. (line 13292)
-* files, reading, multiline records: Multiple Line. (line 3705)
-* files, searching for regular expressions: Egrep Program. (line 14525)
-* files, skipping: File Checking. (line 13334)
-* files, source, search path for: Igawk Program. (line 16601)
-* files, splitting: Split Program. (line 14862)
-* files, Texinfo, extracting programs from: Extract Program.
- (line 15979)
-* Fish, Fred <1>: Bugs. (line 18364)
-* Fish, Fred: Contributors. (line 17100)
-* fixed-width data: Constant Size. (line 3605)
-* flag variables <1>: Tee Program. (line 14978)
-* flag variables: Boolean Ops. (line 6524)
-* floating-point: Floating Point Issues.
- (line 19776)
-* floating-point, numbers: Basic Data Typing. (line 19654)
-* floating-point, numbers, AWKNUM internal type: Internals. (line 18805)
-* FNR variable <1>: Auto-set. (line 8059)
-* FNR variable: Records. (line 2817)
-* FNR variable, changing: Auto-set. (line 8148)
-* for statement: For Statement. (line 7382)
-* for statement, in arrays: Scanning an Array. (line 8544)
-* force_number internal function: Internals. (line 18813)
-* force_string internal function: Internals. (line 18818)
+ (line 62)
+* files, portable object, generating: Options. (line 130)
+* files, portal: Portal Files. (line 6)
+* files, processing, ARGIND variable and: Auto-set. (line 47)
+* files, reading: Rewind Function. (line 6)
+* files, reading, multiline records: Multiple Line. (line 6)
+* files, searching for regular expressions: Egrep Program. (line 6)
+* files, skipping: File Checking. (line 6)
+* files, source, search path for: Igawk Program. (line 358)
+* files, splitting: Split Program. (line 6)
+* files, Texinfo, extracting programs from: Extract Program. (line 6)
+* Fish, Fred <1>: Bugs. (line 57)
+* Fish, Fred: Contributors. (line 50)
+* fixed-width data: Constant Size. (line 9)
+* flag variables <1>: Tee Program. (line 20)
+* flag variables: Boolean Ops. (line 67)
+* floating-point: Unexpected Results. (line 6)
+* floating-point, numbers: Basic Data Typing. (line 21)
+* floating-point, numbers, AWKNUM internal type: Internals. (line 19)
+* FNR variable <1>: Auto-set. (line 98)
+* FNR variable: Records. (line 6)
+* FNR variable, changing: Auto-set. (line 187)
+* for statement: For Statement. (line 6)
+* for statement, in arrays: Scanning an Array. (line 20)
+* force_number internal function: Internals. (line 27)
+* force_string internal function: Internals. (line 32)
* format specifiers, mixing regular with positional specifiers: Printf Ordering.
- (line 11254)
-* format specifiers, printf statement: Control Letters. (line 4527)
+ (line 57)
+* format specifiers, printf statement: Control Letters. (line 6)
* format specifiers, strftime function (gawk): Time Functions.
- (line 10063)
-* format strings: Basic Printf. (line 4495)
-* formats, numeric output: OFMT. (line 4434)
-* formatting output: Printf. (line 4465)
-* forward slash (/): Regexp. (line 1949)
-* forward slash (/), / operator: Precedence. (line 6701)
-* forward slash (/), /= operator <1>: Precedence. (line 6742)
-* forward slash (/), /= operator: Assignment Ops. (line 6111)
+ (line 85)
+* format strings: Basic Printf. (line 15)
+* formats, numeric output: OFMT. (line 6)
+* formatting output: Printf. (line 6)
+* forward slash (/): Regexp. (line 10)
+* forward slash (/), / operator: Precedence. (line 55)
+* forward slash (/), /= operator <1>: Precedence. (line 96)
+* forward slash (/), /= operator: Assignment Ops. (line 129)
* forward slash (/), /= operator, vs. /=.../ regexp constant: Assignment Ops.
- (line 6137)
-* forward slash (/), patterns and: Expression Patterns.
- (line 6851)
+ (line 148)
+* forward slash (/), patterns and: Expression Patterns. (line 24)
* Free Documentation License (FDL): GNU Free Documentation License.
- (line 20789)
-* Free Software Foundation (FSF) <1>: Glossary. (line 20109)
-* Free Software Foundation (FSF) <2>: Getting. (line 17193)
-* Free Software Foundation (FSF): Manual History. (line 865)
-* free_temp internal macro: Internals. (line 18888)
-* FreeBSD: Glossary. (line 20404)
-* FS variable <1>: User-modified. (line 7850)
-* FS variable: Field Separators. (line 3271)
-* FS variable, --field-separator option and: Options. (line 12027)
+ (line 6)
+* Free Software Foundation (FSF) <1>: Glossary. (line 284)
+* Free Software Foundation (FSF) <2>: Getting. (line 10)
+* Free Software Foundation (FSF): Manual History. (line 6)
+* free_temp internal macro: Internals. (line 102)
+* FreeBSD: Glossary. (line 582)
+* FS variable <1>: User-modified. (line 43)
+* FS variable: Field Separators. (line 13)
+* FS variable, --field-separator option and: Options. (line 21)
* FS variable, as null string: Single Character Fields.
- (line 3415)
-* FS variable, as TAB character: Options. (line 12195)
-* FS variable, changing value of <1>: Known Bugs. (line 12454)
-* FS variable, changing value of: Field Separators. (line 3290)
-* FS variable, running awk programs and: Cut Program. (line 14331)
+ (line 20)
+* FS variable, as TAB character: Options. (line 196)
+* FS variable, changing value of <1>: Known Bugs. (line 6)
+* FS variable, changing value of: Field Separators. (line 33)
+* FS variable, running awk programs and: Cut Program. (line 66)
* FS variable, setting from command line: Command Line Field Separator.
- (line 3427)
-* FSF (Free Software Foundation) <1>: Glossary. (line 20109)
-* FSF (Free Software Foundation) <2>: Getting. (line 17193)
-* FSF (Free Software Foundation): Manual History. (line 865)
-* function calls: Function Calls. (line 6593)
-* functions, arrays as parameters to: Function Caveats. (line 10716)
-* functions, built-in <1>: Functions. (line 8964)
-* functions, built-in: Function Calls. (line 6597)
-* functions, built-in, adding to gawk: Dynamic Extensions.
- (line 18765)
-* functions, built-in, evaluation order: Calling Built-in. (line 9031)
-* functions, defining: Definition Syntax. (line 10492)
-* functions, library: Library Functions. (line 12469)
-* functions, library, assertions: Assert Function. (line 12815)
-* functions, library, associative arrays and: Library Names.
- (line 12592)
-* functions, library, C library: Getopt Function. (line 13460)
+ (line 6)
+* FSF (Free Software Foundation) <1>: Glossary. (line 284)
+* FSF (Free Software Foundation) <2>: Getting. (line 10)
+* FSF (Free Software Foundation): Manual History. (line 6)
+* function calls: Function Calls. (line 6)
+* functions, arrays as parameters to: Function Caveats. (line 55)
+* functions, built-in <1>: Functions. (line 6)
+* functions, built-in: Function Calls. (line 10)
+* functions, built-in, adding to gawk: Dynamic Extensions. (line 10)
+* functions, built-in, evaluation order: Calling Built-in. (line 30)
+* functions, defining: Definition Syntax. (line 6)
+* functions, library: Library Functions. (line 6)
+* functions, library, assertions: Assert Function. (line 6)
+* functions, library, associative arrays and: Library Names. (line 57)
+* functions, library, C library: Getopt Function. (line 6)
* functions, library, character values as numbers: Ordinal Functions.
- (line 12976)
+ (line 6)
* functions, library, Cliff random numbers: Cliff Random Function.
- (line 12945)
-* functions, library, command-line options: Getopt Function.
- (line 13460)
+ (line 6)
+* functions, library, command-line options: Getopt Function. (line 6)
* functions, library, example program for using: Igawk Program.
- (line 16250)
+ (line 6)
* functions, library, group database, reading: Group Functions.
- (line 13968)
+ (line 6)
* functions, library, managing data files: Data File Management.
- (line 13194)
+ (line 6)
* functions, library, managing time: Gettimeofday Function.
- (line 13112)
+ (line 6)
* functions, library, merging arrays into strings: Join Function.
- (line 13067)
-* functions, library, nextfile statement: Nextfile Function.
- (line 12645)
-* functions, library, rounding numbers: Round Function. (line 12900)
+ (line 6)
+* functions, library, nextfile statement: Nextfile Function. (line 6)
+* functions, library, rounding numbers: Round Function. (line 6)
* functions, library, user database, reading: Passwd Functions.
- (line 13743)
-* functions, names of <1>: Definition Syntax. (line 10506)
-* functions, names of: Arrays. (line 8287)
-* functions, recursive: Definition Syntax. (line 10554)
-* functions, return values, setting: Internals. (line 18932)
-* functions, string-translation: I18N Functions. (line 10436)
-* functions, undefined: Function Caveats. (line 10740)
-* functions, user-defined: User-defined. (line 10472)
-* functions, user-defined, calling: Function Caveats. (line 10667)
-* functions, user-defined, counts: Profiling. (line 11868)
-* functions, user-defined, library of: Library Functions. (line 12469)
+ (line 6)
+* functions, names of <1>: Definition Syntax. (line 20)
+* functions, names of: Arrays. (line 17)
+* functions, recursive: Definition Syntax. (line 68)
+* functions, return values, setting: Internals. (line 146)
+* functions, string-translation: I18N Functions. (line 6)
+* functions, undefined: Function Caveats. (line 79)
+* functions, user-defined: User-defined. (line 6)
+* functions, user-defined, calling: Function Caveats. (line 6)
+* functions, user-defined, counts: Profiling. (line 135)
+* functions, user-defined, library of: Library Functions. (line 6)
* functions, user-defined, next/nextfile statements and <1>: Nextfile Statement.
- (line 7717)
+ (line 39)
* functions, user-defined, next/nextfile statements and: Next Statement.
- (line 7668)
-* G-d: Acknowledgments. (line 1012)
-* Garfinkle, Scott: Contributors. (line 17087)
-* gawk, awk and <1>: This Manual. (line 718)
-* gawk, awk and: Preface. (line 569)
-* gawk, bitwise operations in: Bitwise Functions. (line 10347)
-* gawk, break statement in: Break Statement. (line 7566)
-* gawk, built-in variables and: Built-in Variables.
- (line 7795)
-* gawk, character classes and: Character Lists. (line 2451)
-* gawk, coding style in: Adding Code. (line 18573)
+ (line 39)
+* G-d: Acknowledgments. (line 70)
+* Garfinkle, Scott: Contributors. (line 37)
+* gawk, awk and <1>: This Manual. (line 13)
+* gawk, awk and: Preface. (line 22)
+* gawk, bitwise operations in: Bitwise Functions. (line 39)
+* gawk, break statement in: Break Statement. (line 47)
+* gawk, built-in variables and: Built-in Variables. (line 14)
+* gawk, character classes and: Character Lists. (line 92)
+* gawk, coding style in: Adding Code. (line 32)
* gawk, command-line options: GNU Regexp Operators.
- (line 2517)
-* gawk, comparison operators and: Typing and Comparison.
- (line 6390)
+ (line 62)
+* gawk, comparison operators and: Comparison Operators.
+ (line 50)
* gawk, configuring: Configuration Philosophy.
- (line 17507)
+ (line 6)
* gawk, configuring, options: Additional Configuration Options.
- (line 17466)
-* gawk, continue statement in: Continue Statement.
- (line 7619)
-* gawk, debugging: Known Bugs. (line 12454)
+ (line 6)
+* gawk, continue statement in: Continue Statement. (line 43)
+* gawk, debugging: Known Bugs. (line 6)
* gawk, distribution: Distribution contents.
- (line 17253)
-* gawk, escape sequences: Escape Sequences. (line 2157)
-* gawk, extensions, disabling: Options. (line 12175)
-* gawk, features, adding: Adding Code. (line 18547)
-* gawk, features, advanced: Advanced Features. (line 11449)
-* gawk, fflush function in: I/O Functions. (line 9854)
-* gawk, field separators and: User-modified. (line 7870)
-* gawk, FIELDWIDTHS variable in: User-modified. (line 7846)
-* gawk, file names in: Special Files. (line 5002)
-* gawk, format-control characters: Control Letters. (line 4601)
-* gawk, function arguments and: Calling Built-in. (line 9017)
-* gawk, functions, adding: Dynamic Extensions.
- (line 18765)
-* gawk, hexadecimal numbers and: Nondecimal-numbers.
- (line 5493)
-* gawk, IGNORECASE variable in: User-modified. (line 7886)
-* gawk, implementation issues: Notes. (line 18484)
-* gawk, implementation issues, debugging: Compatibility Mode.
- (line 18503)
+ (line 6)
+* gawk, escape sequences: Escape Sequences. (line 125)
+* gawk, extensions, disabling: Options. (line 176)
+* gawk, features, adding: Adding Code. (line 6)
+* gawk, features, advanced: Advanced Features. (line 6)
+* gawk, fflush function in: I/O Functions. (line 45)
+* gawk, field separators and: User-modified. (line 63)
+* gawk, FIELDWIDTHS variable in: User-modified. (line 39)
+* gawk, file names in: Special Files. (line 6)
+* gawk, format-control characters: Control Letters. (line 80)
+* gawk, function arguments and: Calling Built-in. (line 16)
+* gawk, functions, adding: Dynamic Extensions. (line 10)
+* gawk, hexadecimal numbers and: Nondecimal-numbers. (line 42)
+* gawk, IGNORECASE variable in: User-modified. (line 79)
+* gawk, implementation issues: Notes. (line 6)
+* gawk, implementation issues, debugging: Compatibility Mode. (line 6)
* gawk, implementation issues, downward compatibility: Compatibility Mode.
- (line 18503)
-* gawk, implementation issues, limits: Getline Notes. (line 4193)
-* gawk, implementation issues, pipes: Redirection. (line 4973)
-* gawk, installing: Installation. (line 17151)
-* gawk, internals: Internals. (line 18792)
+ (line 6)
+* gawk, implementation issues, limits: Getline Notes. (line 14)
+* gawk, implementation issues, pipes: Redirection. (line 132)
+* gawk, installing: Installation. (line 6)
+* gawk, internals: Internals. (line 6)
* gawk, internationalization and, See internationalization: Internationalization.
- (line 10883)
-* gawk, interpreter, adding code to <1>: Future Extensions. (line 19505)
+ (line 13)
+* gawk, interpreter, adding code to <1>: Future Extensions. (line 87)
* gawk, interpreter, adding code to: Using Internal File Ops.
- (line 19364)
-* gawk, interval expressions and: Regexp Operators. (line 2313)
-* gawk, line continuation in: Conditional Exp. (line 6581)
-* gawk, LINT variable in: User-modified. (line 7899)
-* gawk, list of contributors to: Contributors. (line 17056)
-* gawk, MS-DOS version of: PC Using. (line 17858)
-* gawk, newlines in: Statements/Lines. (line 1776)
-* gawk, next file statement in: Nextfile Statement.
- (line 7724)
-* gawk, nextfile statement in <1>: Nextfile Function. (line 12645)
-* gawk, nextfile statement in: Nextfile Statement.
- (line 7724)
-* gawk, octal numbers and: Nondecimal-numbers.
- (line 5493)
-* gawk, OS/2 version of: PC Using. (line 17858)
+ (line 6)
+* gawk, interval expressions and: Regexp Operators. (line 138)
+* gawk, line continuation in: Conditional Exp. (line 34)
+* gawk, LINT variable in: User-modified. (line 92)
+* gawk, list of contributors to: Contributors. (line 6)
+* gawk, MS-DOS version of: PC Using. (line 11)
+* gawk, newlines in: Statements/Lines. (line 12)
+* gawk, next file statement in: Nextfile Statement. (line 46)
+* gawk, nextfile statement in <1>: Nextfile Function. (line 6)
+* gawk, nextfile statement in: Nextfile Statement. (line 46)
+* gawk, octal numbers and: Nondecimal-numbers. (line 42)
+* gawk, OS/2 version of: PC Using. (line 11)
* gawk, regexp constants and: Using Constant Regexps.
- (line 5566)
+ (line 28)
* gawk, regular expressions, case sensitivity: Case-sensitivity.
- (line 2569)
+ (line 26)
* gawk, regular expressions, operators: GNU Regexp Operators.
- (line 2461)
-* gawk, regular expressions, precedence: Regexp Operators. (line 2329)
-* gawk, See Also awk: Preface. (line 582)
-* gawk, source code, obtaining: Getting. (line 17189)
-* gawk, splitting fields and: Constant Size. (line 3682)
-* gawk, string-translation functions: I18N Functions. (line 10436)
-* gawk, timestamps: Time Functions. (line 9987)
-* gawk, uses for: Preface. (line 582)
-* gawk, versions of, information about, printing: Options. (line 12235)
+ (line 6)
+* gawk, regular expressions, precedence: Regexp Operators. (line 154)
+* gawk, See Also awk: Preface. (line 35)
+* gawk, source code, obtaining: Getting. (line 6)
+* gawk, splitting fields and: Constant Size. (line 87)
+* gawk, string-translation functions: I18N Functions. (line 6)
+* gawk, timestamps: Time Functions. (line 6)
+* gawk, uses for: Preface. (line 35)
+* gawk, versions of, information about, printing: Options. (line 244)
* gawk, word-boundary operator: GNU Regexp Operators.
- (line 2510)
-* General Public License (GPL): Glossary. (line 20118)
-* General Public License, See GPL: Manual History. (line 870)
-* gensub function (gawk) <1>: String Functions. (line 9519)
+ (line 55)
+* General Public License (GPL): Glossary. (line 293)
+* General Public License, See GPL: Manual History. (line 11)
+* gensub function (gawk) <1>: String Functions. (line 361)
* gensub function (gawk): Using Constant Regexps.
- (line 5582)
-* gensub function (gawk), escape processing: Gory Details. (line 9642)
-* get_actual_argument internal function: Internals. (line 18912)
-* get_argument internal function: Internals. (line 18907)
-* get_array_argument internal macro: Internals. (line 18927)
-* get_curfunc_arg_count internal function: Internals. (line 18823)
-* get_record input method: Internals. (line 18964)
-* get_scalar_argument internal macro: Internals. (line 18922)
-* getgrent function (C library): Group Functions. (line 13968)
-* getgrent user-defined function: Group Functions. (line 13968)
-* getgrgid function (C library): Group Functions. (line 14142)
-* getgrgid user-defined function: Group Functions. (line 14145)
-* getgrnam function (C library): Group Functions. (line 14130)
-* getgrnam user-defined function: Group Functions. (line 14134)
-* getgruser function (C library): Group Functions. (line 14153)
-* getgruser function, user-defined: Group Functions. (line 14156)
-* getline command: Reading Files. (line 2794)
+ (line 44)
+* gensub function (gawk), escape processing: Gory Details. (line 6)
+* get_actual_argument internal function: Internals. (line 126)
+* get_argument internal function: Internals. (line 121)
+* get_array_argument internal macro: Internals. (line 141)
+* get_curfunc_arg_count internal function: Internals. (line 37)
+* get_record input method: Internals. (line 178)
+* get_scalar_argument internal macro: Internals. (line 136)
+* getgrent function (C library): Group Functions. (line 6)
+* getgrent user-defined function: Group Functions. (line 6)
+* getgrgid function (C library): Group Functions. (line 180)
+* getgrgid user-defined function: Group Functions. (line 183)
+* getgrnam function (C library): Group Functions. (line 168)
+* getgrnam user-defined function: Group Functions. (line 172)
+* getgruser function (C library): Group Functions. (line 191)
+* getgruser function, user-defined: Group Functions. (line 194)
+* getline command: Reading Files. (line 20)
* getline command, _gr_init user-defined function: Group Functions.
- (line 14042)
-* getline command, _pw_init function: Passwd Functions. (line 13873)
+ (line 80)
+* getline command, _pw_init function: Passwd Functions. (line 136)
* getline command, coprocesses, using from <1>: Close Files And Pipes.
- (line 5199)
+ (line 6)
* getline command, coprocesses, using from: Getline/Coprocess.
- (line 4137)
-* getline command, deadlock and: Two-way I/O. (line 11587)
-* getline command, explicit input with: Getline. (line 3843)
-* getline command, FILENAME variable and: Getline Notes. (line 4198)
-* getline command, return values: Getline. (line 3856)
-* getline command, variants: Getline Summary. (line 4219)
-* getopt function (C library): Getopt Function. (line 13469)
-* getopt user-defined function: Getopt Function. (line 13559)
-* getpwent function (C library): Passwd Functions. (line 13753)
-* getpwent user-defined function: Passwd Functions. (line 13753)
-* getpwnam function (C library): Passwd Functions. (line 13893)
-* getpwnam user-defined function: Passwd Functions. (line 13897)
-* getpwuid function (C library): Passwd Functions. (line 13905)
-* getpwuid user-defined function: Passwd Functions. (line 13909)
-* getservbyname function (C library): TCP/IP Networking. (line 11686)
-* gettext function (C library): Explaining gettext.
- (line 10975)
-* gettext library: Explaining gettext.
- (line 10921)
-* gettext library, locale categories: Explaining gettext.
- (line 10993)
+ (line 6)
+* getline command, deadlock and: Two-way I/O. (line 71)
+* getline command, explicit input with: Getline. (line 6)
+* getline command, FILENAME variable and: Getline Notes. (line 19)
+* getline command, return values: Getline. (line 19)
+* getline command, variants: Getline Summary. (line 6)
+* getopt function (C library): Getopt Function. (line 15)
+* getopt user-defined function: Getopt Function. (line 106)
+* getpwent function (C library): Passwd Functions. (line 16)
+* getpwent user-defined function: Passwd Functions. (line 16)
+* getpwnam function (C library): Passwd Functions. (line 156)
+* getpwnam user-defined function: Passwd Functions. (line 160)
+* getpwuid function (C library): Passwd Functions. (line 168)
+* getpwuid user-defined function: Passwd Functions. (line 172)
+* getservbyname function (C library): TCP/IP Networking. (line 34)
+* gettext function (C library): Explaining gettext. (line 60)
+* gettext library: Explaining gettext. (line 6)
+* gettext library, locale categories: Explaining gettext. (line 78)
* gettimeofday user-defined function: Gettimeofday Function.
- (line 13122)
-* GNITS mailing list: Acknowledgments. (line 991)
-* GNU awk, See gawk: Preface. (line 595)
+ (line 16)
+* GNITS mailing list: Acknowledgments. (line 49)
+* GNU awk, See gawk: Preface. (line 48)
* GNU Free Documentation License: GNU Free Documentation License.
- (line 20789)
-* GNU General Public License: Glossary. (line 20118)
-* GNU Lesser General Public License: Glossary. (line 20195)
-* GNU long options <1>: Options. (line 12012)
-* GNU long options: Command Line. (line 11995)
-* GNU long options, printing list of: Options. (line 12145)
-* GNU Project <1>: Glossary. (line 20127)
-* GNU Project: Manual History. (line 870)
-* GNU/Linux <1>: Glossary. (line 20404)
-* GNU/Linux <2>: Atari Compiling. (line 18198)
-* GNU/Linux <3>: I18N Example. (line 11393)
-* GNU/Linux: Manual History. (line 886)
-* GPL (General Public License) <1>: Glossary. (line 20118)
-* GPL (General Public License): Manual History. (line 870)
-* GPL (General Public License), printing: Options. (line 12093)
-* grcat program: Group Functions. (line 13977)
-* Grigera, Juan <1>: Bugs. (line 18366)
-* Grigera, Juan: Contributors. (line 17104)
-* group database, reading: Group Functions. (line 13968)
-* group file: Group Functions. (line 13968)
-* groups, information about: Group Functions. (line 13968)
-* gsub function <1>: String Functions. (line 9503)
+ (line 6)
+* GNU General Public License: Glossary. (line 293)
+* GNU Lesser General Public License: Glossary. (line 373)
+* GNU long options <1>: Options. (line 6)
+* GNU long options: Command Line. (line 13)
+* GNU long options, printing list of: Options. (line 139)
+* GNU Project <1>: Glossary. (line 302)
+* GNU Project: Manual History. (line 11)
+* GNU/Linux <1>: Glossary. (line 582)
+* GNU/Linux <2>: Atari Compiling. (line 16)
+* GNU/Linux <3>: I18N Example. (line 55)
+* GNU/Linux: Manual History. (line 28)
+* GPL (General Public License) <1>: Glossary. (line 293)
+* GPL (General Public License): Manual History. (line 11)
+* GPL (General Public License), printing: Options. (line 87)
+* grcat program: Group Functions. (line 15)
+* Grigera, Juan <1>: Bugs. (line 59)
+* Grigera, Juan: Contributors. (line 54)
+* group database, reading: Group Functions. (line 6)
+* group file: Group Functions. (line 6)
+* groups, information about: Group Functions. (line 6)
+* gsub function <1>: String Functions. (line 345)
* gsub function: Using Constant Regexps.
- (line 5582)
-* gsub function, arguments of: String Functions. (line 9483)
-* gsub function, escape processing: Gory Details. (line 9642)
-* Hankerson, Darrel <1>: Bugs. (line 18365)
-* Hankerson, Darrel <2>: Contributors. (line 17106)
-* Hankerson, Darrel: Acknowledgments. (line 995)
-* Hartholz, Elaine: Acknowledgments. (line 977)
-* Hartholz, Marshall: Acknowledgments. (line 977)
-* Hasegawa, Isamu <1>: Contributors. (line 17132)
-* Hasegawa, Isamu: Acknowledgments. (line 995)
-* hexadecimal numbers: Nondecimal-numbers.
- (line 5457)
-* hexadecimal values, enabling interpretation of: Options. (line 12167)
-* histsort.awk program: History Sorting. (line 15953)
-* Hughes, Phil: Acknowledgments. (line 982)
-* HUP signal: Profiling. (line 11943)
-* hyphen (-), - operator: Precedence. (line 6698)
-* hyphen (-), -- (decrement/increment) operators: Precedence.
- (line 6692)
-* hyphen (-), -- operator: Increment Ops. (line 6202)
-* hyphen (-), -= operator <1>: Precedence. (line 6742)
-* hyphen (-), -= operator: Assignment Ops. (line 6111)
-* hyphen (-), filenames beginning with: Options. (line 12073)
-* hyphen (-), in character lists: Character Lists. (line 2364)
-* id utility: Id Program. (line 14755)
-* id.awk program: Id Program. (line 14779)
-* if statement <1>: If Statement. (line 7260)
-* if statement: Regexp Usage. (line 1989)
-* if statement, actions, changing: Ranges. (line 6932)
-* igawk.sh program: Igawk Program. (line 16362)
-* IGNORECASE variable <1>: User-modified. (line 7875)
-* IGNORECASE variable: Case-sensitivity. (line 2569)
-* IGNORECASE variable, array sorting and: Array Sorting. (line 8953)
-* IGNORECASE variable, array subscripts and: Array Intro. (line 8398)
+ (line 44)
+* gsub function, arguments of: String Functions. (line 325)
+* gsub function, escape processing: Gory Details. (line 6)
+* Hankerson, Darrel <1>: Bugs. (line 58)
+* Hankerson, Darrel <2>: Contributors. (line 56)
+* Hankerson, Darrel: Acknowledgments. (line 53)
+* Hartholz, Elaine: Acknowledgments. (line 35)
+* Hartholz, Marshall: Acknowledgments. (line 35)
+* Hasegawa, Isamu <1>: Contributors. (line 83)
+* Hasegawa, Isamu: Acknowledgments. (line 53)
+* hexadecimal numbers: Nondecimal-numbers. (line 6)
+* hexadecimal values, enabling interpretation of: Options. (line 168)
+* histsort.awk program: History Sorting. (line 25)
+* Hughes, Phil: Acknowledgments. (line 40)
+* HUP signal: Profiling. (line 207)
+* hyphen (-), - operator: Precedence. (line 52)
+* hyphen (-), -- (decrement/increment) operators: Precedence. (line 46)
+* hyphen (-), -- operator: Increment Ops. (line 48)
+* hyphen (-), -= operator <1>: Precedence. (line 96)
+* hyphen (-), -= operator: Assignment Ops. (line 129)
+* hyphen (-), filenames beginning with: Options. (line 67)
+* hyphen (-), in character lists: Character Lists. (line 17)
+* id utility: Id Program. (line 6)
+* id.awk program: Id Program. (line 30)
+* if statement <1>: If Statement. (line 6)
+* if statement: Regexp Usage. (line 19)
+* if statement, actions, changing: Ranges. (line 25)
+* igawk.sh program: Igawk Program. (line 118)
+* IGNORECASE variable <1>: User-modified. (line 68)
+* IGNORECASE variable: Case-sensitivity. (line 26)
+* IGNORECASE variable, array sorting and: Array Sorting. (line 86)
+* IGNORECASE variable, array subscripts and: Array Intro. (line 87)
* IGNORECASE variable, in example programs: Library Functions.
- (line 12506)
-* implementation issues, gawk: Notes. (line 18484)
-* implementation issues, gawk, debugging: Compatibility Mode.
- (line 18503)
-* implementation issues, gawk, limits <1>: Redirection. (line 4973)
-* implementation issues, gawk, limits: Getline Notes. (line 4193)
-* in operator <1>: Id Program. (line 14842)
-* in operator <2>: For Statement. (line 7449)
-* in operator <3>: Precedence. (line 6730)
-* in operator: Typing and Comparison.
- (line 6342)
-* in operator, arrays and <1>: Scanning an Array. (line 8541)
+ (line 43)
+* implementation issues, gawk: Notes. (line 6)
+* implementation issues, gawk, debugging: Compatibility Mode. (line 6)
+* implementation issues, gawk, limits <1>: Redirection. (line 132)
+* implementation issues, gawk, limits: Getline Notes. (line 14)
+* in operator <1>: Id Program. (line 93)
+* in operator <2>: For Statement. (line 74)
+* in operator <3>: Precedence. (line 84)
+* in operator: Comparison Operators.
+ (line 11)
+* in operator, arrays and <1>: Scanning an Array. (line 17)
* in operator, arrays and: Reference to Elements.
- (line 8432)
-* increment operators: Increment Ops. (line 6160)
-* index function: String Functions. (line 9218)
-* indexing arrays: Array Intro. (line 8356)
-* initialization, automatic: More Complex. (line 1731)
-* input files: Reading Files. (line 2780)
+ (line 25)
+* increment operators: Increment Ops. (line 6)
+* index function: String Functions. (line 60)
+* indexing arrays: Array Intro. (line 45)
+* initialization, automatic: More Complex. (line 38)
+* input files: Reading Files. (line 6)
* input files, closing: Close Files And Pipes.
- (line 5199)
-* input files, counting elements in: Wc Program. (line 15264)
-* input files, examples: Sample Data Files. (line 1461)
-* input files, reading: Reading Files. (line 2780)
-* input files, running awk without: Read Terminal. (line 1146)
-* input files, skipping: Nextfile Function. (line 12645)
-* input files, variable assignments and: Other Arguments. (line 12318)
-* input pipeline: Getline/Pipe. (line 4051)
-* input redirection: Getline/File. (line 3979)
-* input, data, nondecimal: Nondecimal Data. (line 11480)
-* input, explicit: Getline. (line 3843)
-* input, files, See input files: Multiple Line. (line 3705)
-* input, multiline records: Multiple Line. (line 3705)
-* input, splitting into records: Records. (line 2817)
-* input, standard <1>: Special FD. (line 5019)
-* input, standard: Read Terminal. (line 1146)
-* input/output, binary: User-modified. (line 7817)
-* input/output, from BEGIN and END: I/O And BEGIN/END. (line 7058)
-* input/output, two-way: Two-way I/O. (line 11560)
-* insomnia, cure for: Alarm Program. (line 15477)
-* installation, amiga: Amiga Installation.
- (line 17569)
-* installation, atari: Atari Installation.
- (line 18161)
-* installation, beos: BeOS Installation. (line 17602)
-* installation, tandem: Tandem Installation.
- (line 18278)
-* installation, vms: VMS Installation. (line 17981)
-* installing gawk: Installation. (line 17151)
-* int function: Numeric Functions. (line 9056)
-* INT signal (MS-DOS): Profiling. (line 11946)
-* integers: Basic Data Typing. (line 19654)
-* integers, unsigned: Basic Data Typing. (line 19661)
-* interacting with other programs: I/O Functions. (line 9872)
-* internationalization <1>: I18N and L10N. (line 10906)
-* internationalization: I18N Functions. (line 10436)
+ (line 6)
+* input files, counting elements in: Wc Program. (line 6)
+* input files, examples: Sample Data Files. (line 6)
+* input files, reading: Reading Files. (line 6)
+* input files, running awk without: Read Terminal. (line 6)
+* input files, skipping: Nextfile Function. (line 6)
+* input files, variable assignments and: Other Arguments. (line 19)
+* input pipeline: Getline/Pipe. (line 6)
+* input redirection: Getline/File. (line 6)
+* input, data, nondecimal: Nondecimal Data. (line 6)
+* input, explicit: Getline. (line 6)
+* input, files, See input files: Multiple Line. (line 6)
+* input, multiline records: Multiple Line. (line 6)
+* input, splitting into records: Records. (line 6)
+* input, standard <1>: Special FD. (line 6)
+* input, standard: Read Terminal. (line 6)
+* input/output, binary: User-modified. (line 10)
+* input/output, from BEGIN and END: I/O And BEGIN/END. (line 6)
+* input/output, two-way: Two-way I/O. (line 44)
+* insomnia, cure for: Alarm Program. (line 6)
+* installation, amiga: Amiga Installation. (line 6)
+* installation, atari: Atari Installation. (line 9)
+* installation, beos: BeOS Installation. (line 6)
+* installation, tandem: Tandem Installation. (line 6)
+* installation, vms: VMS Installation. (line 6)
+* installing gawk: Installation. (line 6)
+* int function: Numeric Functions. (line 11)
+* INT signal (MS-DOS): Profiling. (line 210)
+* integers: Basic Data Typing. (line 21)
+* integers, unsigned: Basic Data Typing. (line 28)
+* interacting with other programs: I/O Functions. (line 63)
+* internationalization <1>: I18N and L10N. (line 6)
+* internationalization: I18N Functions. (line 6)
* internationalization, localization <1>: Internationalization.
- (line 10883)
-* internationalization, localization: User-modified. (line 7945)
+ (line 13)
+* internationalization, localization: User-modified. (line 138)
* internationalization, localization, character classes: Character Lists.
- (line 2451)
+ (line 92)
* internationalization, localization, gawk and: Internationalization.
- (line 10883)
+ (line 13)
* internationalization, localization, locale categories: Explaining gettext.
- (line 10993)
+ (line 78)
* internationalization, localization, marked strings: Programmer i18n.
- (line 11059)
+ (line 14)
* internationalization, localization, portability and: I18N Portability.
- (line 11280)
-* internationalizing a program: Explaining gettext.
- (line 10921)
-* interpreted programs <1>: Glossary. (line 20167)
-* interpreted programs: Basic High Level. (line 19551)
-* interval expressions: Regexp Operators. (line 2290)
-* inventory-shipped file: Sample Data Files. (line 1487)
-* IOBUF internal structure: Internals. (line 18964)
-* iop_alloc internal function: Internals. (line 18964)
-* ISO: Glossary. (line 20178)
-* ISO 8859-1: Glossary. (line 19963)
-* ISO Latin-1: Glossary. (line 19963)
-* Jacobs, Andrew: Passwd Functions. (line 13813)
-* Jaegermann, Michal <1>: Contributors. (line 17095)
-* Jaegermann, Michal: Acknowledgments. (line 995)
-* Jedi knights: Undocumented. (line 12443)
-* join user-defined function: Join Function. (line 13079)
-* Kahrs, Ju"rgen <1>: Contributors. (line 17114)
-* Kahrs, Ju"rgen: Acknowledgments. (line 995)
-* Kenobi, Obi-Wan: Undocumented. (line 12443)
-* Kernighan, Brian <1>: Basic Data Typing. (line 19704)
-* Kernighan, Brian <2>: Other Versions. (line 18390)
-* Kernighan, Brian <3>: Contributors. (line 17062)
-* Kernighan, Brian <4>: BTL. (line 16809)
-* Kernighan, Brian <5>: Concatenation. (line 5908)
-* Kernighan, Brian <6>: Acknowledgments. (line 1002)
-* Kernighan, Brian <7>: Conventions. (line 846)
-* Kernighan, Brian: History. (line 640)
-* kill command, dynamic profiling: Profiling. (line 11921)
-* Knights, jedi: Undocumented. (line 12443)
-* Kwok, Conrad: Contributors. (line 17087)
-* labels.awk program: Labels Program. (line 15765)
-* languages, data-driven: Basic High Level. (line 19620)
-* LC_ALL locale category: Explaining gettext.
- (line 11031)
-* LC_COLLATE locale category: Explaining gettext.
- (line 11004)
-* LC_CTYPE locale category: Explaining gettext.
- (line 11008)
-* LC_MESSAGES locale category: Explaining gettext.
- (line 10998)
+ (line 6)
+* internationalizing a program: Explaining gettext. (line 6)
+* interpreted programs <1>: Glossary. (line 342)
+* interpreted programs: Basic High Level. (line 14)
+* interval expressions: Regexp Operators. (line 115)
+* inventory-shipped file: Sample Data Files. (line 32)
+* IOBUF internal structure: Internals. (line 178)
+* iop_alloc internal function: Internals. (line 178)
+* ISO: Glossary. (line 353)
+* ISO 8859-1: Glossary. (line 138)
+* ISO Latin-1: Glossary. (line 138)
+* Jacobs, Andrew: Passwd Functions. (line 76)
+* Jaegermann, Michal <1>: Contributors. (line 45)
+* Jaegermann, Michal: Acknowledgments. (line 53)
+* Java implementation of awk: Other Versions. (line 105)
+* jawk: Other Versions. (line 105)
+* Jedi knights: Undocumented. (line 6)
+* join user-defined function: Join Function. (line 18)
+* Kahrs, Ju"rgen <1>: Contributors. (line 64)
+* Kahrs, Ju"rgen: Acknowledgments. (line 53)
+* Kenobi, Obi-Wan: Undocumented. (line 6)
+* Kernighan, Brian <1>: Basic Data Typing. (line 71)
+* Kernighan, Brian <2>: Other Versions. (line 13)
+* Kernighan, Brian <3>: Contributors. (line 12)
+* Kernighan, Brian <4>: BTL. (line 6)
+* Kernighan, Brian <5>: Concatenation. (line 6)
+* Kernighan, Brian <6>: Acknowledgments. (line 60)
+* Kernighan, Brian <7>: Conventions. (line 33)
+* Kernighan, Brian: History. (line 17)
+* kill command, dynamic profiling: Profiling. (line 185)
+* Knights, jedi: Undocumented. (line 6)
+* Kwok, Conrad: Contributors. (line 37)
+* labels.awk program: Labels Program. (line 48)
+* languages, data-driven: Basic High Level. (line 83)
+* LC_ALL locale category: Explaining gettext. (line 116)
+* LC_COLLATE locale category: Explaining gettext. (line 89)
+* LC_CTYPE locale category: Explaining gettext. (line 93)
+* LC_MESSAGES locale category: Explaining gettext. (line 83)
* LC_MESSAGES locale category, bindtextdomain function (gawk): Programmer i18n.
- (line 11131)
-* LC_MONETARY locale category: Explaining gettext.
- (line 11014)
-* LC_NUMERIC locale category: Explaining gettext.
- (line 11018)
-* LC_RESPONSE locale category: Explaining gettext.
- (line 11022)
-* LC_TIME locale category: Explaining gettext.
- (line 11026)
-* left angle bracket (<), < operator <1>: Precedence. (line 6711)
-* left angle bracket (<), < operator: Typing and Comparison.
- (line 6342)
-* left angle bracket (<), < operator (I/O): Getline/File. (line 3979)
-* left angle bracket (<), <= operator <1>: Precedence. (line 6711)
-* left angle bracket (<), <= operator: Typing and Comparison.
- (line 6342)
-* left shift, bitwise: Bitwise Functions. (line 10340)
-* leftmost longest match: Multiple Line. (line 3725)
-* length function: String Functions. (line 9229)
-* Lesser General Public License (LGPL): Glossary. (line 20195)
-* LGPL (Lesser General Public License): Glossary. (line 20195)
-* libraries of awk functions: Library Functions. (line 12469)
-* libraries of awk functions, assertions: Assert Function. (line 12815)
+ (line 86)
+* LC_MONETARY locale category: Explaining gettext. (line 99)
+* LC_NUMERIC locale category: Explaining gettext. (line 103)
+* LC_RESPONSE locale category: Explaining gettext. (line 107)
+* LC_TIME locale category: Explaining gettext. (line 111)
+* left angle bracket (<), < operator <1>: Precedence. (line 65)
+* left angle bracket (<), < operator: Comparison Operators.
+ (line 11)
+* left angle bracket (<), < operator (I/O): Getline/File. (line 6)
+* left angle bracket (<), <= operator <1>: Precedence. (line 65)
+* left angle bracket (<), <= operator: Comparison Operators.
+ (line 11)
+* left shift, bitwise: Bitwise Functions. (line 32)
+* leftmost longest match: Multiple Line. (line 26)
+* length function: String Functions. (line 71)
+* Lesser General Public License (LGPL): Glossary. (line 373)
+* LGPL (Lesser General Public License): Glossary. (line 373)
+* libraries of awk functions: Library Functions. (line 6)
+* libraries of awk functions, assertions: Assert Function. (line 6)
* libraries of awk functions, associative arrays and: Library Names.
- (line 12592)
+ (line 57)
* libraries of awk functions, character values as numbers: Ordinal Functions.
- (line 12976)
+ (line 6)
* libraries of awk functions, command-line options: Getopt Function.
- (line 13460)
+ (line 6)
* libraries of awk functions, example program for using: Igawk Program.
- (line 16250)
+ (line 6)
* libraries of awk functions, group database, reading: Group Functions.
- (line 13968)
+ (line 6)
* libraries of awk functions, managing, data files: Data File Management.
- (line 13194)
+ (line 6)
* libraries of awk functions, managing, time: Gettimeofday Function.
- (line 13112)
+ (line 6)
* libraries of awk functions, merging arrays into strings: Join Function.
- (line 13067)
+ (line 6)
* libraries of awk functions, nextfile statement: Nextfile Function.
- (line 12645)
+ (line 6)
* libraries of awk functions, rounding numbers: Round Function.
- (line 12900)
+ (line 6)
* libraries of awk functions, user database, reading: Passwd Functions.
- (line 13743)
-* line breaks: Statements/Lines. (line 1770)
-* line continuations: Boolean Ops. (line 6519)
-* line continuations, gawk: Conditional Exp. (line 6581)
-* line continuations, in print statement: Print Examples. (line 4383)
-* line continuations, with C shell: More Complex. (line 1723)
-* lines, blank, printing: Print. (line 4300)
-* lines, counting: Wc Program. (line 15264)
-* lines, duplicate, removing: History Sorting. (line 15934)
-* lines, matching ranges of: Ranges. (line 6913)
-* lines, skipping between markers: Ranges. (line 6950)
-* lint checking: User-modified. (line 7890)
-* lint checking, array elements: Delete. (line 8613)
+ (line 6)
+* line breaks: Statements/Lines. (line 6)
+* line continuations: Boolean Ops. (line 62)
+* line continuations, gawk: Conditional Exp. (line 34)
+* line continuations, in print statement: Print Examples. (line 76)
+* line continuations, with C shell: More Complex. (line 30)
+* lines, blank, printing: Print. (line 22)
+* lines, counting: Wc Program. (line 6)
+* lines, duplicate, removing: History Sorting. (line 6)
+* lines, matching ranges of: Ranges. (line 6)
+* lines, skipping between markers: Ranges. (line 43)
+* lint checking: User-modified. (line 83)
+* lint checking, array elements: Delete. (line 34)
* lint checking, array subscripts: Uninitialized Subscripts.
- (line 8743)
-* lint checking, empty programs: Command Line. (line 11998)
-* lint checking, issuing warnings: Options. (line 12150)
+ (line 42)
+* lint checking, empty programs: Command Line. (line 16)
+* lint checking, issuing warnings: Options. (line 144)
* lint checking, POSIXLY_CORRECT environment variable: Options.
- (line 12273)
-* lint checking, undefined functions: Function Caveats. (line 10757)
-* LINT variable: User-modified. (line 7890)
-* Linux <1>: Glossary. (line 20404)
-* Linux <2>: Atari Compiling. (line 18198)
-* Linux <3>: I18N Example. (line 11393)
-* Linux: Manual History. (line 886)
-* locale categories: Explaining gettext.
- (line 10993)
-* localization: I18N and L10N. (line 10906)
+ (line 282)
+* lint checking, undefined functions: Function Caveats. (line 96)
+* LINT variable: User-modified. (line 83)
+* Linux <1>: Glossary. (line 582)
+* Linux <2>: Atari Compiling. (line 16)
+* Linux <3>: I18N Example. (line 55)
+* Linux: Manual History. (line 28)
+* locale categories: Explaining gettext. (line 78)
+* locale decimal point character: Options. (line 200)
+* locale, definition of: Locales. (line 6)
+* localization: I18N and L10N. (line 6)
* localization, See internationalization, localization: I18N and L10N.
- (line 10906)
-* log files, timestamps in: Time Functions. (line 9987)
-* log function: Numeric Functions. (line 9072)
-* logical false/true: Truth Values. (line 6246)
-* logical operators, See Boolean expressions: Boolean Ops. (line 6463)
-* login information: Passwd Functions. (line 13753)
-* long options: Command Line. (line 11995)
-* loops: While Statement. (line 7299)
-* loops, continue statements and: For Statement. (line 7438)
-* loops, count for header: Profiling. (line 11862)
-* loops, exiting: Break Statement. (line 7525)
-* loops, See Also while statement: While Statement. (line 7299)
-* Lost In Space: Dynamic Extensions.
- (line 18761)
-* ls utility: More Complex. (line 1708)
-* lshift function (gawk): Bitwise Functions. (line 10353)
-* lvalues/rvalues: Assignment Ops. (line 6014)
-* mailing labels, printing: Labels Program. (line 15723)
-* mailing list, GNITS: Acknowledgments. (line 991)
-* make_builtin internal function: Internals. (line 18893)
-* make_number internal function: Internals. (line 18868)
-* make_string internal function: Internals. (line 18863)
-* mark parity: Ordinal Functions. (line 13014)
+ (line 6)
+* log files, timestamps in: Time Functions. (line 6)
+* log function: Numeric Functions. (line 27)
+* logical false/true: Truth Values. (line 6)
+* logical operators, See Boolean expressions: Boolean Ops. (line 6)
+* login information: Passwd Functions. (line 16)
+* long options: Command Line. (line 13)
+* loops: While Statement. (line 6)
+* loops, continue statements and: For Statement. (line 63)
+* loops, count for header: Profiling. (line 129)
+* loops, exiting: Break Statement. (line 6)
+* loops, See Also while statement: While Statement. (line 6)
+* Lost In Space: Dynamic Extensions. (line 6)
+* ls utility: More Complex. (line 15)
+* lshift function (gawk): Bitwise Functions. (line 45)
+* lvalues/rvalues: Assignment Ops. (line 32)
+* mailing labels, printing: Labels Program. (line 6)
+* mailing list, GNITS: Acknowledgments. (line 49)
+* make_builtin internal function: Internals. (line 107)
+* make_number internal function: Internals. (line 82)
+* make_string internal function: Internals. (line 77)
+* mark parity: Ordinal Functions. (line 44)
* marked string extraction (internationalization): String Extraction.
- (line 11177)
-* marked strings, extracting: String Extraction. (line 11177)
-* Marx, Groucho: Increment Ops. (line 6215)
-* match function: String Functions. (line 9256)
-* match function, RSTART/RLENGTH variables: String Functions.
- (line 9273)
+ (line 6)
+* marked strings, extracting: String Extraction. (line 6)
+* Marx, Groucho: Increment Ops. (line 61)
+* match function: String Functions. (line 98)
+* match function, RSTART/RLENGTH variables: String Functions. (line 115)
* matching, expressions, See comparison expressions: Typing and Comparison.
- (line 6277)
-* matching, leftmost longest: Multiple Line. (line 3725)
-* matching, null strings: Gory Details. (line 9796)
-* mawk program: Other Versions. (line 18410)
-* McPhee, Patrick: Contributors. (line 17138)
-* memory, releasing: Internals. (line 18888)
-* memory, setting limits: Options. (line 12051)
-* message object files: Explaining gettext.
- (line 10954)
+ (line 9)
+* matching, leftmost longest: Multiple Line. (line 26)
+* matching, null strings: Gory Details. (line 160)
+* mawk program: Other Versions. (line 33)
+* McPhee, Patrick: Contributors. (line 89)
+* memory, releasing: Internals. (line 102)
+* memory, setting limits: Options. (line 45)
+* message object files: Explaining gettext. (line 39)
* message object files, converting from portable object files: I18N Example.
- (line 11400)
+ (line 62)
* message object files, specifying directory of <1>: Programmer i18n.
- (line 11090)
+ (line 45)
* message object files, specifying directory of: Explaining gettext.
- (line 10966)
-* metacharacters, escape sequences for: Escape Sequences. (line 2164)
-* mktime function (gawk): Time Functions. (line 10011)
-* modifiers, in format specifiers: Format Modifiers. (line 4614)
-* monetary information, localization: Explaining gettext.
- (line 11014)
-* msgfmt utility: I18N Example. (line 11400)
-* names, arrays/variables <1>: Library Names. (line 12541)
-* names, arrays/variables: Arrays. (line 8287)
-* names, functions <1>: Library Names. (line 12541)
-* names, functions: Definition Syntax. (line 10506)
-* namespace issues <1>: Library Names. (line 12541)
-* namespace issues: Arrays. (line 8287)
-* namespace issues, functions: Definition Syntax. (line 10506)
-* nawk utility: Names. (line 688)
-* negative zero: Floating Point Issues.
- (line 19798)
-* NetBSD: Glossary. (line 20404)
-* networks, programming: TCP/IP Networking. (line 11658)
-* networks, support for: Special Network. (line 5145)
-* newlines <1>: Options. (line 12182)
-* newlines <2>: Boolean Ops. (line 6524)
-* newlines: Statements/Lines. (line 1770)
-* newlines, as field separators: Field Separators. (line 3320)
-* newlines, as record separators: Records. (line 2831)
-* newlines, in dynamic regexps: Computed Regexps. (line 2708)
-* newlines, in regexp constants: Computed Regexps. (line 2718)
-* newlines, printing: Print Examples. (line 4320)
-* newlines, separating statements in actions <1>: Statements.
- (line 7228)
+ (line 51)
+* metacharacters, escape sequences for: Escape Sequences. (line 132)
+* mktime function (gawk): Time Functions. (line 30)
+* modifiers, in format specifiers: Format Modifiers. (line 6)
+* monetary information, localization: Explaining gettext. (line 99)
+* msgfmt utility: I18N Example. (line 62)
+* names, arrays/variables <1>: Library Names. (line 6)
+* names, arrays/variables: Arrays. (line 17)
+* names, functions <1>: Library Names. (line 6)
+* names, functions: Definition Syntax. (line 20)
+* namespace issues <1>: Library Names. (line 6)
+* namespace issues: Arrays. (line 17)
+* namespace issues, functions: Definition Syntax. (line 20)
+* nawk utility: Names. (line 17)
+* negative zero: Unexpected Results. (line 28)
+* NetBSD: Glossary. (line 582)
+* networks, programming: TCP/IP Networking. (line 6)
+* networks, support for: Special Network. (line 6)
+* newlines <1>: Options. (line 183)
+* newlines <2>: Boolean Ops. (line 67)
+* newlines: Statements/Lines. (line 6)
+* newlines, as field separators: Field Separators. (line 63)
+* newlines, as record separators: Records. (line 20)
+* newlines, in dynamic regexps: Computed Regexps. (line 59)
+* newlines, in regexp constants: Computed Regexps. (line 69)
+* newlines, printing: Print Examples. (line 12)
+* newlines, separating statements in actions <1>: Statements. (line 10)
* newlines, separating statements in actions: Action Overview.
- (line 7178)
-* next file statement: POSIX/GNU. (line 17001)
-* next file statement, deprecated: Obsolete. (line 12426)
-* next file statement, in gawk: Nextfile Statement.
- (line 7724)
-* next statement <1>: Next Statement. (line 7635)
-* next statement: Boolean Ops. (line 6541)
-* next statement, BEGIN/END patterns and: I/O And BEGIN/END.
- (line 7088)
-* next statement, user-defined functions and: Next Statement.
- (line 7668)
-* nextfile statement: Nextfile Statement.
- (line 7684)
+ (line 19)
+* next file statement: POSIX/GNU. (line 155)
+* next file statement, deprecated: Obsolete. (line 11)
+* next file statement, in gawk: Nextfile Statement. (line 46)
+* next statement <1>: Next Statement. (line 6)
+* next statement: Boolean Ops. (line 85)
+* next statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 36)
+* next statement, user-defined functions and: Next Statement. (line 39)
+* nextfile statement: Nextfile Statement. (line 6)
* nextfile statement, BEGIN/END patterns and: I/O And BEGIN/END.
- (line 7088)
-* nextfile statement, implementing: Nextfile Function. (line 12645)
-* nextfile statement, in gawk: Nextfile Statement.
- (line 7724)
-* nextfile statement, next file statement and: Obsolete. (line 12426)
+ (line 36)
+* nextfile statement, implementing: Nextfile Function. (line 6)
+* nextfile statement, in gawk: Nextfile Statement. (line 46)
+* nextfile statement, next file statement and: Obsolete. (line 11)
* nextfile statement, user-defined functions and: Nextfile Statement.
- (line 7717)
-* nextfile user-defined function: Nextfile Function. (line 12677)
-* NF variable <1>: Auto-set. (line 8064)
-* NF variable: Fields. (line 3041)
-* NF variable, decrementing: Changing Fields. (line 3231)
-* noassign.awk program: Ignoring Assigns. (line 13427)
-* NODE internal type: Internals. (line 18809)
-* nodes, duplicating: Internals. (line 18883)
-* not Boolean-logic operator: Boolean Ops. (line 6463)
-* NR variable <1>: Auto-set. (line 8075)
-* NR variable: Records. (line 2817)
-* NR variable, changing: Auto-set. (line 8148)
-* null strings <1>: Basic Data Typing. (line 19680)
-* null strings <2>: Truth Values. (line 6246)
+ (line 39)
+* nextfile user-defined function: Nextfile Function. (line 38)
+* NF variable <1>: Auto-set. (line 103)
+* NF variable: Fields. (line 33)
+* NF variable, decrementing: Changing Fields. (line 107)
+* noassign.awk program: Ignoring Assigns. (line 15)
+* NODE internal type: Internals. (line 23)
+* nodes, duplicating: Internals. (line 97)
+* not Boolean-logic operator: Boolean Ops. (line 6)
+* NR variable <1>: Auto-set. (line 114)
+* NR variable: Records. (line 6)
+* NR variable, changing: Auto-set. (line 187)
+* null strings <1>: Basic Data Typing. (line 47)
+* null strings <2>: Truth Values. (line 6)
* null strings <3>: Regexp Field Splitting.
- (line 3379)
-* null strings: Records. (line 2912)
-* null strings, array elements and: Delete. (line 8606)
+ (line 43)
+* null strings: Records. (line 102)
+* null strings, array elements and: Delete. (line 27)
* null strings, as array subscripts: Uninitialized Subscripts.
- (line 8743)
-* null strings, converting numbers to strings: Conversion. (line 5734)
-* null strings, matching: Gory Details. (line 9796)
-* null strings, quoting and: Quoting. (line 1401)
+ (line 42)
+* null strings, converting numbers to strings: Conversion. (line 21)
+* null strings, matching: Gory Details. (line 160)
+* null strings, quoting and: Quoting. (line 58)
* number sign (#), #! (executable scripts): Executable Scripts.
- (line 1233)
+ (line 6)
* number sign (#), #! (executable scripts), portability issues with: Executable Scripts.
- (line 1233)
-* number sign (#), commenting: Comments. (line 1296)
-* numbers: Internals. (line 18868)
+ (line 6)
+* number sign (#), commenting: Comments. (line 6)
+* numbers: Internals. (line 82)
* numbers, as array subscripts: Numeric Array Subscripts.
- (line 8656)
-* numbers, as values of characters: Ordinal Functions. (line 12976)
+ (line 6)
+* numbers, as values of characters: Ordinal Functions. (line 6)
* numbers, Cliff random: Cliff Random Function.
- (line 12945)
-* numbers, converting: Conversion. (line 5719)
-* numbers, converting, to strings <1>: Bitwise Functions. (line 10407)
-* numbers, converting, to strings: User-modified. (line 7833)
-* numbers, floating-point: Basic Data Typing. (line 19654)
-* numbers, floating-point, AWKNUM internal type: Internals. (line 18805)
-* numbers, hexadecimal: Nondecimal-numbers.
- (line 5457)
-* numbers, NODE internal type: Internals. (line 18809)
-* numbers, octal: Nondecimal-numbers.
- (line 5457)
-* numbers, random: Numeric Functions. (line 9115)
-* numbers, rounding: Round Function. (line 12900)
-* numeric, constants: Scalar Constants. (line 5425)
-* numeric, output format: OFMT. (line 4434)
-* numeric, strings: Typing and Comparison.
- (line 6281)
-* numeric, values: Internals. (line 18813)
-* oawk utility: Names. (line 688)
-* obsolete features: Obsolete. (line 12421)
-* octal numbers: Nondecimal-numbers.
- (line 5457)
-* octal values, enabling interpretation of: Options. (line 12167)
-* OFMT variable <1>: User-modified. (line 7907)
-* OFMT variable <2>: Conversion. (line 5767)
-* OFMT variable: OFMT. (line 4443)
-* OFMT variable, POSIX awk and: OFMT. (line 4455)
-* OFS variable <1>: User-modified. (line 7916)
-* OFS variable <2>: Output Separators. (line 4393)
-* OFS variable: Changing Fields. (line 3188)
-* OpenBSD: Glossary. (line 20404)
-* operating systems, BSD-based <1>: Portal Files. (line 11725)
-* operating systems, BSD-based: Manual History. (line 886)
-* operating systems, PC, gawk on: PC Using. (line 17853)
+ (line 6)
+* numbers, converting: Conversion. (line 6)
+* numbers, converting, to strings <1>: Bitwise Functions. (line 99)
+* numbers, converting, to strings: User-modified. (line 26)
+* numbers, floating-point: Basic Data Typing. (line 21)
+* numbers, floating-point, AWKNUM internal type: Internals. (line 19)
+* numbers, hexadecimal: Nondecimal-numbers. (line 6)
+* numbers, NODE internal type: Internals. (line 23)
+* numbers, octal: Nondecimal-numbers. (line 6)
+* numbers, random: Numeric Functions. (line 70)
+* numbers, rounding: Round Function. (line 6)
+* numeric, constants: Scalar Constants. (line 6)
+* numeric, output format: OFMT. (line 6)
+* numeric, strings: Variable Typing. (line 6)
+* numeric, values: Internals. (line 27)
+* oawk utility: Names. (line 17)
+* obsolete features: Obsolete. (line 6)
+* octal numbers: Nondecimal-numbers. (line 6)
+* octal values, enabling interpretation of: Options. (line 168)
+* OFMT variable <1>: User-modified. (line 100)
+* OFMT variable <2>: Conversion. (line 54)
+* OFMT variable: OFMT. (line 15)
+* OFMT variable, POSIX awk and: OFMT. (line 27)
+* OFS variable <1>: User-modified. (line 109)
+* OFS variable <2>: Output Separators. (line 6)
+* OFS variable: Changing Fields. (line 64)
+* OpenBSD: Glossary. (line 582)
+* OpenSolaris: Other Versions. (line 96)
+* operating systems, BSD-based <1>: Portal Files. (line 6)
+* operating systems, BSD-based: Manual History. (line 28)
+* operating systems, PC, gawk on: PC Using. (line 6)
* operating systems, PC, gawk on, installing: PC Installation.
- (line 17634)
-* operating systems, porting gawk to: New Ports. (line 18680)
+ (line 6)
+* operating systems, porting gawk to: New Ports. (line 6)
* operating systems, See Also GNU/Linux, PC operating systems, Unix: Installation.
- (line 17151)
-* operations, bitwise: Bitwise Functions. (line 10314)
-* operators, arithmetic: Arithmetic Ops. (line 5823)
-* operators, assignment: Assignment Ops. (line 5989)
-* operators, assignment, evaluation order: Assignment Ops. (line 6093)
-* operators, Boolean, See Boolean expressions: Boolean Ops. (line 6463)
-* operators, decrement/increment: Increment Ops. (line 6160)
+ (line 6)
+* operations, bitwise: Bitwise Functions. (line 6)
+* operators, arithmetic: Arithmetic Ops. (line 6)
+* operators, assignment: Assignment Ops. (line 6)
+* operators, assignment, evaluation order: Assignment Ops. (line 111)
+* operators, Boolean, See Boolean expressions: Boolean Ops. (line 6)
+* operators, decrement/increment: Increment Ops. (line 6)
* operators, GNU-specific: GNU Regexp Operators.
- (line 2461)
-* operators, input/output <1>: Precedence. (line 6711)
-* operators, input/output <2>: Redirection. (line 4864)
-* operators, input/output <3>: Getline/Coprocess. (line 4137)
-* operators, input/output <4>: Getline/Pipe. (line 4051)
-* operators, input/output: Getline/File. (line 3979)
-* operators, logical, See Boolean expressions: Boolean Ops. (line 6463)
-* operators, precedence <1>: Precedence. (line 6657)
-* operators, precedence: Increment Ops. (line 6215)
+ (line 6)
+* operators, input/output <1>: Precedence. (line 65)
+* operators, input/output <2>: Redirection. (line 19)
+* operators, input/output <3>: Getline/Coprocess. (line 6)
+* operators, input/output <4>: Getline/Pipe. (line 6)
+* operators, input/output: Getline/File. (line 6)
+* operators, logical, See Boolean expressions: Boolean Ops. (line 6)
+* operators, precedence <1>: Precedence. (line 6)
+* operators, precedence: Increment Ops. (line 61)
* operators, relational, See operators, comparison: Typing and Comparison.
- (line 6277)
-* operators, short-circuit: Boolean Ops. (line 6514)
-* operators, string: Concatenation. (line 5911)
-* operators, string-matching: Regexp Usage. (line 1989)
+ (line 9)
+* operators, short-circuit: Boolean Ops. (line 57)
+* operators, string: Concatenation. (line 9)
+* operators, string-matching: Regexp Usage. (line 19)
* operators, string-matching, for buffers: GNU Regexp Operators.
- (line 2495)
+ (line 40)
* operators, word-boundary (gawk): GNU Regexp Operators.
- (line 2510)
-* options, command-line <1>: Options. (line 12012)
+ (line 55)
+* options, command-line <1>: Options. (line 6)
* options, command-line <2>: Command Line Field Separator.
- (line 3427)
-* options, command-line: Long. (line 1202)
-* options, command-line, end of: Options. (line 12068)
-* options, command-line, invoking awk: Command Line. (line 11988)
-* options, command-line, processing: Getopt Function. (line 13460)
-* options, deprecated: Obsolete. (line 12421)
-* options, long <1>: Options. (line 12012)
-* options, long: Command Line. (line 11995)
-* options, printing list of: Options. (line 12145)
-* OR bitwise operation: Bitwise Functions. (line 10314)
-* or Boolean-logic operator: Boolean Ops. (line 6463)
-* or function (gawk): Bitwise Functions. (line 10347)
-* ord user-defined function: Ordinal Functions. (line 12986)
-* order of evaluation, concatenation: Concatenation. (line 5943)
-* ORS variable <1>: User-modified. (line 7921)
-* ORS variable: Output Separators. (line 4407)
-* output field separator, See OFS variable: Changing Fields.
- (line 3188)
+ (line 6)
+* options, command-line: Long. (line 12)
+* options, command-line, end of: Options. (line 62)
+* options, command-line, invoking awk: Command Line. (line 6)
+* options, command-line, processing: Getopt Function. (line 6)
+* options, deprecated: Obsolete. (line 6)
+* options, long <1>: Options. (line 6)
+* options, long: Command Line. (line 13)
+* options, printing list of: Options. (line 139)
+* OR bitwise operation: Bitwise Functions. (line 6)
+* or Boolean-logic operator: Boolean Ops. (line 6)
+* or function (gawk): Bitwise Functions. (line 39)
+* ord user-defined function: Ordinal Functions. (line 16)
+* order of evaluation, concatenation: Concatenation. (line 42)
+* ORS variable <1>: User-modified. (line 114)
+* ORS variable: Output Separators. (line 20)
+* output field separator, See OFS variable: Changing Fields. (line 64)
* output record separator, See ORS variable: Output Separators.
- (line 4407)
-* output redirection: Redirection. (line 4851)
-* output, buffering: I/O Functions. (line 9838)
-* output, duplicating into files: Tee Program. (line 14964)
+ (line 20)
+* output redirection: Redirection. (line 6)
+* output, buffering: I/O Functions. (line 29)
+* output, duplicating into files: Tee Program. (line 6)
* output, files, closing: Close Files And Pipes.
- (line 5199)
-* output, format specifier, OFMT: OFMT. (line 4443)
-* output, formatted: Printf. (line 4465)
-* output, pipes: Redirection. (line 4899)
-* output, printing, See printing: Printing. (line 4249)
-* output, records: Output Separators. (line 4407)
-* output, standard: Special FD. (line 5019)
-* P1003.2 POSIX standard: Glossary. (line 20248)
-* param_cnt internal variable: Internals. (line 18832)
-* parameters, number of: Internals. (line 18832)
-* parentheses (): Regexp Operators. (line 2253)
-* parentheses (), pgawk program: Profiling. (line 11877)
-* password file: Passwd Functions. (line 13753)
+ (line 6)
+* output, format specifier, OFMT: OFMT. (line 15)
+* output, formatted: Printf. (line 6)
+* output, pipes: Redirection. (line 54)
+* output, printing, See printing: Printing. (line 6)
+* output, records: Output Separators. (line 20)
+* output, standard: Special FD. (line 6)
+* P1003.2 POSIX standard: Glossary. (line 426)
+* param_cnt internal variable: Internals. (line 46)
+* parameters, number of: Internals. (line 46)
+* parentheses (): Regexp Operators. (line 78)
+* parentheses (), pgawk program: Profiling. (line 144)
+* password file: Passwd Functions. (line 16)
* patterns: Patterns and Actions.
- (line 6755)
-* patterns, comparison expressions as: Expression Patterns.
- (line 6841)
-* patterns, counts: Profiling. (line 11849)
-* patterns, default: Very Simple. (line 1559)
-* patterns, empty: Empty. (line 7101)
-* patterns, expressions as: Regexp Patterns. (line 6819)
-* patterns, ranges in: Ranges. (line 6913)
-* patterns, regexp constants as: Expression Patterns.
- (line 6863)
-* patterns, types of: Pattern Overview. (line 6788)
-* pawk profiling Bell Labs awk: Other Versions. (line 18465)
-* PC operating systems, gawk on: PC Using. (line 17853)
-* PC operating systems, gawk on, installing: PC Installation.
- (line 17634)
-* percent sign (%), % operator: Precedence. (line 6701)
-* percent sign (%), %= operator <1>: Precedence. (line 6742)
-* percent sign (%), %= operator: Assignment Ops. (line 6111)
-* period (.): Regexp Operators. (line 2218)
-* PERL: Future Extensions. (line 19424)
-* Peters, Arno: Contributors. (line 17123)
-* Peterson, Hal: Contributors. (line 17090)
-* pgawk program: Profiling. (line 11740)
-* pgawk program, awkprof.out file: Profiling. (line 11744)
-* pgawk program, dynamic profiling: Profiling. (line 11913)
+ (line 6)
+* patterns, comparison expressions as: Expression Patterns. (line 14)
+* patterns, counts: Profiling. (line 116)
+* patterns, default: Very Simple. (line 34)
+* patterns, empty: Empty. (line 6)
+* patterns, expressions as: Regexp Patterns. (line 6)
+* patterns, ranges in: Ranges. (line 6)
+* patterns, regexp constants as: Expression Patterns. (line 36)
+* patterns, types of: Pattern Overview. (line 14)
+* pawk profiling Bell Labs awk: Other Versions. (line 88)
+* PC operating systems, gawk on: PC Using. (line 6)
+* PC operating systems, gawk on, installing: PC Installation. (line 6)
+* percent sign (%), % operator: Precedence. (line 55)
+* percent sign (%), %= operator <1>: Precedence. (line 96)
+* percent sign (%), %= operator: Assignment Ops. (line 129)
+* period (.): Regexp Operators. (line 43)
+* PERL: Future Extensions. (line 6)
+* Peters, Arno: Contributors. (line 74)
+* Peterson, Hal: Contributors. (line 40)
+* pgawk program: Profiling. (line 6)
+* pgawk program, awkprof.out file: Profiling. (line 10)
+* pgawk program, dynamic profiling: Profiling. (line 177)
* pipes, closing: Close Files And Pipes.
- (line 5199)
-* pipes, input: Getline/Pipe. (line 4051)
-* pipes, output: Redirection. (line 4899)
-* plus sign (+): Regexp Operators. (line 2276)
-* plus sign (+), + operator: Precedence. (line 6698)
-* plus sign (+), ++ operator <1>: Precedence. (line 6692)
-* plus sign (+), ++ operator: Increment Ops. (line 6194)
-* plus sign (+), += operator <1>: Precedence. (line 6742)
-* plus sign (+), += operator: Assignment Ops. (line 6064)
+ (line 6)
+* pipes, input: Getline/Pipe. (line 6)
+* pipes, output: Redirection. (line 54)
+* plus sign (+): Regexp Operators. (line 101)
+* plus sign (+), + operator: Precedence. (line 52)
+* plus sign (+), ++ operator <1>: Precedence. (line 46)
+* plus sign (+), ++ operator: Increment Ops. (line 40)
+* plus sign (+), += operator <1>: Precedence. (line 96)
+* plus sign (+), += operator: Assignment Ops. (line 82)
* plus sign (+), decrement/increment operators: Increment Ops.
- (line 6165)
-* portability: Escape Sequences. (line 2126)
-* portability, #! (executable scripts): Executable Scripts.
- (line 1261)
-* portability, ** operator and: Arithmetic Ops. (line 5898)
-* portability, **= operator and: Assignment Ops. (line 6131)
-* portability, ARGV variable: Executable Scripts.
- (line 1270)
-* portability, backslash continuation and: Statements/Lines.
- (line 1793)
+ (line 11)
+* portability: Escape Sequences. (line 94)
+* portability, #! (executable scripts): Executable Scripts. (line 34)
+* portability, ** operator and: Arithmetic Ops. (line 81)
+* portability, **= operator and: Assignment Ops. (line 142)
+* portability, ARGV variable: Executable Scripts. (line 43)
+* portability, backslash continuation and: Statements/Lines. (line 30)
* portability, backslash in escape sequences: Escape Sequences.
- (line 2145)
+ (line 113)
* portability, close function and: Close Files And Pipes.
- (line 5274)
-* portability, data files as single record: Records. (line 2979)
-* portability, deleting array elements: Delete. (line 8630)
-* portability, example programs: Library Functions. (line 12494)
-* portability, fflush function and: I/O Functions. (line 9838)
-* portability, functions, defining: Definition Syntax. (line 10574)
-* portability, gawk: New Ports. (line 18680)
-* portability, gettext library and: Explaining gettext.
- (line 10925)
-* portability, internationalization and: I18N Portability. (line 11280)
-* portability, length function: String Functions. (line 9238)
-* portability, new awk vs. old awk: Conversion. (line 5767)
+ (line 81)
+* portability, data files as single record: Records. (line 170)
+* portability, deleting array elements: Delete. (line 51)
+* portability, example programs: Library Functions. (line 31)
+* portability, fflush function and: I/O Functions. (line 29)
+* portability, functions, defining: Definition Syntax. (line 88)
+* portability, gawk: New Ports. (line 6)
+* portability, gettext library and: Explaining gettext. (line 10)
+* portability, internationalization and: I18N Portability. (line 6)
+* portability, length function: String Functions. (line 80)
+* portability, new awk vs. old awk: Conversion. (line 54)
* portability, next statement in user-defined functions: Function Caveats.
- (line 10760)
-* portability, NF variable, decrementing: Changing Fields. (line 3239)
-* portability, operators: Increment Ops. (line 6215)
-* portability, operators, not in POSIX awk: Precedence. (line 6746)
-* portability, POSIXLY_CORRECT environment variable: Options.
- (line 12291)
-* portability, substr function: String Functions. (line 9601)
-* portable object files <1>: Translator i18n. (line 11156)
-* portable object files: Explaining gettext.
- (line 10951)
+ (line 99)
+* portability, NF variable, decrementing: Changing Fields. (line 115)
+* portability, operators: Increment Ops. (line 61)
+* portability, operators, not in POSIX awk: Precedence. (line 100)
+* portability, POSIXLY_CORRECT environment variable: Options. (line 300)
+* portability, substr function: String Functions. (line 443)
+* portable object files <1>: Translator i18n. (line 6)
+* portable object files: Explaining gettext. (line 36)
* portable object files, converting to message object files: I18N Example.
- (line 11400)
-* portable object files, generating: Options. (line 12136)
-* portal files: Portal Files. (line 11725)
-* porting gawk: New Ports. (line 18680)
+ (line 62)
+* portable object files, generating: Options. (line 130)
+* portal files: Portal Files. (line 6)
+* porting gawk: New Ports. (line 6)
* positional specifiers, printf statement <1>: Printf Ordering.
- (line 11203)
-* positional specifiers, printf statement: Format Modifiers.
- (line 4621)
+ (line 6)
+* positional specifiers, printf statement: Format Modifiers. (line 13)
* positional specifiers, printf statement, mixing with regular formats: Printf Ordering.
- (line 11254)
-* positive zero: Floating Point Issues.
- (line 19798)
-* POSIX awk <1>: Assignment Ops. (line 6122)
-* POSIX awk: This Manual. (line 718)
-* POSIX awk, **= operator and: Assignment Ops. (line 6131)
-* POSIX awk, < operator and: Getline/File. (line 3999)
-* POSIX awk, arithmetic operators and: Arithmetic Ops. (line 5853)
+ (line 57)
+* positive zero: Unexpected Results. (line 28)
+* POSIX awk <1>: Assignment Ops. (line 136)
+* POSIX awk: This Manual. (line 13)
+* POSIX awk, **= operator and: Assignment Ops. (line 142)
+* POSIX awk, < operator and: Getline/File. (line 26)
+* POSIX awk, arithmetic operators and: Arithmetic Ops. (line 36)
* POSIX awk, backslashes in string constants: Escape Sequences.
- (line 2145)
-* POSIX awk, BEGIN/END patterns: I/O And BEGIN/END. (line 7068)
-* POSIX awk, break statement and: Break Statement. (line 7566)
-* POSIX awk, changes in awk versions: POSIX. (line 16765)
-* POSIX awk, character lists and: Character Lists. (line 2371)
+ (line 113)
+* POSIX awk, BEGIN/END patterns: I/O And BEGIN/END. (line 16)
+* POSIX awk, break statement and: Break Statement. (line 47)
+* POSIX awk, changes in awk versions: POSIX. (line 6)
+* POSIX awk, character lists and: Character Lists. (line 24)
* POSIX awk, character lists and, character classes: Character Lists.
- (line 2377)
-* POSIX awk, continue statement and: Continue Statement.
- (line 7619)
-* POSIX awk, CONVFMT variable and: User-modified. (line 7833)
-* POSIX awk, date utility and: Time Functions. (line 10245)
+ (line 30)
+* POSIX awk, continue statement and: Continue Statement. (line 43)
+* POSIX awk, CONVFMT variable and: User-modified. (line 26)
+* POSIX awk, date utility and: Time Functions. (line 259)
* POSIX awk, field separators and <1>: Field Splitting Summary.
- (line 3549)
-* POSIX awk, field separators and: Fields. (line 3014)
-* POSIX awk, FS variable and: User-modified. (line 7859)
-* POSIX awk, function keyword in: Definition Syntax. (line 10559)
-* POSIX awk, functions and, gsub/sub: Gory Details. (line 9689)
-* POSIX awk, functions and, length: String Functions. (line 9238)
-* POSIX awk, GNU long options and: Options. (line 12021)
-* POSIX awk, interval expressions in: Regexp Operators. (line 2309)
-* POSIX awk, next/nextfile statements and: Next Statement. (line 7668)
-* POSIX awk, numeric strings and: Typing and Comparison.
- (line 6281)
-* POSIX awk, OFMT variable and <1>: Conversion. (line 5767)
-* POSIX awk, OFMT variable and: OFMT. (line 4455)
-* POSIX awk, period (.), using: Regexp Operators. (line 2225)
-* POSIX awk, printf format strings and: Format Modifiers. (line 4767)
-* POSIX awk, regular expressions and: Regexp Operators. (line 2329)
-* POSIX awk, timestamps and: Time Functions. (line 9987)
-* POSIX awk, | I/O operator and: Getline/Pipe. (line 4097)
-* POSIX mode: Options. (line 12175)
-* POSIX, awk and: Preface. (line 569)
-* POSIX, gawk extensions not included in: POSIX/GNU. (line 16852)
-* POSIX, programs, implementing in awk: Clones. (line 14243)
-* POSIXLY_CORRECT environment variable: Options. (line 12273)
-* precedence <1>: Precedence. (line 6657)
-* precedence: Increment Ops. (line 6215)
-* precedence, regexp operators: Regexp Operators. (line 2324)
-* print statement: Printing. (line 4259)
-* print statement, BEGIN/END patterns and: I/O And BEGIN/END.
- (line 7068)
-* print statement, commas, omitting: Print Examples. (line 4338)
-* print statement, I/O operators in: Precedence. (line 6718)
-* print statement, line continuations and: Print Examples. (line 4383)
-* print statement, OFMT variable and: User-modified. (line 7916)
+ (line 41)
+* POSIX awk, field separators and: Fields. (line 6)
+* POSIX awk, FS variable and: User-modified. (line 52)
+* POSIX awk, function keyword in: Definition Syntax. (line 73)
+* POSIX awk, functions and, gsub/sub: Gory Details. (line 53)
+* POSIX awk, functions and, length: String Functions. (line 80)
+* POSIX awk, GNU long options and: Options. (line 15)
+* POSIX awk, interval expressions in: Regexp Operators. (line 134)
+* POSIX awk, next/nextfile statements and: Next Statement. (line 39)
+* POSIX awk, numeric strings and: Variable Typing. (line 6)
+* POSIX awk, OFMT variable and <1>: Conversion. (line 54)
+* POSIX awk, OFMT variable and: OFMT. (line 27)
+* POSIX awk, period (.), using: Regexp Operators. (line 50)
+* POSIX awk, printf format strings and: Format Modifiers. (line 159)
+* POSIX awk, regular expressions and: Regexp Operators. (line 154)
+* POSIX awk, timestamps and: Time Functions. (line 6)
+* POSIX awk, | I/O operator and: Getline/Pipe. (line 52)
+* POSIX mode: Options. (line 176)
+* POSIX, awk and: Preface. (line 22)
+* POSIX, gawk extensions not included in: POSIX/GNU. (line 6)
+* POSIX, programs, implementing in awk: Clones. (line 6)
+* POSIXLY_CORRECT environment variable: Options. (line 282)
+* precedence <1>: Precedence. (line 6)
+* precedence: Increment Ops. (line 61)
+* precedence, regexp operators: Regexp Operators. (line 149)
+* print statement: Printing. (line 16)
+* print statement, BEGIN/END patterns and: I/O And BEGIN/END. (line 16)
+* print statement, commas, omitting: Print Examples. (line 31)
+* print statement, I/O operators in: Precedence. (line 72)
+* print statement, line continuations and: Print Examples. (line 76)
+* print statement, OFMT variable and: User-modified. (line 109)
* print statement, See Also redirection, of output: Redirection.
- (line 4859)
-* print statement, sprintf function and: Round Function. (line 12900)
-* printf statement <1>: Printf. (line 4465)
-* printf statement: Printing. (line 4259)
-* printf statement, columns, aligning: Print Examples. (line 4377)
+ (line 14)
+* print statement, sprintf function and: Round Function. (line 6)
+* printf statement <1>: Printf. (line 6)
+* printf statement: Printing. (line 16)
+* printf statement, columns, aligning: Print Examples. (line 70)
* printf statement, format-control characters: Control Letters.
- (line 4527)
-* printf statement, I/O operators in: Precedence. (line 6718)
-* printf statement, modifiers: Format Modifiers. (line 4614)
+ (line 6)
+* printf statement, I/O operators in: Precedence. (line 72)
+* printf statement, modifiers: Format Modifiers. (line 6)
* printf statement, positional specifiers <1>: Printf Ordering.
- (line 11203)
-* printf statement, positional specifiers: Format Modifiers.
- (line 4621)
+ (line 6)
+* printf statement, positional specifiers: Format Modifiers. (line 13)
* printf statement, positional specifiers, mixing with regular formats: Printf Ordering.
- (line 11254)
+ (line 57)
* printf statement, See Also redirection, of output: Redirection.
- (line 4859)
-* printf statement, sprintf function and: Round Function. (line 12900)
-* printf statement, syntax of: Basic Printf. (line 4486)
-* printing: Printing. (line 4249)
-* printing, list of options: Options. (line 12145)
-* printing, mailing labels: Labels Program. (line 15723)
-* printing, unduplicated lines of text: Uniq Program. (line 15048)
-* printing, user information: Id Program. (line 14755)
-* private variables: Library Names. (line 12546)
-* process information, files for: Special Process. (line 5086)
-* processes, two-way communications with: Two-way I/O. (line 11539)
-* processing data: Basic High Level. (line 19543)
-* PROCINFO array <1>: Group Functions. (line 13968)
-* PROCINFO array <2>: Passwd Functions. (line 13743)
-* PROCINFO array <3>: Auto-set. (line 8080)
-* PROCINFO array: Special Caveats. (line 5170)
-* PROCINFO variable: Internals. (line 18951)
-* profiling awk programs: Profiling. (line 11740)
-* profiling awk programs, dynamically: Profiling. (line 11913)
-* profiling gawk, See pgawk program: Profiling. (line 11740)
-* program, definition of: Getting Started. (line 1047)
-* programmers, attractiveness of: Two-way I/O. (line 11522)
+ (line 14)
+* printf statement, sprintf function and: Round Function. (line 6)
+* printf statement, syntax of: Basic Printf. (line 6)
+* printing: Printing. (line 6)
+* printing, list of options: Options. (line 139)
+* printing, mailing labels: Labels Program. (line 6)
+* printing, unduplicated lines of text: Uniq Program. (line 6)
+* printing, user information: Id Program. (line 6)
+* private variables: Library Names. (line 11)
+* process information, files for: Special Process. (line 6)
+* processes, two-way communications with: Two-way I/O. (line 23)
+* processing data: Basic High Level. (line 6)
+* PROCINFO array <1>: Group Functions. (line 6)
+* PROCINFO array <2>: Passwd Functions. (line 6)
+* PROCINFO array <3>: Auto-set. (line 119)
+* PROCINFO array: Special Caveats. (line 12)
+* PROCINFO variable: Internals. (line 165)
+* profiling awk programs: Profiling. (line 6)
+* profiling awk programs, dynamically: Profiling. (line 177)
+* profiling gawk, See pgawk program: Profiling. (line 6)
+* program, definition of: Getting Started. (line 21)
+* programmers, attractiveness of: Two-way I/O. (line 6)
* programming conventions, --non-decimal-data option: Nondecimal Data.
- (line 11510)
-* programming conventions, ARGC/ARGV variables: Auto-set. (line 7992)
-* programming conventions, exit statement: Exit Statement. (line 7767)
+ (line 36)
+* programming conventions, ARGC/ARGV variables: Auto-set. (line 31)
+* programming conventions, exit statement: Exit Statement. (line 36)
* programming conventions, function parameters: Return Statement.
- (line 10803)
+ (line 39)
* programming conventions, functions, calling: Calling Built-in.
- (line 9011)
+ (line 10)
* programming conventions, functions, writing: Definition Syntax.
- (line 10536)
-* programming conventions, gawk internals: Internal File Ops.
- (line 19220)
+ (line 50)
+* programming conventions, gawk internals: Internal File Ops. (line 33)
* programming conventions, nextfile statement: Nextfile Function.
- (line 12659)
+ (line 20)
* programming conventions, private variable names: Library Names.
- (line 12558)
-* programming language, recipe for: History. (line 630)
+ (line 23)
+* programming language, recipe for: History. (line 6)
* programming languages, data-driven vs. procedural: Getting Started.
- (line 1038)
-* programming, basic steps: Basic High Level. (line 19556)
-* programming, concepts: Basic Concepts. (line 19524)
-* pwcat program: Passwd Functions. (line 13760)
+ (line 12)
+* programming, basic steps: Basic High Level. (line 19)
+* programming, concepts: Basic Concepts. (line 6)
+* pwcat program: Passwd Functions. (line 23)
* question mark (?) <1>: GNU Regexp Operators.
- (line 2506)
-* question mark (?): Regexp Operators. (line 2285)
-* question mark (?), ?: operator: Precedence. (line 6739)
-* QUIT signal (MS-DOS): Profiling. (line 11946)
-* quoting <1>: Comments. (line 1317)
-* quoting <2>: Long. (line 1216)
-* quoting: Read Terminal. (line 1165)
-* quoting, rules for: Quoting. (line 1349)
-* quoting, tricks for: Quoting. (line 1410)
-* Rakitzis, Byron: History Sorting. (line 15953)
-* rand function: Numeric Functions. (line 9085)
+ (line 51)
+* question mark (?): Regexp Operators. (line 110)
+* question mark (?), ?: operator: Precedence. (line 93)
+* QUIT signal (MS-DOS): Profiling. (line 210)
+* quoting <1>: Comments. (line 27)
+* quoting <2>: Long. (line 26)
+* quoting: Read Terminal. (line 25)
+* quoting, rules for: Quoting. (line 6)
+* quoting, tricks for: Quoting. (line 67)
+* Rakitzis, Byron: History Sorting. (line 25)
+* rand function: Numeric Functions. (line 40)
* random numbers, Cliff: Cliff Random Function.
- (line 12945)
-* random numbers, rand/srand functions: Numeric Functions. (line 9085)
-* random numbers, seed of: Numeric Functions. (line 9115)
-* range expressions: Character Lists. (line 2353)
-* range patterns: Ranges. (line 6913)
-* Rankin, Pat <1>: Bugs. (line 18371)
-* Rankin, Pat <2>: Contributors. (line 17085)
-* Rankin, Pat <3>: Assignment Ops. (line 6082)
-* Rankin, Pat: Acknowledgments. (line 995)
-* raw sockets: TCP/IP Networking. (line 11682)
-* readable data files, checking: File Checking. (line 13334)
-* readable.awk program: File Checking. (line 13339)
-* recipe for a programming language: History. (line 630)
-* record separators <1>: User-modified. (line 7926)
-* record separators: Records. (line 2825)
-* record separators, changing: Records. (line 2891)
-* record separators, regular expressions as: Records. (line 2921)
-* record separators, with multiline records: Multiple Line. (line 3709)
-* records <1>: Basic High Level. (line 19608)
-* records: Reading Files. (line 2788)
-* records, multiline: Multiple Line. (line 3705)
-* records, printing: Print. (line 4300)
-* records, splitting input into: Records. (line 2817)
-* records, terminating: Records. (line 2921)
-* records, treating files as: Records. (line 3000)
-* recursive functions: Definition Syntax. (line 10554)
-* redirection of input: Getline/File. (line 3979)
-* redirection of output: Redirection. (line 4851)
-* reference counting, sorting arrays: Array Sorting. (line 8946)
-* regexp constants <1>: Typing and Comparison.
- (line 6442)
-* regexp constants <2>: Regexp Constants. (line 5532)
-* regexp constants: Regexp Usage. (line 2028)
-* regexp constants, /=.../, /= operator and: Assignment Ops.
- (line 6137)
-* regexp constants, as patterns: Expression Patterns.
- (line 6863)
+ (line 6)
+* random numbers, rand/srand functions: Numeric Functions. (line 40)
+* random numbers, seed of: Numeric Functions. (line 70)
+* range expressions: Character Lists. (line 6)
+* range patterns: Ranges. (line 6)
+* Rankin, Pat <1>: Bugs. (line 64)
+* Rankin, Pat <2>: Contributors. (line 35)
+* Rankin, Pat <3>: Assignment Ops. (line 100)
+* Rankin, Pat: Acknowledgments. (line 53)
+* raw sockets: TCP/IP Networking. (line 30)
+* readable data files, checking: File Checking. (line 6)
+* readable.awk program: File Checking. (line 11)
+* recipe for a programming language: History. (line 6)
+* record separators <1>: User-modified. (line 119)
+* record separators: Records. (line 14)
+* record separators, changing: Records. (line 81)
+* record separators, regular expressions as: Records. (line 112)
+* record separators, with multiline records: Multiple Line. (line 10)
+* records <1>: Basic High Level. (line 71)
+* records: Reading Files. (line 14)
+* records, multiline: Multiple Line. (line 6)
+* records, printing: Print. (line 22)
+* records, splitting input into: Records. (line 6)
+* records, terminating: Records. (line 112)
+* records, treating files as: Records. (line 191)
+* recursive functions: Definition Syntax. (line 68)
+* redirection of input: Getline/File. (line 6)
+* redirection of output: Redirection. (line 6)
+* reference counting, sorting arrays: Array Sorting. (line 79)
+* regexp constants <1>: Comparison Operators.
+ (line 102)
+* regexp constants <2>: Regexp Constants. (line 6)
+* regexp constants: Regexp Usage. (line 58)
+* regexp constants, /=.../, /= operator and: Assignment Ops. (line 148)
+* regexp constants, as patterns: Expression Patterns. (line 36)
* regexp constants, in gawk: Using Constant Regexps.
- (line 5566)
-* regexp constants, slashes vs. quotes: Computed Regexps. (line 2677)
-* regexp constants, vs. string constants: Computed Regexps. (line 2687)
-* regexp, See regular expressions: Regexp. (line 1945)
-* register_deferred_variable internal function: Internals. (line 18951)
-* register_open_hook internal function: Internals. (line 18964)
-* regular expressions: Regexp. (line 1945)
-* regular expressions as field separators: Field Separators.
- (line 3306)
-* regular expressions, anchors in: Regexp Operators. (line 2197)
+ (line 28)
+* regexp constants, slashes vs. quotes: Computed Regexps. (line 28)
+* regexp constants, vs. string constants: Computed Regexps. (line 38)
+* regexp, See regular expressions: Regexp. (line 6)
+* register_deferred_variable internal function: Internals. (line 165)
+* register_open_hook internal function: Internals. (line 178)
+* regular expressions: Regexp. (line 6)
+* regular expressions as field separators: Field Separators. (line 49)
+* regular expressions, anchors in: Regexp Operators. (line 22)
* regular expressions, as field separators: Regexp Field Splitting.
- (line 3343)
-* regular expressions, as patterns <1>: Regexp Patterns. (line 6819)
-* regular expressions, as patterns: Regexp Usage. (line 1976)
-* regular expressions, as record separators: Records. (line 2921)
-* regular expressions, case sensitivity <1>: User-modified. (line 7875)
-* regular expressions, case sensitivity: Case-sensitivity. (line 2549)
-* regular expressions, computed: Computed Regexps. (line 2656)
+ (line 6)
+* regular expressions, as patterns <1>: Regexp Patterns. (line 6)
+* regular expressions, as patterns: Regexp Usage. (line 6)
+* regular expressions, as record separators: Records. (line 112)
+* regular expressions, case sensitivity <1>: User-modified. (line 68)
+* regular expressions, case sensitivity: Case-sensitivity. (line 6)
+* regular expressions, computed: Computed Regexps. (line 6)
* regular expressions, constants, See regexp constants: Regexp Usage.
- (line 2028)
-* regular expressions, dynamic: Computed Regexps. (line 2656)
+ (line 58)
+* regular expressions, dynamic: Computed Regexps. (line 6)
* regular expressions, dynamic, with embedded newlines: Computed Regexps.
- (line 2708)
+ (line 59)
* regular expressions, gawk, command-line options: GNU Regexp Operators.
- (line 2517)
-* regular expressions, interval expressions and: Options. (line 12220)
+ (line 62)
+* regular expressions, interval expressions and: Options. (line 224)
* regular expressions, leftmost longest match: Leftmost Longest.
- (line 2626)
-* regular expressions, operators <1>: Regexp Operators. (line 2181)
-* regular expressions, operators: Regexp Usage. (line 1989)
+ (line 6)
+* regular expressions, operators <1>: Regexp Operators. (line 6)
+* regular expressions, operators: Regexp Usage. (line 19)
* regular expressions, operators, for buffers: GNU Regexp Operators.
- (line 2495)
+ (line 40)
* regular expressions, operators, for words: GNU Regexp Operators.
- (line 2461)
+ (line 6)
* regular expressions, operators, gawk: GNU Regexp Operators.
- (line 2461)
+ (line 6)
* regular expressions, operators, precedence of: Regexp Operators.
- (line 2324)
-* regular expressions, searching for: Egrep Program. (line 14525)
+ (line 149)
+* regular expressions, searching for: Egrep Program. (line 6)
* relational operators, See comparison operators: Typing and Comparison.
- (line 6277)
-* return statement, user-defined functions: Return Statement.
- (line 10770)
+ (line 9)
+* return statement, user-defined functions: Return Statement. (line 6)
* return values, close function: Close Files And Pipes.
- (line 5323)
-* rev user-defined function: Function Example. (line 10629)
-* rewind user-defined function: Rewind Function. (line 13302)
-* right angle bracket (>), > operator <1>: Precedence. (line 6711)
-* right angle bracket (>), > operator: Typing and Comparison.
- (line 6342)
-* right angle bracket (>), > operator (I/O): Redirection. (line 4864)
-* right angle bracket (>), >= operator <1>: Precedence. (line 6711)
-* right angle bracket (>), >= operator: Typing and Comparison.
- (line 6342)
-* right angle bracket (>), >> operator (I/O) <1>: Precedence.
- (line 6711)
-* right angle bracket (>), >> operator (I/O): Redirection. (line 4892)
-* right shift, bitwise: Bitwise Functions. (line 10340)
-* Ritchie, Dennis: Basic Data Typing. (line 19704)
-* RLENGTH variable: Auto-set. (line 8124)
-* RLENGTH variable, match function and: String Functions. (line 9273)
-* Robbins, Arnold <1>: Future Extensions. (line 19424)
-* Robbins, Arnold <2>: Bugs. (line 18337)
-* Robbins, Arnold <3>: Contributors. (line 17141)
-* Robbins, Arnold <4>: Alarm Program. (line 15477)
-* Robbins, Arnold <5>: Passwd Functions. (line 13813)
-* Robbins, Arnold <6>: Getline/Pipe. (line 4081)
+ (line 130)
+* rev user-defined function: Function Example. (line 52)
+* rewind user-defined function: Rewind Function. (line 16)
+* right angle bracket (>), > operator <1>: Precedence. (line 65)
+* right angle bracket (>), > operator: Comparison Operators.
+ (line 11)
+* right angle bracket (>), > operator (I/O): Redirection. (line 19)
+* right angle bracket (>), >= operator <1>: Precedence. (line 65)
+* right angle bracket (>), >= operator: Comparison Operators.
+ (line 11)
+* right angle bracket (>), >> operator (I/O) <1>: Precedence. (line 65)
+* right angle bracket (>), >> operator (I/O): Redirection. (line 47)
+* right shift, bitwise: Bitwise Functions. (line 32)
+* Ritchie, Dennis: Basic Data Typing. (line 71)
+* RLENGTH variable: Auto-set. (line 163)
+* RLENGTH variable, match function and: String Functions. (line 115)
+* Robbins, Arnold <1>: Future Extensions. (line 6)
+* Robbins, Arnold <2>: Bugs. (line 29)
+* Robbins, Arnold <3>: Contributors. (line 92)
+* Robbins, Arnold <4>: Alarm Program. (line 6)
+* Robbins, Arnold <5>: Passwd Functions. (line 76)
+* Robbins, Arnold <6>: Getline/Pipe. (line 36)
* Robbins, Arnold: Command Line Field Separator.
- (line 3501)
-* Robbins, Bill: Getline/Pipe. (line 4081)
-* Robbins, Harry: Acknowledgments. (line 1012)
-* Robbins, Jean: Acknowledgments. (line 1012)
-* Robbins, Miriam <1>: Passwd Functions. (line 13813)
-* Robbins, Miriam <2>: Getline/Pipe. (line 4081)
-* Robbins, Miriam: Acknowledgments. (line 1012)
-* Robinson, Will: Dynamic Extensions.
- (line 18761)
-* robot, the: Dynamic Extensions.
- (line 18761)
-* Rommel, Kai Uwe <1>: Contributors. (line 17092)
-* Rommel, Kai Uwe: Acknowledgments. (line 995)
-* round user-defined function: Round Function. (line 12910)
-* rounding: Round Function. (line 12900)
-* rounding numbers: Round Function. (line 12900)
-* RS variable <1>: User-modified. (line 7926)
-* RS variable: Records. (line 2831)
-* RS variable, multiline records and: Multiple Line. (line 3716)
-* rshift function (gawk): Bitwise Functions. (line 10354)
-* RSTART variable: Auto-set. (line 8130)
-* RSTART variable, match function and: String Functions. (line 9273)
-* RT variable <1>: Auto-set. (line 8137)
-* RT variable <2>: Multiple Line. (line 3828)
-* RT variable: Records. (line 2921)
-* Rubin, Paul <1>: Contributors. (line 17066)
-* Rubin, Paul: History. (line 653)
-* rule, definition of: Getting Started. (line 1047)
-* rvalues/lvalues: Assignment Ops. (line 6014)
-* scalar values: Basic Data Typing. (line 19646)
-* Schreiber, Bert: Acknowledgments. (line 977)
-* Schreiber, Rita: Acknowledgments. (line 977)
-* search paths <1>: VMS Running. (line 18102)
-* search paths: PC Using. (line 17858)
-* search paths, for source files <1>: VMS Running. (line 18102)
-* search paths, for source files <2>: Igawk Program. (line 16601)
-* search paths, for source files: AWKPATH Variable. (line 12361)
-* searching: String Functions. (line 9218)
-* searching, files for regular expressions: Egrep Program. (line 14525)
-* searching, for words: Dupword Program. (line 15429)
-* sed utility <1>: Glossary. (line 19837)
-* sed utility <2>: Simple Sed. (line 16170)
+ (line 80)
+* Robbins, Bill: Getline/Pipe. (line 36)
+* Robbins, Harry: Acknowledgments. (line 70)
+* Robbins, Jean: Acknowledgments. (line 70)
+* Robbins, Miriam <1>: Passwd Functions. (line 76)
+* Robbins, Miriam <2>: Getline/Pipe. (line 36)
+* Robbins, Miriam: Acknowledgments. (line 70)
+* Robinson, Will: Dynamic Extensions. (line 6)
+* robot, the: Dynamic Extensions. (line 6)
+* Rommel, Kai Uwe <1>: Contributors. (line 42)
+* Rommel, Kai Uwe: Acknowledgments. (line 53)
+* round user-defined function: Round Function. (line 16)
+* rounding: Round Function. (line 6)
+* rounding numbers: Round Function. (line 6)
+* RS variable <1>: User-modified. (line 119)
+* RS variable: Records. (line 20)
+* RS variable, multiline records and: Multiple Line. (line 17)
+* rshift function (gawk): Bitwise Functions. (line 46)
+* RSTART variable: Auto-set. (line 169)
+* RSTART variable, match function and: String Functions. (line 115)
+* RT variable <1>: Auto-set. (line 176)
+* RT variable <2>: Multiple Line. (line 129)
+* RT variable: Records. (line 112)
+* Rubin, Paul <1>: Contributors. (line 16)
+* Rubin, Paul: History. (line 30)
+* rule, definition of: Getting Started. (line 21)
+* rvalues/lvalues: Assignment Ops. (line 32)
+* scalar values: Basic Data Typing. (line 13)
+* Schreiber, Bert: Acknowledgments. (line 35)
+* Schreiber, Rita: Acknowledgments. (line 35)
+* search paths <1>: VMS Running. (line 28)
+* search paths: PC Using. (line 11)
+* search paths, for source files <1>: VMS Running. (line 28)
+* search paths, for source files <2>: Igawk Program. (line 358)
+* search paths, for source files: AWKPATH Variable. (line 6)
+* searching: String Functions. (line 60)
+* searching, files for regular expressions: Egrep Program. (line 6)
+* searching, for words: Dupword Program. (line 6)
+* sed utility <1>: Glossary. (line 12)
+* sed utility <2>: Simple Sed. (line 6)
* sed utility: Field Splitting Summary.
- (line 3555)
-* semicolon (;): Statements/Lines. (line 1853)
-* semicolon (;), AWKPATH variable and: PC Using. (line 17858)
+ (line 47)
+* semicolon (;): Statements/Lines. (line 90)
+* semicolon (;), AWKPATH variable and: PC Using. (line 11)
* semicolon (;), separating statements in actions <1>: Statements.
- (line 7228)
+ (line 10)
* semicolon (;), separating statements in actions: Action Overview.
- (line 7178)
-* separators, field: User-modified. (line 7850)
-* separators, field, FIELDWIDTHS variable and: User-modified.
- (line 7840)
-* separators, field, POSIX and: Fields. (line 3014)
-* separators, for records: Records. (line 2825)
-* separators, for records, regular expressions as: Records. (line 2921)
-* separators, for statements in actions: Action Overview. (line 7178)
-* separators, record: User-modified. (line 7926)
-* separators, subscript: User-modified. (line 7939)
-* set_value internal function: Internals. (line 18932)
-* shells, piping commands into: Redirection. (line 4981)
+ (line 19)
+* separators, field: User-modified. (line 43)
+* separators, field, FIELDWIDTHS variable and: User-modified. (line 33)
+* separators, field, POSIX and: Fields. (line 6)
+* separators, for records: Records. (line 14)
+* separators, for records, regular expressions as: Records. (line 112)
+* separators, for statements in actions: Action Overview. (line 19)
+* separators, record: User-modified. (line 119)
+* separators, subscript: User-modified. (line 132)
+* set_value internal function: Internals. (line 146)
+* shells, piping commands into: Redirection. (line 140)
* shells, quoting: Using Shell Variables.
- (line 7120)
-* shells, quoting, rules for: Quoting. (line 1357)
-* shells, scripts: One-shot. (line 1133)
+ (line 12)
+* shells, quoting, rules for: Quoting. (line 14)
+* shells, scripts: One-shot. (line 22)
* shells, variables: Using Shell Variables.
- (line 7114)
-* shift, bitwise: Bitwise Functions. (line 10340)
-* short-circuit operators: Boolean Ops. (line 6514)
-* side effects <1>: Increment Ops. (line 6165)
-* side effects: Concatenation. (line 5943)
+ (line 6)
+* shift, bitwise: Bitwise Functions. (line 32)
+* short-circuit operators: Boolean Ops. (line 57)
+* side effects <1>: Increment Ops. (line 11)
+* side effects: Concatenation. (line 42)
* side effects, array indexing: Reference to Elements.
- (line 8437)
-* side effects, asort function: Array Sorting. (line 8894)
-* side effects, assignment expressions: Assignment Ops. (line 6005)
-* side effects, Boolean operators: Boolean Ops. (line 6487)
-* side effects, conditional expressions: Conditional Exp. (line 6569)
-* side effects, decrement/increment operators: Increment Ops.
- (line 6165)
-* side effects, FILENAME variable: Getline Notes. (line 4198)
-* side effects, function calls: Function Calls. (line 6635)
-* side effects, statements: Action Overview. (line 7191)
-* signals, HUP/SIGHUP: Profiling. (line 11943)
-* signals, INT/SIGINT (MS-DOS): Profiling. (line 11946)
-* signals, QUIT/SIGQUIT (MS-DOS): Profiling. (line 11946)
-* signals, USR1/SIGUSR1: Profiling. (line 11921)
-* sin function: Numeric Functions. (line 9076)
-* single quote (') <1>: Quoting. (line 1370)
-* single quote (') <2>: Long. (line 1223)
-* single quote ('): One-shot. (line 1126)
-* single quote ('), vs. apostrophe: Comments. (line 1317)
-* single quote ('), with double quotes: Quoting. (line 1392)
+ (line 30)
+* side effects, asort function: Array Sorting. (line 25)
+* side effects, assignment expressions: Assignment Ops. (line 23)
+* side effects, Boolean operators: Boolean Ops. (line 30)
+* side effects, conditional expressions: Conditional Exp. (line 22)
+* side effects, decrement/increment operators: Increment Ops. (line 11)
+* side effects, FILENAME variable: Getline Notes. (line 19)
+* side effects, function calls: Function Calls. (line 49)
+* side effects, statements: Action Overview. (line 32)
+* signals, HUP/SIGHUP: Profiling. (line 207)
+* signals, INT/SIGINT (MS-DOS): Profiling. (line 210)
+* signals, QUIT/SIGQUIT (MS-DOS): Profiling. (line 210)
+* signals, USR1/SIGUSR1: Profiling. (line 185)
+* sin function: Numeric Functions. (line 31)
+* single quote (') <1>: Quoting. (line 27)
+* single quote (') <2>: Long. (line 33)
+* single quote ('): One-shot. (line 15)
+* single quote ('), vs. apostrophe: Comments. (line 27)
+* single quote ('), with double quotes: Quoting. (line 49)
* single-character fields: Single Character Fields.
- (line 3401)
-* single-precision floating-point: Basic Data Typing. (line 19666)
-* Skywalker, Luke: Undocumented. (line 12443)
-* sleep utility: Alarm Program. (line 15572)
-* sockets: TCP/IP Networking. (line 11682)
-* sort function, arrays, sorting: Array Sorting. (line 8875)
-* sort utility: Word Sorting. (line 15876)
-* sort utility, coprocesses and: Two-way I/O. (line 11600)
+ (line 6)
+* single-precision floating-point: Basic Data Typing. (line 33)
+* Skywalker, Luke: Undocumented. (line 6)
+* sleep utility: Alarm Program. (line 102)
+* sockets: TCP/IP Networking. (line 30)
+* Solaris, POSIX compliant awk: Other Versions. (line 96)
+* sort function, arrays, sorting: Array Sorting. (line 6)
+* sort utility: Word Sorting. (line 54)
+* sort utility, coprocesses and: Two-way I/O. (line 84)
* sorting characters in different languages: Explaining gettext.
- (line 11004)
-* source code, awka: Other Versions. (line 18453)
-* source code, Bell Laboratories awk: Other Versions. (line 18390)
-* source code, gawk: Gawk Distribution. (line 17174)
-* source code, mawk: Other Versions. (line 18410)
-* source code, mixing: Options. (line 12227)
-* source files, search path for: Igawk Program. (line 16601)
-* sparse arrays: Array Intro. (line 8377)
-* Spencer, Henry: Glossary. (line 19837)
-* split function: String Functions. (line 9344)
-* split function, array elements, deleting: Delete. (line 8635)
-* split utility: Split Program. (line 14862)
-* split.awk program: Split Program. (line 14886)
-* sprintf function <1>: String Functions. (line 9397)
-* sprintf function: OFMT. (line 4443)
-* sprintf function, OFMT variable and: User-modified. (line 7916)
+ (line 89)
+* source code, awka: Other Versions. (line 76)
+* source code, Bell Laboratories awk: Other Versions. (line 13)
+* source code, gawk: Gawk Distribution. (line 6)
+* source code, mawk: Other Versions. (line 33)
+* source code, mixing: Options. (line 231)
+* source files, search path for: Igawk Program. (line 358)
+* sparse arrays: Array Intro. (line 66)
+* Spencer, Henry: Glossary. (line 12)
+* split function: String Functions. (line 186)
+* split function, array elements, deleting: Delete. (line 56)
+* split utility: Split Program. (line 6)
+* split.awk program: Split Program. (line 30)
+* sprintf function <1>: String Functions. (line 239)
+* sprintf function: OFMT. (line 15)
+* sprintf function, OFMT variable and: User-modified. (line 109)
* sprintf function, print/printf statements and: Round Function.
- (line 12900)
-* sqrt function: Numeric Functions. (line 9063)
-* square brackets ([]): Regexp Operators. (line 2230)
-* srand function: Numeric Functions. (line 9125)
-* Stallman, Richard <1>: Glossary. (line 20109)
-* Stallman, Richard <2>: Contributors. (line 17074)
-* Stallman, Richard <3>: Acknowledgments. (line 960)
-* Stallman, Richard: Manual History. (line 865)
-* standard input <1>: Special FD. (line 5019)
-* standard input: Read Terminal. (line 1146)
-* standard output: Special FD. (line 5019)
-* stat function, implementing in gawk: Sample Library. (line 19054)
-* statements, compound, control statements and: Statements. (line 7228)
-* statements, control, in actions: Statements. (line 7224)
-* statements, multiple: Statements/Lines. (line 1853)
-* stlen internal variable: Internals. (line 18836)
-* stptr internal variable: Internals. (line 18836)
-* stream editors <1>: Simple Sed. (line 16170)
+ (line 6)
+* sqrt function: Numeric Functions. (line 18)
+* square brackets ([]): Regexp Operators. (line 55)
+* srand function: Numeric Functions. (line 80)
+* Stallman, Richard <1>: Glossary. (line 284)
+* Stallman, Richard <2>: Contributors. (line 24)
+* Stallman, Richard <3>: Acknowledgments. (line 18)
+* Stallman, Richard: Manual History. (line 6)
+* standard input <1>: Special FD. (line 6)
+* standard input: Read Terminal. (line 6)
+* standard output: Special FD. (line 6)
+* stat function, implementing in gawk: Sample Library. (line 6)
+* statements, compound, control statements and: Statements. (line 10)
+* statements, control, in actions: Statements. (line 6)
+* statements, multiple: Statements/Lines. (line 90)
+* stlen internal variable: Internals. (line 50)
+* stptr internal variable: Internals. (line 50)
+* stream editors <1>: Simple Sed. (line 6)
* stream editors: Field Splitting Summary.
- (line 3555)
-* strftime function (gawk): Time Functions. (line 10034)
-* string constants: Scalar Constants. (line 5434)
-* string constants, vs. regexp constants: Computed Regexps. (line 2687)
+ (line 47)
+* strftime function (gawk): Time Functions. (line 53)
+* string constants: Scalar Constants. (line 15)
+* string constants, vs. regexp constants: Computed Regexps. (line 38)
* string extraction (internationalization): String Extraction.
- (line 11177)
-* string operators: Concatenation. (line 5911)
-* string-matching operators: Regexp Usage. (line 1989)
-* strings: Internals. (line 18863)
-* strings, converting: Conversion. (line 5719)
-* strings, converting, numbers to <1>: Bitwise Functions. (line 10407)
-* strings, converting, numbers to: User-modified. (line 7833)
-* strings, empty, See null strings: Records. (line 2912)
-* strings, extracting: String Extraction. (line 11177)
-* strings, for localization: Programmer i18n. (line 11059)
-* strings, length of: Scalar Constants. (line 5439)
-* strings, merging arrays into: Join Function. (line 13067)
-* strings, NODE internal type: Internals. (line 18809)
+ (line 6)
+* string operators: Concatenation. (line 9)
+* string-matching operators: Regexp Usage. (line 19)
+* strings: Internals. (line 77)
+* strings, converting: Conversion. (line 6)
+* strings, converting, numbers to <1>: Bitwise Functions. (line 99)
+* strings, converting, numbers to: User-modified. (line 26)
+* strings, empty, See null strings: Records. (line 102)
+* strings, extracting: String Extraction. (line 6)
+* strings, for localization: Programmer i18n. (line 14)
+* strings, length of: Scalar Constants. (line 20)
+* strings, merging arrays into: Join Function. (line 6)
+* strings, NODE internal type: Internals. (line 23)
* strings, null: Regexp Field Splitting.
- (line 3379)
-* strings, numeric: Typing and Comparison.
- (line 6281)
-* strings, splitting: String Functions. (line 9358)
-* strtonum function (gawk): String Functions. (line 9405)
+ (line 43)
+* strings, numeric: Variable Typing. (line 6)
+* strings, splitting: String Functions. (line 200)
+* strtonum function (gawk): String Functions. (line 247)
* strtonum function (gawk), --non-decimal-data option and: Nondecimal Data.
- (line 11510)
-* sub function <1>: String Functions. (line 9426)
+ (line 36)
+* sub function <1>: String Functions. (line 268)
* sub function: Using Constant Regexps.
- (line 5582)
-* sub function, arguments of: String Functions. (line 9483)
-* sub function, escape processing: Gory Details. (line 9642)
-* subscript separators: User-modified. (line 7939)
-* subscripts in arrays, multidimensional: Multi-dimensional.
- (line 8754)
+ (line 44)
+* sub function, arguments of: String Functions. (line 325)
+* sub function, escape processing: Gory Details. (line 6)
+* subscript separators: User-modified. (line 132)
+* subscripts in arrays, multidimensional: Multi-dimensional. (line 6)
* subscripts in arrays, multidimensional, scanning: Multi-scanning.
- (line 8840)
+ (line 11)
* subscripts in arrays, numbers as: Numeric Array Subscripts.
- (line 8656)
+ (line 6)
* subscripts in arrays, uninitialized variables as: Uninitialized Subscripts.
- (line 8707)
-* SUBSEP variable: User-modified. (line 7939)
+ (line 6)
+* SUBSEP variable: User-modified. (line 132)
* SUBSEP variable, multidimensional arrays: Multi-dimensional.
- (line 8760)
-* substr function: String Functions. (line 9570)
-* Sumner, Andrew: Other Versions. (line 18453)
-* switch statement: Switch Statement. (line 7464)
+ (line 12)
+* substr function: String Functions. (line 412)
+* Sumner, Andrew: Other Versions. (line 76)
+* switch statement: Switch Statement. (line 6)
* syntactic ambiguity: /= operator vs. /=.../ regexp constant: Assignment Ops.
- (line 6137)
-* system function: I/O Functions. (line 9872)
-* systime function (gawk): Time Functions. (line 10005)
-* tandem: Tandem Installation.
- (line 18278)
-* Tcl: Library Names. (line 12592)
-* TCP/IP: TCP/IP Networking. (line 11658)
-* TCP/IP, support for: Special Network. (line 5145)
-* tee utility: Tee Program. (line 14964)
-* tee.awk program: Tee Program. (line 14984)
-* terminating records: Records. (line 2921)
-* testbits.awk program: Bitwise Functions. (line 10368)
-* Texinfo <1>: Adding Code. (line 18640)
+ (line 148)
+* system function: I/O Functions. (line 63)
+* systime function (gawk): Time Functions. (line 24)
+* tandem: Tandem Installation. (line 6)
+* Tcl: Library Names. (line 57)
+* TCP/IP: TCP/IP Networking. (line 6)
+* TCP/IP, support for: Special Network. (line 6)
+* tee utility: Tee Program. (line 6)
+* tee.awk program: Tee Program. (line 26)
+* terminating records: Records. (line 112)
+* testbits.awk program: Bitwise Functions. (line 60)
+* Texinfo <1>: Adding Code. (line 99)
* Texinfo <2>: Distribution contents.
- (line 17315)
-* Texinfo <3>: Extract Program. (line 15985)
-* Texinfo <4>: Dupword Program. (line 15440)
-* Texinfo <5>: Library Functions. (line 12485)
-* Texinfo <6>: Sample Data Files. (line 1521)
-* Texinfo: Conventions. (line 819)
-* Texinfo, chapter beginnings in files: Regexp Operators. (line 2197)
+ (line 68)
+* Texinfo <3>: Extract Program. (line 12)
+* Texinfo <4>: Dupword Program. (line 17)
+* Texinfo <5>: Library Functions. (line 22)
+* Texinfo <6>: Sample Data Files. (line 66)
+* Texinfo: Conventions. (line 6)
+* Texinfo, chapter beginnings in files: Regexp Operators. (line 22)
* Texinfo, extracting programs from source files: Extract Program.
- (line 15979)
-* text, printing: Print. (line 4300)
-* text, printing, unduplicated lines of: Uniq Program. (line 15048)
-* textdomain function (C library): Explaining gettext.
- (line 10942)
-* TEXTDOMAIN variable <1>: Programmer i18n. (line 11054)
-* TEXTDOMAIN variable: User-modified. (line 7945)
-* TEXTDOMAIN variable, BEGIN pattern and: Programmer i18n. (line 11103)
-* TEXTDOMAIN variable, portability and: I18N Portability. (line 11294)
-* tilde (~), ~ operator <1>: Expression Patterns.
- (line 6851)
-* tilde (~), ~ operator <2>: Precedence. (line 6727)
-* tilde (~), ~ operator <3>: Typing and Comparison.
- (line 6342)
-* tilde (~), ~ operator <4>: Regexp Constants. (line 5532)
-* tilde (~), ~ operator <5>: Computed Regexps. (line 2656)
-* tilde (~), ~ operator <6>: Case-sensitivity. (line 2569)
-* tilde (~), ~ operator: Regexp Usage. (line 1989)
-* time, alarm clock example program: Alarm Program. (line 15480)
-* time, localization and: Explaining gettext.
- (line 11026)
+ (line 6)
+* text, printing: Print. (line 22)
+* text, printing, unduplicated lines of: Uniq Program. (line 6)
+* textdomain function (C library): Explaining gettext. (line 27)
+* TEXTDOMAIN variable <1>: Programmer i18n. (line 9)
+* TEXTDOMAIN variable: User-modified. (line 138)
+* TEXTDOMAIN variable, BEGIN pattern and: Programmer i18n. (line 58)
+* TEXTDOMAIN variable, portability and: I18N Portability. (line 20)
+* tilde (~), ~ operator <1>: Expression Patterns. (line 24)
+* tilde (~), ~ operator <2>: Precedence. (line 81)
+* tilde (~), ~ operator <3>: Comparison Operators.
+ (line 11)
+* tilde (~), ~ operator <4>: Regexp Constants. (line 6)
+* tilde (~), ~ operator <5>: Computed Regexps. (line 6)
+* tilde (~), ~ operator <6>: Case-sensitivity. (line 26)
+* tilde (~), ~ operator: Regexp Usage. (line 19)
+* time, alarm clock example program: Alarm Program. (line 9)
+* time, localization and: Explaining gettext. (line 111)
* time, managing: Gettimeofday Function.
- (line 13112)
-* time, retrieving: Time Functions. (line 9998)
-* timestamps: Time Functions. (line 9987)
-* timestamps, converting dates to: Time Functions. (line 10050)
+ (line 6)
+* time, retrieving: Time Functions. (line 17)
+* timestamps: Time Functions. (line 6)
+* timestamps, converting dates to: Time Functions. (line 72)
* timestamps, formatted: Gettimeofday Function.
- (line 13112)
-* tmp_number internal function: Internals. (line 18878)
-* tmp_string internal function: Internals. (line 18873)
-* tolower function: String Functions. (line 9612)
-* toupper function: String Functions. (line 9618)
-* tr utility: Translate Program. (line 15601)
-* translate.awk program: Translate Program. (line 15649)
-* troubleshooting, --non-decimal-data option: Options. (line 12170)
-* troubleshooting, -F option: Known Bugs. (line 12454)
-* troubleshooting, == operator: Typing and Comparison.
- (line 6377)
-* troubleshooting, awk uses FS not IFS: Field Separators. (line 3285)
+ (line 6)
+* tmp_number internal function: Internals. (line 92)
+* tmp_string internal function: Internals. (line 87)
+* tolower function: String Functions. (line 454)
+* toupper function: String Functions. (line 460)
+* tr utility: Translate Program. (line 6)
+* translate.awk program: Translate Program. (line 55)
+* troubleshooting, --non-decimal-data option: Options. (line 171)
+* troubleshooting, -F option: Known Bugs. (line 6)
+* troubleshooting, == operator: Comparison Operators.
+ (line 37)
+* troubleshooting, awk uses FS not IFS: Field Separators. (line 28)
* troubleshooting, backslash before nonspecial character: Escape Sequences.
- (line 2145)
-* troubleshooting, division: Arithmetic Ops. (line 5861)
+ (line 113)
+* troubleshooting, division: Arithmetic Ops. (line 44)
* troubleshooting, fatal errors, field widths, specifying: Constant Size.
- (line 3618)
+ (line 22)
* troubleshooting, fatal errors, printf format strings: Format Modifiers.
- (line 4767)
-* troubleshooting, fflush function: I/O Functions. (line 9860)
-* troubleshooting, function call syntax: Function Calls. (line 6615)
-* troubleshooting, gawk <1>: Compatibility Mode.
- (line 18503)
-* troubleshooting, gawk: Known Bugs. (line 12454)
-* troubleshooting, gawk, bug reports: Bugs. (line 18317)
+ (line 159)
+* troubleshooting, fflush function: I/O Functions. (line 51)
+* troubleshooting, function call syntax: Function Calls. (line 28)
+* troubleshooting, gawk <1>: Compatibility Mode. (line 6)
+* troubleshooting, gawk: Known Bugs. (line 6)
+* troubleshooting, gawk, bug reports: Bugs. (line 9)
* troubleshooting, gawk, fatal errors, function arguments: Calling Built-in.
- (line 9017)
-* troubleshooting, getline function: File Checking. (line 13352)
-* troubleshooting, gsub/sub functions: String Functions. (line 9493)
-* troubleshooting, match function: String Functions. (line 9339)
+ (line 16)
+* troubleshooting, getline function: File Checking. (line 24)
+* troubleshooting, gsub/sub functions: String Functions. (line 335)
+* troubleshooting, match function: String Functions. (line 181)
* troubleshooting, print statement, omitting commas: Print Examples.
- (line 4338)
-* troubleshooting, printing: Redirection. (line 4959)
-* troubleshooting, quotes with file names: Special FD. (line 5076)
-* troubleshooting, readable data files: File Checking. (line 13334)
+ (line 31)
+* troubleshooting, printing: Redirection. (line 115)
+* troubleshooting, quotes with file names: Special FD. (line 63)
+* troubleshooting, readable data files: File Checking. (line 6)
* troubleshooting, regexp constants vs. string constants: Computed Regexps.
- (line 2687)
-* troubleshooting, string concatenation: Concatenation. (line 5929)
-* troubleshooting, substr function: String Functions. (line 9588)
-* troubleshooting, system function: I/O Functions. (line 9896)
+ (line 38)
+* troubleshooting, string concatenation: Concatenation. (line 27)
+* troubleshooting, substr function: String Functions. (line 430)
+* troubleshooting, system function: I/O Functions. (line 87)
* troubleshooting, typographical errors, global variables: Options.
- (line 12107)
-* true, logical: Truth Values. (line 6246)
-* Trueman, David <1>: Contributors. (line 17081)
-* Trueman, David <2>: Acknowledgments. (line 986)
-* Trueman, David: History. (line 653)
-* trunc-mod operation: Arithmetic Ops. (line 5883)
-* truth values: Truth Values. (line 6246)
-* type conversion: Conversion. (line 5734)
-* type internal variable: Internals. (line 18844)
-* undefined functions: Function Caveats. (line 10740)
-* underscore (_), _ C macro: Explaining gettext.
- (line 10983)
+ (line 101)
+* true, logical: Truth Values. (line 6)
+* Trueman, David <1>: Contributors. (line 31)
+* Trueman, David <2>: Acknowledgments. (line 44)
+* Trueman, David: History. (line 30)
+* trunc-mod operation: Arithmetic Ops. (line 66)
+* truth values: Truth Values. (line 6)
+* type conversion: Conversion. (line 21)
+* type internal variable: Internals. (line 58)
+* undefined functions: Function Caveats. (line 79)
+* underscore (_), _ C macro: Explaining gettext. (line 68)
* underscore (_), in names of private variables: Library Names.
- (line 12564)
-* underscore (_), translatable string: Programmer i18n. (line 11112)
-* undocumented features: Undocumented. (line 12443)
+ (line 29)
+* underscore (_), translatable string: Programmer i18n. (line 67)
+* undocumented features: Undocumented. (line 6)
* uninitialized variables, as array subscripts: Uninitialized Subscripts.
- (line 8707)
-* uniq utility: Uniq Program. (line 15048)
-* uniq.awk program: Uniq Program. (line 15107)
-* Unix: Glossary. (line 20404)
+ (line 6)
+* uniq utility: Uniq Program. (line 6)
+* uniq.awk program: Uniq Program. (line 65)
+* Unix: Glossary. (line 582)
* Unix awk, backslashes in escape sequences: Escape Sequences.
- (line 2157)
+ (line 125)
* Unix awk, close function and: Close Files And Pipes.
- (line 5323)
+ (line 130)
* Unix awk, password files, field separators and: Command Line Field Separator.
- (line 3493)
-* Unix, awk scripts and: Executable Scripts.
- (line 1233)
-* unsigned integers: Basic Data Typing. (line 19661)
-* update_ERRNO internal function: Internals. (line 18938)
-* update_ERRNO_saved internal function: Internals. (line 18943)
-* user database, reading: Passwd Functions. (line 13743)
-* user-defined, functions: User-defined. (line 10472)
-* user-defined, functions, counts: Profiling. (line 11868)
-* user-defined, variables: Variables. (line 5621)
-* user-modifiable variables: User-modified. (line 7813)
-* users, information about, printing: Id Program. (line 14755)
-* users, information about, retrieving: Passwd Functions. (line 13753)
-* USR1 signal: Profiling. (line 11921)
-* values, numeric: Basic Data Typing. (line 19646)
-* values, string: Basic Data Typing. (line 19646)
+ (line 72)
+* Unix, awk scripts and: Executable Scripts. (line 6)
+* unsigned integers: Basic Data Typing. (line 28)
+* update_ERRNO internal function: Internals. (line 152)
+* update_ERRNO_saved internal function: Internals. (line 157)
+* user database, reading: Passwd Functions. (line 6)
+* user-defined, functions: User-defined. (line 6)
+* user-defined, functions, counts: Profiling. (line 135)
+* user-defined, variables: Variables. (line 6)
+* user-modifiable variables: User-modified. (line 6)
+* users, information about, printing: Id Program. (line 6)
+* users, information about, retrieving: Passwd Functions. (line 16)
+* USR1 signal: Profiling. (line 185)
+* values, numeric: Basic Data Typing. (line 13)
+* values, string: Basic Data Typing. (line 13)
* variable typing: Typing and Comparison.
- (line 6277)
-* variables <1>: Basic Data Typing. (line 19639)
-* variables: Other Features. (line 1879)
-* variables, assigning on command line: Assignment Options.
- (line 5671)
-* variables, built-in <1>: Built-in Variables.
- (line 7787)
-* variables, built-in: Using Variables. (line 5650)
-* variables, built-in, -v option, setting with: Options. (line 12044)
-* variables, built-in, conveying information: Auto-set. (line 7967)
-* variables, flag: Boolean Ops. (line 6524)
+ (line 9)
+* variables <1>: Basic Data Typing. (line 6)
+* variables: Other Features. (line 6)
+* variables, assigning on command line: Assignment Options. (line 6)
+* variables, built-in <1>: Built-in Variables. (line 6)
+* variables, built-in: Using Variables. (line 17)
+* variables, built-in, -v option, setting with: Options. (line 38)
+* variables, built-in, conveying information: Auto-set. (line 6)
+* variables, flag: Boolean Ops. (line 67)
* variables, getline command into, using <1>: Getline/Variable/Coprocess.
- (line 4167)
+ (line 6)
* variables, getline command into, using <2>: Getline/Variable/Pipe.
- (line 4110)
+ (line 6)
* variables, getline command into, using <3>: Getline/Variable/File.
- (line 4012)
-* variables, getline command into, using: Getline/Variable. (line 3938)
-* variables, global, for library functions: Library Names. (line 12546)
-* variables, global, printing list of: Options. (line 12101)
-* variables, initializing: Using Variables. (line 5650)
-* variables, names of: Arrays. (line 8287)
-* variables, private: Library Names. (line 12546)
-* variables, setting: Options. (line 12036)
-* variables, shadowing: Definition Syntax. (line 10542)
-* variables, types of: Assignment Ops. (line 6022)
+ (line 6)
+* variables, getline command into, using: Getline/Variable. (line 6)
+* variables, global, for library functions: Library Names. (line 11)
+* variables, global, printing list of: Options. (line 95)
+* variables, initializing: Using Variables. (line 17)
+* variables, names of: Arrays. (line 17)
+* variables, private: Library Names. (line 11)
+* variables, setting: Options. (line 30)
+* variables, shadowing: Definition Syntax. (line 56)
+* variables, types of: Assignment Ops. (line 40)
* variables, types of, comparison expressions and: Typing and Comparison.
- (line 6277)
+ (line 9)
* variables, uninitialized, as array subscripts: Uninitialized Subscripts.
- (line 8707)
-* variables, user-defined: Variables. (line 5621)
-* vertical bar (|): Regexp Operators. (line 2243)
-* vertical bar (|), | operator (I/O) <1>: Precedence. (line 6711)
-* vertical bar (|), | operator (I/O): Getline/Pipe. (line 4051)
-* vertical bar (|), |& I/O operator (I/O): Two-way I/O. (line 11560)
-* vertical bar (|), |& operator (I/O) <1>: Precedence. (line 6711)
-* vertical bar (|), |& operator (I/O): Getline/Coprocess. (line 4137)
+ (line 6)
+* variables, user-defined: Variables. (line 6)
+* vertical bar (|): Regexp Operators. (line 68)
+* vertical bar (|), | operator (I/O) <1>: Precedence. (line 65)
+* vertical bar (|), | operator (I/O): Getline/Pipe. (line 6)
+* vertical bar (|), |& I/O operator (I/O): Two-way I/O. (line 44)
+* vertical bar (|), |& operator (I/O) <1>: Precedence. (line 65)
+* vertical bar (|), |& operator (I/O): Getline/Coprocess. (line 6)
* vertical bar (|), |& operator (I/O), two-way communications: Portal Files.
- (line 11729)
-* vertical bar (|), || operator <1>: Precedence. (line 6736)
-* vertical bar (|), || operator: Boolean Ops. (line 6514)
-* vname internal variable: Internals. (line 18848)
-* w utility: Constant Size. (line 3618)
-* Wall, Larry: Future Extensions. (line 19424)
-* warnings, issuing: Options. (line 12150)
-* wc utility: Wc Program. (line 15264)
-* wc.awk program: Wc Program. (line 15303)
-* Weinberger, Peter <1>: Contributors. (line 17062)
-* Weinberger, Peter: History. (line 640)
-* while statement <1>: While Statement. (line 7299)
-* while statement: Regexp Usage. (line 1989)
-* whitespace, as field separators: Field Separators. (line 3320)
-* whitespace, functions, calling: Calling Built-in. (line 9011)
-* whitespace, newlines as: Options. (line 12182)
-* Williams, Kent: Contributors. (line 17087)
-* Woods, John: Contributors. (line 17078)
+ (line 10)
+* vertical bar (|), || operator <1>: Precedence. (line 90)
+* vertical bar (|), || operator: Boolean Ops. (line 57)
+* vname internal variable: Internals. (line 62)
+* w utility: Constant Size. (line 22)
+* Wall, Larry: Future Extensions. (line 6)
+* warnings, issuing: Options. (line 144)
+* wc utility: Wc Program. (line 6)
+* wc.awk program: Wc Program. (line 45)
+* Weinberger, Peter <1>: Contributors. (line 12)
+* Weinberger, Peter: History. (line 17)
+* while statement <1>: While Statement. (line 6)
+* while statement: Regexp Usage. (line 19)
+* whitespace, as field separators: Field Separators. (line 63)
+* whitespace, functions, calling: Calling Built-in. (line 10)
+* whitespace, newlines as: Options. (line 183)
+* Williams, Kent: Contributors. (line 37)
+* Woods, John: Contributors. (line 28)
* word boundaries, matching: GNU Regexp Operators.
- (line 2485)
+ (line 30)
* word, regexp definition of: GNU Regexp Operators.
- (line 2461)
+ (line 6)
* word-boundary operator (gawk): GNU Regexp Operators.
- (line 2510)
-* wordfreq.awk program: Word Sorting. (line 15882)
-* words, counting: Wc Program. (line 15264)
-* words, duplicate, searching for: Dupword Program. (line 15429)
-* words, usage counts, generating: Word Sorting. (line 15828)
-* xgettext utility: String Extraction. (line 11184)
-* XML: Internals. (line 18964)
-* XOR bitwise operation: Bitwise Functions. (line 10314)
-* xor function (gawk): Bitwise Functions. (line 10349)
-* Zaretskii, Eli: Acknowledgments. (line 995)
-* zero, negative vs. positive: Floating Point Issues.
- (line 19798)
-* zerofile.awk program: Empty Files. (line 13377)
-* Zoulas, Christos: Contributors. (line 17111)
-* {} (braces), actions and: Action Overview. (line 7178)
-* {} (braces), pgawk program: Profiling. (line 11873)
-* {} (braces), statements, grouping: Statements. (line 7228)
-* | (vertical bar): Regexp Operators. (line 2243)
-* | (vertical bar), | operator (I/O) <1>: Precedence. (line 6711)
-* | (vertical bar), | operator (I/O) <2>: Redirection. (line 4899)
-* | (vertical bar), | operator (I/O): Getline/Pipe. (line 4051)
-* | (vertical bar), |& operator (I/O) <1>: Two-way I/O. (line 11560)
-* | (vertical bar), |& operator (I/O) <2>: Precedence. (line 6711)
-* | (vertical bar), |& operator (I/O) <3>: Redirection. (line 4944)
-* | (vertical bar), |& operator (I/O): Getline/Coprocess. (line 4137)
+ (line 55)
+* wordfreq.awk program: Word Sorting. (line 60)
+* words, counting: Wc Program. (line 6)
+* words, duplicate, searching for: Dupword Program. (line 6)
+* words, usage counts, generating: Word Sorting. (line 6)
+* xgettext utility: String Extraction. (line 13)
+* XML: Internals. (line 178)
+* XOR bitwise operation: Bitwise Functions. (line 6)
+* xor function (gawk): Bitwise Functions. (line 41)
+* Zaretskii, Eli: Acknowledgments. (line 53)
+* zero, negative vs. positive: Unexpected Results. (line 28)
+* zerofile.awk program: Empty Files. (line 21)
+* Zoulas, Christos: Contributors. (line 61)
+* {} (braces), actions and: Action Overview. (line 19)
+* {} (braces), pgawk program: Profiling. (line 140)
+* {} (braces), statements, grouping: Statements. (line 10)
+* | (vertical bar): Regexp Operators. (line 68)
+* | (vertical bar), | operator (I/O) <1>: Precedence. (line 65)
+* | (vertical bar), | operator (I/O) <2>: Redirection. (line 54)
+* | (vertical bar), | operator (I/O): Getline/Pipe. (line 6)
+* | (vertical bar), |& operator (I/O) <1>: Two-way I/O. (line 44)
+* | (vertical bar), |& operator (I/O) <2>: Precedence. (line 65)
+* | (vertical bar), |& operator (I/O) <3>: Redirection. (line 99)
+* | (vertical bar), |& operator (I/O): Getline/Coprocess. (line 6)
* | (vertical bar), |& operator (I/O), pipes, closing: Close Files And Pipes.
- (line 5310)
+ (line 117)
* | (vertical bar), |& operator (I/O), two-way communications: Portal Files.
- (line 11729)
-* | (vertical bar), || operator <1>: Precedence. (line 6736)
-* | (vertical bar), || operator: Boolean Ops. (line 6514)
-* ~ (tilde), ~ operator <1>: Expression Patterns.
- (line 6851)
-* ~ (tilde), ~ operator <2>: Precedence. (line 6727)
-* ~ (tilde), ~ operator <3>: Typing and Comparison.
- (line 6342)
-* ~ (tilde), ~ operator <4>: Regexp Constants. (line 5532)
-* ~ (tilde), ~ operator <5>: Computed Regexps. (line 2656)
-* ~ (tilde), ~ operator: Case-sensitivity. (line 2569)
+ (line 10)
+* | (vertical bar), || operator <1>: Precedence. (line 90)
+* | (vertical bar), || operator: Boolean Ops. (line 57)
+* ~ (tilde), ~ operator <1>: Expression Patterns. (line 24)
+* ~ (tilde), ~ operator <2>: Precedence. (line 81)
+* ~ (tilde), ~ operator <3>: Comparison Operators.
+ (line 11)
+* ~ (tilde), ~ operator <4>: Regexp Constants. (line 6)
+* ~ (tilde), ~ operator <5>: Computed Regexps. (line 6)
+* ~ (tilde), ~ operator: Case-sensitivity. (line 26)

Tag Table:
-Node: Top1326
-Node: Foreword26895
-Node: Preface31216
-Ref: Preface-Footnote-134077
-Node: History34306
-Node: Names36509
-Ref: Names-Footnote-137969
-Node: This Manual38038
-Ref: This Manual-Footnote-142723
-Node: Conventions42820
-Node: Manual History44682
-Ref: Manual History-Footnote-148102
-Ref: Manual History-Footnote-248140
-Node: How To Contribute48211
-Node: Acknowledgments48809
-Node: Getting Started52576
-Node: Running gawk54940
-Node: One-shot56120
-Node: Read Terminal57336
-Ref: Read Terminal-Footnote-158982
-Node: Long59150
-Node: Executable Scripts60520
-Ref: Executable Scripts-Footnote-162404
-Ref: Executable Scripts-Footnote-262552
-Node: Comments63000
-Node: Quoting65353
-Node: Sample Data Files69833
-Node: Very Simple72853
-Node: Two Rules77443
-Node: More Complex79581
-Ref: More Complex-Footnote-182489
-Ref: More Complex-Footnote-282934
-Node: Statements/Lines83014
-Ref: Statements/Lines-Footnote-187372
-Node: Other Features87634
-Node: When88480
-Ref: When-Footnote-190706
-Node: Regexp90784
-Node: Regexp Usage92235
-Node: Escape Sequences94272
-Node: Regexp Operators99988
-Ref: Regexp Operators-Footnote-1107077
-Ref: Regexp Operators-Footnote-2107221
-Node: Character Lists107316
-Ref: table-char-classes109260
-Node: GNU Regexp Operators112784
-Node: Case-sensitivity116355
-Ref: Case-sensitivity-Footnote-1119505
-Node: Leftmost Longest119737
-Node: Computed Regexps120919
-Node: Locales124282
-Node: Reading Files126302
-Node: Records128053
-Ref: Records-Footnote-1136555
-Node: Fields136589
-Ref: Fields-Footnote-1139601
-Node: Nonconstant Fields139684
-Node: Changing Fields141876
-Node: Field Separators147122
-Node: Regexp Field Splitting150591
-Node: Single Character Fields153047
-Node: Command Line Field Separator154096
-Node: Field Splitting Summary157513
-Ref: Field Splitting Summary-Footnote-1160691
-Node: Constant Size160789
-Node: Multiple Line165245
-Ref: Multiple Line-Footnote-1170908
-Node: Getline171084
-Node: Plain Getline173143
-Node: Getline/Variable175185
-Node: Getline/File176323
-Node: Getline/Variable/File177641
-Node: Getline/Pipe179188
-Node: Getline/Variable/Pipe181244
-Node: Getline/Coprocess182345
-Node: Getline/Variable/Coprocess183576
-Node: Getline Notes184284
-Node: Getline Summary185927
-Ref: table-getline-variants186211
-Node: Printing187376
-Node: Print189005
-Node: Print Examples190325
-Node: Output Separators193105
-Node: OFMT194857
-Node: Printf196209
-Node: Basic Printf197128
-Node: Control Letters198655
-Node: Format Modifiers201875
-Node: Printf Examples207914
-Node: Redirection210613
-Node: Special Files217175
-Node: Special FD217809
-Node: Special Process220823
-Node: Special Network223055
-Node: Special Caveats223894
-Ref: Special Caveats-Footnote-1225089
-Node: Close Files And Pipes225469
-Ref: Close Files And Pipes-Footnote-1232348
-Ref: Close Files And Pipes-Footnote-2232493
-Node: Expressions232638
-Node: Constants234824
-Node: Scalar Constants235502
-Ref: Scalar Constants-Footnote-1236351
-Node: Nondecimal-numbers236530
-Node: Regexp Constants239572
-Node: Using Constant Regexps240045
-Node: Variables243122
-Node: Using Variables243778
-Node: Assignment Options245279
-Node: Conversion247153
-Ref: Conversion-Footnote-1251902
-Node: Arithmetic Ops252008
-Node: Concatenation254503
-Node: Assignment Ops257187
-Ref: table-assign-ops262136
-Node: Increment Ops264040
-Node: Truth Values267515
-Node: Typing and Comparison268562
-Ref: table-relational-ops271609
-Ref: Typing and Comparison-Footnote-1275850
-Node: Boolean Ops275992
-Node: Conditional Exp279998
-Node: Function Calls281729
-Node: Precedence284612
-Node: Patterns and Actions288033
-Node: Pattern Overview289084
-Node: Regexp Patterns290518
-Node: Expression Patterns291061
-Node: Ranges294593
-Node: BEGIN/END297667
-Node: Using BEGIN/END298417
-Ref: Using BEGIN/END-Footnote-1301135
-Node: I/O And BEGIN/END301246
-Node: Empty303503
-Node: Using Shell Variables303811
-Node: Action Overview306082
-Node: Statements308434
-Node: If Statement310287
-Node: While Statement311783
-Node: Do Statement313812
-Node: For Statement314958
-Node: Switch Statement318074
-Node: Break Statement320338
-Node: Continue Statement322386
-Node: Next Statement324284
-Node: Nextfile Statement326552
-Node: Exit Statement329128
-Node: Built-in Variables331183
-Node: User-modified332275
-Ref: User-modified-Footnote-1339515
-Node: Auto-set339574
-Ref: Auto-set-Footnote-1347911
-Node: ARGC and ARGV348113
-Node: Arrays351807
-Node: Array Intro353709
-Node: Reference to Elements357883
-Node: Assigning Elements359738
-Node: Array Example360205
-Node: Scanning an Array361921
-Node: Delete364182
-Ref: Delete-Footnote-1366534
-Node: Numeric Array Subscripts366588
-Node: Uninitialized Subscripts368766
-Node: Multi-dimensional370357
-Node: Multi-scanning373353
-Node: Array Sorting374962
-Node: Functions378599
-Node: Built-in379331
-Node: Calling Built-in380301
-Node: Numeric Functions382256
-Ref: Numeric Functions-Footnote-1385995
-Ref: Numeric Functions-Footnote-2386318
-Node: String Functions386584
-Ref: String Functions-Footnote-1406443
-Ref: String Functions-Footnote-2406569
-Ref: String Functions-Footnote-3406813
-Node: Gory Details406897
-Ref: table-sub-escapes408523
-Ref: table-sub-posix-92409858
-Ref: table-sub-proposed411197
-Ref: table-posix-2001-sub412550
-Ref: table-gensub-escapes413887
-Ref: Gory Details-Footnote-1415070
-Node: I/O Functions415118
-Ref: I/O Functions-Footnote-1421680
-Node: Time Functions421768
-Ref: Time Functions-Footnote-1432452
-Ref: Time Functions-Footnote-2432517
-Ref: Time Functions-Footnote-3432672
-Ref: Time Functions-Footnote-4432780
-Ref: Time Functions-Footnote-5432902
-Ref: Time Functions-Footnote-6433126
-Node: Bitwise Functions433385
-Ref: table-bitwise-ops433960
-Ref: Bitwise Functions-Footnote-1438182
-Node: I18N Functions438363
-Node: User-defined440086
-Node: Definition Syntax440867
-Node: Function Example445193
-Node: Function Caveats447758
-Node: Return Statement451662
-Node: Dynamic Typing454301
-Node: Internationalization455035
-Node: I18N and L10N456451
-Node: Explaining gettext457135
-Ref: Explaining gettext-Footnote-1462023
-Ref: Explaining gettext-Footnote-2462259
-Node: Programmer i18n462425
-Node: Translator i18n466642
-Node: String Extraction467429
-Ref: String Extraction-Footnote-1468373
-Node: Printf Ordering468496
-Ref: Printf Ordering-Footnote-1471248
-Node: I18N Portability471309
-Ref: I18N Portability-Footnote-1473733
-Node: I18N Example473793
-Ref: I18N Example-Footnote-1476385
-Node: Gawk I18N476454
-Node: Advanced Features477033
-Node: Nondecimal Data478427
-Node: Two-way I/O479977
-Ref: Two-way I/O-Footnote-1485426
-Node: TCP/IP Networking485500
-Node: Portal Files487911
-Node: Profiling488552
-Node: Invoking Gawk496068
-Node: Command Line497245
-Node: Options498024
-Ref: Options-Footnote-1510187
-Node: Other Arguments510209
-Node: AWKPATH Variable512869
-Ref: AWKPATH Variable-Footnote-1515626
-Node: Obsolete515883
-Node: Undocumented516877
-Node: Known Bugs517136
-Node: Library Functions517738
-Ref: Library Functions-Footnote-1520692
-Node: Library Names520860
-Ref: Library Names-Footnote-1524307
-Ref: Library Names-Footnote-2524523
-Node: General Functions524606
-Node: Nextfile Function525665
-Node: Strtonum Function530004
-Node: Assert Function532926
-Node: Round Function536212
-Node: Cliff Random Function537719
-Ref: Cliff Random Function-Footnote-1538702
-Node: Ordinal Functions538770
-Ref: Ordinal Functions-Footnote-1541818
-Node: Join Function542031
-Ref: Join Function-Footnote-1543782
-Node: Gettimeofday Function543979
-Node: Data File Management547676
-Node: Filetrans Function548308
-Node: Rewind Function551716
-Node: File Checking553153
-Node: Empty Files554201
-Node: Ignoring Assigns556408
-Node: Getopt Function557944
-Ref: Getopt Function-Footnote-1568908
-Node: Passwd Functions569106
-Ref: Passwd Functions-Footnote-1577714
-Node: Group Functions577799
-Node: Sample Programs585738
-Node: Running Examples586412
-Node: Clones587134
-Node: Cut Program588260
-Node: Egrep Program597933
-Ref: Egrep Program-Footnote-1605635
-Node: Id Program605742
-Node: Split Program609332
-Node: Tee Program612780
-Node: Uniq Program615442
-Node: Wc Program622780
-Ref: Wc Program-Footnote-1626994
-Node: Miscellaneous Programs627187
-Node: Dupword Program628183
-Node: Alarm Program630205
-Node: Translate Program634730
-Ref: Translate Program-Footnote-1638949
-Ref: Translate Program-Footnote-2639183
-Node: Labels Program639314
-Ref: Labels Program-Footnote-1642587
-Node: Word Sorting642668
-Node: History Sorting646931
-Node: Extract Program648757
-Node: Simple Sed656078
-Node: Igawk Program659112
-Ref: Igawk Program-Footnote-1673741
-Ref: Igawk Program-Footnote-2673939
-Node: Language History674074
-Node: V7/SVR3.1675458
-Node: SVR4677538
-Node: POSIX678977
-Node: BTL680484
-Node: POSIX/GNU682006
-Node: Contributors689379
-Node: Installation692822
-Node: Gawk Distribution693793
-Node: Getting694277
-Node: Extracting695508
-Node: Distribution contents696890
-Node: Unix Installation701971
-Node: Quick Installation702562
-Node: Additional Configuration Options704253
-Node: Configuration Philosophy706001
-Node: Non-Unix Installation708349
-Node: Amiga Installation708936
-Node: BeOS Installation710023
-Node: PC Installation711164
-Node: PC Binary Installation712391
-Node: PC Compiling714222
-Node: PC Dynamic718742
-Node: PC Using721088
-Node: Cygwin725682
-Ref: Cygwin-Footnote-1726674
-Node: VMS Installation726703
-Node: VMS Compilation727231
-Node: VMS Installation Details728802
-Node: VMS Running730426
-Node: VMS POSIX732015
-Node: Unsupported733286
-Node: Atari Installation733689
-Node: Atari Compiling734972
-Node: Atari Using736844
-Node: Tandem Installation739677
-Node: Bugs741342
-Node: Other Versions744605
-Ref: Other Versions-Footnote-1748206
-Node: Notes748245
-Node: Compatibility Mode748937
-Node: Additions749725
-Node: Adding Code750472
-Node: New Ports756519
-Node: Dynamic Extensions760574
-Node: Internals761821
-Node: Sample Library772806
-Node: Internal File Description773465
-Node: Internal File Ops777146
-Ref: Internal File Ops-Footnote-1782436
-Node: Using Internal File Ops782581
-Node: Future Extensions784598
-Node: Basic Concepts788534
-Node: Basic High Level789291
-Ref: Basic High Level-Footnote-1793302
-Node: Basic Data Typing793493
-Node: Floating Point Issues797895
-Ref: Floating Point Issues-Footnote-1801748
-Ref: Floating Point Issues-Footnote-2801798
-Node: Glossary801904
-Node: Copying825513
-Node: GNU Free Documentation License844649
-Node: Index867040
+Node: Top1336
+Node: Foreword27371
+Node: Preface31692
+Ref: Preface-Footnote-134571
+Node: History34803
+Node: Names37019
+Ref: Names-Footnote-138491
+Node: This Manual38563
+Ref: This Manual-Footnote-143318
+Node: Conventions43418
+Node: Manual History45292
+Ref: Manual History-Footnote-148745
+Ref: Manual History-Footnote-248786
+Node: How To Contribute48860
+Node: Acknowledgments49458
+Node: Getting Started53260
+Node: Running gawk55632
+Node: One-shot56818
+Node: Read Terminal58043
+Ref: Read Terminal-Footnote-159701
+Node: Long59872
+Node: Executable Scripts61248
+Ref: Executable Scripts-Footnote-163144
+Ref: Executable Scripts-Footnote-263295
+Node: Comments63746
+Node: Quoting66114
+Node: Sample Data Files70615
+Node: Very Simple73647
+Node: Two Rules78252
+Node: More Complex80399
+Ref: More Complex-Footnote-183322
+Ref: More Complex-Footnote-283770
+Node: Statements/Lines83853
+Ref: Statements/Lines-Footnote-188235
+Node: Other Features88500
+Node: When89352
+Ref: When-Footnote-191591
+Node: Regexp91676
+Node: Regexp Usage93130
+Node: Escape Sequences95182
+Node: Regexp Operators100921
+Ref: Regexp Operators-Footnote-1108028
+Ref: Regexp Operators-Footnote-2108175
+Node: Character Lists108273
+Ref: table-char-classes110230
+Node: GNU Regexp Operators112855
+Node: Case-sensitivity116499
+Ref: Case-sensitivity-Footnote-1119672
+Node: Leftmost Longest119907
+Node: Computed Regexps121098
+Node: Locales124479
+Node: Reading Files126745
+Node: Records128502
+Ref: Records-Footnote-1137060
+Node: Fields137097
+Ref: Fields-Footnote-1140127
+Node: Nonconstant Fields140213
+Node: Changing Fields142415
+Node: Field Separators147696
+Node: Regexp Field Splitting151187
+Node: Single Character Fields153652
+Node: Command Line Field Separator154703
+Node: Field Splitting Summary158142
+Ref: Field Splitting Summary-Footnote-1161328
+Node: Constant Size161429
+Node: Multiple Line165906
+Ref: Multiple Line-Footnote-1171637
+Node: Getline171816
+Node: Plain Getline173884
+Node: Getline/Variable175901
+Node: Getline/File177042
+Node: Getline/Variable/File178366
+Node: Getline/Pipe179925
+Node: Getline/Variable/Pipe182522
+Node: Getline/Coprocess183629
+Node: Getline/Variable/Coprocess184872
+Node: Getline Notes185586
+Node: Getline Summary187229
+Ref: table-getline-variants187513
+Node: Printing188079
+Node: Print189708
+Node: Print Examples191034
+Node: Output Separators193829
+Node: OFMT195590
+Node: Printf196945
+Node: Basic Printf197864
+Node: Control Letters199399
+Node: Format Modifiers202617
+Node: Printf Examples208635
+Node: Redirection211352
+Node: Special Files218249
+Node: Special FD218883
+Node: Special Process221909
+Node: Special Network224144
+Node: Special Caveats224986
+Ref: Special Caveats-Footnote-1226184
+Node: Close Files And Pipes226567
+Ref: Close Files And Pipes-Footnote-1233488
+Ref: Close Files And Pipes-Footnote-2233636
+Node: Expressions233784
+Node: Constants235973
+Node: Scalar Constants236654
+Ref: Scalar Constants-Footnote-1237509
+Node: Nondecimal-numbers237691
+Node: Regexp Constants240749
+Node: Using Constant Regexps241222
+Node: Variables244305
+Node: Using Variables244961
+Node: Assignment Options246471
+Node: Conversion248348
+Ref: table-locale-affects253780
+Ref: Conversion-Footnote-1254404
+Node: Arithmetic Ops254513
+Node: Concatenation257025
+Ref: Concatenation-Footnote-1259807
+Node: Assignment Ops259898
+Ref: table-assign-ops264876
+Node: Increment Ops266277
+Node: Truth Values269770
+Node: Typing and Comparison270820
+Node: Variable Typing271523
+Ref: Variable Typing-Footnote-1275198
+Node: Comparison Operators275342
+Ref: table-relational-ops275718
+Node: Boolean Ops279267
+Ref: Boolean Ops-Footnote-1283327
+Node: Conditional Exp283418
+Node: Function Calls285155
+Node: Precedence288437
+Node: Patterns and Actions292093
+Node: Pattern Overview293147
+Node: Regexp Patterns294584
+Node: Expression Patterns295127
+Node: Ranges298677
+Node: BEGIN/END301766
+Node: Using BEGIN/END302516
+Ref: Using BEGIN/END-Footnote-1305248
+Node: I/O And BEGIN/END305362
+Node: Empty307629
+Node: Using Shell Variables307937
+Node: Action Overview310218
+Node: Statements312576
+Node: If Statement314432
+Node: While Statement315931
+Node: Do Statement317963
+Node: For Statement319112
+Node: Switch Statement322252
+Node: Break Statement324528
+Node: Continue Statement326585
+Node: Next Statement328489
+Node: Nextfile Statement330769
+Node: Exit Statement333366
+Node: Built-in Variables335437
+Node: User-modified336532
+Ref: User-modified-Footnote-1343775
+Node: Auto-set343837
+Ref: Auto-set-Footnote-1352177
+Node: ARGC and ARGV352382
+Node: Arrays356094
+Node: Array Intro358002
+Node: Reference to Elements362199
+Node: Assigning Elements364066
+Node: Array Example364533
+Node: Scanning an Array366255
+Node: Delete368522
+Ref: Delete-Footnote-1370904
+Node: Numeric Array Subscripts370961
+Node: Uninitialized Subscripts373148
+Node: Multi-dimensional374754
+Node: Multi-scanning377767
+Node: Array Sorting379382
+Node: Functions383045
+Node: Built-in383780
+Node: Calling Built-in384750
+Node: Numeric Functions386717
+Ref: Numeric Functions-Footnote-1390459
+Ref: Numeric Functions-Footnote-2390785
+Node: String Functions391054
+Ref: String Functions-Footnote-1410916
+Ref: String Functions-Footnote-2411045
+Ref: String Functions-Footnote-3411293
+Node: Gory Details411380
+Ref: table-sub-escapes413015
+Ref: table-sub-posix-92414350
+Ref: table-sub-proposed415689
+Ref: table-posix-2001-sub417041
+Ref: table-gensub-escapes418378
+Ref: Gory Details-Footnote-1419564
+Node: I/O Functions419615
+Ref: I/O Functions-Footnote-1426189
+Node: Time Functions426280
+Ref: Time Functions-Footnote-1437072
+Ref: Time Functions-Footnote-2437140
+Ref: Time Functions-Footnote-3437298
+Ref: Time Functions-Footnote-4437409
+Ref: Time Functions-Footnote-5437534
+Ref: Time Functions-Footnote-6437761
+Node: Bitwise Functions438023
+Ref: table-bitwise-ops438601
+Ref: Bitwise Functions-Footnote-1442835
+Node: I18N Functions443019
+Node: User-defined444740
+Node: Definition Syntax445521
+Node: Function Example449880
+Node: Function Caveats452460
+Node: Return Statement456385
+Node: Dynamic Typing459042
+Node: Internationalization459779
+Node: I18N and L10N461198
+Node: Explaining gettext461882
+Ref: Explaining gettext-Footnote-1466789
+Ref: Explaining gettext-Footnote-2467028
+Node: Programmer i18n467197
+Node: Translator i18n471420
+Node: String Extraction472210
+Ref: String Extraction-Footnote-1473160
+Node: Printf Ordering473286
+Ref: Printf Ordering-Footnote-1476064
+Node: I18N Portability476128
+Ref: I18N Portability-Footnote-1478556
+Node: I18N Example478619
+Ref: I18N Example-Footnote-1481231
+Node: Gawk I18N481303
+Node: Advanced Features481885
+Node: Nondecimal Data483284
+Node: Two-way I/O484843
+Ref: Two-way I/O-Footnote-1490324
+Node: TCP/IP Networking490401
+Node: Portal Files492830
+Node: Profiling493474
+Node: Invoking Gawk500930
+Node: Command Line502110
+Node: Options502895
+Ref: Options-Footnote-1515735
+Node: Other Arguments515760
+Node: AWKPATH Variable518441
+Ref: AWKPATH Variable-Footnote-1521213
+Node: Obsolete521473
+Node: Undocumented522473
+Node: Known Bugs522735
+Node: Library Functions523337
+Ref: Library Functions-Footnote-1526318
+Node: Library Names526489
+Ref: Library Names-Footnote-1529962
+Ref: Library Names-Footnote-2530181
+Node: General Functions530267
+Node: Nextfile Function531326
+Node: Strtonum Function535690
+Node: Assert Function538625
+Node: Round Function541929
+Node: Cliff Random Function543436
+Ref: Cliff Random Function-Footnote-1544425
+Node: Ordinal Functions544496
+Ref: Ordinal Functions-Footnote-1547556
+Node: Join Function547772
+Ref: Join Function-Footnote-1549532
+Node: Gettimeofday Function549732
+Node: Data File Management553435
+Node: Filetrans Function554067
+Node: Rewind Function557493
+Node: File Checking558939
+Node: Empty Files559991
+Node: Ignoring Assigns562216
+Node: Getopt Function563764
+Ref: Getopt Function-Footnote-1575042
+Node: Passwd Functions575243
+Ref: Passwd Functions-Footnote-1583904
+Node: Group Functions583992
+Node: Sample Programs591990
+Node: Running Examples592667
+Node: Clones593395
+Node: Cut Program594527
+Node: Egrep Program604284
+Ref: Egrep Program-Footnote-1612034
+Node: Id Program612144
+Node: Split Program615751
+Node: Tee Program619215
+Node: Uniq Program621892
+Node: Wc Program629260
+Ref: Wc Program-Footnote-1633504
+Node: Miscellaneous Programs633700
+Node: Dupword Program634696
+Node: Alarm Program636727
+Node: Translate Program641267
+Ref: Translate Program-Footnote-1645513
+Ref: Translate Program-Footnote-2645750
+Node: Labels Program645884
+Ref: Labels Program-Footnote-1649175
+Node: Word Sorting649259
+Node: History Sorting653542
+Node: Extract Program655380
+Node: Simple Sed662732
+Node: Igawk Program665787
+Ref: Igawk Program-Footnote-1680492
+Ref: Igawk Program-Footnote-2680693
+Node: Language History680831
+Node: V7/SVR3.1682215
+Node: SVR4684479
+Node: POSIX685918
+Node: BTL687526
+Node: POSIX/GNU689051
+Node: Contributors696885
+Node: Installation700421
+Node: Gawk Distribution701392
+Node: Getting701876
+Node: Extracting703110
+Node: Distribution contents704498
+Node: Unix Installation709579
+Node: Quick Installation710170
+Node: Additional Configuration Options711872
+Node: Configuration Philosophy713734
+Node: Non-Unix Installation716098
+Node: Amiga Installation716685
+Node: BeOS Installation717781
+Node: PC Installation718934
+Node: PC Binary Installation720164
+Node: PC Compiling722007
+Node: PC Dynamic726559
+Node: PC Using728920
+Node: Cygwin733533
+Ref: Cygwin-Footnote-1734531
+Node: VMS Installation734563
+Node: VMS Compilation735167
+Node: VMS Installation Details736744
+Node: VMS Running738374
+Node: VMS POSIX739971
+Node: VMS Old Gawk741269
+Node: Unsupported741738
+Node: Atari Installation742141
+Node: Atari Compiling743430
+Node: Atari Using745315
+Node: Tandem Installation748160
+Node: Bugs749840
+Node: Other Versions753145
+Ref: Other Versions-Footnote-1757571
+Ref: Other Versions-Footnote-2757613
+Ref: Other Versions-Footnote-3757650
+Node: Notes757688
+Node: Compatibility Mode758380
+Node: Additions759174
+Node: Adding Code759924
+Node: New Ports765974
+Node: Dynamic Extensions770106
+Node: Internals771363
+Node: Sample Library782366
+Node: Internal File Description783025
+Node: Internal File Ops786718
+Ref: Internal File Ops-Footnote-1792044
+Node: Using Internal File Ops792192
+Node: Future Extensions794215
+Node: Basic Concepts798168
+Node: Basic High Level798925
+Ref: Basic High Level-Footnote-1802957
+Node: Basic Data Typing803151
+Node: Floating Point Issues807588
+Ref: Floating Point Issues-Footnote-1808674
+Node: String Conversion Precision808727
+Ref: String Conversion Precision-Footnote-1810421
+Node: Unexpected Results810530
+Node: POSIX Floating Point Problems812356
+Ref: POSIX Floating Point Problems-Footnote-1815830
+Node: Glossary815868
+Node: Copying839636
+Node: GNU Free Documentation License877193
+Node: Index899595

End Tag Table
diff --git a/doc/gawk.texi b/doc/gawk.texi
index c0b738c7..39673e01 100755..100644
--- a/doc/gawk.texi
+++ b/doc/gawk.texi
@@ -20,9 +20,9 @@
@c applies to and all the info about who's publishing this edition
@c These apply across the board.
-@set UPDATE-MONTH June, 2005
+@set UPDATE-MONTH October, 2007
@set VERSION 3.1
-@set PATCHLEVEL 5
+@set PATCHLEVEL 6
@set FSF
@@ -110,7 +110,7 @@ Some comments on the layout for TeX.
@end iftex
@copying
-Copyright @copyright{} 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005 Free Software Foundation, Inc.
+Copyright @copyright{} 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2007 Free Software Foundation, Inc.
@sp 2
This is Edition @value{EDITION} of @cite{@value{TITLE}: @value{SUBTITLE}},
@@ -171,13 +171,15 @@ liabilities with respect to the programs or applications.
So there.
@sp 2
UNIX is a registered trademark of The Open Group in the United States and other countries. @*
+Linux is a registered trademark of Linus Torvalds in the United States and other countries. @*
Microsoft, MS and MS-DOS are registered trademarks, and Windows is a
trademark of Microsoft Corporation in the United States and other
countries. @*
Atari, 520ST, 1040ST, TT, STE, Mega and Falcon are registered trademarks
or trademarks of Atari Corporation. @*
-DEC, Digital, OpenVMS, ULTRIX and VMS are trademarks of Digital Equipment
-Corporation. @*
+Once upon a time,
+DEC, Digital, OpenVMS, ULTRIX and VMS were trademarks of Digital Equipment
+Corporation. Now they belong to Hewlett-Packard Corporation. @*
@end ignore
``To boldly go where no man has gone before'' is a
Registered Trademark of Paramount Pictures Corporation. @*
@@ -281,7 +283,7 @@ particular records in a file and perform operations upon them.
operating systems.
* Notes:: Notes about @command{gawk} extensions and
possible future work.
-* Basic Concepts:: A very quick intoduction to programming
+* Basic Concepts:: A very quick introduction to programming
concepts.
* Glossary:: An explanation of some unfamiliar terms.
* Copying:: Your right to copy and distribute
@@ -406,6 +408,8 @@ particular records in a file and perform operations upon them.
* Typing and Comparison:: How variables acquire types and how this
affects comparison of numbers and strings
with @samp{<}, etc.
+* Variable Typing:: String type versus numeric type.
+* Comparison Operators:: The comparison operators.
* Boolean Ops:: Combining comparison expressions using
boolean operators @samp{||} (``or''),
@samp{&&} (``and'') and @samp{!} (``not'').
@@ -601,6 +605,7 @@ particular records in a file and perform operations upon them.
* VMS Installation Details:: How to install @command{gawk} under VMS.
* VMS Running:: How to run @command{gawk} under VMS.
* VMS POSIX:: Alternate instructions for VMS POSIX.
+* VMS Old Gawk:: An old version comes with some VMS systems.
* Unsupported:: Systems whose ports are no longer
supported.
* Atari Installation:: Installing @command{gawk} on the Atari ST.
@@ -630,6 +635,10 @@ particular records in a file and perform operations upon them.
* Basic High Level:: The high level view.
* Basic Data Typing:: A very quick intro to data types.
* Floating Point Issues:: Stuff to know about floating-point numbers.
+* String Conversion Precision:: The String Value Can Lie.
+* Unexpected Results:: Floating Point Numbers Are Not
+ Abstract Numbers.
+* POSIX Floating Point Problems:: Standards Versus Existing Practice.
@end detailmenu
@end menu
@@ -930,7 +939,7 @@ for a complete list of those who made important contributions to @command{gawk}.
@node Names
@section A Rose by Any Other Name
-@cindex @command{awk}, new vs. old
+@cindex @command{awk}, new vs.@: old
The @command{awk} language has evolved over the years. Full details are
provided in @ref{Language History}.
The language described in this @value{DOCUMENT}
@@ -1218,7 +1227,7 @@ The GPL applies to the C language source code for @command{gawk}.
To find out more about the FSF and the GNU Project online,
see @uref{http://www.gnu.org, the GNU Project's home page}.
This @value{DOCUMENT} may also be read from
-@uref{http://www.gnu.org/manual/gawk/, their web site}.
+@uref{http://www.gnu.org/software/gawk/manual/, their web site}.
A shell, an editor (Emacs), highly portable optimizing C, C++, and
Objective-C compilers, a symbolic debugger and dozens of large and
@@ -1559,7 +1568,7 @@ of the patterns, @command{awk} performs specified actions on that line.
the end of the input files.
@cindex @command{awk}, uses for
-@cindex programming languages@comma{} data-driven vs. procedural
+@cindex programming languages@comma{} data-driven vs.@: procedural
@cindex @command{awk} programs
Programs in @command{awk} are different from programs in most other languages,
because @command{awk} programs are @dfn{data-driven}; that is, you describe
@@ -1926,8 +1935,8 @@ comment is to help you or another person understand the program
when reading it at a later time.
@cindex quoting
-@cindex single quote (@code{'}), vs. apostrophe
-@cindex @code{'} (single quote), vs. apostrophe
+@cindex single quote (@code{'}), vs.@: apostrophe
+@cindex @code{'} (single quote), vs.@: apostrophe
@strong{Caution:} As mentioned in
@ref{One-shot},
you can enclose small to medium programs in single quotes, in order to keep
@@ -2692,7 +2701,7 @@ Complex programs have been written in @command{awk}, including a complete
retargetable assembler for eight-bit microprocessors (@pxref{Glossary}, for
more information), and a microcode assembler for a special-purpose Prolog
computer. More recently, @command{gawk} was used for writing a Wiki
-clone.@footnote{@uref{http://www.awk-scripting.de/cgi/wiki.cgi/yawk/, Yet Another Wiki Clone}.}
+clone.@footnote{@uref{http://www.awk-scripting.de/cgi-bin/wiki.cgi/yawk/, Yet Another Wiki Clone}.}
While the original @command{awk}'s capabilities were strained by tasks
of such complexity, modern versions are more capable. Even the Bell
Labs version of @command{awk} has fewer predefined limits, and those
@@ -3561,6 +3570,7 @@ are not special, interval expressions are not available, nor
are the POSIX character classes (@code{[[:alnum:]]}, etc.).
Characters described by octal and hexadecimal escape sequences are
treated literally, even if they represent regexp metacharacters.
+Also, @command{gawk} silently skips directories named on the command line.
@item @code{--re-interval}
Allow interval expressions in regexps, even if @option{--traditional}
@@ -3663,7 +3673,7 @@ character set. This character set is a superset of the traditional 128
ASCII characters, which also provides a number of characters suitable
for use with European languages.
-As of @command{gawk} 3.1.4, the case equivalencies are fully
+As of @command{gawk} 3.1.4, the case equivalences are fully
locale-aware. They are based on the C @code{<ctype.h>} facilities,
such as @code{isalpha()} and @code{toupper()}.
@@ -3751,7 +3761,7 @@ match the string on the lefthand side of the operator with the pattern
on the right. This is true of any string-valued expression (such as
@code{digits_regexp}, shown previously), not just string constants.
-@cindex regexp constants, slashes vs. quotes
+@cindex regexp constants, slashes vs.@: quotes
@cindex @code{\} (backslash), regexp constants
@cindex backslash (@code{\}), regexp constants
@cindex @code{"} (double quote), regexp constants
@@ -3767,9 +3777,9 @@ you have to type @code{"\\*"}. The first backslash escapes the
second one so that the string actually contains the
two characters @samp{\} and @samp{*}.
-@cindex troubleshooting, regexp constants vs. string constants
-@cindex regexp constants, vs. string constants
-@cindex string constants, vs. regexp constants
+@cindex troubleshooting, regexp constants vs.@: string constants
+@cindex regexp constants, vs.@: string constants
+@cindex string constants, vs.@: regexp constants
Given that you can use both regexp and string constants to describe
regular expressions, which should you use? The answer is ``regexp
constants,'' for several reasons:
@@ -3828,6 +3838,7 @@ occur often in practice, but it's worth noting for future reference.
@node Locales
@section Where You Are Makes A Difference
+@cindex locale, definition of
Modern systems support the notion of @dfn{locales}: a way to tell
the system about the local character set and language. The current
@@ -3852,6 +3863,7 @@ should not normally match @samp{[A-Z]*}. This result is due to the
locale setting (and thus you may not see it on your system).
There are two fixes. The first is to use the POSIX character
class @samp{[[:upper:]]}, instead of @samp{[A-Z]}.
+(This is preferred, since then your program will work everywhere.)
The second is to change the locale setting in the environment,
before running @command{gawk},
by using the shell statements:
@@ -3873,10 +3885,14 @@ ranges should be avoided; either list the characters individually,
or use a POSIX character class such as @samp{[[:punct:]]}.)
For the normal case of @samp{RS = "\n"}, the locale is largely irrelevant.
-For other single byte record separators, using @samp{LC_ALL=C} will give you
-much better performance when reading records. Otherwise, @command{gawk} has
-to make several function calls, @emph{per input character} to find the record
-terminator.
+For other single-character record separators, using @samp{LC_ALL=C}
+will give you much better performance when reading records. Otherwise,
+@command{gawk} has to make several function calls, @emph{per input
+character} to find the record terminator.
+
+Finally, the locale affects the value of the decimal point character
+used when @command{gawk} parses input data. This is discussed in
+detail in @ref{Conversion}.
@node Reading Files
@chapter Reading Input Files
@@ -4840,7 +4856,7 @@ Perhaps the most common use of a single character as the field
separator occurs when processing the Unix system password file.
On many Unix systems, each user has a separate entry in the system password
file, one line per user. The information in these lines is separated
-by colons. The first field is the user's logon name and the second is
+by colons. The first field is the user's login name and the second is
the user's (encrypted or shadow) password. A password file entry might look
like this:
@@ -5161,7 +5177,7 @@ Now that the input is separated into records, the second step is to
separate the fields in the record. One way to do this is to divide each
of the lines into fields in the normal manner. This happens by default
as the result of a special feature. When @code{RS} is set to the empty
-string, @emph{and} @code{FS} is a set to a single character,
+string, @emph{and} @code{FS} is set to a single character,
the newline character @emph{always} acts as a field separator.
This is in addition to whatever field separations result from
@code{FS}.@footnote{When @code{FS} is the null string (@code{""})
@@ -5185,7 +5201,7 @@ separator is a percent character, instead of
Another way to separate fields is to
put each field on a separate line: to do this, just set the
variable @code{FS} to the string @code{"\n"}. (This single
-character seperator matches a single newline.)
+character separator matches a single newline.)
A practical example of a @value{DF} organized this way might be a mailing
list, where each entry is separated by blank lines. Consider a mailing
list in a file named @file{addresses}, which looks like this:
@@ -5259,7 +5275,9 @@ Records are separated by each occurrence of the character. Multiple
successive occurrences delimit empty records.
@item RS == ""
-Records are separated by runs of blank lines. The newline character
+Records are separated by runs of blank lines.
+When @code{FS} is a single character, then
+the newline character
always serves as a field separator, in addition to whatever value
@code{FS} may have. Leading and trailing newlines in a file are ignored.
@@ -5347,7 +5365,6 @@ processing on the next record @emph{right now}. For example:
print m > "/dev/stderr"
exit
@}
- t = -1
u = index($0, "*/")
@}
# substr expression will be "" if */
@@ -5358,7 +5375,7 @@ processing on the next record @emph{right now}. For example:
@}
@end example
-This @command{awk} program deletes all C-style comments (@samp{/* @dots{}
+This @command{awk} program deletes C-style comments (@samp{/* @dots{}
*/}) from the input. By replacing the @samp{print $0} with other
statements, you could perform more complicated processing on the
decommented input, such as searching for matches of a regular
@@ -5601,6 +5618,20 @@ because the concatenation operator is not parenthesized. You should
write it as @samp{(@w{"echo "} "date") | getline} if you want your program
to be portable to other @command{awk} implementations.
+@quotation NOTE
+Unfortunately, @command{gawk} has not been consistent in its treatment
+of a construct like @samp{@w{"echo "} "date" | getline}. Up to and including
+@value{PVERSION} 3.1.1 of @command{gawk}, it was treated as
+@samp{@w{("echo "} "date") | getline}.
+(This how Unix @command{awk} behaves.)
+From 3.1.2 through 3.1.5, it was treated as
+@samp{@w{"echo "} ("date" | getline)}.
+(This is how @command{mawk} behaves.)
+Starting with @value{PVERSION} 3.1.6, the earlier behavior was reinstated.
+In short, @emph{always} use explicit parentheses, and then you won't
+have to worry.
+@end quotation
+
@node Getline/Variable/Pipe
@subsection Using @code{getline} into a Variable from a Pipe
@cindex variables, @code{getline} command into@comma{} using
@@ -5648,7 +5679,7 @@ sends data @emph{to} your @command{awk} program.
On occasion, you might want to send data to another program
for processing and then read the results back.
-@command{gawk} allows you start a @dfn{coprocess}, with which two-way
+@command{gawk} allows you to start a @dfn{coprocess}, with which two-way
communications are possible. This is done with the @samp{|&}
operator.
Typically, you write data to the coprocess first and then
@@ -6179,7 +6210,7 @@ representing negative
infinity are formatted as
@samp{-inf} or @samp{-infinity},
and positive infinity as
-@samp{inf} and @samp{-infinity}.
+@samp{inf} and @samp{infinity}.
The special ``not a number'' value formats as @samp{-nan} or @samp{nan}.
@item %F
@@ -6187,7 +6218,7 @@ Like @code{%f} but the infinity and ``not a number'' values are spelled
using uppercase letters.
The @code{%F} format is a POSIX extension to ISO C; not all systems
-support. On those that don't, @command{gawk} uses @code{%f} instead.
+support it. On those that don't, @command{gawk} uses @code{%f} instead.
@item %g@r{,} %G
These print a number in either scientific notation or in floating-point
@@ -6220,7 +6251,7 @@ argument and it ignores any modifiers.
@cindex @command{gawk}, format-control characters
@quotation NOTE
When using the integer format-control letters for values that are
-outside the range of the widest C integer type, @command{gawk} switches to the
+outside the range of the widest C integer type, @command{gawk} switches to
the @samp{%g} format specifier. If @option{--lint} is provided on the
command line (@pxref{Options}), @command{gawk}
warns about this. Other versions of @command{awk} may print invalid
@@ -6313,19 +6344,19 @@ This flag only has an effect when the field width is wider than the
value to print.
@item '
-A single quote or apostrohe character is a POSIX extension to ISO C.
+A single quote or apostrophe character is a POSIX extension to ISO C.
It indicates that the integer part of a floating point value, or the
entire part of an integer decimal value, should have a thousands-separator
character in it. This only works in locales that support such characters.
For example:
@example
-$ @kbd{cat thousands.awk} @i{Show source program}
+$ @kbd{cat thousands.awk} @i{Show source program}
@print{} BEGIN @{ printf "%'d\n", 1234567 @}
-$ @kbd{LC_ALL=C gawk -f thousands.awk} @i{Run it in "C" locale}
-@print{} 1234567
-$ @kbd{LC_ALL=en_US.UTF-8 gawk -f thousands.awk} @i{Run in US English UTF locale}
-@print{} 1,234,567
+$ @kbd{LC_ALL=C gawk -f thousands.awk}
+@print{} 1234567 @i{Results in "C" locale}
+$ @kbd{LC_ALL=en_US.UTF-8 gawk -f thousands.awk}
+@print{} 1,234,567 @i{Results in US English UTF locale}
@end example
@noindent
@@ -6334,7 +6365,7 @@ see @ref{Locales}.
@quotation NOTE
The @samp{'} flag is a nice feature, but its use complicates things: it
-now becomes difficult to use it in command-line programs. For information
+becomes difficult to use it in command-line programs. For information
on appropriate quoting tricks, see @ref{Quoting}.
@end quotation
@@ -6654,7 +6685,8 @@ for more information.
This example also illustrates the use of a variable to represent
a @var{file} or @var{command}---it is not necessary to always
use a string constant. Using a variable is generally a good idea,
-because @command{awk} requires that the string value be spelled identically
+because (if you mean to refer to that same file or command)
+@command{awk} requires that the string value be spelled identically
every time.
@cindex coprocesses
@@ -6671,6 +6703,8 @@ but subsidiary to, the @command{awk} program.
This feature is a @command{gawk} extension, and is not available in
POSIX @command{awk}.
+@xref{Getline/Coprocess},
+for a brief discussion.
@xref{Two-way I/O},
for a more complete discussion.
@end table
@@ -6696,7 +6730,10 @@ print "Avoid improbability generators" >> "guide.txt"
This is indeed how redirections must be used from the shell. But in
@command{awk}, it isn't necessary. In this kind of case, a program should
use @samp{>} for all the @code{print} statements, since the output file
-is only opened once.
+is only opened once. (It happens that if you mix @samp{>} and @samp{>>}
+that output is produced in the expected order. However, mixing the operators
+for the same file is definitely poor style, and is confusing to readers
+of your program.)
@cindex differences in @command{awk} and @command{gawk}, implementation limitations
@cindex implementation issues@comma{} @command{gawk}, limits
@@ -7767,8 +7804,8 @@ b = a ""
@cindex POSIX @command{awk}, @code{OFMT} variable and
@cindex @code{OFMT} variable
-@cindex portability, new @command{awk} vs. old @command{awk}
-@cindex @command{awk}, new vs. old, @code{OFMT} variable
+@cindex portability, new @command{awk} vs.@: old @command{awk}
+@cindex @command{awk}, new vs.@: old, @code{OFMT} variable
Prior to the POSIX standard, @command{awk} used the value
of @code{OFMT} for converting numbers to strings. @code{OFMT}
specifies the output format to use when printing numbers with @code{print}.
@@ -7783,23 +7820,22 @@ that instead of changing your programs, just port @command{gawk} itself.
@xref{Print},
for more information on the @code{print} statement.
-Finally, once again, where you are can matter when it comes to
-converting between numbers and strings. In
-@ref{Locales}, we mentioned that the
-local character set and language (the locale) can affect how @command{gawk} matches
-characters. The locale also affects numeric formats. In particular, for @command{awk}
-programs, it affects the decimal point character. The @code{"C"} locale, and most
-English-language locales, use the period character (@samp{.}) as the decimal point.
-However, many (if not most) European and non-English locales use the comma (@samp{,})
-as the decimal point character.
+And, once again, where you are can matter when it comes to converting
+between numbers and strings. In @ref{Locales}, we mentioned that
+the local character set and language (the locale) can affect how
+@command{gawk} matches characters. The locale also affects numeric
+formats. In particular, for @command{awk} programs, it affects the
+decimal point character. The @code{"C"} locale, and most English-language
+locales, use the period character (@samp{.}) as the decimal point.
+However, many (if not most) European and non-English locales use the comma
+(@samp{,}) as the decimal point character.
The POSIX standard says that @command{awk} always uses the period as the decimal
point when reading the @command{awk} program source code, and for command-line
variable assignments (@pxref{Other Arguments}).
However, when interpreting input data, for @code{print} and @code{printf} output,
and for number to string conversion, the local decimal point character is used.
-As of @value{PVERSION} 3.1.3, @command{gawk} fully complies with this aspect
-of the standard. Here are some examples indicating the difference in behavior,
+Here are some examples indicating the difference in behavior,
on a GNU/Linux system:
@example
@@ -7819,6 +7855,37 @@ the decimal point separator. In the normal @code{"C"} locale, @command{gawk}
treats @samp{4,321} as @samp{4}, while in the Danish locale, it's treated
as the full number, @samp{4.321}.
+For @value{PVERSION} 3.1.3 through 3.1.5, @command{gawk} fully complied
+with this aspect of the standard. However, many users in non-English
+locales complained about this behavior, since their data used a period
+as the decimal point. Beginning in @value{PVERSION} 3.1.6, the default
+behavior was restored to use a period as the decimal point character.
+You can use the @option{--use-lc-numeric} option (@pxref{Options})
+to force @command{gawk} to use the locale's decimal point character.
+(@command{gawk} also uses the locale's decimal point character when in
+POSIX mode, either via @option{--posix}, or the @env{POSIXLY_CORRECT}
+environment variable.)
+
+The following table describes the cases in which the locale's decimal
+point character is used and when a period is used. Some of these
+features have not been described yet.
+
+@float Table,table-locale-affects
+@caption{Locale Decimal Point versus A Period}
+@multitable @columnfractions .15 .20 .45
+@headitem Feature @tab Default @tab @option{--posix} or @option{--use-lc-numeric}
+@item @samp{%'g} @tab Use locale @tab Use locale
+@item @samp{%g} @tab Use period @tab Use locale
+@item Input @tab Use period @tab Use locale
+@item @samp{strtonum} @tab Use period @tab Use locale
+@end multitable
+@end float
+
+Finally, modern day formal standards and IEEE standard floating point
+representation can have an unusual but important effect on the way
+@command{gawk} converts some special string values to numbers. The details
+are presented in @ref{POSIX Floating Point Problems}.
+
@node Arithmetic Ops
@section Arithmetic Operators
@cindex arithmetic operators
@@ -7969,9 +8036,9 @@ $ awk '@{ print "Field number one:" $1 @}' BBS-list
@cindex troubleshooting, string concatenation
Because string concatenation does not have an explicit operator, it is
often necessary to insure that it happens at the right time by using
-parentheses to enclose the items to concatenate. For example, the
-following code fragment does not concatenate @code{file} and @code{name}
-as you might expect:
+parentheses to enclose the items to concatenate. For example,
+you might expect that the
+following code fragment concatenates @code{file} and @code{name}:
@example
file = "file"
@@ -7980,6 +8047,9 @@ print "something meaningful" > file name
@end example
@noindent
+This produces a syntax error with Unix @command{awk}.@footnote{It happens
+that @command{gawk} and @command{mawk} ``get it right,'' but you should
+not rely on this.}
It is necessary to use the following:
@example
@@ -8013,7 +8083,7 @@ counter-intuitive. Consider this example:
@ignore
> To: bug-gnu-utils@@gnu.org
-> CC: arnold@gnu.org
+> CC: arnold@@gnu.org
> Subject: gawk 3.0.4 bug with {print -12 " " -24}
> From: Russell Schulz <Russell_Schulz@locutus.ofB.ORG>
> Date: Tue, 8 Feb 2000 19:56:08 -0700
@@ -8500,6 +8570,16 @@ The Hitchhiker's Guide to the Galaxy
Unlike other programming languages, @command{awk} variables do not have a
fixed type. Instead, they can be either a number or a string, depending
upon the value that is assigned to them.
+We look now at how variables are typed, and how @command{awk}
+compares variables.
+
+@menu
+* Variable Typing:: String type versus numeric type.
+* Comparison Operators:: The comparison operators.
+@end menu
+
+@node Variable Typing
+@subsection String Type Versus Numeric Type
@cindex numeric, strings
@cindex strings, numeric
@@ -8544,9 +8624,9 @@ operation:
@example
BEGIN @{
- a = 12.345
- b = a " is a cute number"
- print b
+ a = 12.345
+ b = a " is a cute number"
+ print b
@}
@end example
@@ -8615,17 +8695,49 @@ STRNUM | string numeric numeric
The basic idea is that user input that looks numeric---and @emph{only}
user input---should be treated as numeric, even though it is actually
made of characters and is therefore also a string.
-Thus, for example, the string constant @w{@code{" +3.14"}}
-is a string, even though it looks numeric,
-and is @emph{never} treated as number for comparison
+Thus, for example, the string constant @w{@code{" +3.14"}},
+when it appears in program source code,
+is a string---even though it looks numeric---and
+is @emph{never} treated as number for comparison
purposes.
In short, when one operand is a ``pure'' string, such as a string
constant, then a string comparison is performed. Otherwise, a
-numeric comparison is performed.@footnote{The POSIX standard is under
-revision. The revised standard's rules for typing and comparison are
+numeric comparison is performed.@footnote{The POSIX standard has
+been revised. The revised standard's rules for typing and comparison are
the same as just described for @command{gawk}.}
+This point bears additional emphasis: All user input is made of characters,
+and so is first and foremost of @var{string} type; input strings
+that look numeric are additionally given the @var{strnum} attribute.
+Thus, the six-character input string @w{@samp{ +3.14}} receives the
+@var{strnum} attribute. In contrast, the eight-character literal
+@w{@code{" +3.14"}} appearing in program text is a string constant.
+The following examples print @samp{1} when the comparison between
+the two different constants is true, @samp{0} otherwise:
+
+@example
+$ echo ' +3.14' | gawk '@{ print $0 == " +3.14" @}' @i{True}
+@print{} 1
+$ echo ' +3.14' | gawk '@{ print $0 == "+3.14" @}' @i{False}
+@print{} 0
+$ echo ' +3.14' | gawk '@{ print $0 == "3.14" @}' @i{False}
+@print{} 0
+$ echo ' +3.14' | gawk '@{ print $0 == 3.14 @}' @i{True}
+@print{} 1
+$ echo ' +3.14' | gawk '@{ print $1 == " +3.14" @}' @i{False}
+@print{} 0
+$ echo ' +3.14' | gawk '@{ print $1 == "+3.14" @}' @i{True}
+@print{} 1
+$ echo ' +3.14' | gawk '@{ print $1 == "3.14" @}' @i{False}
+@print{} 0
+$ echo ' +3.14' | gawk '@{ print $1 == 3.14 @}' @i{True}
+@print{} 1
+@end example
+
+@node Comparison Operators
+@subsection Comparison Operators
+
@dfn{Comparison expressions} compare strings or numbers for
relationships such as equality. They are written using @dfn{relational
operators}, which are a superset of those in C.
@@ -8726,9 +8838,9 @@ $ echo 1e2 3 | awk '@{ print ($1 < $2) ? "true" : "false" @}'
@print{} false
@end example
-@cindex comparison expressions, string vs. regexp
-@c @cindex string comparison vs. regexp comparison
-@c @cindex regexp comparison vs. string comparison
+@cindex comparison expressions, string vs.@: regexp
+@c @cindex string comparison vs.@: regexp comparison
+@c @cindex regexp comparison vs.@: string comparison
@noindent
the result is @samp{false} because both @code{$1} and @code{$2}
are user input. They are numeric strings---therefore both have
@@ -8906,7 +9018,9 @@ out initialized to zero, which is also false. When a line is seen whose
first field is @samp{START}, the value of @code{interested} is toggled
to true, using @samp{!}. The next rule prints lines as long as
@code{interested} is true. When a line is seen whose first field is
-@samp{END}, @code{interested} is toggled back to false.
+@samp{END}, @code{interested} is toggled back to false.@footnote{This
+program has a bug; it prints lines starting with @samp{END}. How
+would you fix it?}
@ignore
Scott Deifik points out that this program isn't robust against
@@ -9047,8 +9161,7 @@ treated as local variables and initialized to the empty string
Like every other expression, the function call has a value, which is
computed by the function based on the arguments you give it. In this
example, the value of @samp{sqrt(@var{argument})} is the square root of
-@var{argument}. A function can also have side effects, such as assigning
-values to certain variables or doing I/O.
+@var{argument}.
The following program reads numbers, one number per line, and prints the
square root of each one:
@@ -9063,6 +9176,34 @@ $ awk '@{ print "The square root of", $1, "is", sqrt($1) @}'
@kbd{@value{CTL}-d}
@end example
+A function can also have side effects, such as assigning
+values to certain variables or doing I/O.
+This program shows how the @samp{match} function
+(@pxref{String Functions})
+changes the variables @code{RSTART} and @code{RLENGTH}:
+
+@example
+@{
+ if (match($1, $2))
+ print RSTART, RLENGTH
+ else
+ print "no match"
+@}
+@end example
+
+@noindent
+Here is a sample run:
+
+@example
+$ awk -f matchit.awk
+aaccdd c+
+@print{} 3 2
+foo bar
+@print{} no match
+abcdefg e
+@print{} 5 1
+@end example
+
@node Precedence
@section Operator Precedence (How Operators Nest)
@c STARTOFRANGE prec
@@ -9093,14 +9234,20 @@ exponentiation operators, which group in the opposite order.
Thus, @samp{a - b + c} groups as @samp{(a - b) + c} and
@samp{a = b = c} groups as @samp{a = (b = c)}.
-The precedence of prefix unary operators does not matter as long as only
-unary operators are involved, because there is only one way to interpret
+Normally the precedence of prefix unary operators does not matter,
+because there is only one way to interpret
them: innermost first. Thus, @samp{$++i} means @samp{$(++i)} and
@samp{++$x} means @samp{++($x)}. However, when another operator follows
the operand, then the precedence of the unary operators can matter.
@samp{$x^2} means @samp{($x)^2}, but @samp{-x^2} means
@samp{-(x^2)}, because @samp{-} has lower precedence than @samp{^},
whereas @samp{$} has higher precedence.
+Also, operators cannot be combined in a way that violates the
+precedence rules; for example, @samp{$$0++--} is not a valid
+expression because the first @samp{$} has higher precedence than the
+@samp{++}; to avoid the problem the expression can be rewritten as
+@samp{$($0++)--}.
+
This table presents @command{awk}'s operators, in order of highest
to lowest precedence:
@@ -9144,7 +9291,7 @@ Unary plus, minus, logical ``not.''
@cindex @code{%} (percent sign), @code{%} operator
@cindex percent sign (@code{%}), @code{%} operator
@item * / %
-Multiplication, division, modulus.
+Multiplication, division, remainder.
@cindex @code{+} (plus sign), @code{+} operator
@cindex plus sign (@code{+}), @code{+} operator
@@ -11168,9 +11315,9 @@ BEGIN @{
verbose = 1
else if (ARGV[i] == "-d")
debug = 1
- else if (ARGV[i] ~ /^-?/) @{
+ else if (ARGV[i] ~ /^-./) @{
e = sprintf("%s: unrecognized option -- %c",
- ARGV[0], substr(ARGV[i], 1, ,1))
+ ARGV[0], substr(ARGV[i], 2, 1))
print e > "/dev/stderr"
@} else
break
@@ -12699,7 +12846,7 @@ store a modified value there. If this argument is omitted, then the
default is to use and alter @code{$0}.@footnote{Note that this means
that the record will first be regenerated using the value of @code{OFS} if
any fields have been changed, and that the fields will be updated
-after the substituion, even if the operation is a ``no-op'' such
+after the substitution, even if the operation is a ``no-op'' such
as @samp{sub(/^/, "")}.}
For example:
@@ -13112,7 +13259,7 @@ to produce a @samp{\} preceding the matched text. This is shown in
@ref{table-sub-proposed}.
@float Table,table-sub-proposed
-@caption{Propsosed rules for sub and backslash}
+@caption{Proposed rules for sub and backslash}
@tex
\vbox{\bigskip
% This table has lots of &'s and \'s, so unspecialize them.
@@ -13425,7 +13572,7 @@ Some operating systems cannot implement the @code{system} function.
@c fakenode --- for prepinfo
@subheading Advanced Notes: Interactive Versus Noninteractive Buffering
@cindex advanced features, buffering
-@cindex buffering, interactive vs. noninteractive
+@cindex buffering, interactive vs.@: noninteractive
As a side point, buffering issues can be even more confusing, depending
upon whether your program is @dfn{interactive}, i.e., communicating
@@ -13598,12 +13745,15 @@ whether daylight savings time is in effect for the specified time.
If @var{datespec} does not contain enough elements or if the resulting time
is out of range, @code{mktime} returns @minus{}1.
-@item strftime(@r{[}@var{format} @r{[}, @var{timestamp}@r{]]})
+@item strftime(@r{[}@var{format} @r{[}, @var{timestamp} @r{[}, @var{utc-flag}@r{]]]})
@c STARTOFRANGE strf
@cindex @code{strftime} function (@command{gawk})
This function returns a string. It is similar to the function of the
same name in ISO C. The time specified by @var{timestamp} is used to
produce a string, based on the contents of the @var{format} string.
+If @var{utc-flag} is present and is either non-zero or non-null, the value
+is formatted as UTC (Coordinated Universal Time, formerly GMT or Greenwich
+Mean Time). Otherwise, the value is formatted for the local time zone.
The @var{timestamp} is in the same format as the value returned by the
@code{systime} function. If no @var{timestamp} argument is supplied,
@command{gawk} uses the current time of day as the timestamp.
@@ -13805,8 +13955,9 @@ Thus, the @samp{%x} specification in a @code{"US"} locale might produce
locale, which is an environment that is typical of what most C programmers
are used to.
-A public-domain C version of @code{strftime} is supplied with @command{gawk}
-for systems that are not yet fully standards-compliant.
+For systems that are not yet fully standards-compliant,
+@command{gawk} supplies a copy of
+@code{strftime} from the GNU C Library.
It supports all of the just listed format specifications.
If that version is
used to compile @command{gawk} (@pxref{Installation}),
@@ -13821,6 +13972,7 @@ Single-digit numbers are padded with a space.
The hour (12-hour clock) as a decimal number (1--12).
Single-digit numbers are padded with a space.
+@ignore
@item %N
The ``Emperor/Era'' name.
Equivalent to @code{%C}.
@@ -13828,12 +13980,15 @@ Equivalent to @code{%C}.
@item %o
The ``Emperor/Era'' year.
Equivalent to @code{%y}.
+@end ignore
@item %s
The time as a decimal timestamp in seconds since the epoch.
+@ignore
@item %v
The date in VMS format (e.g., @samp{20-JUN-1991}).
+@end ignore
@end table
@c ENDOFRANGE strf
@@ -15241,7 +15396,7 @@ Even though @code{gettext} can return the translated string
at runtime,
it cannot change the argument order in the call to @code{printf}.
-To solve this problem, @code{printf} format specificiers may have
+To solve this problem, @code{printf} format specifiers may have
an additional optional element, which we call a @dfn{positional specifier}.
For example:
@@ -15281,7 +15436,7 @@ $ gawk 'BEGIN @{
@quotation NOTE
When using @samp{*} with a positional specifier, the @samp{*}
comes first, then the integer position, and then the @samp{$}.
-This is somewhat counterintutive.
+This is somewhat counterintuitive.
@end quotation
@cindex @code{printf} statement, positional specifiers, mixing with regular formats
@@ -16130,9 +16285,11 @@ For example, @samp{(3 + 5) * 4} means add three plus five, then multiply
the total by four. However, @samp{3 + 5 * 4} has no parentheses, and
means @samp{3 + (5 * 4)}.
+@ignore
@item
All string concatenations are parenthesized too.
(This could be made a bit smarter.)
+@end ignore
@item
Parentheses are used around the arguments to @code{print}
@@ -16241,6 +16398,8 @@ keyboard. The @code{INT} signal is generated by the
@c ENDOFRANGE awkp
@c ENDOFRANGE proawk
+
+
@node Invoking Gawk
@chapter Running @command{awk} and @command{gawk}
@@ -16525,6 +16684,12 @@ development of cleaner @command{awk} programs.
With an optional argument of @samp{invalid}, only warnings about things that are
actually invalid are issued. (This is not fully implemented yet.)
+Some warnings are only printed once, even if the dubious constructs they warn
+about occur multiple times in your @command{awk} program. Thus, when eliminating
+problems pointed out by @option{--lint}, you should take care to search for all
+occurrences of each inappropriate construct. As @command{awk} programs are
+usually short, doing so is not burdensome.
+
@item -W lint-old
@itemx --lint-old
@cindex @code{--lint-old} option
@@ -16596,6 +16761,12 @@ Specifying @samp{-Ft} on the command-line does not set the value
of @code{FS} to be a single TAB character
(@pxref{Field Separators}).
+@cindex locale decimal point character
+@cindex decimal point character, locale specific
+@item
+The locale's decimal point character is used for parsing input
+data (@pxref{Locales}).
+
@cindex @code{fflush} function@comma{} unsupported
@item
The @code{fflush} built-in function is not supported
@@ -16647,6 +16818,12 @@ This is particularly useful
when you have library functions that you want to use from your command-line
programs (@pxref{AWKPATH Variable}).
+@item -W use-lc-numeric
+@itemx --use-lc-numeric
+@cindex @code{--use-lc-numeric} option
+This option forces the use of the locale's decimal point character
+when parsing numeric input data (@pxref{Locales}).
+
@item -W version
@itemx --version
@cindex @code{--version} option
@@ -16700,8 +16877,8 @@ If no @option{-f} or @option{--source} option is specified, then @command{gawk}
uses the first non-option command-line argument as the text of the
program source code.
-@cindex @code{POSIXLY_CORRECT} environment variable
-@cindex lint checking, @code{POSIXLY_CORRECT} environment variable
+@cindex @env{POSIXLY_CORRECT} environment variable
+@cindex lint checking, @env{POSIXLY_CORRECT} environment variable
@cindex POSIX mode
If the environment variable @env{POSIXLY_CORRECT} exists,
then @command{gawk} behaves in strict POSIX mode, exactly as if
@@ -16720,7 +16897,7 @@ POSIXLY_CORRECT=true
export POSIXLY_CORRECT
@end example
-@cindex @command{csh} utility, @code{POSIXLY_CORRECT} environment variable
+@cindex @command{csh} utility, @env{POSIXLY_CORRECT} environment variable
For a @command{csh}-compatible
shell,@footnote{Not recommended.}
you would add this line to the @file{.login} file in your home directory:
@@ -16729,7 +16906,7 @@ you would add this line to the @file{.login} file in your home directory:
setenv POSIXLY_CORRECT true
@end example
-@cindex portability, @code{POSIXLY_CORRECT} environment variable
+@cindex portability, @env{POSIXLY_CORRECT} environment variable
Having @env{POSIXLY_CORRECT} set is not recommended for daily use,
but it is good for testing the portability of your programs to other
environments.
@@ -17302,7 +17479,7 @@ is necessary if you are not using @command{gawk}.}
@cindex @code{nextfile} user-defined function
This initial version has a subtle problem.
-If the same @value{DF} is listed @emph{twice} on the commandline,
+If the same @value{DF} is listed @emph{twice} on the command line,
one right after the other
or even with just a variable assignment between them,
this code skips right through the file a second time, even though
@@ -17318,7 +17495,7 @@ is shown here:
@ignore
@c file eg/lib/nextfile.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May, 1993
@c endfile
@@ -17462,7 +17639,7 @@ The use of @code{tolower} simplifies the computation for finding
the correct numeric value for each hexadecimal digit.
Finally, if the string matches the (rather complicated) regex for a
-regular decimal integer or floating-point numer, the computation
+regular decimal integer or floating-point number, the computation
@samp{ret = str + 0} lets @command{awk} convert the value to a
number.
@@ -17524,7 +17701,7 @@ Following is the function:
@c file eg/lib/assert.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May, 1993
@c endfile
@@ -17631,7 +17808,7 @@ does unbiased rounding:
@ignore
@c file eg/lib/round.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# August, 1996
@c endfile
@@ -17661,10 +17838,11 @@ function round(x, ival, aval, fraction)
return ival
@}
@}
+@c endfile
+@c don't include test harness in the file that gets installed
# test harness
@{ print $0, round($0) @}
-@c endfile
@end example
@node Cliff Random Function
@@ -17675,7 +17853,7 @@ function round(x, ival, aval, fraction)
@cindex functions, library, Cliff random numbers
The Cliff random number
-generator@footnote{@uref{http://mathworld.wolfram.com/CliffRandomNumberGenerator.hmtl}}
+generator@footnote{@uref{http://mathworld.wolfram.com/CliffRandomNumberGenerator.html}}
is a very simple random number generator that ``passes the noise sphere test
for randomness by showing no structure.''
It is easily programmed, in less than 10 lines of @command{awk} code:
@@ -17688,7 +17866,7 @@ It is easily programmed, in less than 10 lines of @command{awk} code:
@ignore
@c file eg/lib/cliff_rand.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# December 2000
@c endfile
@@ -17742,7 +17920,7 @@ reason to build them into the @command{awk} interpreter:
@ignore
@c file eg/lib/ord.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# 16 January, 1992
# 20 July, 1992, revised
@@ -17860,7 +18038,7 @@ assumption since the array was likely created with @code{split}
@ignore
@c file eg/lib/join.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -17918,7 +18096,7 @@ time formatted in the same way as the @command{date} utility:
@ignore
@c file eg/lib/gettime.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain, May 1993
+# Arnold Robbins, arnold@@skeeve.com, Public Domain, May 1993
#
@c endfile
@end ignore
@@ -18044,7 +18222,7 @@ Besides solving the problem in only nine(!) lines of code, it does so
# that each take the name of the file being started or
# finished, respectively.
@c #
-@c # Arnold Robbins, arnold@@gnu.org, Public Domain
+@c # Arnold Robbins, arnold@@skeeve.com, Public Domain
@c # January 1992
FILENAME != _oldfilename \
@@ -18097,7 +18275,7 @@ The following version solves the problem:
@ignore
@c file eg/lib/ftrans.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# November 1992
@c endfile
@@ -18141,7 +18319,7 @@ For lack of a better name, we'll call it @code{rewind}:
@ignore
@c file eg/lib/rewind.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# September 2000
@c endfile
@@ -18204,7 +18382,7 @@ program:
@ignore
@c file eg/lib/readable.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# October 2000
@c endfile
@@ -18258,7 +18436,7 @@ the @value{FN} and the position in @code{ARGV} where it was found:
@ignore
@c file eg/lib/zerofile.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# June 2003
@c endfile
@@ -18358,7 +18536,7 @@ a library file does the trick:
@ignore
@c file eg/lib/noassign.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# October 1999
@c endfile
@@ -18533,7 +18711,7 @@ The discussion that follows walks through the code a bit at a time:
@ignore
@c file eg/lib/getopt.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
#
# Initial version: March, 1991
# Revised: May, 1993
@@ -18739,6 +18917,15 @@ $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc
In both runs,
the first @option{--} terminates the arguments to @command{awk}, so that it does
not try to interpret the @option{-a}, etc., as its own options.
+
+@quotation NOTE
+After @code{getopt} is through, it is the responsibility of the user level
+code to
+clear out all the elements of @code{ARGV} from 1 to @code{Optind},
+so that @command{awk} does not try to process the command-line options
+as @value{FN}s.
+@end quotation
+
Several of the sample programs presented in
@ref{Sample Programs},
use @code{getopt} to process their arguments.
@@ -18811,7 +18998,7 @@ Following is @command{pwcat}, a C program that ``cats'' the password database:
@ignore
@c file eg/lib/pwcat.c
/*
- * Arnold Robbins, arnold@@gnu.org, May 1993
+ * Arnold Robbins, arnold@@skeeve.com, May 1993
* Public Domain
*/
@@ -18940,7 +19127,7 @@ functions of the same names:
@ignore
@c file eg/lib/passwdawk.in
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
# Revised October 2000
@@ -19161,7 +19348,7 @@ is as follows:
@ignore
@c file eg/lib/grcat.c
/*
- * Arnold Robbins, arnold@@gnu.org, May 1993
+ * Arnold Robbins, arnold@@skeeve.com, May 1993
* Public Domain
*/
@@ -19232,7 +19419,7 @@ The numeric group ID number. This number is unique within the file.
we cast it to @code{long} for all cases.)
@item Group Member List
-A comma-separated list of usernames. These users are members of the group.
+A comma-separated list of user names. These users are members of the group.
Modern Unix systems allow users to be members of several groups
simultaneously. If your system does, then there are elements
@code{"group1"} through @code{"group@var{N}"} in @code{PROCINFO}
@@ -19252,7 +19439,7 @@ it is usually empty or set to @samp{*}.
The group's numeric group ID number; this number should be unique within the file.
@item Group member list @tab
-A comma-separated list of usernames. These users are members of the group.
+A comma-separated list of user names. These users are members of the group.
Modern Unix systems allow users to be members of several groups
simultaneously. If your system does, then there are elements
@code{"group1"} through @code{"group@var{N}"} in @code{PROCINFO}
@@ -19286,7 +19473,7 @@ There are several, modeled after the C library functions of the same names:
@ignore
@c file eg/lib/groupawk.in
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
# Revised October 2000
@@ -19362,7 +19549,7 @@ scanning the group information.
The group information is stored is several associative arrays.
The arrays are indexed by group name (@code{@w{_gr_byname}}), by group ID number
(@code{@w{_gr_bygid}}), and by position in the database (@code{@w{_gr_bycount}}).
-There is an additional array indexed by username (@code{@w{_gr_groupsbyuser}}),
+There is an additional array indexed by user name (@code{@w{_gr_groupsbyuser}}),
which is a space-separated list of groups to which each user belongs.
Unlike the user database, it is possible to have multiple records in the
@@ -19375,7 +19562,7 @@ tvpeople:*:101:david,conan,tom,joan
@end example
For this reason, @code{_gr_init} looks to see if a group name or
-group ID number is already seen. If it is, then the usernames are
+group ID number is already seen. If it is, then the user names are
simply concatenated onto the previous list of users. (There is actually a
subtle problem with the code just presented. Suppose that
the first time there were no names. This code adds the names with
@@ -19423,7 +19610,7 @@ function getgrgid(gid)
@cindex @code{getgruser} function (C library)
The @code{getgruser} function does not have a C counterpart. It takes a
-username and returns the list of groups that have the user as a member:
+user name and returns the list of groups that have the user as a member:
@cindex @code{getgruser} function, user-defined
@example
@@ -19645,7 +19832,7 @@ supplied:
@ignore
@c file eg/prog/cut.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -19735,7 +19922,9 @@ Special care is taken when the field delimiter is a space. Using
a single space (@code{@w{" "}}) for the value of @code{FS} is
incorrect---@command{awk} would separate fields with runs of spaces,
tabs, and/or newlines, and we want them to be separated with individual
-spaces. Also, note that after @code{getopt} is through, we have to
+spaces. Also remember that after @code{getopt} is through
+(as described in @ref{Getopt Function}),
+we have to
clear out all the elements of @code{ARGV} from 1 to @code{Optind},
so that @command{awk} does not try to process the command-line options
as @value{FN}s.
@@ -19983,7 +20172,7 @@ that processes the command-line arguments with @code{getopt}. The @option{-i}
@ignore
@c file eg/prog/egrep.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -20252,7 +20441,7 @@ numbers:
@ignore
@c file eg/prog/id.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
# Revised February 1996
@@ -20390,7 +20579,7 @@ is used as the prefix for the output @value{FN}s:
@ignore
@c file eg/prog/split.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -20532,7 +20721,7 @@ Finally, @command{awk} is forced to read the standard input by setting
@ignore
@c file eg/prog/tee.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
# Revised December 1995
@@ -20697,7 +20886,7 @@ standard output, @file{/dev/stdout}:
@ignore
@c file eg/prog/uniq.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -20935,7 +21124,7 @@ command line:
@ignore
@c file eg/prog/wc.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@end ignore
@@ -21126,7 +21315,7 @@ word, comparing it to the previous one:
@ignore
@c file eg/prog/dupword.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# December 1991
# Revised October 2000
@@ -21192,7 +21381,7 @@ Here is the program:
@ignore
@c file eg/prog/alarm.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -21391,7 +21580,7 @@ Finally, the processing rule simply calls @code{translate} for each record:
@ignore
@c file eg/prog/translate.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# August 1989
@c endfile
@@ -21523,7 +21712,7 @@ not have been an even multiple of 20 labels in the data:
@ignore
@c file eg/prog/labels.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# June 1992
@c endfile
@end ignore
@@ -21751,7 +21940,7 @@ The @code{END} rule simply prints out the lines, in order:
@ignore
@c file eg/prog/histsort.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
@c endfile
@@ -21901,7 +22090,7 @@ exits with a zero exit status, signifying OK:
@ignore
@c file eg/prog/extract.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# May 1993
# Revised September 2000
@@ -22087,7 +22276,7 @@ are provided, the standard input is used:
@ignore
@c file eg/prog/awksed.awk
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# August 1995
@c endfile
@@ -22318,7 +22507,7 @@ The program is as follows:
@ignore
@c file eg/prog/igawk.sh
#
-# Arnold Robbins, arnold@@gnu.org, Public Domain
+# Arnold Robbins, arnold@@skeeve.com, Public Domain
# July 1993
@c endfile
@@ -22330,7 +22519,7 @@ then
shift
fi
-# A literal newline, so that program text is formmatted correctly
+# A literal newline, so that program text is formatted correctly
n='
'
@@ -22769,10 +22958,17 @@ The @code{ARGC}, @code{ARGV}, @code{FNR}, @code{RLENGTH}, @code{RSTART},
and @code{SUBSEP} built-in variables (@pxref{Built-in Variables}).
@item
+Assignable @code{$0}.
+
+@item
The conditional expression using the ternary operator @samp{?:}
(@pxref{Conditional Exp}).
@item
+The expression @samp{@var{index} in @var{array}} outside of @samp{for}
+statements (@pxref{Reference to Elements}).
+
+@item
The exponentiation operator @samp{^}
(@pxref{Arithmetic Ops}) and its assignment operator
form @samp{^=} (@pxref{Assignment Ops}).
@@ -22785,7 +22981,8 @@ programs (@pxref{Precedence}).
Regexps as the value of @code{FS}
(@pxref{Field Separators}) and as the
third argument to the @code{split} function
-(@pxref{String Functions}).
+(@pxref{String Functions}), rather than using only the first character
+of @code{FS}.
@item
Dynamic regexps as operands of the @samp{~} and @samp{!~} operators
@@ -22931,6 +23128,10 @@ of @code{FS} to be a single TAB character
(@pxref{Field Separators}).
@item
+The locale's decimal point character is used for parsing input
+data (@pxref{Locales}).
+
+@item
The @code{fflush} built-in function is not supported
(@pxref{I/O Functions}).
@end itemize
@@ -23012,7 +23213,7 @@ The ability to delete all of an array at once with @samp{delete @var{array}}
@appendixsec Extensions in @command{gawk} Not in POSIX @command{awk}
@ignore
-I've tried to follow this general order, esp. for the 3.0 and 3.1 sections:
+I've tried to follow this general order, esp.@: for the 3.0 and 3.1 sections:
variables
special files
language changes (e.g., hex constants)
@@ -23296,11 +23497,21 @@ profiles of @command{awk} programs
(@pxref{Profiling}).
@item
+The @option{--use-lc-numeric} option to force @command{gawk}
+to use the locale's decimal point for parsing input data
+(@pxref{Conversion}).
+
+@item
The @option{--enable-portals} configuration option to enable special treatment of
pathnames that begin with @file{/p} as BSD portals
(@pxref{Portal Files}).
@item
+The @option{--disable-directories-fatal} configuration option which
+causes @command{gawk} to silently skip directories named on the
+command line (@pxref{Additional Configuration Options}).
+
+@item
The use of GNU Automake to help in standardizing the configuration process
(@pxref{Quick Installation}).
@@ -23334,7 +23545,7 @@ POSIX compliance for @code{sub} and @code{gsub}
(@pxref{Gory Details}).
@item
-The @option{--exec} option, for use in CGI scripts.
+The @option{--exec} option, for use in CGI scripts
(@pxref{Options}).
@item
@@ -23342,6 +23553,11 @@ The @code{length} function was extended to accept an array argument
and return the number of elements in the array
(@pxref{String Functions}).
+@item
+The @code{strftime} function acquired a third argument to
+enable printing times as UTC
+(@pxref{Time Functions}).
+
@end itemize
@c XXX ADD MORE STUFF HERE
@@ -23481,7 +23697,9 @@ code and documentation, and motivated the inclusion of the @samp{|&} operator.
@item
@cindex Davies, Stephen
Stephen Davies
-provided the port to Tandem systems and its documentation.
+provided the initial port to Tandem systems and its documentation.
+Matthew Woehlke provided improvements for Tandem's POSIX-compliant
+systems.
@item
@cindex Brown, Martin
@@ -23498,7 +23716,8 @@ GNU Automake and @code{gettext}.
@cindex Broder, Alan J.@:
Alan J.@: Broder
provided the initial version of the @code{asort} function
-as well as the code for the new optional third argument to the @code{match} function.
+as well as the code for the new optional third argument to the
+@code{match} function.
@item
@cindex Buening, Andreas
@@ -23942,6 +24161,11 @@ to fail. This option may be removed at a later date.
Disable all message-translation facilities.
This is usually not desirable, but it may bring you some slight performance
improvement.
+
+@cindex @code{--disable-directories-fatal} configuration option
+@cindex configuration option, @code{--disable-directories-fatal}
+@item --disable-directories-fatal
+Causes @command{gawk} to silently skip directories named on the command line.
@end table
As of version 3.1.5, the @option{--with-included-gettext} configuration
@@ -24084,7 +24308,7 @@ under Unix.
If these steps do not work, please send in a bug report
(@pxref{Bugs}).
-@c Rewritten by Scott Deifik <scottd@amgen.com>
+@c Rewritten by Scott Deifik <scottd.mail@sbcglobal.net>
@c and Darrel Hankerson <hankedr@mail.auburn.edu>
@node PC Installation
@@ -24508,6 +24732,7 @@ This @value{SUBSECTION} describes how to compile and install @command{gawk} unde
* VMS Installation Details:: How to install @command{gawk} under VMS.
* VMS Running:: How to run @command{gawk} under VMS.
* VMS POSIX:: Alternate instructions for VMS POSIX.
+* VMS Old Gawk:: An old version comes with some VMS systems.
@end menu
@node VMS Compilation
@@ -24674,6 +24899,21 @@ Once built, @command{gawk} works like any other shell utility. Unlike
the normal VMS port of @command{gawk}, no special command-line manipulation is
needed in the VMS POSIX environment.
+@node VMS Old Gawk
+@appendixsubsubsec Some VMS Systems Have An Old Version of @command{gawk}
+
+@c Thanks to "gerard labadie" <gerard.labadie@gmail.com>
+
+Some versions of VMS have an old version of @command{gawk}. To access it,
+define a symbol, as follows:
+
+@example
+$ @kbd{gawk :== $ sys$common:[syshlp.examples.tcpip.snmp]gawk.exe}
+@end example
+
+This is apparently @value{PVERSION} 2.15.6, which is quite old. We
+recommend compiling and using the current version.
+
@node Unsupported
@appendixsec Unsupported Operating System Ports
@@ -24891,7 +25131,7 @@ Please include the version number of @command{gawk} you are using.
You can get this information with the command @samp{gawk --version}.
Using this address automatically sends a carbon copy of your
mail to me. If necessary, I can be reached directly at
-@email{arnold@@gnu.org}. The bug reporting address is preferred since the
+@email{arnold@@skeeve.com}. The bug reporting address is preferred since the
email list is archived at the GNU Project.
@emph{All email should be in English, since that is my native language.}
@@ -24930,7 +25170,7 @@ Martin Brown, @email{mc@@whoever.com}.
@cindex Deifik, Scott
@cindex Hankerson, Darrel
@item MS-DOS
-Scott Deifik, @email{scottd@@amgen.com} and
+Scott Deifik, @email{scottd.mail@@sbcglobal.net} and
Darrel Hankerson, @email{hankedr@@mail.auburn.edu}.
@cindex Grigera, Juan
@@ -24959,7 +25199,7 @@ Pat Rankin, @email{rankin@@pactechdata.com}.
@cindex Deifik, Scott
@cindex Hankerson, Darrel
-@item MS-DOS @tab Scott Deifik, @email{scottd@@amgen.com} and
+@item MS-DOS @tab Scott Deifik, @email{scottd.mail@@sbcglobal.net} and
Darrel Hankerson, @email{hankedr@@mail.auburn.edu}.
@cindex Grigera, Juan
@@ -24997,7 +25237,7 @@ Date: Wed, 4 Sep 1996 08:11:48 -0700 (PDT)
Michael Brennan
@end quotation
-There are three other freely available @command{awk} implementations.
+There are a number of other freely available @command{awk} implementations.
This @value{SECTION} briefly describes where to get them:
@table @asis
@@ -25124,6 +25364,27 @@ profiling. You may find it at either
or
@uref{http://www.math.utah.edu/pub/pawk/pawk-20020210.tar.gz}.
+@cindex OpenSolaris
+@cindex Solaris, POSIX compliant @command{awk}
+@item The OpenSolaris POSIX @command{awk}
+The version of @command{awk} in @file{/usr/xpg4/bin} on Solaris is
+POSIX compliant. It is based on the @command{awk} from Mortice Kern
+Systems for PCs. The source code can be downloaded from
+the OpenSolaris web site.@footnote{@uref{http://www.opensolaris.org}}
+This author was able to make it compile and work under GNU/Linux
+with 1--2 hours of work. Making it more generally portable (using
+GNU Autoconf and/or Automake) would take more work, and this
+has not been done, at least to our knowledge.
+
+@cindex @command{jawk}
+@cindex Java implementation of @command{awk}
+@item @command{jawk}
+This is an interpreter for @command{awk} written in Java. It claims
+to be a full interpreter, although because it uses Java facilities
+for I/O and for regexp matching, the language it supports is different
+from POSIX @command{awk}. More information is available on the
+project's home page.@footnote{@uref{http://jawk.sourceforge.net}}.
+
@end table
@c ENDOFRANGE gligawk
@c ENDOFRANGE ingawk
@@ -25406,9 +25667,10 @@ A number of the files that come with @command{gawk} are maintained by other
people at the Free Software Foundation. Thus, you should not change them
unless it is for a very good reason; i.e., changes are not out of the
question, but changes to these files are scrutinized extra carefully.
-The files are @file{getopt.h}, @file{getopt.c},
-@file{getopt1.c}, @file{regex.h}, @file{regex.c}, @file{dfa.h},
-@file{dfa.c}, @file{install-sh}, and @file{mkinstalldirs}.
+The files are @file{getopt.h}, @file{getopt.c}, @file{getopt1.c},
+@file{regex.h}, @file{regex.c}, @file{regcomp.c}, @file{regex_internal.c},
+@file{regex_internal.h}, @file{regexec.c}, @file{dfa.h}, @file{dfa.c},
+@file{install-sh}, and @file{mkinstalldirs}.
@item
Be willing to continue to maintain the port.
@@ -25503,7 +25765,7 @@ at some future time.
@strong{Caution:} If you have written your own dynamic extensions,
be sure to recompile them for each new @command{gawk} release.
There is no guarantee of binary compatibility between different
-releases, no will there ever be such a guarantee.
+releases, nor will there ever be such a guarantee.
@menu
* Internals:: A brief look at some @command{gawk} internals.
@@ -26822,6 +27084,16 @@ Computer Scientist Should Know About Floating-point Arithmetic,''
This is worth reading if you are interested in the details,
but it does require a background in computer science.
+@menu
+* String Conversion Precision:: The String Value Can Lie.
+* Unexpected Results:: Floating Point Numbers Are Not
+ Abstract Numbers.
+* POSIX Floating Point Problems:: Standards Versus Existing Practice.
+@end menu
+
+@node String Conversion Precision
+@appendixsubsec The String Value Can Lie
+
Internally, @command{awk} keeps both the numeric value
(double-precision floating-point) and the string value for a variable.
Separately, @command{awk} keeps
@@ -26875,6 +27147,9 @@ On most modern machines, most of the time,
value exactly.@footnote{Pathological cases can require up to
752 digits (!), but we doubt that you need to worry about this.}
+@node Unexpected Results
+@appendixsubsec Floating Point Numbers Are Not Abstract Numbers
+
@cindex floating-point
Unlike numbers in the abstract sense (such as what you studied in high school
or college math), numbers stored in computers are limited in certain ways.
@@ -26927,6 +27202,101 @@ $ gawk 'BEGIN @{ mz = -0 ; pz = 0
It helps to keep this in mind should you process numeric data
that contains negative zero values; the fact that the zero is negative
is noted and can affect comparisons.
+
+@node POSIX Floating Point Problems
+@appendixsubsec Standards Versus Existing Practice
+
+Historically, @command{awk} has converted any non-numeric looking string
+to the numeric value zero, when required. Furthermore, the original
+definition of the language and the original POSIX standards specified that
+@command{awk} only understands decimal numbers (base 10), and not octal
+(base 8) or hexadecimal numbers (base 16).
+
+As of this writing (February, 2007), changes in the language of the
+current POSIX standard can be interpreted to imply that @command{awk}
+should support additional features. These features are:
+
+@itemize @bullet
+@item
+Interpretation of floating point data values specified in hexadecimal
+notation (@samp{0xDEADBEEF}). (Note: data values, @emph{not}
+source code constants.)
+
+@item
+Support for the special IEEE 754 floating point values ``Not A Number''
+(NaN), positive Infinity (``inf'') and negative Infinity (``@minus{}inf'').
+In particular, the format for these values is as specified by the ISO C99
+standard, which ignores case and can allow machine-dependent additional
+characters after the @samp{nan} and allow either @samp{inf} or @samp{infinity}.
+@end itemize
+
+The first problem is that both of these are clear changes to historical
+practice:
+
+@itemize @bullet
+@item
+The @command{gawk} maintainer feels that hexadecimal floating
+point values, in particular, is ugly, and was never intended by the
+original designers to be part of the language.
+
+@item
+Allowing completely alphabetic strings to have valid numeric
+values is also a very severe departure from historical practice.
+@end itemize
+
+The second problem is that the @code{gawk} maintainer feels that this
+interpretation of the standard, which requires a certain amount of
+``language lawyering'' to arrive at in the first place, was not intended
+by the standard developers, either. In other words, ``we see how you
+got where you are, but we don't think that that's where you want to be.''
+
+Nevertheless, on systems that support IEEE floating point, it seems
+reasonable to provide @emph{some} way to support NaN and Infinity values.
+The solution implemented in @command{gawk}, as of version 3.1.6, is
+as follows:
+
+@enumerate 1
+@item
+With the @option{--posix} command-line option, @command{gawk} becomes
+``hands off.'' String values are passed directly to the system library's
+@code{strtod()} function, and if it successfuly returns a numeric value,
+that is what's used. By definition, the results are not portable across
+different systems.@footnote{You asked for it, you got it.}
+They are also a little surprising:
+
+@example
+$ @kbd{echo nanny | gawk --posix '@{ print $1 + 0 @}'}
+@print{} nan
+$ @kbd{echo 0xDeadBeef | gawk --posix '@{ print $1 + 0 @}'}
+@print{} 3735928559
+@end example
+
+@item
+Without @option{--posix}, @command{gawk} interprets the four strings
+@samp{+inf},
+@samp{-inf},
+@samp{+nan},
+and
+@samp{-nan}
+specially, producing the corresponding special numeric values.
+The leading sign acts a signal to @command{gawk} (and the user)
+that the value is really numeric. Hexadecimal floating point is
+not supported (unless you also use @option{--non-decimal-data},
+which is @emph{not} recommended). For example:
+
+@example
+$ @kbd{echo nanny | gawk '@{ print $1 + 0 @}'}
+@print{} 0
+$ @kbd{echo +nan | gawk '@{ print $1 + 0 @}'}
+@print{} nan
+$ @kbd{echo 0xDeadBeef | gawk '@{ print $1 + 0 @}'}
+@print{} 0
+@end example
+
+@command{gawk} does ignore case distinction in the four special values.
+Thus @samp{+nan} and @samp{+NaN} are the same.
+@end enumerate
+
@c ENDOFRANGE procon
@node Glossary
@@ -27380,6 +27750,13 @@ meaning. Keywords are reserved and may not be used as variable names.
@code{func},
and
@code{exit}.
+If @command{gawk} was configured with the @option{--enable-switch}
+option (@pxref{Switch Statement}), then
+@code{switch},
+@code{case},
+and
+@code{default}
+are also keywords.
@cindex LGPL (Lesser General Public License)
@cindex Lesser General Public License (LGPL)
@@ -27619,406 +27996,729 @@ A sequence of space, TAB, or newline characters occurring inside an input
record or a string.
@end table
+@c The GNU General Public License.
@node Copying
@unnumbered GNU General Public License
-@center Version 2, June 1991
+@center Version 3, 29 June 2007
+
+@c This file is intended to be included within another document,
+@c hence no sectioning command or @node.
@display
-Copyright @copyright{} 1989, 1991 Free Software Foundation, Inc.
-51 Franklin Street, Fifth Floor, Boston, MA 02111, USA
+Copyright @copyright{} 2007 Free Software Foundation, Inc. @url{http://fsf.org/}
-Everyone is permitted to copy and distribute verbatim copies
-of this license document, but changing it is not allowed.
+Everyone is permitted to copy and distribute verbatim copies of this
+license document, but changing it is not allowed.
@end display
@c fakenode --- for prepinfo
-@unnumberedsec Preamble
-
- The licenses for most software are designed to take away your
-freedom to share and change it. By contrast, the GNU General Public
-License is intended to guarantee your freedom to share and change free
-software---to make sure the software is free for all its users. This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it. (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.) You can apply it to
-your programs, too.
-
- When we speak of free software, we are referring to freedom, not
+@heading Preamble
+
+The GNU General Public License is a free, copyleft license for
+software and other kinds of works.
+
+The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works. By contrast,
+the GNU General Public License is intended to guarantee your freedom
+to share and change all versions of a program---to make sure it remains
+free software for all its users. We, the Free Software Foundation,
+use the GNU General Public License for most of our software; it
+applies also to any other work released this way by its authors. You
+can apply it to your programs, too.
+
+When we speak of free software, we are referring to freedom, not
price. Our General Public Licenses are designed to make sure that you
have the freedom to distribute copies of free software (and charge for
-this service if you wish), that you receive source code or can get it
-if you want it, that you can change the software or use pieces of it
-in new free programs; and that you know you can do these things.
-
- To protect your rights, we need to make restrictions that forbid
-anyone to deny you these rights or to ask you to surrender the rights.
-These restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
-
- For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must give the recipients all the rights that
-you have. You must make sure that they, too, receive or can get the
-source code. And you must show them these terms so they know their
-rights.
-
- We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
-
- Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software. If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
-
- Finally, any free program is threatened constantly by software
-patents. We wish to avoid the danger that redistributors of a free
-program will individually obtain patent licenses, in effect making the
-program proprietary. To prevent this, we have made it clear that any
-patent must be licensed for everyone's free use or not licensed at all.
-
- The precise terms and conditions for copying, distribution and
+them if you wish), that you receive source code or can get it if you
+want it, that you can change the software or use pieces of it in new
+free programs, and that you know you can do these things.
+
+To protect your rights, we need to prevent others from denying you
+these rights or asking you to surrender the rights. Therefore, you
+have certain responsibilities if you distribute copies of the
+software, or if you modify it: responsibilities to respect the freedom
+of others.
+
+For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must pass on to the recipients the same
+freedoms that you received. You must make sure that they, too,
+receive or can get the source code. And you must show them these
+terms so they know their rights.
+
+Developers that use the GNU GPL protect your rights with two steps:
+(1) assert copyright on the software, and (2) offer you this License
+giving you legal permission to copy, distribute and/or modify it.
+
+For the developers' and authors' protection, the GPL clearly explains
+that there is no warranty for this free software. For both users' and
+authors' sake, the GPL requires that modified versions be marked as
+changed, so that their problems will not be attributed erroneously to
+authors of previous versions.
+
+Some devices are designed to deny users access to install or run
+modified versions of the software inside them, although the
+manufacturer can do so. This is fundamentally incompatible with the
+aim of protecting users' freedom to change the software. The
+systematic pattern of such abuse occurs in the area of products for
+individuals to use, which is precisely where it is most unacceptable.
+Therefore, we have designed this version of the GPL to prohibit the
+practice for those products. If such problems arise substantially in
+other domains, we stand ready to extend this provision to those
+domains in future versions of the GPL, as needed to protect the
+freedom of users.
+
+Finally, every program is threatened constantly by software patents.
+States should not allow patents to restrict development and use of
+software on general-purpose computers, but in those that do, we wish
+to avoid the special danger that patents applied to a free program
+could make it effectively proprietary. To prevent this, the GPL
+assures that patents cannot be used to render the program non-free.
+
+The precise terms and conditions for copying, distribution and
modification follow.
-@ifnotinfo
@c fakenode --- for prepinfo
-@unnumberedsec Terms and Conditions for Copying, Distribution and Modification
-@end ifnotinfo
-@ifinfo
-@center TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-@end ifinfo
+@heading TERMS AND CONDITIONS
@enumerate 0
-@item
-This License applies to any program or other work which contains
-a notice placed by the copyright holder saying it may be distributed
-under the terms of this General Public License. The ``Program'', below,
-refers to any such program or work, and a ``work based on the Program''
-means either the Program or any derivative work under copyright law:
-that is to say, a work containing the Program or a portion of it,
-either verbatim or with modifications and/or translated into another
-language. (Hereinafter, translation is included without limitation in
-the term ``modification''.) Each licensee is addressed as ``you''.
-
-Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope. The act of
-running the Program is not restricted, and the output from the Program
-is covered only if its contents constitute a work based on the
-Program (independent of having been made by running the Program).
-Whether that is true depends on what the Program does.
-
-@item
-You may copy and distribute verbatim copies of the Program's
-source code as you receive it, in any medium, provided that you
-conspicuously and appropriately publish on each copy an appropriate
-copyright notice and disclaimer of warranty; keep intact all the
-notices that refer to this License and to the absence of any warranty;
-and give any other recipients of the Program a copy of this License
-along with the Program.
-
-You may charge a fee for the physical act of transferring a copy, and
-you may at your option offer warranty protection in exchange for a fee.
-
-@item
-You may modify your copy or copies of the Program or any portion
-of it, thus forming a work based on the Program, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
+@item Definitions.
+
+``This License'' refers to version 3 of the GNU General Public License.
+
+``Copyright'' also means copyright-like laws that apply to other kinds
+of works, such as semiconductor masks.
+
+``The Program'' refers to any copyrightable work licensed under this
+License. Each licensee is addressed as ``you''. ``Licensees'' and
+``recipients'' may be individuals or organizations.
+
+To ``modify'' a work means to copy from or adapt all or part of the work
+in a fashion requiring copyright permission, other than the making of
+an exact copy. The resulting work is called a ``modified version'' of
+the earlier work or a work ``based on'' the earlier work.
+
+A ``covered work'' means either the unmodified Program or a work based
+on the Program.
+
+To ``propagate'' a work means to do anything with it that, without
+permission, would make you directly or secondarily liable for
+infringement under applicable copyright law, except executing it on a
+computer or modifying a private copy. Propagation includes copying,
+distribution (with or without modification), making available to the
+public, and in some countries other activities as well.
+
+To ``convey'' a work means any kind of propagation that enables other
+parties to make or receive copies. Mere interaction with a user
+through a computer network, with no transfer of a copy, is not
+conveying.
+
+An interactive user interface displays ``Appropriate Legal Notices'' to
+the extent that it includes a convenient and prominently visible
+feature that (1) displays an appropriate copyright notice, and (2)
+tells the user that there is no warranty for the work (except to the
+extent that warranties are provided), that licensees may convey the
+work under this License, and how to view a copy of this License. If
+the interface presents a list of user commands or options, such as a
+menu, a prominent item in the list meets this criterion.
+
+@item Source Code.
+
+The ``source code'' for a work means the preferred form of the work for
+making modifications to it. ``Object code'' means any non-source form
+of a work.
+
+A ``Standard Interface'' means an interface that either is an official
+standard defined by a recognized standards body, or, in the case of
+interfaces specified for a particular programming language, one that
+is widely used among developers working in that language.
+
+The ``System Libraries'' of an executable work include anything, other
+than the work as a whole, that (a) is included in the normal form of
+packaging a Major Component, but which is not part of that Major
+Component, and (b) serves only to enable use of the work with that
+Major Component, or to implement a Standard Interface for which an
+implementation is available to the public in source code form. A
+``Major Component'', in this context, means a major essential component
+(kernel, window system, and so on) of the specific operating system
+(if any) on which the executable work runs, or a compiler used to
+produce the work, or an object code interpreter used to run it.
+
+The ``Corresponding Source'' for a work in object code form means all
+the source code needed to generate, install, and (for an executable
+work) run the object code and to modify the work, including scripts to
+control those activities. However, it does not include the work's
+System Libraries, or general-purpose tools or generally available free
+programs which are used unmodified in performing those activities but
+which are not part of the work. For example, Corresponding Source
+includes interface definition files associated with source files for
+the work, and the source code for shared libraries and dynamically
+linked subprograms that the work is specifically designed to require,
+such as by intimate data communication or control flow between those
+subprograms and other parts of the work.
+
+The Corresponding Source need not include anything that users can
+regenerate automatically from other parts of the Corresponding Source.
+
+The Corresponding Source for a work in source code form is that same
+work.
+
+@item Basic Permissions.
+
+All rights granted under this License are granted for the term of
+copyright on the Program, and are irrevocable provided the stated
+conditions are met. This License explicitly affirms your unlimited
+permission to run the unmodified Program. The output from running a
+covered work is covered by this License only if the output, given its
+content, constitutes a covered work. This License acknowledges your
+rights of fair use or other equivalent, as provided by copyright law.
+
+You may make, run and propagate covered works that you do not convey,
+without conditions so long as your license otherwise remains in force.
+You may convey covered works to others for the sole purpose of having
+them make modifications exclusively for you, or provide you with
+facilities for running those works, provided that you comply with the
+terms of this License in conveying all material for which you do not
+control copyright. Those thus making or running the covered works for
+you must do so exclusively on your behalf, under your direction and
+control, on terms that prohibit them from making any copies of your
+copyrighted material outside their relationship with you.
+
+Conveying under any other circumstances is permitted solely under the
+conditions stated below. Sublicensing is not allowed; section 10
+makes it unnecessary.
+
+@item Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+No covered work shall be deemed part of an effective technological
+measure under any applicable law fulfilling obligations under article
+11 of the WIPO copyright treaty adopted on 20 December 1996, or
+similar laws prohibiting or restricting circumvention of such
+measures.
+
+When you convey a covered work, you waive any legal power to forbid
+circumvention of technological measures to the extent such
+circumvention is effected by exercising rights under this License with
+respect to the covered work, and you disclaim any intention to limit
+operation or modification of the work as a means of enforcing, against
+the work's users, your or third parties' legal rights to forbid
+circumvention of technological measures.
+
+@item Conveying Verbatim Copies.
+
+You may convey verbatim copies of the Program's source code as you
+receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice;
+keep intact all notices stating that this License and any
+non-permissive terms added in accord with section 7 apply to the code;
+keep intact all notices of the absence of any warranty; and give all
+recipients a copy of this License along with the Program.
+
+You may charge any price or no price for each copy that you convey,
+and you may offer support or warranty protection for a fee.
+
+@item Conveying Modified Source Versions.
+
+You may convey a work based on the Program, or the modifications to
+produce it from the Program, in the form of source code under the
+terms of section 4, provided that you also meet all of these
+conditions:
@enumerate a
+@item
+The work must carry prominent notices stating that you modified it,
+and giving a relevant date.
+
@item
-You must cause the modified files to carry prominent notices
-stating that you changed the files and the date of any change.
+The work must carry prominent notices stating that it is released
+under this License and any conditions added under section 7. This
+requirement modifies the requirement in section 4 to ``keep intact all
+notices''.
@item
-You must cause any work that you distribute or publish, that in
-whole or in part contains or is derived from the Program or any
-part thereof, to be licensed as a whole at no charge to all third
-parties under the terms of this License.
+You must license the entire work, as a whole, under this License to
+anyone who comes into possession of a copy. This License will
+therefore apply, along with any applicable section 7 additional terms,
+to the whole of the work, and all its parts, regardless of how they
+are packaged. This License gives no permission to license the work in
+any other way, but it does not invalidate such permission if you have
+separately received it.
@item
-If the modified program normally reads commands interactively
-when run, you must cause it, when started running for such
-interactive use in the most ordinary way, to print or display an
-announcement including an appropriate copyright notice and a
-notice that there is no warranty (or else, saying that you provide
-a warranty) and that users may redistribute the program under
-these conditions, and telling the user how to view a copy of this
-License. (Exception: if the Program itself is interactive but
-does not normally print such an announcement, your work based on
-the Program is not required to print an announcement.)
+If the work has interactive user interfaces, each must display
+Appropriate Legal Notices; however, if the Program has interactive
+interfaces that do not display Appropriate Legal Notices, your work
+need not make them do so.
@end enumerate
-These requirements apply to the modified work as a whole. If
-identifiable sections of that work are not derived from the Program,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works. But when you
-distribute the same sections as part of a whole which is a work based
-on the Program, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote it.
+A compilation of a covered work with other separate and independent
+works, which are not by their nature extensions of the covered work,
+and which are not combined with it such as to form a larger program,
+in or on a volume of a storage or distribution medium, is called an
+``aggregate'' if the compilation and its resulting copyright are not
+used to limit the access or legal rights of the compilation's users
+beyond what the individual works permit. Inclusion of a covered work
+in an aggregate does not cause this License to apply to the other
+parts of the aggregate.
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Program.
+@item Conveying Non-Source Forms.
-In addition, mere aggregation of another work not based on the Program
-with the Program (or with a work based on the Program) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
+You may convey a covered work in object code form under the terms of
+sections 4 and 5, provided that you also convey the machine-readable
+Corresponding Source under the terms of this License, in one of these
+ways:
+@enumerate a
@item
-You may copy and distribute the Program (or a work based on it,
-under Section 2) in object code or executable form under the terms of
-Sections 1 and 2 above provided that you also do one of the following:
+Convey the object code in, or embodied in, a physical product
+(including a physical distribution medium), accompanied by the
+Corresponding Source fixed on a durable physical medium customarily
+used for software interchange.
+
+@item
+Convey the object code in, or embodied in, a physical product
+(including a physical distribution medium), accompanied by a written
+offer, valid for at least three years and valid for as long as you
+offer spare parts or customer support for that product model, to give
+anyone who possesses the object code either (1) a copy of the
+Corresponding Source for all the software in the product that is
+covered by this License, on a durable physical medium customarily used
+for software interchange, for a price no more than your reasonable
+cost of physically performing this conveying of source, or (2) access
+to copy the Corresponding Source from a network server at no charge.
+
+@item
+Convey individual copies of the object code with a copy of the written
+offer to provide the Corresponding Source. This alternative is
+allowed only occasionally and noncommercially, and only if you
+received the object code with such an offer, in accord with subsection
+6b.
+
+@item
+Convey the object code by offering access from a designated place
+(gratis or for a charge), and offer equivalent access to the
+Corresponding Source in the same way through the same place at no
+further charge. You need not require recipients to copy the
+Corresponding Source along with the object code. If the place to copy
+the object code is a network server, the Corresponding Source may be
+on a different server (operated by you or a third party) that supports
+equivalent copying facilities, provided you maintain clear directions
+next to the object code saying where to find the Corresponding Source.
+Regardless of what server hosts the Corresponding Source, you remain
+obligated to ensure that it is available for as long as needed to
+satisfy these requirements.
+
+@item
+Convey the object code using peer-to-peer transmission, provided you
+inform other peers where the object code and Corresponding Source of
+the work are being offered to the general public at no charge under
+subsection 6d.
+
+@end enumerate
+
+A separable portion of the object code, whose source code is excluded
+from the Corresponding Source as a System Library, need not be
+included in conveying the object code work.
+
+A ``User Product'' is either (1) a ``consumer product'', which means any
+tangible personal property which is normally used for personal,
+family, or household purposes, or (2) anything designed or sold for
+incorporation into a dwelling. In determining whether a product is a
+consumer product, doubtful cases shall be resolved in favor of
+coverage. For a particular product received by a particular user,
+``normally used'' refers to a typical or common use of that class of
+product, regardless of the status of the particular user or of the way
+in which the particular user actually uses, or expects or is expected
+to use, the product. A product is a consumer product regardless of
+whether the product has substantial commercial, industrial or
+non-consumer uses, unless such uses represent the only significant
+mode of use of the product.
+
+``Installation Information'' for a User Product means any methods,
+procedures, authorization keys, or other information required to
+install and execute modified versions of a covered work in that User
+Product from a modified version of its Corresponding Source. The
+information must suffice to ensure that the continued functioning of
+the modified object code is in no case prevented or interfered with
+solely because modification has been made.
+
+If you convey an object code work under this section in, or with, or
+specifically for use in, a User Product, and the conveying occurs as
+part of a transaction in which the right of possession and use of the
+User Product is transferred to the recipient in perpetuity or for a
+fixed term (regardless of how the transaction is characterized), the
+Corresponding Source conveyed under this section must be accompanied
+by the Installation Information. But this requirement does not apply
+if neither you nor any third party retains the ability to install
+modified object code on the User Product (for example, the work has
+been installed in ROM).
+
+The requirement to provide Installation Information does not include a
+requirement to continue to provide support service, warranty, or
+updates for a work that has been modified or installed by the
+recipient, or for the User Product in which it has been modified or
+installed. Access to a network may be denied when the modification
+itself materially and adversely affects the operation of the network
+or violates the rules and protocols for communication across the
+network.
+
+Corresponding Source conveyed, and Installation Information provided,
+in accord with this section must be in a format that is publicly
+documented (and with an implementation available to the public in
+source code form), and must require no special password or key for
+unpacking, reading or copying.
+
+@item Additional Terms.
+
+``Additional permissions'' are terms that supplement the terms of this
+License by making exceptions from one or more of its conditions.
+Additional permissions that are applicable to the entire Program shall
+be treated as though they were included in this License, to the extent
+that they are valid under applicable law. If additional permissions
+apply only to part of the Program, that part may be used separately
+under those permissions, but the entire Program remains governed by
+this License without regard to the additional permissions.
+
+When you convey a copy of a covered work, you may at your option
+remove any additional permissions from that copy, or from any part of
+it. (Additional permissions may be written to require their own
+removal in certain cases when you modify the work.) You may place
+additional permissions on material, added by you to a covered work,
+for which you have or can give appropriate copyright permission.
+
+Notwithstanding any other provision of this License, for material you
+add to a covered work, you may (if authorized by the copyright holders
+of that material) supplement the terms of this License with terms:
@enumerate a
@item
-Accompany it with the complete corresponding machine-readable
-source code, which must be distributed under the terms of Sections
-1 and 2 above on a medium customarily used for software interchange; or,
+Disclaiming warranty or limiting liability differently from the terms
+of sections 15 and 16 of this License; or
@item
-Accompany it with a written offer, valid for at least three
-years, to give any third party, for a charge no more than your
-cost of physically performing source distribution, a complete
-machine-readable copy of the corresponding source code, to be
-distributed under the terms of Sections 1 and 2 above on a medium
-customarily used for software interchange; or,
+Requiring preservation of specified reasonable legal notices or author
+attributions in that material or in the Appropriate Legal Notices
+displayed by works containing it; or
@item
-Accompany it with the information you received as to the offer
-to distribute corresponding source code. (This alternative is
-allowed only for noncommercial distribution and only if you
-received the program in object code or executable form with such
-an offer, in accord with Subsection b above.)
-@end enumerate
+Prohibiting misrepresentation of the origin of that material, or
+requiring that modified versions of such material be marked in
+reasonable ways as different from the original version; or
-The source code for a work means the preferred form of the work for
-making modifications to it. For an executable work, complete source
-code means all the source code for all modules it contains, plus any
-associated interface definition files, plus the scripts used to
-control compilation and installation of the executable. However, as a
-special exception, the source code distributed need not include
-anything that is normally distributed (in either source or binary
-form) with the major components (compiler, kernel, and so on) of the
-operating system on which the executable runs, unless that component
-itself accompanies the executable.
-
-If distribution of executable or object code is made by offering
-access to copy from a designated place, then offering equivalent
-access to copy the source code from the same place counts as
-distribution of the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
-@item
-You may not copy, modify, sublicense, or distribute the Program
-except as expressly provided under this License. Any attempt
-otherwise to copy, modify, sublicense or distribute the Program is
-void, and will automatically terminate your rights under this License.
-However, parties who have received copies, or rights, from you under
-this License will not have their licenses terminated so long as such
-parties remain in full compliance.
+@item
+Limiting the use for publicity purposes of names of licensors or
+authors of the material; or
@item
-You are not required to accept this License, since you have not
-signed it. However, nothing else grants you permission to modify or
-distribute the Program or its derivative works. These actions are
-prohibited by law if you do not accept this License. Therefore, by
-modifying or distributing the Program (or any work based on the
-Program), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Program or works based on it.
+Declining to grant rights under trademark law for use of some trade
+names, trademarks, or service marks; or
@item
-Each time you redistribute the Program (or any work based on the
-Program), the recipient automatically receives a license from the
-original licensor to copy, distribute or modify the Program subject to
-these terms and conditions. You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties to
+Requiring indemnification of licensors and authors of that material by
+anyone who conveys the material (or modified versions of it) with
+contractual assumptions of liability to the recipient, for any
+liability that these contractual assumptions directly impose on those
+licensors and authors.
+@end enumerate
+
+All other non-permissive additional terms are considered ``further
+restrictions'' within the meaning of section 10. If the Program as you
+received it, or any part of it, contains a notice stating that it is
+governed by this License along with a term that is a further
+restriction, you may remove that term. If a license document contains
+a further restriction but permits relicensing or conveying under this
+License, you may add to a covered work material governed by the terms
+of that license document, provided that the further restriction does
+not survive such relicensing or conveying.
+
+If you add terms to a covered work in accord with this section, you
+must place, in the relevant source files, a statement of the
+additional terms that apply to those files, or a notice indicating
+where to find the applicable terms.
+
+Additional terms, permissive or non-permissive, may be stated in the
+form of a separately written license, or stated as exceptions; the
+above requirements apply either way.
+
+@item Termination.
+
+You may not propagate or modify a covered work except as expressly
+provided under this License. Any attempt otherwise to propagate or
+modify it is void, and will automatically terminate your rights under
+this License (including any patent licenses granted under the third
+paragraph of section 11).
+
+However, if you cease all violation of this License, then your license
+from a particular copyright holder is reinstated (a) provisionally,
+unless and until the copyright holder explicitly and finally
+terminates your license, and (b) permanently, if the copyright holder
+fails to notify you of the violation by some reasonable means prior to
+60 days after the cessation.
+
+Moreover, your license from a particular copyright holder is
+reinstated permanently if the copyright holder notifies you of the
+violation by some reasonable means, this is the first time you have
+received notice of violation of this License (for any work) from that
+copyright holder, and you cure the violation prior to 30 days after
+your receipt of the notice.
+
+Termination of your rights under this section does not terminate the
+licenses of parties who have received copies or rights from you under
+this License. If your rights have been terminated and not permanently
+reinstated, you do not qualify to receive new licenses for the same
+material under section 10.
+
+@item Acceptance Not Required for Having Copies.
+
+You are not required to accept this License in order to receive or run
+a copy of the Program. Ancillary propagation of a covered work
+occurring solely as a consequence of using peer-to-peer transmission
+to receive a copy likewise does not require acceptance. However,
+nothing other than this License grants you permission to propagate or
+modify any covered work. These actions infringe copyright if you do
+not accept this License. Therefore, by modifying or propagating a
+covered work, you indicate your acceptance of this License to do so.
+
+@item Automatic Licensing of Downstream Recipients.
+
+Each time you convey a covered work, the recipient automatically
+receives a license from the original licensors, to run, modify and
+propagate that work, subject to this License. You are not responsible
+for enforcing compliance by third parties with this License.
+
+An ``entity transaction'' is a transaction transferring control of an
+organization, or substantially all assets of one, or subdividing an
+organization, or merging organizations. If propagation of a covered
+work results from an entity transaction, each party to that
+transaction who receives a copy of the work also receives whatever
+licenses to the work the party's predecessor in interest had or could
+give under the previous paragraph, plus a right to possession of the
+Corresponding Source of the work from the predecessor in interest, if
+the predecessor has it or can get it with reasonable efforts.
+
+You may not impose any further restrictions on the exercise of the
+rights granted or affirmed under this License. For example, you may
+not impose a license fee, royalty, or other charge for exercise of
+rights granted under this License, and you may not initiate litigation
+(including a cross-claim or counterclaim in a lawsuit) alleging that
+any patent claim is infringed by making, using, selling, offering for
+sale, or importing the Program or any portion of it.
+
+@item Patents.
+
+A ``contributor'' is a copyright holder who authorizes use under this
+License of the Program or a work on which the Program is based. The
+work thus licensed is called the contributor's ``contributor version''.
+
+A contributor's ``essential patent claims'' are all patent claims owned
+or controlled by the contributor, whether already acquired or
+hereafter acquired, that would be infringed by some manner, permitted
+by this License, of making, using, or selling its contributor version,
+but do not include claims that would be infringed only as a
+consequence of further modification of the contributor version. For
+purposes of this definition, ``control'' includes the right to grant
+patent sublicenses in a manner consistent with the requirements of
this License.
-@item
-If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
+Each contributor grants you a non-exclusive, worldwide, royalty-free
+patent license under the contributor's essential patent claims, to
+make, use, sell, offer for sale, import and otherwise run, modify and
+propagate the contents of its contributor version.
+
+In the following three paragraphs, a ``patent license'' is any express
+agreement or commitment, however denominated, not to enforce a patent
+(such as an express permission to practice a patent or covenant not to
+sue for patent infringement). To ``grant'' such a patent license to a
+party means to make such an agreement or commitment not to enforce a
+patent against the party.
+
+If you convey a covered work, knowingly relying on a patent license,
+and the Corresponding Source of the work is not available for anyone
+to copy, free of charge and under the terms of this License, through a
+publicly available network server or other readily accessible means,
+then you must either (1) cause the Corresponding Source to be so
+available, or (2) arrange to deprive yourself of the benefit of the
+patent license for this particular work, or (3) arrange, in a manner
+consistent with the requirements of this License, to extend the patent
+license to downstream recipients. ``Knowingly relying'' means you have
+actual knowledge that, but for the patent license, your conveying the
+covered work in a country, or your recipient's use of the covered work
+in a country, would infringe one or more identifiable patents in that
+country that you have reason to believe are valid.
+
+If, pursuant to or in connection with a single transaction or
+arrangement, you convey, or propagate by procuring conveyance of, a
+covered work, and grant a patent license to some of the parties
+receiving the covered work authorizing them to use, propagate, modify
+or convey a specific copy of the covered work, then the patent license
+you grant is automatically extended to all recipients of the covered
+work and works based on it.
+
+A patent license is ``discriminatory'' if it does not include within the
+scope of its coverage, prohibits the exercise of, or is conditioned on
+the non-exercise of one or more of the rights that are specifically
+granted under this License. You may not convey a covered work if you
+are a party to an arrangement with a third party that is in the
+business of distributing software, under which you make payment to the
+third party based on the extent of your activity of conveying the
+work, and under which the third party grants, to any of the parties
+who would receive the covered work from you, a discriminatory patent
+license (a) in connection with copies of the covered work conveyed by
+you (or copies made from those copies), or (b) primarily for and in
+connection with specific products or compilations that contain the
+covered work, unless you entered into that arrangement, or that patent
+license was granted, prior to 28 March 2007.
+
+Nothing in this License shall be construed as excluding or limiting
+any implied license or other defenses to infringement that may
+otherwise be available to you under applicable patent law.
+
+@item No Surrender of Others' Freedom.
+
+If conditions are imposed on you (whether by court order, agreement or
otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Program at all. For example, if a patent
-license would not permit royalty-free redistribution of the Program by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Program.
-
-If any portion of this section is held invalid or unenforceable under
-any particular circumstance, the balance of the section is intended to
-apply and the section as a whole is intended to apply in other
-circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system, which is
-implemented by public license practices. Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
-@item
-If the distribution and/or use of the Program is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Program under this License
-may add an explicit geographical distribution limitation excluding
-those countries, so that distribution is permitted only in or among
-countries not thus excluded. In such case, this License incorporates
-the limitation as if written in the body of this License.
+excuse you from the conditions of this License. If you cannot convey
+a covered work so as to satisfy simultaneously your obligations under
+this License and any other pertinent obligations, then as a
+consequence you may not convey it at all. For example, if you agree
+to terms that obligate you to collect a royalty for further conveying
+from those to whom you convey the Program, the only way you could
+satisfy both those terms and this License would be to refrain entirely
+from conveying the Program.
+
+@item Use with the GNU Affero General Public License.
+
+Notwithstanding any other provision of this License, you have
+permission to link or combine any covered work with a work licensed
+under version 3 of the GNU Affero General Public License into a single
+combined work, and to convey the resulting work. The terms of this
+License will continue to apply to the part which is the covered work,
+but the special requirements of the GNU Affero General Public License,
+section 13, concerning interaction through a network will apply to the
+combination as such.
+
+@item Revised Versions of this License.
-@item
The Free Software Foundation may publish revised and/or new versions
-of the General Public License from time to time. Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
+of the GNU General Public License from time to time. Such new
+versions will be similar in spirit to the present version, but may
+differ in detail to address new problems or concerns.
Each version is given a distinguishing version number. If the Program
-specifies a version number of this License which applies to it and ``any
-later version'', you have the option of following the terms and conditions
-either of that version or of any later version published by the Free
-Software Foundation. If the Program does not specify a version number of
-this License, you may choose any version ever published by the Free Software
-Foundation.
-
-@item
-If you wish to incorporate parts of the Program into other free
-programs whose distribution conditions are different, write to the author
-to ask for permission. For software which is copyrighted by the Free
-Software Foundation, write to the Free Software Foundation; we sometimes
-make exceptions for this. Our decision will be guided by the two goals
-of preserving the free status of all derivatives of our free software and
-of promoting the sharing and reuse of software generally.
-
-@ifnotinfo
-@c fakenode --- for prepinfo
-@heading NO WARRANTY
-@end ifnotinfo
-@ifinfo
-@center NO WARRANTY
-@end ifinfo
-
-@item
-BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
-FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW@. EXCEPT WHEN
-OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
-PROVIDE THE PROGRAM ``AS IS'' WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
-OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
-MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE@. THE ENTIRE RISK AS
-TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU@. SHOULD THE
-PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
-REPAIR OR CORRECTION.
+specifies that a certain numbered version of the GNU General Public
+License ``or any later version'' applies to it, you have the option of
+following the terms and conditions either of that numbered version or
+of any later version published by the Free Software Foundation. If
+the Program does not specify a version number of the GNU General
+Public License, you may choose any version ever published by the Free
+Software Foundation.
+
+If the Program specifies that a proxy can decide which future versions
+of the GNU General Public License can be used, that proxy's public
+statement of acceptance of a version permanently authorizes you to
+choose that version for the Program.
+
+Later license versions may give you additional or different
+permissions. However, no additional obligations are imposed on any
+author or copyright holder as a result of your choosing to follow a
+later version.
+
+@item Disclaimer of Warranty.
+
+THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM ``AS IS'' WITHOUT
+WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT
+LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND
+PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE PROGRAM PROVE
+DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR OR
+CORRECTION.
+
+@item Limitation of Liability.
-@item
IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
-REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
-INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
-OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
-TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
-YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
-PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGES.
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR
+CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES
+ARISING OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT
+NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR
+LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM
+TO OPERATE WITH ANY OTHER PROGRAMS), EVEN IF SUCH HOLDER OR OTHER
+PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES.
+
+@item Interpretation of Sections 15 and 16.
+
+If the disclaimer of warranty and limitation of liability provided
+above cannot be given local legal effect according to their terms,
+reviewing courts shall apply local law that most closely approximates
+an absolute waiver of all civil liability in connection with the
+Program, unless a warranty or assumption of liability accompanies a
+copy of the Program in return for a fee.
+
@end enumerate
-@ifnotinfo
@c fakenode --- for prepinfo
@heading END OF TERMS AND CONDITIONS
-@end ifnotinfo
-@ifinfo
-@center END OF TERMS AND CONDITIONS
-@end ifinfo
-@page
@c fakenode --- for prepinfo
-@unnumberedsec How to Apply These Terms to Your New Programs
+@heading How to Apply These Terms to Your New Programs
- If you develop a new program, and you want it to be of the greatest
+If you develop a new program, and you want it to be of the greatest
possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
+free software which everyone can redistribute and change under these
+terms.
- To do so, attach the following notices to the program. It is safest
+To do so, attach the following notices to the program. It is safest
to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least
+state the exclusion of warranty; and each file should have at least
the ``copyright'' line and a pointer to where the full notice is found.
@smallexample
-@var{one line to give the program's name and an idea of what it does.}
-Copyright (C) @var{year} @var{name of author}
+@var{one line to give the program's name and a brief idea of what it does.}
+Copyright (C) @var{year} @var{name of author}
-This program is free software; you can redistribute it and/or
-modify it under the terms of the GNU General Public License
-as published by the Free Software Foundation; either version 2
-of the License, or (at your option) any later version.
+This program is free software: you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation, either version 3 of the License, or (at
+your option) any later version.
-This program is distributed in the hope that it will be useful,
-but WITHOUT ANY WARRANTY; without even the implied warranty of
-MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE@. See the
-GNU General Public License for more details.
+This program is distributed in the hope that it will be useful, but
+WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+General Public License for more details.
You should have received a copy of the GNU General Public License
-along with this program; if not, write to the Free Software
-Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02111, USA.
+along with this program. If not, see @url{http://www.gnu.org/licenses/}.
@end smallexample
Also add information on how to contact you by electronic and paper mail.
-If the program is interactive, make it output a short notice like this
-when it starts in an interactive mode:
+If the program does terminal interaction, make it output a short
+notice like this when it starts in an interactive mode:
@smallexample
-Gnomovision version 69, Copyright (C) @var{year} @var{name of author}
-Gnomovision comes with ABSOLUTELY NO WARRANTY; for details
-type `show w'. This is free software, and you are welcome
-to redistribute it under certain conditions; type `show c'
-for details.
+@var{program} Copyright (C) @var{year} @var{name of author}
+This program comes with ABSOLUTELY NO WARRANTY; for details type @samp{show w}.
+This is free software, and you are welcome to redistribute it
+under certain conditions; type @samp{show c} for details.
@end smallexample
The hypothetical commands @samp{show w} and @samp{show c} should show
-the appropriate parts of the General Public License. Of course, the
-commands you use may be called something other than @samp{show w} and
-@samp{show c}; they could even be mouse-clicks or menu items---whatever
-suits your program.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a ``copyright disclaimer'' for the program, if
-necessary. Here is a sample; alter the names:
-
-@smallexample
-@group
-Yoyodyne, Inc., hereby disclaims all copyright
-interest in the program `Gnomovision'
-(which makes passes at compilers) written
-by James Hacker.
-
-@var{signature of Ty Coon}, 1 April 1989
-Ty Coon, President of Vice
-@end group
-@end smallexample
-
-This General Public License does not permit incorporating your program into
-proprietary programs. If your program is a subroutine library, you may
-consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Lesser General
-Public License instead of this License.
+the appropriate parts of the General Public License. Of course, your
+program's commands might be different; for a GUI interface, you would
+use an ``about box''.
+
+You should also get your employer (if you work as a programmer) or school,
+if any, to sign a ``copyright disclaimer'' for the program, if necessary.
+For more information on this, and how to apply and follow the GNU GPL, see
+@url{http://www.gnu.org/licenses/}.
+
+The GNU General Public License does not permit incorporating your
+program into proprietary programs. If your program is a subroutine
+library, you may consider it more useful to permit linking proprietary
+applications with the library. If this is what you want to do, use
+the GNU Lesser General Public License instead of this License. But
+first, please read @url{http://www.gnu.org/philosophy/why-not-lgpl.html}.
@node GNU Free Documentation License
@unnumbered GNU Free Documentation License
@@ -28389,7 +29089,7 @@ permission from their copyright holders, but you may include
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License, and all the license notices in the
-Document, and any Warrany Disclaimers, provided that you also include
+Document, and any Warranty Disclaimers, provided that you also include
the original English version of this License and the original versions
of those notices and disclaimers. In case of a disagreement between
the translation and the original version of this License or a notice
diff --git a/doc/gawkinet.info b/doc/gawkinet.info
index 3c23e3c5..a496f6a2 100644
--- a/doc/gawkinet.info
+++ b/doc/gawkinet.info
@@ -1,12 +1,11 @@
-This is gawkinet.info, produced by makeinfo version 4.6 from
-gawkinet.texi.
-
INFO-DIR-SECTION Network applications
START-INFO-DIR-ENTRY
+This is gawkinet.info, produced by makeinfo version 4.11 from gawkinet.texi.
+
* Gawkinet: (gawkinet). TCP/IP Internetworking With `gawk'.
END-INFO-DIR-ENTRY
-This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
+ This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
3.1.4 (or later) version of the GNU implementation of AWK.
@@ -29,7 +28,7 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
This file documents the networking features in GNU `awk'.
-This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
+ This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
3.1.4 (or later) version of the GNU implementation of AWK.
@@ -59,7 +58,7 @@ General Introduction
This file documents the networking features in GNU Awk (`gawk') version
3.1 and later.
-This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
+ This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
3.1.4 (or later) version of the GNU implementation of AWK.
@@ -83,7 +82,7 @@ texts being (a) (see below), and with the Back-Cover Texts being (b)
* Menu:
* Preface:: About this document.
-* Introduction:: About networkiing.
+* Introduction:: About networking.
* Using Networking:: Some examples.
* Some Applications and Techniques:: More extended examples.
* Links:: Where to find the stuff mentioned in this
@@ -167,7 +166,7 @@ File: gawkinet.info, Node: Introduction, Next: Using Networking, Prev: Prefac
1 Networking Concepts
*********************
-This major node provides a (necessarily) brief intoduction to computer
+This major node provides a (necessarily) brief introduction to computer
networking concepts. For many applications of `gawk' to TCP/IP
networking, we hope that this is enough. For more advanced tasks, you
will need deeper background, and it may be necessary to switch to
@@ -301,7 +300,7 @@ IP
UDP
The User Datagram Protocol. This is a best effort datagram
protocol. It provides a small amount of extra reliability over
- IP, and adds the notion of "ports", described in *Note TCP and UDP
+ IP, and adds the notion of "ports", described in *note TCP and UDP
Ports: Ports.
TCP
@@ -394,8 +393,8 @@ the following table, where an "X" indicates that the given action
blocks.
TCP X X
-UDP X
-RAW X
+UDP X
+RAW X
---------- Footnotes ----------
@@ -460,7 +459,7 @@ File: gawkinet.info, Node: Gawk Special Files, Next: TCP Connecting, Prev: Us
==================================
The `|&' operator introduced in `gawk' 3.1 for use in communicating
-with a "coprocess" is described in *Note Two-way Communications With
+with a "coprocess" is described in *note Two-way Communications With
Another Process: (gawk)Two-way I/O. It shows how to do two-way I/O to a
separate process, sending it data with `print' or `printf' and reading
data with `getline'. If you haven't read it already, you should detour
@@ -487,10 +486,10 @@ fields, all of which are mandatory:
/inet/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT
-The `/inet/' field is, of course, constant when accessing the network.
-The LOCALPORT and REMOTEPORT fields do not have a meaning when used
-with `/inet/raw' because "ports" only apply to TCP and UDP. So, when
-using `/inet/raw', the port fields always have to be `0'.
+ The `/inet/' field is, of course, constant when accessing the
+network. The LOCALPORT and REMOTEPORT fields do not have a meaning
+when used with `/inet/raw' because "ports" only apply to TCP and UDP.
+So, when using `/inet/raw', the port fields always have to be `0'.
* Menu:
@@ -546,13 +545,13 @@ REMOTEPORT
Instead they specify a local port to which clients connect. It is
possible to use a name from `/etc/services' here.
-Experts in network programming will notice that the usual client/server
-asymmetry found at the level of the socket API is not visible here.
-This is for the sake of simplicity of the high-level concept. If this
-asymmetry is necessary for your application, use another language. For
-`gawk', it is more important to enable users to write a client program
-with a minimum of code. What happens when first accessing a network
-connection is seen in the following pseudocode:
+ Experts in network programming will notice that the usual
+client/server asymmetry found at the level of the socket API is not
+visible here. This is for the sake of simplicity of the high-level
+concept. If this asymmetry is necessary for your application, use
+another language. For `gawk', it is more important to enable users to
+write a client program with a minimum of code. What happens when first
+accessing a network connection is seen in the following pseudocode:
if ((name of remote host given) && (other side accepts connection)) {
rendez-vous successful; transmit with getline or print
@@ -566,54 +565,40 @@ connection is seen in the following pseudocode:
ready
}
-The exact behavior of this algorithm depends on the values of the
-fields of the special file name. When in doubt, *Note
+ The exact behavior of this algorithm depends on the values of the
+fields of the special file name. When in doubt, *note
table-inet-components:: gives you the combinations of values and their
meaning. If this table is too complicated, focus on the three lines
-printed in *bold*. All the examples in *Note Networking With `gawk':
+printed in *bold*. All the examples in *note Networking With `gawk':
Using Networking, use only the patterns printed in bold letters.
PROTOCOL LOCAL PORT HOST NAME REMOTE RESULTING CONNECTION-LEVEL
PORT BEHAVIOR
-------------------------------------------------------------------------------
+------------------------------------------------------------------------------
*tcp* *0* *x* *x* *Dedicated client, fails if
immediately connecting to a
server on the
other side fails*
-------------------------------------------------------------------------------
udp 0 x x Dedicated client
-------------------------------------------------------------------------------
raw 0 x 0 Dedicated client, works only
as `root'
-------------------------------------------------------------------------------
*tcp, udp* *x* *x* *x* *Client, switches to
dedicated server if
necessary*
-------------------------------------------------------------------------------
*tcp, udp* *x* *0* *0* *Dedicated server*
-------------------------------------------------------------------------------
raw 0 0 0 Dedicated server, works only
as `root'
-------------------------------------------------------------------------------
tcp, udp, x x 0 Invalid
-raw
-------------------------------------------------------------------------------
+raw
tcp, udp, 0 0 x Invalid
-raw
-------------------------------------------------------------------------------
+raw
tcp, udp, x 0 x Invalid
-raw
-------------------------------------------------------------------------------
+raw
tcp, udp 0 0 0 Invalid
-------------------------------------------------------------------------------
tcp, udp 0 x 0 Invalid
-------------------------------------------------------------------------------
raw x 0 0 Invalid
-------------------------------------------------------------------------------
raw 0 x x Invalid
-------------------------------------------------------------------------------
raw x x x Invalid
-------------------------------------------------------------------------------
Table 2.1: /inet Special File Components
@@ -654,7 +639,7 @@ sender program:
close("/inet/tcp/8888/0/0")
}
-The receiver is very simple:
+ The receiver is very simple:
# Client
BEGIN {
@@ -663,7 +648,7 @@ The receiver is very simple:
close("/inet/tcp/0/localhost/8888")
}
-TCP guarantees that the bytes arrive at the receiving end in exactly
+ TCP guarantees that the bytes arrive at the receiving end in exactly
the same order that they were sent. No byte is lost (except for broken
connections), doubled, or out of order. Some overhead is necessary to
accomplish this, but this is the price to pay for a reliable service.
@@ -688,7 +673,7 @@ started first:
close("/inet/udp/8888/0/0")
}
-The receiver is almost identical to the TCP receiver:
+ The receiver is almost identical to the TCP receiver:
# Client
BEGIN {
@@ -697,7 +682,7 @@ The receiver is almost identical to the TCP receiver:
close("/inet/udp/0/localhost/8888")
}
-UDP cannot guarantee that the datagrams at the receiving end will
+ UDP cannot guarantee that the datagrams at the receiving end will
arrive in exactly the same order they were sent. Some datagrams could be
lost, some doubled, and some out of order. But no overhead is necessary
to accomplish this. This unreliable behavior is good enough for tasks
@@ -716,7 +701,7 @@ case, the sender has to supply the encapsulating header bytes in front
of the packet and the receiver has to strip the additional bytes from
the message.
-RAW receivers cannot receive packets sent with TCP or UDP because the
+ RAW receivers cannot receive packets sent with TCP or UDP because the
operating system does not deliver the packets to a RAW receiver. The
operating system knows about some of the protocols on top of IP and
decides on its own which packet to deliver to which process. (d.c.)
@@ -724,7 +709,7 @@ Therefore, the UDP receiver must be used for receiving UDP datagrams
sent with the RAW sender. This is a dark corner, not only of `gawk',
but also of TCP/IP.
-For extended experimentation with protocols, look into the approach
+ For extended experimentation with protocols, look into the approach
implemented in a tool called SPAK. This tool reflects the hierarchical
layering of protocols (encapsulation) in the way data streams are piped
out of one program into the next one. It shows which protocol is based
@@ -733,9 +718,9 @@ ordering of the program calls. Cleverly thought out, SPAK is much
better than `gawk''s `/inet' for learning the meaning of each and every
bit in the protocol headers.
-The next example uses the RAW protocol to emulate the behavior of UDP.
-The sender program is the same as above, but with some additional bytes
-that fill the places of the UDP fields:
+ The next example uses the RAW protocol to emulate the behavior of
+UDP. The sender program is the same as above, but with some additional
+bytes that fill the places of the UDP fields:
BEGIN {
Message = "Hello world\n"
@@ -752,7 +737,7 @@ that fill the places of the UDP fields:
close(RawService)
}
-Since this program tries to emulate the behavior of UDP, it checks if
+ Since this program tries to emulate the behavior of UDP, it checks if
the RAW sender is understood by the UDP receiver but not if the RAW
receiver can understand the UDP sender. In a real network, the RAW
receiver is hardly of any use because it gets every IP packet that
@@ -761,15 +746,15 @@ would be too slow for processing them. Only on a network with little
traffic can the IP-level receiver program be tested. Programs for
analyzing IP traffic on modem or ISDN channels should be possible.
-Port numbers do not have a meaning when using `/inet/raw'. Their fields
-have to be `0'. Only TCP and UDP use ports. Receiving data from
+ Port numbers do not have a meaning when using `/inet/raw'. Their
+fields have to be `0'. Only TCP and UDP use ports. Receiving data from
`/inet/raw' is difficult, not only because of processing speed but also
because data is usually binary and not restricted to ASCII. This
implies that line separation with `RS' does not work as usual.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) This special file is reserved, but not otherwise currently
+ (1) This special file is reserved, but not otherwise currently
implemented.

@@ -789,7 +774,7 @@ the service `daytime' on the machine what time it is:
close("/inet/tcp/0/localhost/daytime")
}
-Even experienced `awk' users will find the second line strange in two
+ Even experienced `awk' users will find the second line strange in two
respects:
* A special file is used as a shell command that pipes its output
@@ -802,12 +787,12 @@ respects:
language needed (apart from the special files) to introduce
network access.
-The `|&' operator was introduced in `gawk' 3.1 in order to overcome the
-crucial restriction that access to files and pipes in `awk' is always
-unidirectional. It was formerly impossible to use both access modes on
-the same file or pipe. Instead of changing the whole concept of file
-access, the `|&' operator behaves exactly like the usual pipe operator
-except for two additions:
+ The `|&' operator was introduced in `gawk' 3.1 in order to overcome
+the crucial restriction that access to files and pipes in `awk' is
+always unidirectional. It was formerly impossible to use both access
+modes on the same file or pipe. Instead of changing the whole concept
+of file access, the `|&' operator behaves exactly like the usual pipe
+operator except for two additions:
* Normal shell commands connected to their `gawk' program with a `|&'
pipe can be accessed bidirectionally. The `|&' turns out to be a
@@ -817,7 +802,7 @@ except for two additions:
are not executed as shell commands. Instead, they can be read and
written to, just like a full-duplex network connection.
-In the earlier example, the `|&' operator tells `getline' to read a
+ In the earlier example, the `|&' operator tells `getline' to read a
line from the special file `/inet/tcp/0/localhost/daytime'. We could
also have printed a line into the special file. But instead we just
read a line with the time, printed it, and closed the connection.
@@ -879,27 +864,28 @@ a look at your `/etc/services' file. It could look like this:
irc 194/udp
...
-Here, you find a list of services that traditional Unix machines usually
-support. If your GNU/Linux machine does not do so, it may be that these
-services are switched off in some startup script. Systems running some
-flavor of Microsoft Windows usually do _not_ support these services.
-Nevertheless, it _is_ possible to do networking with `gawk' on Microsoft
-Windows.(1) The first column of the file gives the name of the service,
-and the second column gives a unique number and the protocol that one
-can use to connect to this service. The rest of the line is treated as
-a comment. You see that some services (`echo') support TCP as well as
-UDP.
-
----------- Footnotes ----------
-
-(1) Microsoft prefered to ignore the TCP/IP family of protocols until
-1995. Then came the rise of the Netscape browser as a landmark "killer
-application." Microsoft added TCP/IP support and their own browser to
-Microsoft Windows 95 at the last minute. They even back-ported their
-TCP/IP implementation to Microsoft Windows for Workgroups 3.11, but it
-was a rather rudimentary and half-hearted implementation. Nevertheless,
-the equivalent of `/etc/services' resides under
-`C:\WINNT\system32\drivers\etc\services' on Microsoft Windows 2000.
+ Here, you find a list of services that traditional Unix machines
+usually support. If your GNU/Linux machine does not do so, it may be
+that these services are switched off in some startup script. Systems
+running some flavor of Microsoft Windows usually do _not_ support these
+services. Nevertheless, it _is_ possible to do networking with `gawk'
+on Microsoft Windows.(1) The first column of the file gives the name of
+the service, and the second column gives a unique number and the
+protocol that one can use to connect to this service. The rest of the
+line is treated as a comment. You see that some services (`echo')
+support TCP as well as UDP.
+
+ ---------- Footnotes ----------
+
+ (1) Microsoft preferred to ignore the TCP/IP family of protocols
+until 1995. Then came the rise of the Netscape browser as a landmark
+"killer application." Microsoft added TCP/IP support and their own
+browser to Microsoft Windows 95 at the last minute. They even
+back-ported their TCP/IP implementation to Microsoft Windows for
+Workgroups 3.11, but it was a rather rudimentary and half-hearted
+implementation. Nevertheless, the equivalent of `/etc/services' resides
+under `C:\WINNT\system32\drivers\etc\services' on Microsoft Windows
+2000.

File: gawkinet.info, Node: Interacting, Next: Setting Up, Prev: Troubleshooting, Up: Using Networking
@@ -921,14 +907,14 @@ name in your local network:
close(NetService)
}
-After telling the service on the machine which user to look for, the
+ After telling the service on the machine which user to look for, the
program repeatedly reads lines that come as a reply. When no more lines
are coming (because the service has closed the connection), the program
also closes the connection. Try replacing `"NAME"' with your login name
(or the name of someone else logged in). For a list of all users
currently logged in, replace NAME with an empty string (`""').
-The final `close' command could be safely deleted from the above
+ The final `close' command could be safely deleted from the above
script, because the operating system closes any open connection by
default when a script reaches the end of execution. In order to avoid
portability problems, it is best to always close connections explicitly.
@@ -936,18 +922,18 @@ With the Linux kernel, for example, proper closing results in flushing
of buffers. Letting the close happen by default may result in
discarding buffers.
-When looking at `/etc/services' you may have noticed that the `daytime'
-service is also available with `udp'. In the earlier example, change
-`tcp' to `udp', and change `finger' to `daytime'. After starting the
-modified program, you see the expected day and time message. The
-program then hangs, because it waits for more lines coming from the
-service. However, they never come. This behavior is a consequence of the
-differences between TCP and UDP. When using UDP, neither party is
-automatically informed about the other closing the connection.
-Continuing to experiment this way reveals many other subtle differences
-between TCP and UDP. To avoid such trouble, one should always remember
-the advice Douglas E. Comer and David Stevens give in Volume III of
-their series `Internetworking With TCP' (page 14):
+ When looking at `/etc/services' you may have noticed that the
+`daytime' service is also available with `udp'. In the earlier example,
+change `tcp' to `udp', and change `finger' to `daytime'. After
+starting the modified program, you see the expected day and time
+message. The program then hangs, because it waits for more lines
+coming from the service. However, they never come. This behavior is a
+consequence of the differences between TCP and UDP. When using UDP,
+neither party is automatically informed about the other closing the
+connection. Continuing to experiment this way reveals many other subtle
+differences between TCP and UDP. To avoid such trouble, one should
+always remember the advice Douglas E. Comer and David Stevens give in
+Volume III of their series `Internetworking With TCP' (page 14):
When designing client-server applications, beginners are strongly
advised to use TCP because it provides reliable,
@@ -969,32 +955,32 @@ a server does not know in advance who is going to connect to it over
the network. Therefore, we cannot insert a name for the host to connect
to in our special file name.
-Start the following program in one window. Notice that the service does
-not have the name `daytime', but the number `8888'. From looking at
-`/etc/services', you know that names like `daytime' are just mnemonics
-for predetermined 16-bit integers. Only the system administrator
-(`root') could enter our new service into `/etc/services' with an
-appropriate name. Also notice that the service name has to be entered
-into a different field of the special file name because we are setting
-up a server, not a client:
+ Start the following program in one window. Notice that the service
+does not have the name `daytime', but the number `8888'. From looking
+at `/etc/services', you know that names like `daytime' are just
+mnemonics for predetermined 16-bit integers. Only the system
+administrator (`root') could enter our new service into `/etc/services'
+with an appropriate name. Also notice that the service name has to be
+entered into a different field of the special file name because we are
+setting up a server, not a client:
BEGIN {
print strftime() |& "/inet/tcp/8888/0/0"
close("/inet/tcp/8888/0/0")
}
-Now open another window on the same machine. Copy the client program
-given as the first example (*note Establishing a TCP Connection: TCP
-Connecting.) to a new file and edit it, changing the name `daytime' to
-`8888'. Then start the modified client. You should get a reply like
-this:
+ Now open another window on the same machine. Copy the client
+program given as the first example (*note Establishing a TCP
+Connection: TCP Connecting.) to a new file and edit it, changing the
+name `daytime' to `8888'. Then start the modified client. You should
+get a reply like this:
Sat Sep 27 19:08:16 CEST 1997
Both programs explicitly close the connection.
-Now we will intentionally make a mistake to see what happens when the
-name `8888' (the so-called port) is already used by another service.
+ Now we will intentionally make a mistake to see what happens when
+the name `8888' (the so-called port) is already used by another service.
Start the server program in both windows. The first one works, but the
second one complains that it could not open the connection. Each port
on a single machine can only be used by one server program at a time.
@@ -1008,7 +994,7 @@ running some flavor of Microsoft Windows, there is no restriction that
reserves ports 1 to 1024 for a privileged user; hence, you can start an
`echo' server there.
-Turning this short server program into something really useful is
+ Turning this short server program into something really useful is
simple. Imagine a server that first reads a file name from the client
through the network connection, then does something with the file and
sends a result back to the client. The server-side processing could be:
@@ -1042,7 +1028,7 @@ that communicate with your machine using special protocols. To receive
email, we will use the Post Office Protocol (POP). Sending can be done
with the much older Simple Mail Transfer Protocol (SMTP).
-When you type in the following program, replace the EMAILHOST by the
+ When you type in the following program, replace the EMAILHOST by the
name of your local email server. Ask your administrator if the server
has a POP service, and then use its name or number in the program below.
Now the program is ready to connect to your email server, but it will
@@ -1067,19 +1053,19 @@ the first email the server has in store:
close(POPService)
}
-The record separators `RS' and `ORS' are redefined because the protocol
-(POP) requires CR-LF to separate lines. After identifying yourself to
-the email service, the command `retr 1' instructs the service to send
-the first of all your email messages in line. If the service replies
-with something other than `+OK', the program exits; maybe there is no
-email. Otherwise, the program first announces that it intends to finish
-reading email, and then redefines `RS' in order to read the entire
-email as multiline input in one record. From the POP RFC, we know that
-the body of the email always ends with a single line containing a
-single dot. The program looks for this using `RS = "\r\n\\.\r\n"'.
-When it finds this sequence in the mail message, it quits. You can
-invoke this program as often as you like; it does not delete the
-message it reads, but instead leaves it on the server.
+ The record separators `RS' and `ORS' are redefined because the
+protocol (POP) requires CR-LF to separate lines. After identifying
+yourself to the email service, the command `retr 1' instructs the
+service to send the first of all your email messages in line. If the
+service replies with something other than `+OK', the program exits;
+maybe there is no email. Otherwise, the program first announces that it
+intends to finish reading email, and then redefines `RS' in order to
+read the entire email as multiline input in one record. From the POP
+RFC, we know that the body of the email always ends with a single line
+containing a single dot. The program looks for this using `RS =
+"\r\n\\.\r\n"'. When it finds this sequence in the mail message, it
+quits. You can invoke this program as often as you like; it does not
+delete the message it reads, but instead leaves it on the server.

File: gawkinet.info, Node: Web page, Next: Primitive Service, Prev: Email, Up: Using Networking
@@ -1095,12 +1081,12 @@ As in the preceding node, ask your administrator about the name of your
local web server or proxy web server and its port number for HTTP
requests.
-The following program employs a rather crude approach toward retrieving
-a web page. It uses the prehistoric syntax of HTTP 0.9, which almost all
-web servers still support. The most noticeable thing about it is that
-the program directs the request to the local proxy server whose name
-you insert in the special file name (which in turn calls
-`www.yahoo.com'):
+ The following program employs a rather crude approach toward
+retrieving a web page. It uses the prehistoric syntax of HTTP 0.9,
+which almost all web servers still support. The most noticeable thing
+about it is that the program directs the request to the local proxy
+server whose name you insert in the special file name (which in turn
+calls `www.yahoo.com'):
BEGIN {
RS = ORS = "\r\n"
@@ -1111,7 +1097,7 @@ you insert in the special file name (which in turn calls
close(HttpService)
}
-Again, lines are separated by a redefined `RS' and `ORS'. The `GET'
+ Again, lines are separated by a redefined `RS' and `ORS'. The `GET'
request that we send to the server is the only kind of HTTP request
that existed when the web was created in the early 1990s. HTTP calls
this `GET' request a "method," which tells the service to transmit a
@@ -1121,13 +1107,13 @@ HTTP is 1.1,(1) and knows the additional request methods `OPTIONS',
`PUT', `DELETE', and `TRACE'. You can fill in any valid web address,
and the program prints the HTML code of that page to your screen.
-Notice the similarity between the responses of the POP and HTTP
+ Notice the similarity between the responses of the POP and HTTP
services. First, you get a header that is terminated by an empty line,
and then you get the body of the page in HTML. The lines of the
headers also have the same form as in POP. There is the name of a
parameter, then a colon, and finally the value of that parameter.
-Images (`.png' or `.gif' files) can also be retrieved this way, but
+ Images (`.png' or `.gif' files) can also be retrieved this way, but
then you get binary data that should be redirected into a file. Another
application is calling a CGI (Common Gateway Interface) script on some
server. CGI scripts are used when the contents of a web page are not
@@ -1139,11 +1125,11 @@ following:
get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
print get |& HttpService
-You can also request weather reports this way.
+ You can also request weather reports this way.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was
+ (1) Version 1.0 of HTTP was defined in RFC 1945. HTTP 1.1 was
initially specified in RFC 2068. In June 1999, RFC 2068 was made
obsolete by RFC 2616, an update without any substantial changes.
@@ -1162,8 +1148,8 @@ number in the `localport' field of the special file name. The other two
fields (HOSTNAME and REMOTEPORT) have to contain a `0' because we do
not know in advance which host will connect to our service.
-In the early 1990s, all a server had to do was send an HTML document and
-close the connection. Here, we adhere to the modern syntax of HTTP.
+ In the early 1990s, all a server had to do was send an HTML document
+and close the connection. Here, we adhere to the modern syntax of HTTP.
The steps are as follows:
1. Send a status line telling the web browser that everything is okay.
@@ -1198,12 +1184,12 @@ The steps are as follows:
close(HttpService)
}
-Now, on the same machine, start your favorite browser and let it point
-to `http://localhost:8080' (the browser needs to know on which port our
-server is listening for requests). If this does not work, the browser
-probably tries to connect to a proxy server that does not know your
-machine. If so, change the browser's configuration so that the browser
-does not try to use a proxy to connect to your machine.
+ Now, on the same machine, start your favorite browser and let it
+point to `http://localhost:8080' (the browser needs to know on which
+port our server is listening for requests). If this does not work, the
+browser probably tries to connect to a proxy server that does not know
+your machine. If so, change the browser's configuration so that the
+browser does not try to use a proxy to connect to your machine.

File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Primitive Service, Up: Using Networking
@@ -1212,22 +1198,22 @@ File: gawkinet.info, Node: Interacting Service, Next: Simple Server, Prev: Pr
==================================
This node shows how to set up a simple web server. The subnode is a
-library file that we will use with all the examples in *Note Some
+library file that we will use with all the examples in *note Some
Applications and Techniques::.
* Menu:
* CGI Lib:: A simple CGI library.
-Setting up a web service that allows user interaction is more difficult
-and shows us the limits of network access in `gawk'. In this node, we
-develop a main program (a `BEGIN' pattern and its action) that will
-become the core of event-driven execution controlled by a graphical
-user interface (GUI). Each HTTP event that the user triggers by some
-action within the browser is received in this central procedure.
-Parameters and menu choices are extracted from this request, and an
-appropriate measure is taken according to the user's choice. For
-example:
+ Setting up a web service that allows user interaction is more
+difficult and shows us the limits of network access in `gawk'. In this
+node, we develop a main program (a `BEGIN' pattern and its action)
+that will become the core of event-driven execution controlled by a
+graphical user interface (GUI). Each HTTP event that the user triggers
+by some action within the browser is received in this central
+procedure. Parameters and menu choices are extracted from this request,
+and an appropriate measure is taken according to the user's choice.
+For example:
BEGIN {
if (MyHost == "") {
@@ -1274,7 +1260,7 @@ example:
}
}
-This web server presents menu choices in the form of HTML links.
+ This web server presents menu choices in the form of HTML links.
Therefore, it has to tell the browser the name of the host it is
residing on. When starting the server, the user may supply the name of
the host from the command line with `gawk -v MyHost="Rumpelstilzchen"'.
@@ -1283,7 +1269,7 @@ it is running on for later use as a web address in HTML documents. The
same applies to the port number. These values are inserted later into
the HTML content of the web pages to refer to the home system.
-Each server that is built around this core has to initialize some
+ Each server that is built around this core has to initialize some
application-dependent variables (such as the default home page) in a
procedure `SetUpServer', which is called immediately before entering the
infinite loop of the server. For now, we will write an instance that
@@ -1302,13 +1288,14 @@ in human-readable format or in seconds since 1970:
TopFooter = "</BODY></HTML>"
}
-On the first run through the main loop, the default line terminators are
-set and the default home page is copied to the actual home page. Since
-this is the first run, `GETARG["Method"]' is not initialized yet, hence
-the case selection over the method does nothing. Now that the home page
-is initialized, the server can start communicating to a client browser.
+ On the first run through the main loop, the default line terminators
+are set and the default home page is copied to the actual home page.
+Since this is the first run, `GETARG["Method"]' is not initialized yet,
+hence the case selection over the method does nothing. Now that the
+home page is initialized, the server can start communicating to a
+client browser.
-It does so by printing the HTTP header into the network connection
+ It does so by printing the HTTP header into the network connection
(`print ... |& HttpService'). This command blocks execution of the
server script until a client connects. If this server script is
compared with the primitive one we wrote before, you will notice two
@@ -1320,14 +1307,14 @@ the browser retrieves the time of day in the previous example just once,
and later it takes the web page from the cache, always displaying the
same time of day although time advances each second.
-Having supplied the initial home page to the browser with a valid
+ Having supplied the initial home page to the browser with a valid
document stored in the parameter `Prompt', it closes the connection and
waits for the next request. When the request comes, a log line is
printed that allows us to see which request the server receives. The
final step in the loop is to call the function `CGI_setup', which reads
all the lines of the request (coming from the browser), processes them,
and stores the transmitted parameters in the array `PARAM'. The complete
-text of these application-independent functions can be found in *Note A
+text of these application-independent functions can be found in *note A
Simple CGI Library: CGI Lib. For now, we use a simplified version of
`CGI_setup':
@@ -1351,8 +1338,8 @@ Simple CGI Library: CGI Lib. For now, we use a simplified version of
}
}
-At first, the function clears all variables used for global storage of
-request parameters. The rest of the function serves the purpose of
+ At first, the function clears all variables used for global storage
+of request parameters. The rest of the function serves the purpose of
filling the global parameters with the extracted new values. To
accomplish this, the name of the requested resource is split into parts
and stored for later evaluation. If the request contains a `?', then
@@ -1368,7 +1355,7 @@ working with the `POST' and `PUT' methods, reading the header and body
becomes inevitable. Header parameters should then be stored in a global
array as well as the body.
-On each subsequent run through the main loop, one request from a
+ On each subsequent run through the main loop, one request from a
browser is received, evaluated, and answered according to the user's
choice. This can be done by letting the value of the HTTP method guide
the main loop into execution of the procedure `HandleGET', which
@@ -1385,7 +1372,7 @@ names. Notice how simple it is to construct menus of arbitrary depth:
}
}
-The disadvantage of this approach is that our server is slow and can
+ The disadvantage of this approach is that our server is slow and can
handle only one request at a time. Its main advantage, however, is that
the server consists of just one `gawk' program. No need for installing
an `httpd', and no need for static separate HTML files, CGI scripts, or
@@ -1393,16 +1380,16 @@ an `httpd', and no need for static separate HTML files, CGI scripts, or
started on the same host that runs your browser. Then let your browser
point to `http://localhost:8080'.
-It is also possible to include images into the HTML pages. Most
+ It is also possible to include images into the HTML pages. Most
browsers support the not very well-known `.xbm' format, which may
contain only monochrome pictures but is an ASCII format. Binary images
are possible but not so easy to handle. Another way of including images
is to generate them with a tool such as GNUPlot, by calling the tool
with the `system' function or through a pipe.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) As defined in RFC 2068.
+ (1) As defined in RFC 2068.

File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interacting Service
@@ -1415,7 +1402,7 @@ File: gawkinet.info, Node: CGI Lib, Prev: Interacting Service, Up: Interactin
Phil Smith III,
`http://www.netfunny.com/rhf/jokes/99/Mar/http.html'
-In *Note A Web Service with Interaction: Interacting Service, we saw
+ In *note A Web Service with Interaction: Interacting Service, we saw
the function `CGI_setup' as part of the web server "core logic"
framework. The code presented there handles almost everything necessary
for CGI requests. One thing it doesn't do is handle encoded characters
@@ -1516,11 +1503,11 @@ is the code:
MENU[i] = _CGI_decode(MENU[i])
}
-This isolates details in a single function, `CGI_setup'. Decoding of
-encoded characters is pushed off to a helper function, `_CGI_decode'.
-The use of the leading underscore (`_') in the function name is
-intended to indicate that it is an "internal" function, although there
-is nothing to enforce this:
+ This isolates details in a single function, `CGI_setup'. Decoding
+of encoded characters is pushed off to a helper function,
+`_CGI_decode'. The use of the leading underscore (`_') in the function
+name is intended to indicate that it is an "internal" function,
+although there is nothing to enforce this:
function _CGI_decode(str, hexdigs, i, pre, code1, code2,
val, result)
@@ -1550,7 +1537,7 @@ is nothing to enforce this:
return result
}
-This works by splitting the string apart around an encoded character.
+ This works by splitting the string apart around an encoded character.
The two digits are converted to lowercase characters and looked up in a
string of hex digits. Note that `0' is not in the string on purpose;
`index' returns zero when it's not found, automatically giving the
@@ -1572,7 +1559,7 @@ above functions:
printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
}
-And this is the result when we run it:
+ And this is the result when we run it:
$ gawk -f testserv.awk
-| MENU["4"] = www.gnu.org
@@ -1603,11 +1590,11 @@ In this node, we finally extend the core to a real application. No one
would actually write a commercial web server in `gawk', but it is
instructive to see that it is feasible in principle.
-The application is ELIZA, the famous program by Joseph Weizenbaum that
-mimics the behavior of a professional psychotherapist when talking to
-you. Weizenbaum would certainly object to this description, but this
-is part of the legend around ELIZA. Take the site-independent core
-logic and append the following code:
+ The application is ELIZA, the famous program by Joseph Weizenbaum
+that mimics the behavior of a professional psychotherapist when talking
+to you. Weizenbaum would certainly object to this description, but
+this is part of the legend around ELIZA. Take the site-independent
+core logic and append the following code:
function SetUpServer() {
SetUpEliza()
@@ -1631,24 +1618,24 @@ logic and append the following code:
TopFooter = "</BODY></HTML>"
}
-`SetUpServer' is similar to the previous example, except for calling
+ `SetUpServer' is similar to the previous example, except for calling
another function, `SetUpEliza'. This approach can be used to implement
other kinds of servers. The only changes needed to do so are hidden in
the functions `SetUpServer' and `HandleGET'. Perhaps it might be
necessary to implement other HTTP methods. The `igawk' program that
comes with `gawk' may be useful for this process.
-When extending this example to a complete application, the first thing
-to do is to implement the function `SetUpServer' to initialize the HTML
-pages and some variables. These initializations determine the way your
-HTML pages look (colors, titles, menu items, etc.).
+ When extending this example to a complete application, the first
+thing to do is to implement the function `SetUpServer' to initialize
+the HTML pages and some variables. These initializations determine the
+way your HTML pages look (colors, titles, menu items, etc.).
-The function `HandleGET' is a nested case selection that decides which
-page the user wants to see next. Each nesting level refers to a menu
-level of the GUI. Each case implements a certain action of the menu. On
-the deepest level of case selection, the handler essentially knows what
-the user wants and stores the answer into the variable that holds the
-HTML page contents:
+ The function `HandleGET' is a nested case selection that decides
+which page the user wants to see next. Each nesting level refers to a
+menu level of the GUI. Each case implements a certain action of the
+menu. On the deepest level of case selection, the handler essentially
+knows what the user wants and stores the answer into the variable that
+holds the HTML page contents:
function HandleGET() {
# A real HTTP server would treat some parts of the URI as a file name.
@@ -1679,7 +1666,7 @@ HTML page contents:
}
}
-Now we are down to the heart of ELIZA, so you can see how it works.
+ Now we are down to the heart of ELIZA, so you can see how it works.
Initially the user does not say anything; then ELIZA resets its money
counter and asks the user to tell what comes to mind open heartedly.
The subsequent answers are converted to uppercase characters and stored
@@ -1732,7 +1719,7 @@ possible answers:
return answer
}
-In the long but simple function `SetUpEliza', you can see tables for
+ In the long but simple function `SetUpEliza', you can see tables for
conjugation, keywords, and answers.(1) The associative array `k'
contains indices into the array of answers `r'. To choose an answer,
ELIZA just picks an index randomly:
@@ -1771,16 +1758,16 @@ ELIZA just picks an index randomly:
}
-Some interesting remarks and details (including the original source code
-of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has a
-page with a collection of ELIZA-like programs. Many of them are written
-in Java, some of them disclosing the Java source code, and a few even
-explain how to modify the Java source code.
+ Some interesting remarks and details (including the original source
+code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has
+a page with a collection of ELIZA-like programs. Many of them are
+written in Java, some of them disclosing the Java source code, and a
+few even explain how to modify the Java source code.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) The version shown here is abbreviated. The full version comes with
-the `gawk' distribution.
+ (1) The version shown here is abbreviated. The full version comes
+with the `gawk' distribution.

File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking
@@ -1800,13 +1787,14 @@ application works or not sometimes depends on the following:
* The state of the party at the other end
-The most difficult problems for a beginner arise from the hidden states
-of the underlying network. After closing a TCP connection, it's often
-necessary to wait a short while before reopening the connection. Even
-more difficult is the establishment of a connection that previously
-ended with a "broken pipe." Those connections have to "time out" for a
-minute or so before they can reopen. Check this with the command
-`netstat -a', which provides a list of still "active" connections.
+ The most difficult problems for a beginner arise from the hidden
+states of the underlying network. After closing a TCP connection, it's
+often necessary to wait a short while before reopening the connection.
+Even more difficult is the establishment of a connection that
+previously ended with a "broken pipe." Those connections have to "time
+out" for a minute or so before they can reopen. Check this with the
+command `netstat -a', which provides a list of still "active"
+connections.

File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking
@@ -1867,16 +1855,16 @@ program of 1997:
JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
PROGRAM[10:49:02]Do you think of yourself as being attractive?
-This program insists on always speaking about the same story around Bill
-Clinton. You see, even a program with a rather narrow mind can behave so
-much like a human being that it can win this prize. It is quite common
-to let these programs talk to each other via network connections. But
-during the competition itself, the program and its computer have to be
-present at the place the competition is held. We all would love to see
-a `gawk' program win in such an event. Maybe it is up to you to
-accomplish this?
+ This program insists on always speaking about the same story around
+Bill Clinton. You see, even a program with a rather narrow mind can
+behave so much like a human being that it can win this prize. It is
+quite common to let these programs talk to each other via network
+connections. But during the competition itself, the program and its
+computer have to be present at the place the competition is held. We
+all would love to see a `gawk' program win in such an event. Maybe it
+is up to you to accomplish this?
-Some other ideas for useful networked applications:
+ Some other ideas for useful networked applications:
* Read the file `doc/awkforai.txt' in the `gawk' distribution. It
was written by Ronald P. Loui (Associate Professor of Computer
Science, at Washington University in St. Louis,
@@ -1965,26 +1953,26 @@ networking world, show new techniques that broaden the scope of
problems that can be solved with `gawk', and explore leading edge
technology that may shape the future of networking.
-We often refer to the site-independent core of the server that we built
-in *Note A Simple Web Server: Simple Server. When building new and
-nontrivial servers, we always copy this building block and append new
-instances of the two functions `SetUpServer' and `HandleGET'.
-
-This makes a lot of sense, since this scheme of event-driven execution
-provides `gawk' with an interface to the most widely accepted standard
-for GUIs: the web browser. Now, `gawk' can rival even Tcl/Tk.
-
-Tcl and `gawk' have much in common. Both are simple scripting languages
-that allow us to quickly solve problems with short programs. But Tcl
-has Tk on top of it, and `gawk' had nothing comparable up to now. While
-Tcl needs a large and ever-changing library (Tk, which was bound to the
-X Window System until recently), `gawk' needs just the networking
-interface and some kind of browser on the client's side. Besides better
-portability, the most important advantage of this approach (embracing
-well-established standards such HTTP and HTML) is that _we do not need
-to change the language_. We let others do the work of fighting over
-protocols and standards. We can use HTML, JavaScript, VRML, or
-whatever else comes along to do our work.
+ We often refer to the site-independent core of the server that we
+built in *note A Simple Web Server: Simple Server. When building new
+and nontrivial servers, we always copy this building block and append
+new instances of the two functions `SetUpServer' and `HandleGET'.
+
+ This makes a lot of sense, since this scheme of event-driven
+execution provides `gawk' with an interface to the most widely accepted
+standard for GUIs: the web browser. Now, `gawk' can rival even Tcl/Tk.
+
+ Tcl and `gawk' have much in common. Both are simple scripting
+languages that allow us to quickly solve problems with short programs.
+But Tcl has Tk on top of it, and `gawk' had nothing comparable up to
+now. While Tcl needs a large and ever-changing library (Tk, which was
+bound to the X Window System until recently), `gawk' needs just the
+networking interface and some kind of browser on the client's side.
+Besides better portability, the most important advantage of this
+approach (embracing well-established standards such HTTP and HTML) is
+that _we do not need to change the language_. We let others do the work
+of fighting over protocols and standards. We can use HTML, JavaScript,
+VRML, or whatever else comes along to do our work.
* Menu:
@@ -2005,11 +1993,11 @@ File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and T
3.1 PANIC: An Emergency Web Server
==================================
-At first glance, the `"Hello, world"' example in *Note A Primitive Web
+At first glance, the `"Hello, world"' example in *note A Primitive Web
Service: Primitive Service, seems useless. By adding just a few lines,
we can turn it into something useful.
-The PANIC program tells everyone who connects that the local site is
+ The PANIC program tells everyone who connects that the local site is
not working. When a web server breaks down, it makes a difference if
customers get a strange "network unreachable" message, or a short
message telling them that the server has a problem. In such an
@@ -2017,10 +2005,10 @@ emergency, the hard disk and everything on it (including the regular
web service) may be unavailable. Rebooting the web server off a
diskette makes sense in this setting.
-To use the PANIC program as an emergency web server, all you need are
-the `gawk' executable and the program below on a diskette. By default,
-it connects to port 8080. A different value may be supplied on the
-command line:
+ To use the PANIC program as an emergency web server, all you need
+are the `gawk' executable and the program below on a diskette. By
+default, it connects to port 8080. A different value may be supplied on
+the command line:
BEGIN {
RS = ORS = "\r\n"
@@ -2058,14 +2046,14 @@ straightforward to write on top of GETURL. On the Internet, you can find
several programs of the same name that do the same job. They are usually
much more complex internally and at least 10 times longer.
-At first, GETURL checks if it was called with exactly one web address.
-Then, it checks if the user chose to use a special proxy server whose
-name is handed over in a variable. By default, it is assumed that the
-local machine serves as proxy. GETURL uses the `GET' method by default
-to access the web page. By handing over the name of a different method
-(such as `HEAD'), it is possible to choose a different behavior. With
-the `HEAD' method, the user does not receive the body of the page
-content, but does receive the header:
+ At first, GETURL checks if it was called with exactly one web
+address. Then, it checks if the user chose to use a special proxy
+server whose name is handed over in a variable. By default, it is
+assumed that the local machine serves as proxy. GETURL uses the `GET'
+method by default to access the web page. By handing over the name of a
+different method (such as `HEAD'), it is possible to choose a different
+behavior. With the `HEAD' method, the user does not receive the body of
+the page content, but does receive the header:
BEGIN {
if (ARGC != 2) {
@@ -2092,7 +2080,7 @@ content, but does receive the header:
close(HttpService)
}
-This program can be changed as needed, but be careful with the last
+ This program can be changed as needed, but be careful with the last
lines. Make sure transmission of binary data is not corrupted by
additional line breaks. Even as it is now, the byte sequence
`"\r\n\r\n"' would disappear if it were contained in binary data. Don't
@@ -2123,7 +2111,7 @@ up:
* HTTP connections with HTML GUIs
-In this node, we look at a solution that uses HTTP connections to
+ In this node, we look at a solution that uses HTTP connections to
control variables of an embedded system that are stored in a file.
Since embedded systems have tight limits on resources like memory, it
is difficult to employ advanced techniques such as SNMP and HTTP
@@ -2132,7 +2120,7 @@ needs just a short script to start working. The following program
stores the variables in a file, and a concurrent process in the
embedded system may read the file. The program uses the
site-independent part of the simple web server that we developed in
-*Note A Web Service with Interaction: Interacting Service. As
+*note A Web Service with Interaction: Interacting Service. As
mentioned there, all we have to do is to write two new procedures
`SetUpServer' and `HandleGET':
@@ -2151,14 +2139,14 @@ mentioned there, all we have to do is to write two new procedures
if (ConfigFile == "") ConfigFile = "config.asc"
}
-The function `SetUpServer' initializes the top level HTML texts as
+ The function `SetUpServer' initializes the top level HTML texts as
usual. It also initializes the name of the file that contains the
configuration parameters and their values. In case the user supplies a
name from the command line, that name is used. The file is expected to
contain one parameter per line, with the name of the parameter in
column one and the value in column two.
-The function `HandleGET' reflects the structure of the menu tree as
+ The function `HandleGET' reflects the structure of the menu tree as
usual. The first menu choice tells the user what this is all about. The
second choice reads the configuration file line by line and stores the
parameters and their values. Notice that the record separator for this
@@ -2209,7 +2197,7 @@ a file:
}
}
-We could also view the configuration file as a database. From this
+ We could also view the configuration file as a database. From this
point of view, the previous program acts like a primitive database
server. Real SQL database systems also make a service available by
providing a TCP port that clients can connect to. But the application
@@ -2229,7 +2217,7 @@ is needed to automatically look at the headers of web pages and tell
which ones have changed. URLCHK does the comparison after using GETURL
with the `HEAD' method to retrieve the header.
-Like GETURL, this program first checks that it is called with exactly
+ Like GETURL, this program first checks that it is called with exactly
one command-line parameter. URLCHK also takes the same command-line
variables `Proxy' and `ProxyPort' as GETURL, because these variables
are handed over to GETURL for each URL that gets checked. The one and
@@ -2246,8 +2234,8 @@ times. Now, we follow this plan:
4. If the most recent and the new length differ, tell the user
-It may seem a bit peculiar to read the URLs from a file together with
-their two most recent lengths, but this approach has several
+ It may seem a bit peculiar to read the URLs from a file together
+with their two most recent lengths, but this approach has several
advantages. You can call the program again and again with the same
file. After running the program, you can regenerate the changed URLs by
extracting those lines that differ in their second and third columns:
@@ -2281,7 +2269,7 @@ extracting those lines that differ in their second and third columns:
close(URLfile)
}
-Another thing that may look strange is the way GETURL is called.
+ Another thing that may look strange is the way GETURL is called.
Before calling GETURL, we have to check if the proxy variables need to
be passed on. If so, we prepare strings that will become part of the
command line later. In `GetHeader', we store these strings together
@@ -2291,7 +2279,7 @@ to form the command that reads the URL's header over the Internet.
GETURL always produces the headers over `/dev/stderr'. That is the
reason why we need the redirection operator to have the header piped in.
-This program is not perfect because it assumes that changing URLs
+ This program is not perfect because it assumes that changing URLs
results in changed lengths, which is not necessarily true. A more
advanced approach is to look at some other header line that holds time
information. But, as always when things get a bit more complicated,
@@ -2315,21 +2303,21 @@ the Bourne shell:
print command
}
-Notice that the regular expression for URLs is rather crude. A precise
-regular expression is much more complex. But this one works rather
-well. One problem is that it is unable to find internal links of an
-HTML document. Another problem is that `ftp', `telnet', `news',
+ Notice that the regular expression for URLs is rather crude. A
+precise regular expression is much more complex. But this one works
+rather well. One problem is that it is unable to find internal links of
+an HTML document. Another problem is that `ftp', `telnet', `news',
`mailto', and other kinds of links are missing in the regular
expression. However, it is straightforward to add them, if doing so is
necessary for other tasks.
-This program reads an HTML file and prints all the HTTP links that it
-finds. It relies on `gawk''s ability to use regular expressions as
+ This program reads an HTML file and prints all the HTTP links that
+it finds. It relies on `gawk''s ability to use regular expressions as
record separators. With `RS' set to a regular expression that matches
links, the second action is executed each time a non-empty link is
found. We can find the matching link itself in `RT'.
-The action could use the `system' function to let another GETURL
+ The action could use the `system' function to let another GETURL
retrieve the page, but here we use a different approach. This simple
program prints shell commands that can be piped into `sh' for
execution. This way it is possible to first extract the links, wrap
@@ -2340,7 +2328,7 @@ retrieve all the pages like this:
gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
-After this, you will find the contents of all referenced documents in
+ After this, you will find the contents of all referenced documents in
files named `doc*.html' even if they do not contain HTML code. The
most annoying thing is that we always have to pass the proxy to GETURL.
If you do not like to see the headers of the web pages appear on the
@@ -2350,13 +2338,13 @@ such as which web server the companies use. Now, it is clear how the
clever marketing people use web robots to determine the market shares
of Microsoft and Netscape in the web server market.
-Port 80 of any web server is like a small hole in a repellent firewall.
-After attaching a browser to port 80, we usually catch a glimpse of the
-bright side of the server (its home page). With a tool like GETURL at
-hand, we are able to discover some of the more concealed or even
-"indecent" services (i.e., lacking conformity to standards of quality).
-It can be exciting to see the fancy CGI scripts that lie there,
-revealing the inner workings of the server, ready to be called:
+ Port 80 of any web server is like a small hole in a repellent
+firewall. After attaching a browser to port 80, we usually catch a
+glimpse of the bright side of the server (its home page). With a tool
+like GETURL at hand, we are able to discover some of the more concealed
+or even "indecent" services (i.e., lacking conformity to standards of
+quality). It can be exciting to see the fancy CGI scripts that lie
+there, revealing the inner workings of the server, ready to be called:
* With a command such as:
@@ -2382,8 +2370,8 @@ revealing the inner workings of the server, ready to be called:
server's log file--possibly containing customer data--or even the
file `/etc/passwd'. (We don't recommend this!)
-*Caution:* Although this may sound funny or simply irrelevant, we are
-talking about severe security holes. Try to explore your own system
+ *Caution:* Although this may sound funny or simply irrelevant, we
+are talking about severe security holes. Try to explore your own system
this way and make sure that none of the above reveals too much
information about your system.
@@ -2399,8 +2387,8 @@ Generating images that reflect some user input and presenting these
dynamically generated images is another. In this node, we use GNUPlot
for generating `.png', `.ps', or `.gif' files.(1)
-The program we develop takes the statistical parameters of two samples
-and computes the t-test statistics. As a result, we get the
+ The program we develop takes the statistical parameters of two
+samples and computes the t-test statistics. As a result, we get the
probabilities that the means and the variances of both samples are the
same. In order to let the user check plausibility, the program presents
an image of the distributions. The statistical computation follows
@@ -2413,8 +2401,8 @@ comparison of means is done as in `tutest', paragraph 14.2, page 613,
and the comparison of variances is done as in `ftest', page 611 in
`Numerical Recipes'.
-As usual, we take the site-independent code for servers and append our
-own functions `SetUpServer' and `HandleGET':
+ As usual, we take the site-independent code for servers and append
+our own functions `SetUpServer' and `HandleGET':
function SetUpServer() {
TopHeader = "<HTML><title>Statistics with GAWK</title>"
@@ -2429,27 +2417,27 @@ own functions `SetUpServer' and `HandleGET':
m1=m2=0; v1=v2=1; n1=n2=10
}
-Here, you see the menu structure that the user sees. Later, we will see
-how the program structure of the `HandleGET' function reflects the menu
-structure. What is missing here is the link for the image we generate.
-In an event-driven environment, request, generation, and delivery of
-images are separated.
-
-Notice the way we initialize the `GnuPlot' command string for the pipe.
-By default, GNUPlot outputs the generated image via standard output, as
-well as the results of `print'(ed) calculations via standard error.
-The redirection causes standard error to be mixed into standard output,
-enabling us to read results of calculations with `getline'. By
+ Here, you see the menu structure that the user sees. Later, we will
+see how the program structure of the `HandleGET' function reflects the
+menu structure. What is missing here is the link for the image we
+generate. In an event-driven environment, request, generation, and
+delivery of images are separated.
+
+ Notice the way we initialize the `GnuPlot' command string for the
+pipe. By default, GNUPlot outputs the generated image via standard
+output, as well as the results of `print'(ed) calculations via standard
+error. The redirection causes standard error to be mixed into standard
+output, enabling us to read results of calculations with `getline'. By
initializing the statistical parameters with some meaningful defaults,
we make sure the user gets an image the first time he uses the program.
-Following is the rather long function `HandleGET', which implements the
-contents of this service by reacting to the different kinds of requests
-from the browser. Before you start playing with this script, make sure
-that your browser supports JavaScript and that it also has this option
-switched on. The script uses a short snippet of JavaScript code for
-delayed opening of a window with an image. A more detailed explanation
-follows:
+ Following is the rather long function `HandleGET', which implements
+the contents of this service by reacting to the different kinds of
+requests from the browser. Before you start playing with this script,
+make sure that your browser supports JavaScript and that it also has
+this option switched on. The script uses a short snippet of JavaScript
+code for delayed opening of a window with an image. A more detailed
+explanation follows:
function HandleGET() {
if(MENU[2] == "AboutServer") {
@@ -2525,27 +2513,27 @@ follows:
}
}
-As usual, we give a short description of the service in the first menu
-choice. The third menu choice shows us that generation and presentation
-of an image are two separate actions. While the latter takes place
-quite instantly in the third menu choice, the former takes place in the
-much longer second choice. Image data passes from the generating action
-to the presenting action via the variable `Image' that contains a
-complete `.png' image, which is otherwise stored in a file. If you
-prefer `.ps' or `.gif' images over the default `.png' images, you may
-select these options by uncommenting the appropriate lines. But
-remember to do so in two places: when telling GNUPlot which kind of
-images to generate, and when transmitting the image at the end of the
-program.
-
-Looking at the end of the program, the way we pass the `Content-type'
-to the browser is a bit unusual. It is appended to the `OK' of the
-first header line to make sure the type information becomes part of the
-header. The other variables that get transmitted across the network are
-made empty, because in this case we do not have an HTML document to
-transmit, but rather raw image data to contain in the body.
-
-Most of the work is done in the second menu choice. It starts with a
+ As usual, we give a short description of the service in the first
+menu choice. The third menu choice shows us that generation and
+presentation of an image are two separate actions. While the latter
+takes place quite instantly in the third menu choice, the former takes
+place in the much longer second choice. Image data passes from the
+generating action to the presenting action via the variable `Image'
+that contains a complete `.png' image, which is otherwise stored in a
+file. If you prefer `.ps' or `.gif' images over the default `.png'
+images, you may select these options by uncommenting the appropriate
+lines. But remember to do so in two places: when telling GNUPlot which
+kind of images to generate, and when transmitting the image at the end
+of the program.
+
+ Looking at the end of the program, the way we pass the
+`Content-type' to the browser is a bit unusual. It is appended to the
+`OK' of the first header line to make sure the type information becomes
+part of the header. The other variables that get transmitted across
+the network are made empty, because in this case we do not have an HTML
+document to transmit, but rather raw image data to contain in the body.
+
+ Most of the work is done in the second menu choice. It starts with a
strange JavaScript code snippet. When first implementing this server,
we used a short `"<IMG SRC=" MyPrefix "/Image>"' here. But then
browsers got smarter and tried to improve on speed by requesting the
@@ -2559,9 +2547,9 @@ solved this problem by telling the browser to open a separate window
for the image, but only after a delay of 1000 milliseconds. By this
time, the server should be ready for serving the next request.
-But there is one more subtlety in the JavaScript code. Each time the
-JavaScript code opens a window for the image, the name of the image is
-appended with a timestamp (`systime'). Why this constant change of
+ But there is one more subtlety in the JavaScript code. Each time
+the JavaScript code opens a window for the image, the name of the image
+is appended with a timestamp (`systime'). Why this constant change of
name for the image? Initially, we always named the image `Image', but
then the Netscape browser noticed the name had _not_ changed since the
previous request and displayed the previous image (caching behavior).
@@ -2571,7 +2559,7 @@ way to circumvent the cache of such overly smart browsers is to change
the name of the image with each request. These three lines of JavaScript
caused us a lot of trouble.
-The rest can be broken down into two phases. At first, we check if
+ The rest can be broken down into two phases. At first, we check if
there are statistical parameters. When the program is first started,
there usually are no parameters because it enters the page coming from
the top menu. Then, we only have to present the user a form that he
@@ -2579,21 +2567,22 @@ can use to change statistical parameters and submit them. Subsequently,
the submission of the form causes the execution of the first phase
because _now_ there _are_ parameters to handle.
-Now that we have parameters, we know there will be an image available.
-Therefore we insert the JavaScript code here to initiate the opening of
-the image in a separate window. Then, we prepare some variables that
-will be passed to GNUPlot for calculation of the probabilities. Prior
-to reading the results, we must temporarily change `RS' because GNUPlot
-separates lines with newlines. After instructing GNUPlot to generate a
-`.png' (or `.ps' or `.gif') image, we initiate the insertion of some
-text, explaining the resulting probabilities. The final `plot' command
-actually generates the image data. This raw binary has to be read in
-carefully without adding, changing, or deleting a single byte. Hence
-the unusual initialization of `Image' and completion with a `while'
-loop.
-
-When using this server, it soon becomes clear that it is far from being
-perfect. It mixes source code of six scripting languages or protocols:
+ Now that we have parameters, we know there will be an image
+available. Therefore we insert the JavaScript code here to initiate
+the opening of the image in a separate window. Then, we prepare some
+variables that will be passed to GNUPlot for calculation of the
+probabilities. Prior to reading the results, we must temporarily change
+`RS' because GNUPlot separates lines with newlines. After instructing
+GNUPlot to generate a `.png' (or `.ps' or `.gif') image, we initiate
+the insertion of some text, explaining the resulting probabilities. The
+final `plot' command actually generates the image data. This raw binary
+has to be read in carefully without adding, changing, or deleting a
+single byte. Hence the unusual initialization of `Image' and completion
+with a `while' loop.
+
+ When using this server, it soon becomes clear that it is far from
+being perfect. It mixes source code of six scripting languages or
+protocols:
* GNU `awk' implements a server for the protocol:
@@ -2607,17 +2596,17 @@ perfect. It mixes source code of six scripting languages or protocols:
* GNUPlot to generate the image to be opened.
-After all this work, the GNUPlot image opens in the JavaScript window
+ After all this work, the GNUPlot image opens in the JavaScript window
where it can be viewed by the user.
-It is probably better not to mix up so many different languages. The
-result is not very readable. Furthermore, the statistical part of the
-server does not take care of invalid input. Among others, using
+ It is probably better not to mix up so many different languages.
+The result is not very readable. Furthermore, the statistical part of
+the server does not take care of invalid input. Among others, using
negative variances will cause invalid results.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) Due to licensing problems, the default installation of GNUPlot
+ (1) Due to licensing problems, the default installation of GNUPlot
disables the generation of `.gif' files. If your installed version
does not accept `set term gif', just download and install the most
recent version of GNUPlot and the GD library
@@ -2634,20 +2623,20 @@ File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some App
In the long run, every program becomes rococo, and then rubble.
Alan Perlis
-By now, we know how to present arbitrary `Content-type's to a browser.
-In this node, our server will present a 3D world to our browser. The
-3D world is described in a scene description language (VRML, Virtual
-Reality Modeling Language) that allows us to travel through a
-perspective view of a 2D maze with our browser. Browsers with a VRML
-plugin enable exploration of this technology. We could do one of those
-boring `Hello world' examples here, that are usually presented when
-introducing novices to VRML. If you have never written any VRML code,
-have a look at the VRML FAQ. Presenting a static VRML scene is a bit
-trivial; in order to expose `gawk''s new capabilities, we will present
-a dynamically generated VRML scene. The function `SetUpServer' is very
-simple because it only sets the default HTML page and initializes the
-random number generator. As usual, the surrounding server lets you
-browse the maze.
+ By now, we know how to present arbitrary `Content-type's to a
+browser. In this node, our server will present a 3D world to our
+browser. The 3D world is described in a scene description language
+(VRML, Virtual Reality Modeling Language) that allows us to travel
+through a perspective view of a 2D maze with our browser. Browsers with
+a VRML plugin enable exploration of this technology. We could do one of
+those boring `Hello world' examples here, that are usually presented
+when introducing novices to VRML. If you have never written any VRML
+code, have a look at the VRML FAQ. Presenting a static VRML scene is a
+bit trivial; in order to expose `gawk''s new capabilities, we will
+present a dynamically generated VRML scene. The function `SetUpServer'
+is very simple because it only sets the default HTML page and
+initializes the random number generator. As usual, the surrounding
+server lets you browse the maze.
function SetUpServer() {
TopHeader = "<HTML><title>Walk through a maze</title>"
@@ -2661,8 +2650,8 @@ browse the maze.
srand()
}
-The function `HandleGET' is a bit longer because it first computes the
-maze and afterwards generates the VRML code that is sent across the
+ The function `HandleGET' is a bit longer because it first computes
+the maze and afterwards generates the VRML code that is sent across the
network. As shown in the STATIST example (*note STATIST::), we set the
type of the content to VRML and then store the VRML representation of
the maze as the page content. We assume that the maze is stored in a 2D
@@ -2718,24 +2707,24 @@ code for each wall field.
}
}
-Finally, we have a look at `MakeMaze', the function that generates the
-`Maze' array. When entered, this function assumes that the array has
-been initialized so that each element represents a wall element and the
-maze is initially full of wall elements. Only the entrance and the exit
-of the maze should have been left free. The parameters of the function
-tell us which element must be marked as not being a wall. After this,
-we take a look at the four neighbouring elements and remember which we
-have already treated. Of all the neighbouring elements, we take one at
-random and walk in that direction. Therefore, the wall element in that
-direction has to be removed and then, we call the function recursively
-for that element. The maze is only completed if we iterate the above
-procedure for _all_ neighbouring elements (in random order) and for our
-present element by recursively calling the function for the present
-element. This last iteration could have been done in a loop, but it is
-done much simpler recursively.
-
-Notice that elements with coordinates that are both odd are assumed to
-be on our way through the maze and the generating process cannot
+ Finally, we have a look at `MakeMaze', the function that generates
+the `Maze' array. When entered, this function assumes that the array
+has been initialized so that each element represents a wall element and
+the maze is initially full of wall elements. Only the entrance and the
+exit of the maze should have been left free. The parameters of the
+function tell us which element must be marked as not being a wall.
+After this, we take a look at the four neighbouring elements and
+remember which we have already treated. Of all the neighbouring
+elements, we take one at random and walk in that direction. Therefore,
+the wall element in that direction has to be removed and then, we call
+the function recursively for that element. The maze is only completed
+if we iterate the above procedure for _all_ neighbouring elements (in
+random order) and for our present element by recursively calling the
+function for the present element. This last iteration could have been
+done in a loop, but it is done much simpler recursively.
+
+ Notice that elements with coordinates that are both odd are assumed
+to be on our way through the maze and the generating process cannot
terminate as long as there is such an element not being `delete'd. All
other elements are potentially part of the wall.
@@ -2769,8 +2758,8 @@ File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Ap
deficiencies.
C. A. R. Hoare
-A "mobile agent" is a program that can be dispatched from a computer and
-transported to a remote server for execution. This is called
+ A "mobile agent" is a program that can be dispatched from a computer
+and transported to a remote server for execution. This is called
"migration", which means that a process on another system is started
that is independent from its originator. Ideally, it wanders through a
network while working for its creator or owner. In places like the UMBC
@@ -2781,10 +2770,10 @@ between users and the networking world. For an unbiased view at this
technology, see the remarkable paper `Mobile Agents: Are they a good
idea?'.(1)
-When trying to migrate a process from one system to another, a server
-process is needed on the receiving side. Depending on the kind of
-server process, several ways of implementation come to mind. How the
-process is implemented depends upon the kind of server process:
+ When trying to migrate a process from one system to another, a
+server process is needed on the receiving side. Depending on the kind
+of server process, several ways of implementation come to mind. How
+the process is implemented depends upon the kind of server process:
* HTTP can be used as the protocol for delivery of the migrating
process. In this case, we use a common web server as the receiving
@@ -2809,12 +2798,12 @@ process is implemented depends upon the kind of server process:
server process with a dedicated protocol specialized for receiving
mobile agents.
-Our agent example abuses a common web server as a migration tool. So,
-it needs a universal CGI script on the receiving side (the web server).
-The receiving script is activated with a `POST' request when placed
-into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure that the
-server system uses a version of `gawk' that supports network access
-(Version 3.1 or later; verify with `gawk --version').
+ Our agent example abuses a common web server as a migration tool.
+So, it needs a universal CGI script on the receiving side (the web
+server). The receiving script is activated with a `POST' request when
+placed into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure
+that the server system uses a version of `gawk' that supports network
+access (Version 3.1 or later; verify with `gawk --version').
#!/bin/sh
MobAg=/tmp/MobileAgent.$$
@@ -2826,7 +2815,7 @@ server system uses a version of `gawk' that supports network access
gawk 'BEGIN { print "\r\nAgent started" }'
rm $MobAg # delete script file of agent
-By making its process id (`$$') part of the unique file name, the
+ By making its process id (`$$') part of the unique file name, the
script avoids conflicts between concurrent instances of the script.
First, all lines from standard input (the mobile agent's source code)
are copied into this unique file. Then, the agent is started as a
@@ -2855,17 +2844,17 @@ Independence
way. By reporting `Agent started', it waves "Goodbye" to its
origin. The originator may choose to terminate or not.
-The originating agent itself is started just like any other command-line
-script, and reports the results on standard output. By letting the name
-of the original host migrate with the agent, the agent that migrates to
-a host far away from its origin can report the result back home.
-Having arrived at the end of the journey, the agent establishes a
-connection and reports the results. This is the reason for determining
-the name of the host with `uname -n' and storing it in `MyOrigin' for
-later use. We may also set variables with the `-v' option from the
-command line. This interactivity is only of importance in the context
-of starting a mobile agent; therefore this `BEGIN' pattern and its
-action do not take part in migration:
+ The originating agent itself is started just like any other
+command-line script, and reports the results on standard output. By
+letting the name of the original host migrate with the agent, the agent
+that migrates to a host far away from its origin can report the result
+back home. Having arrived at the end of the journey, the agent
+establishes a connection and reports the results. This is the reason
+for determining the name of the host with `uname -n' and storing it in
+`MyOrigin' for later use. We may also set variables with the `-v'
+option from the command line. This interactivity is only of importance
+in the context of starting a mobile agent; therefore this `BEGIN'
+pattern and its action do not take part in migration:
BEGIN {
if (ARGC != 2) {
@@ -2883,7 +2872,7 @@ action do not take part in migration:
}
}
-Since `gawk' cannot manipulate and transmit parts of the program
+ Since `gawk' cannot manipulate and transmit parts of the program
directly, the source code is read and stored in strings. Therefore,
the program scans itself for the beginning and the ending of functions.
Each line in between is appended to the code string until the end of
@@ -2901,7 +2890,7 @@ guarantee that the order of the functions is preserved during migration:
{ FUNC = "" }
#EndOfMySelf
-The web server code in *Note A Web Service with Interaction:
+ The web server code in *note A Web Service with Interaction:
Interacting Service, was first developed as a site-independent core.
Likewise, the `gawk'-based mobile agent starts with an
agent-independent core, to which can be appended application-dependent
@@ -2927,19 +2916,19 @@ needed for the mobile agent:
close(HttpService)
}
-The `migrate' function prepares the aforementioned strings containing
-the program code and transmits them to a server. A consequence of this
-modular approach is that the `migrate' function takes some parameters
-that aren't needed in this application, but that will be in future
-ones. Its mandatory parameter `Destination' holds the name (or IP
-address) of the server that the agent wants as a host for its code. The
-optional parameter `MobCode' may contain some `gawk' code that is
-inserted during migration in front of all other code. The optional
-parameter `Label' may contain a string that tells the agent what to do
-in program execution after arrival at its new home site. One of the
-serious obstacles in implementing a framework for mobile agents is that
-it does not suffice to migrate the code. It is also necessary to
-migrate the state of execution of the agent. In contrast to `Agent
+ The `migrate' function prepares the aforementioned strings
+containing the program code and transmits them to a server. A
+consequence of this modular approach is that the `migrate' function
+takes some parameters that aren't needed in this application, but that
+will be in future ones. Its mandatory parameter `Destination' holds the
+name (or IP address) of the server that the agent wants as a host for
+its code. The optional parameter `MobCode' may contain some `gawk' code
+that is inserted during migration in front of all other code. The
+optional parameter `Label' may contain a string that tells the agent
+what to do in program execution after arrival at its new home site. One
+of the serious obstacles in implementing a framework for mobile agents
+is that it does not suffice to migrate the code. It is also necessary
+to migrate the state of execution of the agent. In contrast to `Agent
Tcl', this program does not try to migrate the complete set of
variables. The following conventions are used:
@@ -2953,7 +2942,7 @@ variables. The following conventions are used:
takes part in migration has to be an element of this array.
`migrate' also takes care of this.
-Now it's clear what happens to the `Label' parameter of the function
+ Now it's clear what happens to the `Label' parameter of the function
`migrate'. It is copied into `MOBVAR["Label"]' and travels alongside
the other data. Since travelling takes place via HTTP, records must be
separated with `"\r\n"' in `RS' and `ORS' as usual. The code assembly
@@ -2969,7 +2958,7 @@ for migration takes place in three steps:
any reply over the network, it is read completely and echoed to
standard output to avoid irritating the server.
-The application-independent framework is now almost complete. What
+ The application-independent framework is now almost complete. What
follows is the `END' pattern that is executed when the mobile agent has
finished reading its own code. First, it checks whether it is already
running on a remote host or not. In case initialization has not yet
@@ -2984,10 +2973,10 @@ starts `MyJob':
MyJob() # so we do our job
}
-All that's left to extend the framework into a complete application is
-to write two application-specific functions: `MyInit' and `MyJob'. Keep
-in mind that the former is executed once on the originating host, while
-the latter is executed after each migration:
+ All that's left to extend the framework into a complete application
+is to write two application-specific functions: `MyInit' and `MyJob'.
+Keep in mind that the former is executed once on the originating host,
+while the latter is executed after each migration:
function MyInit() {
MOBVAR["MyOrigin"] = MyOrigin
@@ -2999,7 +2988,7 @@ the latter is executed after each migration:
close("/inet/tcp/8080/0/0")
}
-As mentioned earlier, this agent takes the name of its origin
+ As mentioned earlier, this agent takes the name of its origin
(`MyOrigin') with it. Then, it takes the name of its first destination
and goes there for further work. Notice that this name has the port
number of the web server appended to the name of the server, because
@@ -3024,10 +3013,10 @@ function runs on the remote host:
}
}
-After migrating, the first thing to do in `MyJob' is to delete the name
-of the current host from the list of hosts to visit. Now, it is time to
-start the real work by appending the host's name to the result string,
-and reading line by line who is logged in on this host. A very
+ After migrating, the first thing to do in `MyJob' is to delete the
+name of the current host from the list of hosts to visit. Now, it is
+time to start the real work by appending the host's name to the result
+string, and reading line by line who is logged in on this host. A very
annoying circumstance is the fact that the elements of `MOBVAR' cannot
hold the newline character (`"\n"'). If they did, migration of this
string did not work because the string didn't obey the syntax rule for
@@ -3038,9 +3027,9 @@ the `SUBSEP's with a newline character in the resulting string, and
report it to the originating host, whose name is stored in
`MOBVAR["MyOrigin"]'.
----------- Footnotes ----------
+ ---------- Footnotes ----------
-(1) `http://www.research.ibm.com/massive/mobag.ps'
+ (1) `http://www.research.ibm.com/massive/mobag.ps'

File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques
@@ -3065,7 +3054,7 @@ File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Som
green pieces of paper that were unhappy.
Douglas Adams, `The Hitch Hiker's Guide to the Galaxy'
-Valuable services on the Internet are usually _not_ implemented as
+ Valuable services on the Internet are usually _not_ implemented as
mobile agents. There are much simpler ways of implementing services.
All Unix systems provide, for example, the `cron' service. Unix system
users can write a list of tasks to be done each day, each week, twice a
@@ -3076,17 +3065,17 @@ For example, to distribute a newsletter on a daily basis this way, use
# run at 8 am on weekdays, distribute the newsletter
0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
-The script first looks for interesting information on the Internet,
+ The script first looks for interesting information on the Internet,
assembles it in a nice form and sends the results via email to the
customers.
-The following is an example of a primitive newsletter on stock market
-prediction. It is a report which first tries to predict the change of
-each share in the Dow Jones Industrial Index for the particular day.
-Then it mentions some especially promising shares as well as some
-shares which look remarkably bad on that day. The report ends with the
-usual disclaimer which tells every child _not_ to try this at home and
-hurt anybody.
+ The following is an example of a primitive newsletter on stock
+market prediction. It is a report which first tries to predict the
+change of each share in the Dow Jones Industrial Index for the
+particular day. Then it mentions some especially promising shares as
+well as some shares which look remarkably bad on that day. The report
+ends with the usual disclaimer which tells every child _not_ to try
+this at home and hurt anybody.
Good morning Uncle Scrooge,
@@ -3121,7 +3110,7 @@ hurt anybody.
DD http://biz.yahoo.com/n/d/dd.html
...
-The script as a whole is rather long. In order to ease the pain of
+ The script as a whole is rather long. In order to ease the pain of
studying other people's source code, we have broken the script up into
meaningful parts which are invoked one after the other. The basic
structure of the script is as follows:
@@ -3135,7 +3124,7 @@ structure of the script is as follows:
SendMail()
}
-The earlier parts store data into variables and arrays which are
+ The earlier parts store data into variables and arrays which are
subsequently used by later parts of the script. The `Init' function
first checks if the script is invoked correctly (without any
parameters). If not, it informs the user of the correct usage. What
@@ -3143,10 +3132,10 @@ follows are preparations for the retrieval of the historical quote
data. The names of the 30 stock shares are stored in an array `name'
along with the current date in `day', `month', and `year'.
-All users who are separated from the Internet by a firewall and have to
-direct their Internet accesses to a proxy must supply the name of the
-proxy to this script with the `-v Proxy=NAME' option. For most users,
-the default proxy and port number should suffice.
+ All users who are separated from the Internet by a firewall and have
+to direct their Internet accesses to a proxy must supply the name of
+the proxy to this script with the `-v Proxy=NAME' option. For most
+users, the default proxy and port number should suffice.
function Init() {
if (ARGC != 1) {
@@ -3170,7 +3159,7 @@ the default proxy and port number should suffice.
YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
}
-There are two really interesting parts in the script. One is the
+ There are two really interesting parts in the script. One is the
function which reads the historical stock quotes from an Internet
server. The other is the one that does the actual prediction. In the
following function we see how the quotes are read from the Yahoo
@@ -3182,7 +3171,7 @@ server. The data which comes from the server is in CSV format
6-Oct-00,23.8125,24.9375,21.5625,22,10701100
5-Oct-00,24.4375,24.625,23.125,23.50,5810300
-Lines contain values of the same time instant, whereas columns are
+ Lines contain values of the same time instant, whereas columns are
separated by commas and contain the kind of data that is described in
the header (first) line. At first, `gawk' is instructed to separate
columns by commas (`FS = ","'). In the loop that follows, a connection
@@ -3194,7 +3183,7 @@ ending date are chosen to be exactly the same, but one year apart in
the past. All the action is initiated within the `printf' command which
transmits the request for data to the Yahoo server.
-In the inner loop, the server's data is first read and then scanned
+ In the inner loop, the server's data is first read and then scanned
line by line. Only lines which have six columns and the name of a month
in the first column contain relevant data. This data is stored in the
two-dimensional array `quote'; one dimension being time, the other
@@ -3223,9 +3212,9 @@ because we need them later.
FS = " "
}
-Now that we _have_ the data, it can be checked once again to make sure
-that no individual stock is missing or invalid, and that all the stock
-quotes are aligned correctly. Furthermore, we renumber the time
+ Now that we _have_ the data, it can be checked once again to make
+sure that no individual stock is missing or invalid, and that all the
+stock quotes are aligned correctly. Furthermore, we renumber the time
instances. The most recent day gets day number 1 and all other days get
consecutive numbers. All quotes are rounded toward the nearest whole
number in US Dollars.
@@ -3246,16 +3235,16 @@ number in US Dollars.
delete days
}
-Now we have arrived at the second really interesting part of the whole
-affair. What we present here is a very primitive prediction algorithm:
-_If a stock fell yesterday, assume it will also fall today; if it rose
-yesterday, assume it will rise today_. (Feel free to replace this
-algorithm with a smarter one.) If a stock changed in the same direction
-on two consecutive days, this is an indication which should be
-highlighted. Two-day advances are stored in `hot' and two-day declines
-in `avoid'.
+ Now we have arrived at the second really interesting part of the
+whole affair. What we present here is a very primitive prediction
+algorithm: _If a stock fell yesterday, assume it will also fall today;
+if it rose yesterday, assume it will rise today_. (Feel free to
+replace this algorithm with a smarter one.) If a stock changed in the
+same direction on two consecutive days, this is an indication which
+should be highlighted. Two-day advances are stored in `hot' and
+two-day declines in `avoid'.
-The rest of the function is a sanity check. It counts the number of
+ The rest of the function is a sanity check. It counts the number of
correct predictions in relation to the total number of predictions one
could have made in the year before.
@@ -3292,9 +3281,10 @@ could have made in the year before.
}
}
-At this point the hard work has been done: the array `predict' contains
-the predictions for all the ticker symbols. It is up to the function
-`Report' to find some nice words to introduce the desired information.
+ At this point the hard work has been done: the array `predict'
+contains the predictions for all the ticker symbols. It is up to the
+function `Report' to find some nice words to introduce the desired
+information.
function Report() {
# Generate report
@@ -3330,10 +3320,10 @@ the predictions for all the ticker symbols. It is up to the function
report = report "you should visit a doctor who can treat your ailment."
}
-The function `SendMail' goes through the list of customers and opens a
-pipe to the `mail' command for each of them. Each one receives an email
-message with a proper subject heading and is addressed with his full
-name.
+ The function `SendMail' goes through the list of customers and opens
+a pipe to the `mail' command for each of them. Each one receives an
+email message with a proper subject heading and is addressed with his
+full name.
function SendMail() {
# send report to customers
@@ -3352,7 +3342,7 @@ name.
}
}
-Be patient when running the script by hand. Retrieving the data for
+ Be patient when running the script by hand. Retrieving the data for
all the ticker symbols and sending the emails may take several minutes
to complete, depending upon network traffic and the speed of the
available Internet link. The quality of the prediction algorithm is
@@ -3369,20 +3359,20 @@ File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications an
Hoare's Law of Large Problems: Inside every large problem is a
small problem struggling to get out.
-Yahoo's database of stock market data is just one among the many large
-databases on the Internet. Another one is located at NCBI (National
-Center for Biotechnology Information). Established in 1988 as a
-national resource for molecular biology information, NCBI creates
+ Yahoo's database of stock market data is just one among the many
+large databases on the Internet. Another one is located at NCBI
+(National Center for Biotechnology Information). Established in 1988 as
+a national resource for molecular biology information, NCBI creates
public databases, conducts research in computational biology, develops
software tools for analyzing genome data, and disseminates biomedical
information. In this section, we look at one of NCBI's public services,
which is called BLAST (Basic Local Alignment Search Tool).
-You probably know that the information necessary for reproducing living
-cells is encoded in the genetic material of the cells. The genetic
-material is a very long chain of four base nucleotides. It is the order
-of appearance (the sequence) of nucleotides which contains the
-information about the substance to be produced. Scientists in
+ You probably know that the information necessary for reproducing
+living cells is encoded in the genetic material of the cells. The
+genetic material is a very long chain of four base nucleotides. It is
+the order of appearance (the sequence) of nucleotides which contains
+the information about the substance to be produced. Scientists in
biotechnology often find a specific fragment, determine the nucleotide
sequence, and need to know where the sequence at hand comes from. This
is where the large databases enter the game. At NCBI, databases store
@@ -3421,14 +3411,14 @@ services:
you can send a message consisting of the word "HELP" to the same
address, <blast@ncbi.nlm.nih.gov>.
-Our starting point is the demonstration client mentioned in the first
-option. The `README' file that comes along with the client explains
-the whole process in a nutshell. In the rest of this section, we first
-show what such requests look like. Then we show how to use `gawk' to
-implement a client in about 10 lines of code. Finally, we show how to
-interpret the result returned from the service.
+ Our starting point is the demonstration client mentioned in the
+first option. The `README' file that comes along with the client
+explains the whole process in a nutshell. In the rest of this section,
+we first show what such requests look like. Then we show how to use
+`gawk' to implement a client in about 10 lines of code. Finally, we
+show how to interpret the result returned from the service.
-Sequences are expected to be represented in the standard IUB/IUPAC
+ Sequences are expected to be represented in the standard IUB/IUPAC
amino acid and nucleic acid codes, with these exceptions: lower-case
letters are accepted and are mapped into upper-case; a single hyphen or
dash can be used to represent a gap of indeterminate length; and in
@@ -3448,7 +3438,7 @@ residue). The nucleic acid codes supported are:
K --> G T (keto) N --> A G C T (any)
- gap of indeterminate length
-Now you know the alphabet of nucleotide sequences. The last two lines
+ Now you know the alphabet of nucleotide sequences. The last two lines
of the following example query show you such a sequence, which is
obviously made up only of elements of the alphabet just described.
Store this example query into a file named `protbase.request'. You are
@@ -3462,23 +3452,23 @@ now ready to send it to the server with the demonstration client.
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
caccaccatggacagcaaa
-The actual search request begins with the mandatory parameter `PROGRAM'
-in the first column followed by the value `blastn' (the name of the
-program) for searching nucleic acids. The next line contains the
-mandatory search parameter `DATALIB' with the value `month' for the
+ The actual search request begins with the mandatory parameter
+`PROGRAM' in the first column followed by the value `blastn' (the name
+of the program) for searching nucleic acids. The next line contains
+the mandatory search parameter `DATALIB' with the value `month' for the
newest nucleic acid sequences. The third line contains an optional
`EXPECT' parameter and the value desired for it. The fourth line
contains the mandatory `BEGIN' directive, followed by the query
sequence in FASTA/Pearson format. Each line of information must be
less than 80 characters in length.
-The "month" database contains all new or revised sequences released in
-the last 30 days and is useful for searching against new sequences.
+ The "month" database contains all new or revised sequences released
+in the last 30 days and is useful for searching against new sequences.
There are five different blast programs, `blastn' being the one that
compares a nucleotide query sequence against a nucleotide sequence
database.
-The last server directive that must appear in every request is the
+ The last server directive that must appear in every request is the
`BEGIN' directive. The query sequence should immediately follow the
`BEGIN' directive and must appear in FASTA/Pearson format. A sequence
in FASTA/Pearson format begins with a single-line description. The
@@ -3487,13 +3477,13 @@ sequence data that follow it by having a greater-than (`>') symbol in
the first column. For the purposes of the BLAST server, the text of
the description is arbitrary.
-If you prefer to use a client written in `gawk', just store the
+ If you prefer to use a client written in `gawk', just store the
following 10 lines of code into a file named `protbase.awk' and use
this client instead. Invoke it with `gawk -f protbase.awk
protbase.request'. Then wait a minute and watch the result coming in.
In order to replicate the demonstration client's behaviour as closely
as possible, this client does not use a proxy server. We could also
-have extended the client program in *Note Retrieving Web Pages: GETURL,
+have extended the client program in *note Retrieving Web Pages: GETURL,
to implement the client request from `protbase.awk' as a special case.
{ request = request "\n" $0 }
@@ -3508,19 +3498,19 @@ to implement the client request from `protbase.awk' as a special case.
close(BLASTService)
}
-The demonstration client from NCBI is 214 lines long (written in C) and
-it is not immediately obvious what it does. Our client is so short that
-it _is_ obvious what it does. First it loops over all lines of the
+ The demonstration client from NCBI is 214 lines long (written in C)
+and it is not immediately obvious what it does. Our client is so short
+that it _is_ obvious what it does. First it loops over all lines of the
query and stores the whole query into a variable. Then the script
establishes an Internet connection to the NCBI server and transmits the
query by framing it with a proper HTTP request. Finally it receives and
prints the complete result coming from the server.
-Now, let us look at the result. It begins with an HTTP header, which you
-can ignore. Then there are some comments about the query having been
+ Now, let us look at the result. It begins with an HTTP header, which
+you can ignore. Then there are some comments about the query having been
filtered to avoid spuriously high scores. After this, there is a
reference to the paper that describes the software being used for
-searching the data base. After a repitition of the original query's
+searching the data base. After a repetition of the original query's
description we find the list of significant alignments:
Sequences producing significant alignments: (bits) Value
@@ -3533,13 +3523,13 @@ description we find the list of significant alignments:
emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
-This means that the query sequence was found in seven human chromosomes.
-But the value 0.20 (20%) means that the probability of an accidental
-match is rather high (20%) in all cases and should be taken into
-account. You may wonder what the first column means. It is a key to
-the specific database in which this occurence was found. The unique
-sequence identifiers reported in the search results can be used as
-sequence retrieval keys via the NCBI server. The syntax of sequence
+ This means that the query sequence was found in seven human
+chromosomes. But the value 0.20 (20%) means that the probability of an
+accidental match is rather high (20%) in all cases and should be taken
+into account. You may wonder what the first column means. It is a key
+to the specific database in which this occurrence was found. The
+unique sequence identifiers reported in the search results can be used
+as sequence retrieval keys via the NCBI server. The syntax of sequence
header lines used by the NCBI BLAST server depends on the database from
which each sequence was obtained. The table below lists the
identifiers for the databases from which the sequences were derived.
@@ -3557,13 +3547,13 @@ identifiers for the databases from which the sequences were derived.
Patents pat|country|number
GenInfo Backbone Id bbs|number
-For example, an identifier might be `gb|AC021182.14|AC021182', where the
-`gb' tag indicates that the identifier refers to a GenBank sequence,
+ For example, an identifier might be `gb|AC021182.14|AC021182', where
+the `gb' tag indicates that the identifier refers to a GenBank sequence,
`AC021182.14' is its GenBank ACCESSION, and `AC021182' is the GenBank
LOCUS. The identifier contains no spaces, so that a space indicates
the end of the identifier.
-Let us continue in the result listing. Each of the seven alignments
+ Let us continue in the result listing. Each of the seven alignments
mentioned above is subsequently described in detail. We will have a
closer look at the first of them.
@@ -3579,20 +3569,20 @@ closer look at the first of them.
|||||||||||||||||||
Sbjct: 69786 tggtgaagtgtgtttcttg 69804
-This alignment was located on the human chromosome 7. The fragment on
-which part of the query was found had a total length of 176383. Only 19
-of the nucleotides matched and the matching sequence ran from character
-35 to 53 in the query sequence and from 69786 to 69804 in the fragment
-on chromosome 7. If you are still reading at this point, you are
-probably interested in finding out more about Computational Biology and
-you might appreciate the following hints.
+ This alignment was located on the human chromosome 7. The fragment
+on which part of the query was found had a total length of 176383. Only
+19 of the nucleotides matched and the matching sequence ran from
+character 35 to 53 in the query sequence and from 69786 to 69804 in the
+fragment on chromosome 7. If you are still reading at this point, you
+are probably interested in finding out more about Computational Biology
+and you might appreciate the following hints.
1. There is a book called `Introduction to Computational Biology' by
Michael S. Waterman, which is worth reading if you are seriously
interested. You can find a good book review on the Internet.
2. While Waterman's book can explain to you the algorithms employed
- internally in the database search engines, most practicioners
+ internally in the database search engines, most practitioners
prefer to approach the subject differently. The applied side of
Computational Biology is called Bioinformatics, and emphasizes the
tools available for day-to-day work as well as how to actually
@@ -3740,6 +3730,7 @@ GNU Free Documentation License
******************************
Version 1.2, November 2002
+
Copyright (C) 2000,2001,2002 Free Software Foundation, Inc.
51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA
@@ -4093,7 +4084,7 @@ GNU Free Documentation License
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License, and all the license notices in the
- Document, and any Warrany Disclaimers, provided that you also
+ Document, and any Warranty Disclaimers, provided that you also
include the original English version of this License and the
original versions of those notices and disclaimers. In case of a
disagreement between the translation and the original version of
@@ -4148,18 +4139,18 @@ notices just after the title page:
A copy of the license is included in the section entitled ``GNU
Free Documentation License''.
-If you have Invariant Sections, Front-Cover Texts and Back-Cover Texts,
-replace the "with...Texts." line with this:
+ If you have Invariant Sections, Front-Cover Texts and Back-Cover
+Texts, replace the "with...Texts." line with this:
with the Invariant Sections being LIST THEIR TITLES, with
the Front-Cover Texts being LIST, and with the Back-Cover Texts
being LIST.
-If you have Invariant Sections without Cover Texts, or some other
+ If you have Invariant Sections without Cover Texts, or some other
combination of the three, merge those two alternatives to suit the
situation.
-If your document contains nontrivial examples of program code, we
+ If your document contains nontrivial examples of program code, we
recommend releasing these examples in parallel under your choice of
free software license, such as the GNU General Public License, to
permit their use in free software.
@@ -4170,258 +4161,244 @@ File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: T
Index
*****
+
* Menu:
-* /inet/ files (gawk): Gawk Special Files. (line 490)
-* /inet/raw special files (gawk): File /inet/raw. (line 712)
-* /inet/tcp special files (gawk): File /inet/tcp. (line 647)
-* /inet/udp special files (gawk): File /inet/udp. (line 679)
-* advanced features, network connections: Troubleshooting. (line 834)
-* agent <1>: MOBAGWHO. (line 2766)
-* agent: Challenges. (line 1887)
-* AI: Challenges. (line 1887)
-* apache <1>: MOBAGWHO. (line 2802)
-* apache: WEBGRAB. (line 2372)
-* Bioinformatics: PROTBASE. (line 3590)
-* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 3369)
-* blocking: Making Connections. (line 383)
-* Boutell, Thomas: STATIST. (line 2396)
-* CGI (Common Gateway Interface): MOBAGWHO. (line 2802)
+* /inet/ files (gawk): Gawk Special Files. (line 34)
+* /inet/raw special files (gawk): File /inet/raw. (line 6)
+* /inet/tcp special files (gawk): File /inet/tcp. (line 6)
+* /inet/udp special files (gawk): File /inet/udp. (line 6)
+* advanced features, network connections: Troubleshooting. (line 6)
+* agent <1>: MOBAGWHO. (line 6)
+* agent: Challenges. (line 76)
+* AI: Challenges. (line 76)
+* apache <1>: MOBAGWHO. (line 42)
+* apache: WEBGRAB. (line 72)
+* Bioinformatics: PROTBASE. (line 227)
+* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6)
+* blocking: Making Connections. (line 35)
+* Boutell, Thomas: STATIST. (line 6)
+* CGI (Common Gateway Interface): MOBAGWHO. (line 42)
* CGI (Common Gateway Interface), dynamic web pages and: Web page.
- (line 1130)
-* CGI (Common Gateway Interface), library: CGI Lib. (line 1418)
-* clients: Making Connections. (line 369)
-* Clinton, Bill: Challenges. (line 1870)
-* Common Gateway Interface, See CGI: Web page. (line 1130)
-* Computational Biology: PROTBASE. (line 3590)
-* contest: Challenges. (line 1817)
-* cron utility: STOXPRED. (line 3068)
-* CSV format: STOXPRED. (line 3173)
-* dark corner, RAW protocol: File /inet/raw. (line 719)
-* Dow Jones Industrial Index: STOXPRED. (line 3089)
-* ELIZA program: Simple Server. (line 1606)
-* email: Email. (line 1045)
-* FASTA/Pearson format: PROTBASE. (line 3465)
+ (line 46)
+* CGI (Common Gateway Interface), library: CGI Lib. (line 11)
+* clients: Making Connections. (line 21)
+* Clinton, Bill: Challenges. (line 59)
+* Common Gateway Interface, See CGI: Web page. (line 46)
+* Computational Biology: PROTBASE. (line 227)
+* contest: Challenges. (line 6)
+* cron utility: STOXPRED. (line 23)
+* CSV format: STOXPRED. (line 128)
+* dark corner, RAW protocol: File /inet/raw. (line 13)
+* Dow Jones Industrial Index: STOXPRED. (line 44)
+* ELIZA program: Simple Server. (line 11)
+* email: Email. (line 11)
+* FASTA/Pearson format: PROTBASE. (line 102)
* FDL (Free Documentation License): GNU Free Documentation License.
- (line 3742)
-* filenames, for network access: Gawk Special Files. (line 485)
-* files, /inet/ (gawk): Gawk Special Files. (line 490)
-* files, /inet/raw (gawk): File /inet/raw. (line 712)
-* files, /inet/tcp (gawk): File /inet/tcp. (line 647)
-* files, /inet/udp (gawk): File /inet/udp. (line 679)
-* finger utility: Setting Up. (line 981)
+ (line 6)
+* filenames, for network access: Gawk Special Files. (line 29)
+* files, /inet/ (gawk): Gawk Special Files. (line 34)
+* files, /inet/raw (gawk): File /inet/raw. (line 6)
+* files, /inet/tcp (gawk): File /inet/tcp. (line 6)
+* files, /inet/udp (gawk): File /inet/udp. (line 6)
+* finger utility: Setting Up. (line 22)
* Free Documentation License (FDL): GNU Free Documentation License.
- (line 3742)
-* FTP (File Transfer Protocol): Basic Protocols. (line 316)
-* gawk, networking: Using Networking. (line 414)
-* gawk, networking, connections <1>: TCP Connecting. (line 781)
-* gawk, networking, connections: Special File Fields.
- (line 549)
-* gawk, networking, filenames: Gawk Special Files. (line 485)
-* gawk, networking, See Also email: Email. (line 1040)
-* gawk, networking, service, establishing: Setting Up. (line 965)
-* gawk, networking, troubleshooting: Caveats. (line 1791)
-* gawk, web and, See web service: Interacting Service.
- (line 1214)
-* getline command: TCP Connecting. (line 786)
-* GETURL program: GETURL. (line 2050)
-* GIF image format <1>: STATIST. (line 2396)
-* GIF image format: Web page. (line 1130)
+ (line 6)
+* FTP (File Transfer Protocol): Basic Protocols. (line 29)
+* gawk, networking: Using Networking. (line 6)
+* gawk, networking, connections <1>: TCP Connecting. (line 6)
+* gawk, networking, connections: Special File Fields. (line 49)
+* gawk, networking, filenames: Gawk Special Files. (line 29)
+* gawk, networking, See Also email: Email. (line 6)
+* gawk, networking, service, establishing: Setting Up. (line 6)
+* gawk, networking, troubleshooting: Caveats. (line 6)
+* gawk, web and, See web service: Interacting Service. (line 6)
+* getline command: TCP Connecting. (line 11)
+* GETURL program: GETURL. (line 6)
+* GIF image format <1>: STATIST. (line 6)
+* GIF image format: Web page. (line 46)
* GNU Free Documentation License: GNU Free Documentation License.
- (line 3742)
-* GNU/Linux <1>: REMCONF. (line 2107)
-* GNU/Linux <2>: Interacting. (line 931)
-* GNU/Linux: Troubleshooting. (line 882)
-* GNUPlot utility <1>: STATIST. (line 2396)
-* GNUPlot utility: Interacting Service.
- (line 1396)
-* Hoare, C.A.R. <1>: PROTBASE. (line 3369)
-* Hoare, C.A.R.: MOBAGWHO. (line 2766)
-* hostname field: Special File Fields.
- (line 529)
-* HTML (Hypertext Markup Language): Web page. (line 1114)
-* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 1090)
-* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 316)
+ (line 6)
+* GNU/Linux <1>: REMCONF. (line 6)
+* GNU/Linux <2>: Interacting. (line 27)
+* GNU/Linux: Troubleshooting. (line 54)
+* GNUPlot utility <1>: STATIST. (line 6)
+* GNUPlot utility: Interacting Service. (line 189)
+* Hoare, C.A.R. <1>: PROTBASE. (line 6)
+* Hoare, C.A.R.: MOBAGWHO. (line 6)
+* hostname field: Special File Fields. (line 29)
+* HTML (Hypertext Markup Language): Web page. (line 30)
+* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6)
+* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 29)
* HTTP (Hypertext Transfer Protocol), record separators and: Web page.
- (line 1114)
-* HTTP server, core logic: Interacting Service.
- (line 1214)
-* Humphrys, Mark: Simple Server. (line 1774)
-* Hypertext Markup Language (HTML): Web page. (line 1114)
-* Hypertext Transfer Protocol, See HTTP: Web page. (line 1090)
-* image format: STATIST. (line 2396)
-* images, in web pages: Interacting Service.
- (line 1396)
-* images, retrieving over networks: Web page. (line 1130)
+ (line 30)
+* HTTP server, core logic: Interacting Service. (line 6)
+* Humphrys, Mark: Simple Server. (line 179)
+* Hypertext Markup Language (HTML): Web page. (line 30)
+* Hypertext Transfer Protocol, See HTTP: Web page. (line 6)
+* image format: STATIST. (line 6)
+* images, in web pages: Interacting Service. (line 189)
+* images, retrieving over networks: Web page. (line 46)
* input/output, two-way, See Also gawk, networking: Gawk Special Files.
- (line 475)
-* Internet, See networks: Interacting. (line 952)
-* JavaScript: STATIST. (line 2446)
-* Linux <1>: REMCONF. (line 2107)
-* Linux <2>: Interacting. (line 931)
-* Linux: Troubleshooting. (line 882)
-* Lisp: MOBAGWHO. (line 2858)
-* localport field: Gawk Special Files. (line 490)
-* Loebner, Hugh: Challenges. (line 1817)
-* Loui, Ronald: Challenges. (line 1887)
-* MAZE: MAZE. (line 2634)
-* Microsoft Windows: WEBGRAB. (line 2343)
-* Microsoft Windows, networking: Troubleshooting. (line 882)
-* Microsoft Windows, networking, ports: Setting Up. (line 996)
-* MiniSQL: REMCONF. (line 2212)
-* MOBAGWHO program: MOBAGWHO. (line 2766)
+ (line 19)
+* Internet, See networks: Interacting. (line 48)
+* JavaScript: STATIST. (line 56)
+* Linux <1>: REMCONF. (line 6)
+* Linux <2>: Interacting. (line 27)
+* Linux: Troubleshooting. (line 54)
+* Lisp: MOBAGWHO. (line 98)
+* localport field: Gawk Special Files. (line 34)
+* Loebner, Hugh: Challenges. (line 6)
+* Loui, Ronald: Challenges. (line 76)
+* MAZE: MAZE. (line 6)
+* Microsoft Windows: WEBGRAB. (line 43)
+* Microsoft Windows, networking: Troubleshooting. (line 54)
+* Microsoft Windows, networking, ports: Setting Up. (line 37)
+* MiniSQL: REMCONF. (line 111)
+* MOBAGWHO program: MOBAGWHO. (line 6)
* NCBI, National Center for Biotechnology Information: PROTBASE.
- (line 3369)
-* networks, gawk and: Using Networking. (line 414)
-* networks, gawk and, connections <1>: TCP Connecting. (line 781)
-* networks, gawk and, connections: Special File Fields.
- (line 549)
-* networks, gawk and, filenames: Gawk Special Files. (line 485)
-* networks, gawk and, See Also email: Email. (line 1040)
-* networks, gawk and, service, establishing: Setting Up. (line 965)
-* networks, gawk and, troubleshooting: Caveats. (line 1791)
-* networks, ports, reserved: Setting Up. (line 996)
-* networks, ports, specifying: Special File Fields.
- (line 518)
-* networks, See Also web pages: PANIC. (line 2008)
-* Numerical Recipes: STATIST. (line 2414)
-* ORS variable, HTTP and: Web page. (line 1114)
-* ORS variable, POP and: Email. (line 1070)
-* PANIC program: PANIC. (line 2008)
-* Perl: Using Networking. (line 422)
-* Perl, gawk networking and: Using Networking. (line 432)
-* Perlis, Alan: MAZE. (line 2634)
-* pipes, networking and: TCP Connecting. (line 805)
-* PNG image format <1>: STATIST. (line 2396)
-* PNG image format: Web page. (line 1130)
-* POP (Post Office Protocol): Email. (line 1040)
-* Post Office Protocol (POP): Email. (line 1040)
-* PostScript: STATIST. (line 2528)
-* PROLOG: Challenges. (line 1887)
-* PROTBASE: PROTBASE. (line 3369)
-* protocol field: Special File Fields.
- (line 511)
-* PS image format: STATIST. (line 2396)
-* Python: Using Networking. (line 422)
-* Python, gawk networking and: Using Networking. (line 432)
-* RAW protocol: File /inet/raw. (line 712)
-* record separators, HTTP and: Web page. (line 1114)
-* record separators, POP and: Email. (line 1070)
-* REMCONF program: REMCONF. (line 2107)
-* remoteport field: Gawk Special Files. (line 490)
-* robot <1>: WEBGRAB. (line 2306)
-* robot: Challenges. (line 1896)
-* RS variable, HTTP and: Web page. (line 1114)
-* RS variable, POP and: Email. (line 1070)
-* servers <1>: Setting Up. (line 981)
-* servers: Making Connections. (line 362)
-* servers, as hosts: Special File Fields.
- (line 529)
-* servers, HTTP: Interacting Service.
- (line 1214)
-* servers, web: Simple Server. (line 1601)
-* Simple Mail Transfer Protocol (SMTP): Email. (line 1040)
-* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 1040)
-* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 316)
-* SPAK utility: File /inet/raw. (line 727)
-* STATIST program: STATIST. (line 2396)
-* STOXPRED program: STOXPRED. (line 3051)
-* synchronous communications: Making Connections. (line 383)
-* Tcl/Tk: Using Networking. (line 422)
+ (line 6)
+* networks, gawk and: Using Networking. (line 6)
+* networks, gawk and, connections <1>: TCP Connecting. (line 6)
+* networks, gawk and, connections: Special File Fields. (line 49)
+* networks, gawk and, filenames: Gawk Special Files. (line 29)
+* networks, gawk and, See Also email: Email. (line 6)
+* networks, gawk and, service, establishing: Setting Up. (line 6)
+* networks, gawk and, troubleshooting: Caveats. (line 6)
+* networks, ports, reserved: Setting Up. (line 37)
+* networks, ports, specifying: Special File Fields. (line 18)
+* networks, See Also web pages: PANIC. (line 6)
+* Numerical Recipes: STATIST. (line 24)
+* ORS variable, HTTP and: Web page. (line 30)
+* ORS variable, POP and: Email. (line 36)
+* PANIC program: PANIC. (line 6)
+* Perl: Using Networking. (line 14)
+* Perl, gawk networking and: Using Networking. (line 24)
+* Perlis, Alan: MAZE. (line 6)
+* pipes, networking and: TCP Connecting. (line 30)
+* PNG image format <1>: STATIST. (line 6)
+* PNG image format: Web page. (line 46)
+* POP (Post Office Protocol): Email. (line 6)
+* Post Office Protocol (POP): Email. (line 6)
+* PostScript: STATIST. (line 138)
+* PROLOG: Challenges. (line 76)
+* PROTBASE: PROTBASE. (line 6)
+* protocol field: Special File Fields. (line 11)
+* PS image format: STATIST. (line 6)
+* Python: Using Networking. (line 14)
+* Python, gawk networking and: Using Networking. (line 24)
+* RAW protocol: File /inet/raw. (line 6)
+* record separators, HTTP and: Web page. (line 30)
+* record separators, POP and: Email. (line 36)
+* REMCONF program: REMCONF. (line 6)
+* remoteport field: Gawk Special Files. (line 34)
+* robot <1>: WEBGRAB. (line 6)
+* robot: Challenges. (line 85)
+* RS variable, HTTP and: Web page. (line 30)
+* RS variable, POP and: Email. (line 36)
+* servers <1>: Setting Up. (line 22)
+* servers: Making Connections. (line 14)
+* servers, as hosts: Special File Fields. (line 29)
+* servers, HTTP: Interacting Service. (line 6)
+* servers, web: Simple Server. (line 6)
+* Simple Mail Transfer Protocol (SMTP): Email. (line 6)
+* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6)
+* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 29)
+* SPAK utility: File /inet/raw. (line 21)
+* STATIST program: STATIST. (line 6)
+* STOXPRED program: STOXPRED. (line 6)
+* synchronous communications: Making Connections. (line 35)
+* Tcl/Tk: Using Networking. (line 14)
* Tcl/Tk, gawk and <1>: Some Applications and Techniques.
- (line 1977)
-* Tcl/Tk, gawk and: Using Networking. (line 432)
-* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 647)
-* TCP (Transmission Control Protocol): Using Networking. (line 437)
+ (line 22)
+* Tcl/Tk, gawk and: Using Networking. (line 24)
+* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6)
+* TCP (Transmission Control Protocol): Using Networking. (line 29)
* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting.
- (line 781)
-* TCP (Transmission Control Protocol), UDP and: Interacting. (line 952)
-* TCP/IP, protocols, selecting: Special File Fields.
- (line 511)
-* TCP/IP, sockets and: Gawk Special Files. (line 475)
-* Transmission Control Protocol, See TCP: Using Networking. (line 437)
-* troubleshooting, gawk, networks: Caveats. (line 1791)
-* troubleshooting, networks, connections: Troubleshooting. (line 834)
-* troubleshooting, networks, timeouts: Caveats. (line 1803)
-* UDP (User Datagram Protocol): File /inet/udp. (line 679)
-* UDP (User Datagram Protocol), TCP and: Interacting. (line 952)
-* Unix, network ports and: Setting Up. (line 996)
-* URLCHK program: URLCHK. (line 2225)
-* User Datagram Protocol, See UDP: File /inet/udp. (line 679)
-* vertical bar (|), |& operator (I/O): TCP Connecting. (line 800)
-* VRML: MAZE. (line 2634)
-* web browsers, See web service: Interacting Service.
- (line 1214)
-* web pages: Web page. (line 1090)
-* web pages, images in: Interacting Service.
- (line 1396)
-* web pages, retrieving: GETURL. (line 2050)
-* web servers: Simple Server. (line 1601)
-* web service <1>: PANIC. (line 2008)
-* web service: Primitive Service. (line 1156)
-* WEBGRAB program: WEBGRAB. (line 2306)
-* Weizenbaum, Joseph: Simple Server. (line 1606)
-* XBM image format: Interacting Service.
- (line 1396)
-* Yahoo! <1>: STOXPRED. (line 3051)
-* Yahoo!: REMCONF. (line 2107)
-* | (vertical bar), |& operator (I/O): TCP Connecting. (line 800)
+ (line 6)
+* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48)
+* TCP/IP, protocols, selecting: Special File Fields. (line 11)
+* TCP/IP, sockets and: Gawk Special Files. (line 19)
+* Transmission Control Protocol, See TCP: Using Networking. (line 29)
+* troubleshooting, gawk, networks: Caveats. (line 6)
+* troubleshooting, networks, connections: Troubleshooting. (line 6)
+* troubleshooting, networks, timeouts: Caveats. (line 18)
+* UDP (User Datagram Protocol): File /inet/udp. (line 6)
+* UDP (User Datagram Protocol), TCP and: Interacting. (line 48)
+* Unix, network ports and: Setting Up. (line 37)
+* URLCHK program: URLCHK. (line 6)
+* User Datagram Protocol, See UDP: File /inet/udp. (line 6)
+* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25)
+* VRML: MAZE. (line 6)
+* web browsers, See web service: Interacting Service. (line 6)
+* web pages: Web page. (line 6)
+* web pages, images in: Interacting Service. (line 189)
+* web pages, retrieving: GETURL. (line 6)
+* web servers: Simple Server. (line 6)
+* web service <1>: PANIC. (line 6)
+* web service: Primitive Service. (line 6)
+* WEBGRAB program: WEBGRAB. (line 6)
+* Weizenbaum, Joseph: Simple Server. (line 11)
+* XBM image format: Interacting Service. (line 189)
+* Yahoo! <1>: STOXPRED. (line 6)
+* Yahoo!: REMCONF. (line 6)
+* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25)

Tag Table:
-Node: Top2000
-Node: Preface5688
-Node: Introduction7063
-Node: Stream Communications8088
-Node: Datagram Communications9261
-Node: The TCP/IP Protocols10892
-Ref: The TCP/IP Protocols-Footnote-111576
-Node: Basic Protocols11733
-Node: Ports13055
-Node: Making Connections14460
-Ref: Making Connections-Footnote-117027
-Ref: Making Connections-Footnote-217074
-Node: Using Networking17255
-Node: Gawk Special Files19609
-Node: Special File Fields21609
-Ref: table-inet-components25353
-Node: Comparing Protocols28235
-Node: File /inet/tcp28824
-Node: File /inet/udp29844
-Node: File /inet/raw30959
-Ref: File /inet/raw-Footnote-133974
-Node: TCP Connecting34051
-Node: Troubleshooting36380
-Ref: Troubleshooting-Footnote-139424
-Node: Interacting39964
-Node: Setting Up42684
-Node: Email46166
-Node: Web page48485
-Ref: Web page-Footnote-151272
-Node: Primitive Service51466
-Node: Interacting Service54194
-Ref: Interacting Service-Footnote-163291
-Node: CGI Lib63320
-Node: Simple Server70269
-Ref: Simple Server-Footnote-177975
-Node: Caveats78073
-Node: Challenges79213
-Node: Some Applications and Techniques87874
-Node: PANIC90322
-Node: GETURL92034
-Node: REMCONF94650
-Node: URLCHK100114
-Node: WEBGRAB103937
-Node: STATIST108367
-Ref: STATIST-Footnote-1120029
-Node: MAZE120471
-Node: MOBAGWHO126646
-Ref: MOBAGWHO-Footnote-1140547
-Node: STOXPRED140599
-Node: PROTBASE154809
-Node: Links167844
-Node: GNU Free Documentation License171278
-Node: Index193671
+Node: Top2007
+Node: Preface5697
+Node: Introduction7072
+Node: Stream Communications8098
+Node: Datagram Communications9271
+Node: The TCP/IP Protocols10902
+Ref: The TCP/IP Protocols-Footnote-111586
+Node: Basic Protocols11743
+Node: Ports13065
+Node: Making Connections14470
+Ref: Making Connections-Footnote-117051
+Ref: Making Connections-Footnote-217098
+Node: Using Networking17279
+Node: Gawk Special Files19633
+Node: Special File Fields21637
+Ref: table-inet-components25387
+Node: Comparing Protocols27299
+Node: File /inet/tcp27888
+Node: File /inet/udp28914
+Node: File /inet/raw30035
+Ref: File /inet/raw-Footnote-133068
+Node: TCP Connecting33148
+Node: Troubleshooting35486
+Ref: Troubleshooting-Footnote-138537
+Node: Interacting39081
+Node: Setting Up41811
+Node: Email45305
+Node: Web page47631
+Ref: Web page-Footnote-150436
+Node: Primitive Service50633
+Node: Interacting Service53367
+Ref: Interacting Service-Footnote-162496
+Node: CGI Lib62528
+Node: Simple Server69489
+Ref: Simple Server-Footnote-177219
+Node: Caveats77320
+Node: Challenges78463
+Node: Some Applications and Techniques87130
+Node: PANIC89587
+Node: GETURL91305
+Node: REMCONF93928
+Node: URLCHK99404
+Node: WEBGRAB103239
+Node: STATIST107689
+Ref: STATIST-Footnote-1119397
+Node: MAZE119842
+Node: MOBAGWHO126030
+Ref: MOBAGWHO-Footnote-1139974
+Node: STOXPRED140029
+Node: PROTBASE154284
+Node: Links167366
+Node: GNU Free Documentation License170800
+Node: Index193204

End Tag Table
diff --git a/doc/gawkinet.texi b/doc/gawkinet.texi
index 9ddabc04..f1b66073 100644
--- a/doc/gawkinet.texi
+++ b/doc/gawkinet.texi
@@ -152,7 +152,7 @@ version 3.1 and later.
@menu
* Preface:: About this document.
-* Introduction:: About networkiing.
+* Introduction:: About networking.
* Using Networking:: Some examples.
* Some Applications and Techniques:: More extended examples.
* Links:: Where to find the stuff mentioned in this
@@ -240,7 +240,7 @@ March, 2001
@node Introduction, Using Networking, Preface, Top
@chapter Networking Concepts
-This @value{CHAPTER} provides a (necessarily) brief intoduction to
+This @value{CHAPTER} provides a (necessarily) brief introduction to
computer networking concepts. For many applications of @command{gawk}
to TCP/IP networking, we hope that this is enough. For more
advanced tasks, you will need deeper background, and it may be necessary
@@ -1008,7 +1008,7 @@ look like this:
@ignore
@multitable {1234567890123} {1234567890123} {123456789012345678901234567890123456789012}
@item Service @strong{name} @tab Service @strong{number}
-@item echo @tab 7/tcp @tab echo sends back each line it receivces
+@item echo @tab 7/tcp @tab echo sends back each line it receives
@item echo @tab 7/udp @tab echo is good for testing purposes
@item discard @tab 9/tcp @tab discard behaves like @file{/dev/null}
@item discard @tab 9/udp @tab discard just throws away each line
@@ -1071,7 +1071,7 @@ services are switched off in some startup script. Systems running some
flavor of Microsoft Windows usually do @emph{not} support these services.
Nevertheless, it @emph{is} possible to do networking with @command{gawk} on
Microsoft
-Windows.@footnote{Microsoft prefered to ignore the TCP/IP
+Windows.@footnote{Microsoft preferred to ignore the TCP/IP
family of protocols until 1995. Then came the rise of the Netscape browser
as a landmark ``killer application.'' Microsoft added TCP/IP support and
their own browser to Microsoft Windows 95 at the last minute. They even back-ported
@@ -4476,7 +4476,7 @@ Now, let us look at the result. It begins with an HTTP header, which you
can ignore. Then there are some comments about the query having been
filtered to avoid spuriously high scores. After this, there is a reference
to the paper that describes the software being used for searching the data
-base. After a repitition of the original query's description we find the
+base. After a repetition of the original query's description we find the
list of significant alignments:
@smallexample
@@ -4497,7 +4497,7 @@ This means that the query sequence was found in seven human chromosomes.
But the value 0.20 (20%) means that the probability of an accidental match
is rather high (20%) in all cases and should be taken into account.
You may wonder what the first column means. It is a key to the specific
-database in which this occurence was found. The unique sequence identifiers
+database in which this occurrence was found. The unique sequence identifiers
reported in the search results can be used as sequence retrieval keys
via the NCBI server. The syntax of sequence header lines used by the NCBI
BLAST server depends on the database from which each sequence was obtained.
@@ -4581,7 +4581,7 @@ on the Internet.
@item
While Waterman's book can explain to you the algorithms employed internally
-in the database search engines, most practicioners prefer to approach
+in the database search engines, most practitioners prefer to approach
the subject differently. The applied side of Computational Biology is
called Bioinformatics, and emphasizes the tools available for day-to-day
work as well as how to actually @emph{use} them. One of the very few affordable
@@ -5092,7 +5092,7 @@ permission from their copyright holders, but you may include
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License, and all the license notices in the
-Document, and any Warrany Disclaimers, provided that you also include
+Document, and any Warranty Disclaimers, provided that you also include
the original English version of this License and the original versions
of those notices and disclaimers. In case of a disagreement between
the translation and the original version of this License or a notice
diff --git a/doc/lflashlight.pdf b/doc/lflashlight.pdf
new file mode 100644
index 00000000..4432fdd0
--- /dev/null
+++ b/doc/lflashlight.pdf
@@ -0,0 +1,56 @@
+%PDF-1.3
+%Çì¢
+6 0 obj
+<</Length 7 0 R/Filter /FlateDecode>>
+stream
+xœUA! E÷=EO€¥¯ànôÄ“™ÅèÂëÛ51„P¿Ÿß)D$[ól;pº
+>ÞÀ3~ âE÷*ò²à¹äXpƒ±Z)IwZyBêÈš¢Èl·jFœBæ3fI¡–aáV ¤HàTúMÿÔV›‡*´R‘ÔÈèjÂñowU¢¹Î4ÍEÔì ¼îImä‘tÐ>’Á1Òªë ŸO>endstream
+endobj
+7 0 obj
+168
+endobj
+5 0 obj
+<</Type/Page/MediaBox [0 0 72 28.8]
+/Rotate 0/Parent 3 0 R
+/Resources<</ProcSet[/PDF]
+/ExtGState 8 0 R
+>>
+/Contents 6 0 R
+>>
+endobj
+3 0 obj
+<< /Type /Pages /Kids [
+5 0 R
+] /Count 1
+>>
+endobj
+1 0 obj
+<</Type /Catalog /Pages 3 0 R
+>>
+endobj
+4 0 obj
+<</Type/ExtGState/Name/R4/TR/Identity/OPM 1/SM 0.02>>
+endobj
+8 0 obj
+<</R4
+4 0 R>>
+endobj
+2 0 obj
+<</Producer(GNU Ghostscript 7.07)>>endobj
+xref
+0 9
+0000000000 65535 f
+0000000471 00000 n
+0000000617 00000 n
+0000000412 00000 n
+0000000519 00000 n
+0000000272 00000 n
+0000000015 00000 n
+0000000253 00000 n
+0000000588 00000 n
+trailer
+<< /Size 9 /Root 1 0 R /Info 2 0 R
+>>
+startxref
+667
+%%EOF
diff --git a/doc/rflashlight.pdf b/doc/rflashlight.pdf
new file mode 100644
index 00000000..72c8561e
--- /dev/null
+++ b/doc/rflashlight.pdf
@@ -0,0 +1,57 @@
+%PDF-1.3
+%Çì¢
+6 0 obj
+<</Length 7 0 R/Filter /FlateDecode>>
+stream
+xœEQà †ß9'pBQ»+ì­ÛšeYRº%Ûõ'(] ‚ð£îaÔ5üZa‡ÓUðñœð „—fOàyFÁzD›EÌSH|FN)”,hŒ²ù¨äÀS?iWk¬Ö*Úž%H!F¯Ž¦Ð®®MÁë\m…ø¬
+2±õmƒÆÁ
+òt‡”gÉÏH–¿ðëÞXTR»Û쬊š>@ÿŒ2{¤MéWV¶´õó'E€endstream
+endobj
+7 0 obj
+175
+endobj
+5 0 obj
+<</Type/Page/MediaBox [0 0 72 28.8]
+/Rotate 0/Parent 3 0 R
+/Resources<</ProcSet[/PDF]
+/ExtGState 8 0 R
+>>
+/Contents 6 0 R
+>>
+endobj
+3 0 obj
+<< /Type /Pages /Kids [
+5 0 R
+] /Count 1
+>>
+endobj
+1 0 obj
+<</Type /Catalog /Pages 3 0 R
+>>
+endobj
+4 0 obj
+<</Type/ExtGState/Name/R4/TR/Identity/OPM 1/SM 0.02>>
+endobj
+8 0 obj
+<</R4
+4 0 R>>
+endobj
+2 0 obj
+<</Producer(GNU Ghostscript 7.07)>>endobj
+xref
+0 9
+0000000000 65535 f
+0000000478 00000 n
+0000000624 00000 n
+0000000419 00000 n
+0000000526 00000 n
+0000000279 00000 n
+0000000015 00000 n
+0000000260 00000 n
+0000000595 00000 n
+trailer
+<< /Size 9 /Root 1 0 R /Info 2 0 R
+>>
+startxref
+674
+%%EOF
diff --git a/doc/statist.pdf b/doc/statist.pdf
new file mode 100644
index 00000000..2122a33a
--- /dev/null
+++ b/doc/statist.pdf
Binary files differ
diff --git a/doc/texinfo.tex b/doc/texinfo.tex
index e0fbe635..c49e670b 100644
--- a/doc/texinfo.tex
+++ b/doc/texinfo.tex
@@ -3,16 +3,16 @@
% Load plain if necessary, i.e., if running under initex.
\expandafter\ifx\csname fmtname\endcsname\relax\input plain\fi
%
-\def\texinfoversion{2005-01-30.17}
+\def\texinfoversion{2007-09-03.05}
%
-% Copyright (C) 1985, 1986, 1988, 1990, 1991, 1992, 1993, 1994, 1995,
-% 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005 Free Software
-% Foundation, Inc.
+% Copyright (C) 1985, 1986, 1988, 1990, 1991, 1992, 1993, 1994, 1995, 2007,
+% 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006,
+% 2007 Free Software Foundation, Inc.
%
-% This texinfo.tex file is free software; you can redistribute it and/or
+% This texinfo.tex file is free software: you can redistribute it and/or
% modify it under the terms of the GNU General Public License as
-% published by the Free Software Foundation; either version 2, or (at
-% your option) any later version.
+% published by the Free Software Foundation, either version 3 of the
+% License, or (at your option) any later version.
%
% This texinfo.tex file is distributed in the hope that it will be
% useful, but WITHOUT ANY WARRANTY; without even the implied warranty
@@ -20,9 +20,7 @@
% General Public License for more details.
%
% You should have received a copy of the GNU General Public License
-% along with this texinfo.tex file; see the file COPYING. If not, write
-% to the Free Software Foundation, Inc., 51 Franklin Street, Fifth Floor,
-% Boston, MA 02110-1301, USA.
+% along with this program. If not, see <http://www.gnu.org/licenses/>.
%
% As a special exception, when this file is read by TeX when processing
% a Texinfo source document, you may use the result without
@@ -67,7 +65,7 @@
\everyjob{\message{[Texinfo version \texinfoversion]}%
\catcode`+=\active \catcode`\_=\active}
-\message{Basics,}
+
\chardef\other=12
% We never want plain's \outer definition of \+ in Texinfo.
@@ -153,20 +151,22 @@
\ifx\putwordDefopt\undefined \gdef\putwordDefopt{User Option}\fi
\ifx\putwordDeffunc\undefined \gdef\putwordDeffunc{Function}\fi
-% In some macros, we cannot use the `\? notation---the left quote is
-% in some cases the escape char.
+% Since the category of space is not known, we have to be careful.
+\chardef\spacecat = 10
+\def\spaceisspace{\catcode`\ =\spacecat}
+
+% sometimes characters are active, so we need control sequences.
\chardef\colonChar = `\:
\chardef\commaChar = `\,
+\chardef\dashChar = `\-
\chardef\dotChar = `\.
\chardef\exclamChar= `\!
+\chardef\lquoteChar= `\`
\chardef\questChar = `\?
+\chardef\rquoteChar= `\'
\chardef\semiChar = `\;
\chardef\underChar = `\_
-\chardef\spaceChar = `\ %
-\chardef\spacecat = 10
-\def\spaceisspace{\catcode\spaceChar=\spacecat}
-
% Ignore a token.
%
\def\gobble#1{}
@@ -277,6 +277,50 @@
\newdimen\cornerthick \cornerthick=.3pt
\newdimen\topandbottommargin \topandbottommargin=.75in
+% Output a mark which sets \thischapter, \thissection and \thiscolor.
+% We dump everything together because we only have one kind of mark.
+% This works because we only use \botmark / \topmark, not \firstmark.
+%
+% A mark contains a subexpression of the \ifcase ... \fi construct.
+% \get*marks macros below extract the needed part using \ifcase.
+%
+% Another complication is to let the user choose whether \thischapter
+% (\thissection) refers to the chapter (section) in effect at the top
+% of a page, or that at the bottom of a page. The solution is
+% described on page 260 of The TeXbook. It involves outputting two
+% marks for the sectioning macros, one before the section break, and
+% one after. I won't pretend I can describe this better than DEK...
+\def\domark{%
+ \toks0=\expandafter{\lastchapterdefs}%
+ \toks2=\expandafter{\lastsectiondefs}%
+ \toks4=\expandafter{\prevchapterdefs}%
+ \toks6=\expandafter{\prevsectiondefs}%
+ \toks8=\expandafter{\lastcolordefs}%
+ \mark{%
+ \the\toks0 \the\toks2
+ \noexpand\or \the\toks4 \the\toks6
+ \noexpand\else \the\toks8
+ }%
+}
+% \topmark doesn't work for the very first chapter (after the title
+% page or the contents), so we use \firstmark there -- this gets us
+% the mark with the chapter defs, unless the user sneaks in, e.g.,
+% @setcolor (or @url, or @link, etc.) between @contents and the very
+% first @chapter.
+\def\gettopheadingmarks{%
+ \ifcase0\topmark\fi
+ \ifx\thischapter\empty \ifcase0\firstmark\fi \fi
+}
+\def\getbottomheadingmarks{\ifcase1\botmark\fi}
+\def\getcolormarks{\ifcase2\topmark\fi}
+
+% Avoid "undefined control sequence" errors.
+\def\lastchapterdefs{}
+\def\lastsectiondefs{}
+\def\prevchapterdefs{}
+\def\prevsectiondefs{}
+\def\lastcolordefs{}
+
% Main output routine.
\chardef\PAGE = 255
\output = {\onepageout{\pagecontents\PAGE}}
@@ -294,7 +338,9 @@
%
% Do this outside of the \shipout so @code etc. will be expanded in
% the headline as they should be, not taken literally (outputting ''code).
+ \ifodd\pageno \getoddheadingmarks \else \getevenheadingmarks \fi
\setbox\headlinebox = \vbox{\let\hsize=\pagewidth \makeheadline}%
+ \ifodd\pageno \getoddfootingmarks \else \getevenfootingmarks \fi
\setbox\footlinebox = \vbox{\let\hsize=\pagewidth \makefootline}%
%
{%
@@ -302,10 +348,14 @@
% take effect in \write's, yet the group defined by the \vbox ends
% before the \shipout runs.
%
- \escapechar = `\\ % use backslash in output files.
\indexdummies % don't expand commands in the output.
\normalturnoffactive % \ in index entries must not stay \, e.g., if
- % the page break happens to be in the middle of an example.
+ % the page break happens to be in the middle of an example.
+ % We don't want .vr (or whatever) entries like this:
+ % \entry{{\tt \indexbackslash }acronym}{32}{\code {\acronym}}
+ % "\acronym" won't work when it's read back in;
+ % it needs to be
+ % {\code {{\tt \backslashcurfont }acronym}
\shipout\vbox{%
% Do this early so pdf references go to the beginning of the page.
\ifpdfmakepagedest \pdfdest name{\the\pageno} xyz\fi
@@ -333,9 +383,9 @@
\pagebody{#1}%
\ifdim\ht\footlinebox > 0pt
% Only leave this space if the footline is nonempty.
- % (We lessened \vsize for it in \oddfootingxxx.)
+ % (We lessened \vsize for it in \oddfootingyyy.)
% The \baselineskip=24pt in plain's \makefootline has no effect.
- \vskip 2\baselineskip
+ \vskip 24pt
\unvbox\footlinebox
\fi
%
@@ -356,7 +406,7 @@
\egroup % \vbox from first cropmarks clause
\fi
}% end of \shipout\vbox
- }% end of group with \normalturnoffactive
+ }% end of group with \indexdummies
\advancepageno
\ifnum\outputpenalty>-20000 \else\dosupereject\fi
}
@@ -369,7 +419,7 @@
% marginal hacks, juha@viisa.uucp (Juha Takala)
\ifvoid\margin\else % marginal info is present
\rlap{\kern\hsize\vbox to\z@{\kern1pt\box\margin \vss}}\fi
-\dimen@=\dp#1 \unvbox#1
+\dimen@=\dp#1\relax \unvbox#1\relax
\ifvoid\footins\else\vskip\skip\footins\footnoterule \unvbox\footins\fi
\ifr@ggedbottom \kern-\dimen@ \vfil \fi}
}
@@ -391,7 +441,7 @@
%
\def\parsearg{\parseargusing{}}
\def\parseargusing#1#2{%
- \def\next{#2}%
+ \def\argtorun{#2}%
\begingroup
\obeylines
\spaceisspace
@@ -422,8 +472,7 @@
\def\argcheckspacesY#1\^^M#2\^^M#3\ArgTerm{%
\def\temp{#3}%
\ifx\temp\empty
- % We cannot use \next here, as it holds the macro to run;
- % thus we reuse \temp.
+ % Do not use \next, perhaps the caller of \parsearg uses it; reuse \temp:
\let\temp\finishparsearg
\else
\let\temp\argcheckspaces
@@ -435,14 +484,14 @@
% If a _delimited_ argument is enclosed in braces, they get stripped; so
% to get _exactly_ the rest of the line, we had to prevent such situation.
% We prepended an \empty token at the very beginning and we expand it now,
-% just before passing the control to \next.
+% just before passing the control to \argtorun.
% (Similarily, we have to think about #3 of \argcheckspacesY above: it is
% either the null string, or it ends with \^^M---thus there is no danger
% that a pair of braces would be stripped.
%
% But first, we have to remove the trailing space token.
%
-\def\finishparsearg#1 \ArgTerm{\expandafter\next\expandafter{#1}}
+\def\finishparsearg#1 \ArgTerm{\expandafter\argtorun\expandafter{#1}}
% \parseargdef\foo{...}
% is roughly equivalent to
@@ -566,7 +615,7 @@
\let\}=\myrbrace
\begingroup
% Definitions to produce \{ and \} commands for indices,
- % and @{ and @} for the aux file.
+ % and @{ and @} for the aux/toc files.
\catcode`\{ = \other \catcode`\} = \other
\catcode`\[ = 1 \catcode`\] = 2
\catcode`\! = 0 \catcode`\\ = \other
@@ -647,13 +696,28 @@
\let\/=\allowbreak
% @. is an end-of-sentence period.
-\def\.{.\spacefactor=3000 }
+\def\.{.\spacefactor=\endofsentencespacefactor\space}
% @! is an end-of-sentence bang.
-\def\!{!\spacefactor=3000 }
+\def\!{!\spacefactor=\endofsentencespacefactor\space}
% @? is an end-of-sentence query.
-\def\?{?\spacefactor=3000 }
+\def\?{?\spacefactor=\endofsentencespacefactor\space}
+
+% @frenchspacing on|off says whether to put extra space after punctuation.
+%
+\def\onword{on}
+\def\offword{off}
+%
+\parseargdef\frenchspacing{%
+ \def\temp{#1}%
+ \ifx\temp\onword \plainfrenchspacing
+ \else\ifx\temp\offword \plainnonfrenchspacing
+ \else
+ \errhelp = \EMsimple
+ \errmessage{Unknown @frenchspacing option `\temp', must be on/off}%
+ \fi\fi
+}
% @w prevents a word break. Without the \leavevmode, @w at the
% beginning of a paragraph, when TeX is still in vertical mode, would
@@ -1031,9 +1095,9 @@ where each line of input produces a line of output.}
% _ active, and distinguish by seeing if the current family is \slfam,
% which is what @var uses.
{
- \catcode\underChar = \active
+ \catcode`\_ = \active
\gdef\mathunderscore{%
- \catcode\underChar=\active
+ \catcode`\_=\active
\def_{\ifnum\fam=\slfam \_\else\sb\fi}%
}
}
@@ -1076,15 +1140,24 @@ where each line of input produces a line of output.}
\def\minus{$-$}
% @dots{} outputs an ellipsis using the current font.
-% We do .5em per period so that it has the same spacing in a typewriter
-% font as three actual period characters.
+% We do .5em per period so that it has the same spacing in the cm
+% typewriter fonts as three actual period characters; on the other hand,
+% in other typewriter fonts three periods are wider than 1.5em. So do
+% whichever is larger.
%
\def\dots{%
\leavevmode
- \hbox to 1.5em{%
- \hskip 0pt plus 0.25fil
- .\hfil.\hfil.%
- \hskip 0pt plus 0.5fil
+ \setbox0=\hbox{...}% get width of three periods
+ \ifdim\wd0 > 1.5em
+ \dimen0 = \wd0
+ \else
+ \dimen0 = 1.5em
+ \fi
+ \hbox to \dimen0{%
+ \hskip 0pt plus.25fil
+ .\hskip 0pt plus1fil
+ .\hskip 0pt plus1fil
+ .\hskip 0pt plus.5fil
}%
}
@@ -1092,7 +1165,7 @@ where each line of input produces a line of output.}
%
\def\enddots{%
\dots
- \spacefactor=3000
+ \spacefactor=\endofsentencespacefactor
}
% @comma{} is so commas can be inserted into text without messing up
@@ -1176,13 +1249,134 @@ where each line of input produces a line of output.}
\fi
\fi
\fi
-%
+
+% PDF uses PostScript string constants for the names of xref targets,
+% for display in the outlines, and in other places. Thus, we have to
+% double any backslashes. Otherwise, a name like "\node" will be
+% interpreted as a newline (\n), followed by o, d, e. Not good.
+% http://www.ntg.nl/pipermail/ntg-pdftex/2004-July/000654.html
+% (and related messages, the final outcome is that it is up to the TeX
+% user to double the backslashes and otherwise make the string valid, so
+% that's what we do).
+
+% double active backslashes.
+%
+{\catcode`\@=0 \catcode`\\=\active
+ @gdef@activebackslashdouble{%
+ @catcode`@\=@active
+ @let\=@doublebackslash}
+}
+
+% To handle parens, we must adopt a different approach, since parens are
+% not active characters. hyperref.dtx (which has the same problem as
+% us) handles it with this amazing macro to replace tokens, with minor
+% changes for Texinfo. It is included here under the GPL by permission
+% from the author, Heiko Oberdiek.
+%
+% #1 is the tokens to replace.
+% #2 is the replacement.
+% #3 is the control sequence with the string.
+%
+\def\HyPsdSubst#1#2#3{%
+ \def\HyPsdReplace##1#1##2\END{%
+ ##1%
+ \ifx\\##2\\%
+ \else
+ #2%
+ \HyReturnAfterFi{%
+ \HyPsdReplace##2\END
+ }%
+ \fi
+ }%
+ \xdef#3{\expandafter\HyPsdReplace#3#1\END}%
+}
+\long\def\HyReturnAfterFi#1\fi{\fi#1}
+
+% #1 is a control sequence in which to do the replacements.
+\def\backslashparens#1{%
+ \xdef#1{#1}% redefine it as its expansion; the definition is simply
+ % \lastnode when called from \setref -> \pdfmkdest.
+ \HyPsdSubst{(}{\realbackslash(}{#1}%
+ \HyPsdSubst{)}{\realbackslash)}{#1}%
+}
+
+\newhelp\nopdfimagehelp{Texinfo supports .png, .jpg, .jpeg, and .pdf images
+with PDF output, and none of those formats could be found. (.eps cannot
+be supported due to the design of the PDF format; use regular TeX (DVI
+output) for that.)}
+
\ifpdf
- \input pdfcolor
- \pdfcatalog{/PageMode /UseOutlines}%
+ %
+ % Color manipulation macros based on pdfcolor.tex.
+ \def\cmykDarkRed{0.28 1 1 0.35}
+ \def\cmykBlack{0 0 0 1}
+ %
+ \def\pdfsetcolor#1{\pdfliteral{#1 k}}
+ % Set color, and create a mark which defines \thiscolor accordingly,
+ % so that \makeheadline knows which color to restore.
+ \def\setcolor#1{%
+ \xdef\lastcolordefs{\gdef\noexpand\thiscolor{#1}}%
+ \domark
+ \pdfsetcolor{#1}%
+ }
+ %
+ \def\maincolor{\cmykBlack}
+ \pdfsetcolor{\maincolor}
+ \edef\thiscolor{\maincolor}
+ \def\lastcolordefs{}
+ %
+ \def\makefootline{%
+ \baselineskip24pt
+ \line{\pdfsetcolor{\maincolor}\the\footline}%
+ }
+ %
+ \def\makeheadline{%
+ \vbox to 0pt{%
+ \vskip-22.5pt
+ \line{%
+ \vbox to8.5pt{}%
+ % Extract \thiscolor definition from the marks.
+ \getcolormarks
+ % Typeset the headline with \maincolor, then restore the color.
+ \pdfsetcolor{\maincolor}\the\headline\pdfsetcolor{\thiscolor}%
+ }%
+ \vss
+ }%
+ \nointerlineskip
+ }
+ %
+ %
+ \pdfcatalog{/PageMode /UseOutlines}
+ %
+ % #1 is image name, #2 width (might be empty/whitespace), #3 height (ditto).
\def\dopdfimage#1#2#3{%
- \def\imagewidth{#2}%
- \def\imageheight{#3}%
+ \def\imagewidth{#2}\setbox0 = \hbox{\ignorespaces #2}%
+ \def\imageheight{#3}\setbox2 = \hbox{\ignorespaces #3}%
+ %
+ % pdftex (and the PDF format) support .png, .jpg, .pdf (among
+ % others). Let's try in that order.
+ \let\pdfimgext=\empty
+ \begingroup
+ \openin 1 #1.png \ifeof 1
+ \openin 1 #1.jpg \ifeof 1
+ \openin 1 #1.jpeg \ifeof 1
+ \openin 1 #1.JPG \ifeof 1
+ \openin 1 #1.pdf \ifeof 1
+ \errhelp = \nopdfimagehelp
+ \errmessage{Could not find image file #1 for pdf}%
+ \else \gdef\pdfimgext{pdf}%
+ \fi
+ \else \gdef\pdfimgext{JPG}%
+ \fi
+ \else \gdef\pdfimgext{jpeg}%
+ \fi
+ \else \gdef\pdfimgext{jpg}%
+ \fi
+ \else \gdef\pdfimgext{png}%
+ \fi
+ \closein 1
+ \endgroup
+ %
% without \immediate, pdftex seg faults when the same image is
% included twice. (Version 3.14159-pre-1.0-unofficial-20010704.)
\ifnum\pdftexversion < 14
@@ -1190,26 +1384,38 @@ where each line of input produces a line of output.}
\else
\immediate\pdfximage
\fi
- \ifx\empty\imagewidth\else width \imagewidth \fi
- \ifx\empty\imageheight\else height \imageheight \fi
+ \ifdim \wd0 >0pt width \imagewidth \fi
+ \ifdim \wd2 >0pt height \imageheight \fi
\ifnum\pdftexversion<13
- #1.pdf%
+ #1.\pdfimgext
\else
- {#1.pdf}%
+ {#1.\pdfimgext}%
\fi
\ifnum\pdftexversion < 14 \else
\pdfrefximage \pdflastximage
\fi}
+ %
\def\pdfmkdest#1{{%
- % We have to set dummies so commands such as @code in a section title
- % aren't expanded.
- \atdummies
- \normalturnoffactive
- \pdfdest name{#1} xyz%
+ % We have to set dummies so commands such as @code, and characters
+ % such as \, aren't expanded when present in a section title.
+ \indexnofonts
+ \turnoffactive
+ \activebackslashdouble
+ \makevalueexpandable
+ \def\pdfdestname{#1}%
+ \backslashparens\pdfdestname
+ \safewhatsit{\pdfdest name{\pdfdestname} xyz}%
}}
+ %
+ % used to mark target names; must be expandable.
\def\pdfmkpgn#1{#1}
- \let\linkcolor = \Blue % was Cyan, but that seems light?
- \def\endlink{\Black\pdfendlink}
+ %
+ % by default, use a color that is dark enough to print on paper as
+ % nearly black, but still distinguishable for online viewing.
+ \def\urlcolor{\cmykDarkRed}
+ \def\linkcolor{\cmykDarkRed}
+ \def\endlink{\setcolor{\maincolor}\pdfendlink}
+ %
% Adding outlines to PDF; macros for calculating structure of outlines
% come from Petr Olsak
\def\expnumber#1{\expandafter\ifx\csname#1\endcsname\relax 0%
@@ -1218,20 +1424,31 @@ where each line of input produces a line of output.}
\advance\tempnum by 1
\expandafter\xdef\csname#1\endcsname{\the\tempnum}}
%
- % #1 is the section text. #2 is the pdf expression for the number
- % of subentries (or empty, for subsubsections). #3 is the node
- % text, which might be empty if this toc entry had no
- % corresponding node. #4 is the page number.
+ % #1 is the section text, which is what will be displayed in the
+ % outline by the pdf viewer. #2 is the pdf expression for the number
+ % of subentries (or empty, for subsubsections). #3 is the node text,
+ % which might be empty if this toc entry had no corresponding node.
+ % #4 is the page number
%
\def\dopdfoutline#1#2#3#4{%
% Generate a link to the node text if that exists; else, use the
% page number. We could generate a destination for the section
% text in the case where a section has no node, but it doesn't
- % seem worthwhile, since most documents are normally structured.
+ % seem worth the trouble, since most documents are normally structured.
\def\pdfoutlinedest{#3}%
- \ifx\pdfoutlinedest\empty \def\pdfoutlinedest{#4}\fi
+ \ifx\pdfoutlinedest\empty
+ \def\pdfoutlinedest{#4}%
+ \else
+ % Doubled backslashes in the name.
+ {\activebackslashdouble \xdef\pdfoutlinedest{#3}%
+ \backslashparens\pdfoutlinedest}%
+ \fi
%
- \pdfoutline goto name{\pdfmkpgn{\pdfoutlinedest}}#2{#1}%
+ % Also double the backslashes in the display string.
+ {\activebackslashdouble \xdef\pdfoutlinetext{#1}%
+ \backslashparens\pdfoutlinetext}%
+ %
+ \pdfoutline goto name{\pdfmkpgn{\pdfoutlinedest}}#2{\pdfoutlinetext}%
}
%
\def\pdfmakeoutlines{%
@@ -1272,7 +1489,7 @@ where each line of input produces a line of output.}
\def\unnsecentry{\numsecentry}%
\def\unnsubsecentry{\numsubsecentry}%
\def\unnsubsubsecentry{\numsubsubsecentry}%
- \input \jobname.toc
+ \readdatafile{toc}%
%
% Read toc second time, this time actually producing the outlines.
% The `-' means take the \expnumber as the absolute number of
@@ -1298,41 +1515,12 @@ where each line of input produces a line of output.}
% their "best" equivalent, based on the @documentencoding. Right
% now, I guess we'll just let the pdf reader have its way.
\indexnofonts
- \turnoffactive
- \input \jobname.toc
+ \setupdatafile
+ \catcode`\\=\active \otherbackslash
+ \input \tocreadfilename
\endgroup
}
%
- \def\makelinks #1,{%
- \def\params{#1}\def\E{END}%
- \ifx\params\E
- \let\nextmakelinks=\relax
- \else
- \let\nextmakelinks=\makelinks
- \ifnum\lnkcount>0,\fi
- \picknum{#1}%
- \startlink attr{/Border [0 0 0]}
- goto name{\pdfmkpgn{\the\pgn}}%
- \linkcolor #1%
- \advance\lnkcount by 1%
- \endlink
- \fi
- \nextmakelinks
- }
- \def\picknum#1{\expandafter\pn#1}
- \def\pn#1{%
- \def\p{#1}%
- \ifx\p\lbrace
- \let\nextpn=\ppn
- \else
- \let\nextpn=\ppnn
- \def\first{#1}
- \fi
- \nextpn
- }
- \def\ppn#1{\pgn=#1\gobble}
- \def\ppnn{\pgn=\first}
- \def\pdfmklnk#1{\lnkcount=0\makelinks #1,END,}
\def\skipspaces#1{\def\PP{#1}\def\D{|}%
\ifx\PP\D\let\nextsp\relax
\else\let\nextsp\skipspaces
@@ -1347,11 +1535,19 @@ where each line of input produces a line of output.}
\else
\let \startlink \pdfstartlink
\fi
+ % make a live url in pdf output.
\def\pdfurl#1{%
\begingroup
- \normalturnoffactive\def\@{@}%
+ % it seems we really need yet another set of dummies; have not
+ % tried to figure out what each command should do in the context
+ % of @url. for now, just make @/ a no-op, that's the only one
+ % people have actually reported a problem with.
+ %
+ \normalturnoffactive
+ \def\@{@}%
+ \let\/=\empty
\makevalueexpandable
- \leavevmode\Red
+ \leavevmode\setcolor{\urlcolor}%
\startlink attr{/Border [0 0 0]}%
user{/Subtype /Link /A << /S /URI /URI (#1) >>}%
\endgroup}
@@ -1378,13 +1574,14 @@ where each line of input produces a line of output.}
{\noexpand\pdflink{\the\toksC}}\toksC={}\global\countA=0}
\def\pdflink#1{%
\startlink attr{/Border [0 0 0]} goto name{\pdfmkpgn{#1}}
- \linkcolor #1\endlink}
+ \setcolor{\linkcolor}#1\endlink}
\def\done{\edef\st{\global\noexpand\toksA={\the\toksB}}\st}
\else
\let\pdfmkdest = \gobble
\let\pdfurl = \gobble
\let\endlink = \relax
- \let\linkcolor = \relax
+ \let\setcolor = \gobble
+ \let\pdfsetcolor = \gobble
\let\pdfmakeoutlines = \relax
\fi % \ifx\pdfoutput
@@ -1419,6 +1616,7 @@ where each line of input produces a line of output.}
% We don't need math for this font style.
\def\ttsl{\setfontstyle{ttsl}}
+
% Default leading.
\newdimen\textleading \textleading = 13.2pt
@@ -1430,8 +1628,12 @@ where each line of input produces a line of output.}
\def\strutheightpercent{.70833}
\def\strutdepthpercent {.29167}
%
+% can get a sort of poor man's double spacing by redefining this.
+\def\baselinefactor{1}
+%
\def\setleading#1{%
- \normalbaselineskip = #1\relax
+ \dimen0 = #1\relax
+ \normalbaselineskip = \baselinefactor\dimen0
\normallineskip = \lineskipfactor\normalbaselineskip
\normalbaselines
\setbox\strutbox =\hbox{%
@@ -1440,10 +1642,277 @@ where each line of input produces a line of output.}
}%
}
+%
+% PDF CMaps. See also LaTeX's t1.cmap.
+%
+% \cmapOT1
+\ifpdf
+ \begingroup
+ \catcode`\^^M=\active \def^^M{^^J}% Output line endings as the ^^J char.
+ \catcode`\%=12 \immediate\pdfobj stream {%!PS-Adobe-3.0 Resource-CMap
+%%DocumentNeededResources: ProcSet (CIDInit)
+%%IncludeResource: ProcSet (CIDInit)
+%%BeginResource: CMap (TeX-OT1-0)
+%%Title: (TeX-OT1-0 TeX OT1 0)
+%%Version: 1.000
+%%EndComments
+/CIDInit /ProcSet findresource begin
+12 dict begin
+begincmap
+/CIDSystemInfo
+<< /Registry (TeX)
+/Ordering (OT1)
+/Supplement 0
+>> def
+/CMapName /TeX-OT1-0 def
+/CMapType 2 def
+1 begincodespacerange
+<00> <7F>
+endcodespacerange
+8 beginbfrange
+<00> <01> <0393>
+<09> <0A> <03A8>
+<23> <26> <0023>
+<28> <3B> <0028>
+<3F> <5B> <003F>
+<5D> <5E> <005D>
+<61> <7A> <0061>
+<7B> <7C> <2013>
+endbfrange
+40 beginbfchar
+<02> <0398>
+<03> <039B>
+<04> <039E>
+<05> <03A0>
+<06> <03A3>
+<07> <03D2>
+<08> <03A6>
+<0B> <00660066>
+<0C> <00660069>
+<0D> <0066006C>
+<0E> <006600660069>
+<0F> <00660066006C>
+<10> <0131>
+<11> <0237>
+<12> <0060>
+<13> <00B4>
+<14> <02C7>
+<15> <02D8>
+<16> <00AF>
+<17> <02DA>
+<18> <00B8>
+<19> <00DF>
+<1A> <00E6>
+<1B> <0153>
+<1C> <00F8>
+<1D> <00C6>
+<1E> <0152>
+<1F> <00D8>
+<21> <0021>
+<22> <201D>
+<27> <2019>
+<3C> <00A1>
+<3D> <003D>
+<3E> <00BF>
+<5C> <201C>
+<5F> <02D9>
+<60> <2018>
+<7D> <02DD>
+<7E> <007E>
+<7F> <00A8>
+endbfchar
+endcmap
+CMapName currentdict /CMap defineresource pop
+end
+end
+%%EndResource
+%%EOF
+ }\endgroup
+ \expandafter\edef\csname cmapOT1\endcsname#1{%
+ \pdffontattr#1{/ToUnicode \the\pdflastobj\space 0 R}%
+ }%
+%
+% \cmapOT1IT
+ \begingroup
+ \catcode`\^^M=\active \def^^M{^^J}% Output line endings as the ^^J char.
+ \catcode`\%=12 \immediate\pdfobj stream {%!PS-Adobe-3.0 Resource-CMap
+%%DocumentNeededResources: ProcSet (CIDInit)
+%%IncludeResource: ProcSet (CIDInit)
+%%BeginResource: CMap (TeX-OT1IT-0)
+%%Title: (TeX-OT1IT-0 TeX OT1IT 0)
+%%Version: 1.000
+%%EndComments
+/CIDInit /ProcSet findresource begin
+12 dict begin
+begincmap
+/CIDSystemInfo
+<< /Registry (TeX)
+/Ordering (OT1IT)
+/Supplement 0
+>> def
+/CMapName /TeX-OT1IT-0 def
+/CMapType 2 def
+1 begincodespacerange
+<00> <7F>
+endcodespacerange
+8 beginbfrange
+<00> <01> <0393>
+<09> <0A> <03A8>
+<25> <26> <0025>
+<28> <3B> <0028>
+<3F> <5B> <003F>
+<5D> <5E> <005D>
+<61> <7A> <0061>
+<7B> <7C> <2013>
+endbfrange
+42 beginbfchar
+<02> <0398>
+<03> <039B>
+<04> <039E>
+<05> <03A0>
+<06> <03A3>
+<07> <03D2>
+<08> <03A6>
+<0B> <00660066>
+<0C> <00660069>
+<0D> <0066006C>
+<0E> <006600660069>
+<0F> <00660066006C>
+<10> <0131>
+<11> <0237>
+<12> <0060>
+<13> <00B4>
+<14> <02C7>
+<15> <02D8>
+<16> <00AF>
+<17> <02DA>
+<18> <00B8>
+<19> <00DF>
+<1A> <00E6>
+<1B> <0153>
+<1C> <00F8>
+<1D> <00C6>
+<1E> <0152>
+<1F> <00D8>
+<21> <0021>
+<22> <201D>
+<23> <0023>
+<24> <00A3>
+<27> <2019>
+<3C> <00A1>
+<3D> <003D>
+<3E> <00BF>
+<5C> <201C>
+<5F> <02D9>
+<60> <2018>
+<7D> <02DD>
+<7E> <007E>
+<7F> <00A8>
+endbfchar
+endcmap
+CMapName currentdict /CMap defineresource pop
+end
+end
+%%EndResource
+%%EOF
+ }\endgroup
+ \expandafter\edef\csname cmapOT1IT\endcsname#1{%
+ \pdffontattr#1{/ToUnicode \the\pdflastobj\space 0 R}%
+ }%
+%
+% \cmapOT1TT
+ \begingroup
+ \catcode`\^^M=\active \def^^M{^^J}% Output line endings as the ^^J char.
+ \catcode`\%=12 \immediate\pdfobj stream {%!PS-Adobe-3.0 Resource-CMap
+%%DocumentNeededResources: ProcSet (CIDInit)
+%%IncludeResource: ProcSet (CIDInit)
+%%BeginResource: CMap (TeX-OT1TT-0)
+%%Title: (TeX-OT1TT-0 TeX OT1TT 0)
+%%Version: 1.000
+%%EndComments
+/CIDInit /ProcSet findresource begin
+12 dict begin
+begincmap
+/CIDSystemInfo
+<< /Registry (TeX)
+/Ordering (OT1TT)
+/Supplement 0
+>> def
+/CMapName /TeX-OT1TT-0 def
+/CMapType 2 def
+1 begincodespacerange
+<00> <7F>
+endcodespacerange
+5 beginbfrange
+<00> <01> <0393>
+<09> <0A> <03A8>
+<21> <26> <0021>
+<28> <5F> <0028>
+<61> <7E> <0061>
+endbfrange
+32 beginbfchar
+<02> <0398>
+<03> <039B>
+<04> <039E>
+<05> <03A0>
+<06> <03A3>
+<07> <03D2>
+<08> <03A6>
+<0B> <2191>
+<0C> <2193>
+<0D> <0027>
+<0E> <00A1>
+<0F> <00BF>
+<10> <0131>
+<11> <0237>
+<12> <0060>
+<13> <00B4>
+<14> <02C7>
+<15> <02D8>
+<16> <00AF>
+<17> <02DA>
+<18> <00B8>
+<19> <00DF>
+<1A> <00E6>
+<1B> <0153>
+<1C> <00F8>
+<1D> <00C6>
+<1E> <0152>
+<1F> <00D8>
+<20> <2423>
+<27> <2019>
+<60> <2018>
+<7F> <00A8>
+endbfchar
+endcmap
+CMapName currentdict /CMap defineresource pop
+end
+end
+%%EndResource
+%%EOF
+ }\endgroup
+ \expandafter\edef\csname cmapOT1TT\endcsname#1{%
+ \pdffontattr#1{/ToUnicode \the\pdflastobj\space 0 R}%
+ }%
+\else
+ \expandafter\let\csname cmapOT1\endcsname\gobble
+ \expandafter\let\csname cmapOT1IT\endcsname\gobble
+ \expandafter\let\csname cmapOT1TT\endcsname\gobble
+\fi
+
+
% Set the font macro #1 to the font named #2, adding on the
% specified font prefix (normally `cm').
-% #3 is the font's design size, #4 is a scale factor
-\def\setfont#1#2#3#4{\font#1=\fontprefix#2#3 scaled #4}
+% #3 is the font's design size, #4 is a scale factor, #5 is the CMap
+% encoding (currently only OT1, OT1IT and OT1TT are allowed, pass
+% empty to omit).
+\def\setfont#1#2#3#4#5{%
+ \font#1=\fontprefix#2#3 scaled #4
+ \csname cmap#5\endcsname#1%
+}
+% This is what gets called when #5 of \setfont is empty.
+\let\cmap\gobble
+
% Use cm as the default font prefix.
% To specify the font prefix, you must define \fontprefix
@@ -1468,118 +1937,297 @@ where each line of input produces a line of output.}
\def\scshape{csc}
\def\scbshape{csc}
+% Definitions for a main text size of 11pt. This is the default in
+% Texinfo.
+%
+\def\definetextfontsizexi{%
% Text fonts (11.2pt, magstep1).
\def\textnominalsize{11pt}
\edef\mainmagstep{\magstephalf}
-\setfont\textrm\rmshape{10}{\mainmagstep}
-\setfont\texttt\ttshape{10}{\mainmagstep}
-\setfont\textbf\bfshape{10}{\mainmagstep}
-\setfont\textit\itshape{10}{\mainmagstep}
-\setfont\textsl\slshape{10}{\mainmagstep}
-\setfont\textsf\sfshape{10}{\mainmagstep}
-\setfont\textsc\scshape{10}{\mainmagstep}
-\setfont\textttsl\ttslshape{10}{\mainmagstep}
+\setfont\textrm\rmshape{10}{\mainmagstep}{OT1}
+\setfont\texttt\ttshape{10}{\mainmagstep}{OT1TT}
+\setfont\textbf\bfshape{10}{\mainmagstep}{OT1}
+\setfont\textit\itshape{10}{\mainmagstep}{OT1IT}
+\setfont\textsl\slshape{10}{\mainmagstep}{OT1}
+\setfont\textsf\sfshape{10}{\mainmagstep}{OT1}
+\setfont\textsc\scshape{10}{\mainmagstep}{OT1}
+\setfont\textttsl\ttslshape{10}{\mainmagstep}{OT1TT}
\font\texti=cmmi10 scaled \mainmagstep
\font\textsy=cmsy10 scaled \mainmagstep
+\def\textecsize{1095}
% A few fonts for @defun names and args.
-\setfont\defbf\bfshape{10}{\magstep1}
-\setfont\deftt\ttshape{10}{\magstep1}
-\setfont\defttsl\ttslshape{10}{\magstep1}
+\setfont\defbf\bfshape{10}{\magstep1}{OT1}
+\setfont\deftt\ttshape{10}{\magstep1}{OT1TT}
+\setfont\defttsl\ttslshape{10}{\magstep1}{OT1TT}
\def\df{\let\tentt=\deftt \let\tenbf = \defbf \let\tenttsl=\defttsl \bf}
% Fonts for indices, footnotes, small examples (9pt).
\def\smallnominalsize{9pt}
-\setfont\smallrm\rmshape{9}{1000}
-\setfont\smalltt\ttshape{9}{1000}
-\setfont\smallbf\bfshape{10}{900}
-\setfont\smallit\itshape{9}{1000}
-\setfont\smallsl\slshape{9}{1000}
-\setfont\smallsf\sfshape{9}{1000}
-\setfont\smallsc\scshape{10}{900}
-\setfont\smallttsl\ttslshape{10}{900}
+\setfont\smallrm\rmshape{9}{1000}{OT1}
+\setfont\smalltt\ttshape{9}{1000}{OT1TT}
+\setfont\smallbf\bfshape{10}{900}{OT1}
+\setfont\smallit\itshape{9}{1000}{OT1IT}
+\setfont\smallsl\slshape{9}{1000}{OT1}
+\setfont\smallsf\sfshape{9}{1000}{OT1}
+\setfont\smallsc\scshape{10}{900}{OT1}
+\setfont\smallttsl\ttslshape{10}{900}{OT1TT}
\font\smalli=cmmi9
\font\smallsy=cmsy9
+\def\smallecsize{0900}
% Fonts for small examples (8pt).
\def\smallernominalsize{8pt}
-\setfont\smallerrm\rmshape{8}{1000}
-\setfont\smallertt\ttshape{8}{1000}
-\setfont\smallerbf\bfshape{10}{800}
-\setfont\smallerit\itshape{8}{1000}
-\setfont\smallersl\slshape{8}{1000}
-\setfont\smallersf\sfshape{8}{1000}
-\setfont\smallersc\scshape{10}{800}
-\setfont\smallerttsl\ttslshape{10}{800}
+\setfont\smallerrm\rmshape{8}{1000}{OT1}
+\setfont\smallertt\ttshape{8}{1000}{OT1TT}
+\setfont\smallerbf\bfshape{10}{800}{OT1}
+\setfont\smallerit\itshape{8}{1000}{OT1IT}
+\setfont\smallersl\slshape{8}{1000}{OT1}
+\setfont\smallersf\sfshape{8}{1000}{OT1}
+\setfont\smallersc\scshape{10}{800}{OT1}
+\setfont\smallerttsl\ttslshape{10}{800}{OT1TT}
\font\smalleri=cmmi8
\font\smallersy=cmsy8
+\def\smallerecsize{0800}
% Fonts for title page (20.4pt):
\def\titlenominalsize{20pt}
-\setfont\titlerm\rmbshape{12}{\magstep3}
-\setfont\titleit\itbshape{10}{\magstep4}
-\setfont\titlesl\slbshape{10}{\magstep4}
-\setfont\titlett\ttbshape{12}{\magstep3}
-\setfont\titlettsl\ttslshape{10}{\magstep4}
-\setfont\titlesf\sfbshape{17}{\magstep1}
+\setfont\titlerm\rmbshape{12}{\magstep3}{OT1}
+\setfont\titleit\itbshape{10}{\magstep4}{OT1IT}
+\setfont\titlesl\slbshape{10}{\magstep4}{OT1}
+\setfont\titlett\ttbshape{12}{\magstep3}{OT1TT}
+\setfont\titlettsl\ttslshape{10}{\magstep4}{OT1TT}
+\setfont\titlesf\sfbshape{17}{\magstep1}{OT1}
\let\titlebf=\titlerm
-\setfont\titlesc\scbshape{10}{\magstep4}
+\setfont\titlesc\scbshape{10}{\magstep4}{OT1}
\font\titlei=cmmi12 scaled \magstep3
\font\titlesy=cmsy10 scaled \magstep4
\def\authorrm{\secrm}
\def\authortt{\sectt}
+\def\titleecsize{2074}
% Chapter (and unnumbered) fonts (17.28pt).
\def\chapnominalsize{17pt}
-\setfont\chaprm\rmbshape{12}{\magstep2}
-\setfont\chapit\itbshape{10}{\magstep3}
-\setfont\chapsl\slbshape{10}{\magstep3}
-\setfont\chaptt\ttbshape{12}{\magstep2}
-\setfont\chapttsl\ttslshape{10}{\magstep3}
-\setfont\chapsf\sfbshape{17}{1000}
+\setfont\chaprm\rmbshape{12}{\magstep2}{OT1}
+\setfont\chapit\itbshape{10}{\magstep3}{OT1IT}
+\setfont\chapsl\slbshape{10}{\magstep3}{OT1}
+\setfont\chaptt\ttbshape{12}{\magstep2}{OT1TT}
+\setfont\chapttsl\ttslshape{10}{\magstep3}{OT1TT}
+\setfont\chapsf\sfbshape{17}{1000}{OT1}
\let\chapbf=\chaprm
-\setfont\chapsc\scbshape{10}{\magstep3}
+\setfont\chapsc\scbshape{10}{\magstep3}{OT1}
\font\chapi=cmmi12 scaled \magstep2
\font\chapsy=cmsy10 scaled \magstep3
+\def\chapecsize{1728}
% Section fonts (14.4pt).
\def\secnominalsize{14pt}
-\setfont\secrm\rmbshape{12}{\magstep1}
-\setfont\secit\itbshape{10}{\magstep2}
-\setfont\secsl\slbshape{10}{\magstep2}
-\setfont\sectt\ttbshape{12}{\magstep1}
-\setfont\secttsl\ttslshape{10}{\magstep2}
-\setfont\secsf\sfbshape{12}{\magstep1}
+\setfont\secrm\rmbshape{12}{\magstep1}{OT1}
+\setfont\secit\itbshape{10}{\magstep2}{OT1IT}
+\setfont\secsl\slbshape{10}{\magstep2}{OT1}
+\setfont\sectt\ttbshape{12}{\magstep1}{OT1TT}
+\setfont\secttsl\ttslshape{10}{\magstep2}{OT1TT}
+\setfont\secsf\sfbshape{12}{\magstep1}{OT1}
\let\secbf\secrm
-\setfont\secsc\scbshape{10}{\magstep2}
+\setfont\secsc\scbshape{10}{\magstep2}{OT1}
\font\seci=cmmi12 scaled \magstep1
\font\secsy=cmsy10 scaled \magstep2
+\def\sececsize{1440}
% Subsection fonts (13.15pt).
\def\ssecnominalsize{13pt}
-\setfont\ssecrm\rmbshape{12}{\magstephalf}
-\setfont\ssecit\itbshape{10}{1315}
-\setfont\ssecsl\slbshape{10}{1315}
-\setfont\ssectt\ttbshape{12}{\magstephalf}
-\setfont\ssecttsl\ttslshape{10}{1315}
-\setfont\ssecsf\sfbshape{12}{\magstephalf}
+\setfont\ssecrm\rmbshape{12}{\magstephalf}{OT1}
+\setfont\ssecit\itbshape{10}{1315}{OT1IT}
+\setfont\ssecsl\slbshape{10}{1315}{OT1}
+\setfont\ssectt\ttbshape{12}{\magstephalf}{OT1TT}
+\setfont\ssecttsl\ttslshape{10}{1315}{OT1TT}
+\setfont\ssecsf\sfbshape{12}{\magstephalf}{OT1}
\let\ssecbf\ssecrm
-\setfont\ssecsc\scbshape{10}{1315}
+\setfont\ssecsc\scbshape{10}{1315}{OT1}
\font\sseci=cmmi12 scaled \magstephalf
\font\ssecsy=cmsy10 scaled 1315
+\def\ssececsize{1200}
% Reduced fonts for @acro in text (10pt).
\def\reducednominalsize{10pt}
-\setfont\reducedrm\rmshape{10}{1000}
-\setfont\reducedtt\ttshape{10}{1000}
-\setfont\reducedbf\bfshape{10}{1000}
-\setfont\reducedit\itshape{10}{1000}
-\setfont\reducedsl\slshape{10}{1000}
-\setfont\reducedsf\sfshape{10}{1000}
-\setfont\reducedsc\scshape{10}{1000}
-\setfont\reducedttsl\ttslshape{10}{1000}
+\setfont\reducedrm\rmshape{10}{1000}{OT1}
+\setfont\reducedtt\ttshape{10}{1000}{OT1TT}
+\setfont\reducedbf\bfshape{10}{1000}{OT1}
+\setfont\reducedit\itshape{10}{1000}{OT1IT}
+\setfont\reducedsl\slshape{10}{1000}{OT1}
+\setfont\reducedsf\sfshape{10}{1000}{OT1}
+\setfont\reducedsc\scshape{10}{1000}{OT1}
+\setfont\reducedttsl\ttslshape{10}{1000}{OT1TT}
\font\reducedi=cmmi10
\font\reducedsy=cmsy10
+\def\reducedecsize{1000}
+
+% reset the current fonts
+\textfonts
+\rm
+} % end of 11pt text font size definitions
+
+
+% Definitions to make the main text be 10pt Computer Modern, with
+% section, chapter, etc., sizes following suit. This is for the GNU
+% Press printing of the Emacs 22 manual. Maybe other manuals in the
+% future. Used with @smallbook, which sets the leading to 12pt.
+%
+\def\definetextfontsizex{%
+% Text fonts (10pt).
+\def\textnominalsize{10pt}
+\edef\mainmagstep{1000}
+\setfont\textrm\rmshape{10}{\mainmagstep}{OT1}
+\setfont\texttt\ttshape{10}{\mainmagstep}{OT1TT}
+\setfont\textbf\bfshape{10}{\mainmagstep}{OT1}
+\setfont\textit\itshape{10}{\mainmagstep}{OT1IT}
+\setfont\textsl\slshape{10}{\mainmagstep}{OT1}
+\setfont\textsf\sfshape{10}{\mainmagstep}{OT1}
+\setfont\textsc\scshape{10}{\mainmagstep}{OT1}
+\setfont\textttsl\ttslshape{10}{\mainmagstep}{OT1TT}
+\font\texti=cmmi10 scaled \mainmagstep
+\font\textsy=cmsy10 scaled \mainmagstep
+\def\textecsize{1000}
+
+% A few fonts for @defun names and args.
+\setfont\defbf\bfshape{10}{\magstephalf}{OT1}
+\setfont\deftt\ttshape{10}{\magstephalf}{OT1TT}
+\setfont\defttsl\ttslshape{10}{\magstephalf}{OT1TT}
+\def\df{\let\tentt=\deftt \let\tenbf = \defbf \let\tenttsl=\defttsl \bf}
+
+% Fonts for indices, footnotes, small examples (9pt).
+\def\smallnominalsize{9pt}
+\setfont\smallrm\rmshape{9}{1000}{OT1}
+\setfont\smalltt\ttshape{9}{1000}{OT1TT}
+\setfont\smallbf\bfshape{10}{900}{OT1}
+\setfont\smallit\itshape{9}{1000}{OT1IT}
+\setfont\smallsl\slshape{9}{1000}{OT1}
+\setfont\smallsf\sfshape{9}{1000}{OT1}
+\setfont\smallsc\scshape{10}{900}{OT1}
+\setfont\smallttsl\ttslshape{10}{900}{OT1TT}
+\font\smalli=cmmi9
+\font\smallsy=cmsy9
+\def\smallecsize{0900}
+
+% Fonts for small examples (8pt).
+\def\smallernominalsize{8pt}
+\setfont\smallerrm\rmshape{8}{1000}{OT1}
+\setfont\smallertt\ttshape{8}{1000}{OT1TT}
+\setfont\smallerbf\bfshape{10}{800}{OT1}
+\setfont\smallerit\itshape{8}{1000}{OT1IT}
+\setfont\smallersl\slshape{8}{1000}{OT1}
+\setfont\smallersf\sfshape{8}{1000}{OT1}
+\setfont\smallersc\scshape{10}{800}{OT1}
+\setfont\smallerttsl\ttslshape{10}{800}{OT1TT}
+\font\smalleri=cmmi8
+\font\smallersy=cmsy8
+\def\smallerecsize{0800}
+
+% Fonts for title page (20.4pt):
+\def\titlenominalsize{20pt}
+\setfont\titlerm\rmbshape{12}{\magstep3}{OT1}
+\setfont\titleit\itbshape{10}{\magstep4}{OT1IT}
+\setfont\titlesl\slbshape{10}{\magstep4}{OT1}
+\setfont\titlett\ttbshape{12}{\magstep3}{OT1TT}
+\setfont\titlettsl\ttslshape{10}{\magstep4}{OT1TT}
+\setfont\titlesf\sfbshape{17}{\magstep1}{OT1}
+\let\titlebf=\titlerm
+\setfont\titlesc\scbshape{10}{\magstep4}{OT1}
+\font\titlei=cmmi12 scaled \magstep3
+\font\titlesy=cmsy10 scaled \magstep4
+\def\authorrm{\secrm}
+\def\authortt{\sectt}
+\def\titleecsize{2074}
+
+% Chapter fonts (14.4pt).
+\def\chapnominalsize{14pt}
+\setfont\chaprm\rmbshape{12}{\magstep1}{OT1}
+\setfont\chapit\itbshape{10}{\magstep2}{OT1IT}
+\setfont\chapsl\slbshape{10}{\magstep2}{OT1}
+\setfont\chaptt\ttbshape{12}{\magstep1}{OT1TT}
+\setfont\chapttsl\ttslshape{10}{\magstep2}{OT1TT}
+\setfont\chapsf\sfbshape{12}{\magstep1}{OT1}
+\let\chapbf\chaprm
+\setfont\chapsc\scbshape{10}{\magstep2}{OT1}
+\font\chapi=cmmi12 scaled \magstep1
+\font\chapsy=cmsy10 scaled \magstep2
+\def\chapecsize{1440}
+
+% Section fonts (12pt).
+\def\secnominalsize{12pt}
+\setfont\secrm\rmbshape{12}{1000}{OT1}
+\setfont\secit\itbshape{10}{\magstep1}{OT1IT}
+\setfont\secsl\slbshape{10}{\magstep1}{OT1}
+\setfont\sectt\ttbshape{12}{1000}{OT1TT}
+\setfont\secttsl\ttslshape{10}{\magstep1}{OT1TT}
+\setfont\secsf\sfbshape{12}{1000}{OT1}
+\let\secbf\secrm
+\setfont\secsc\scbshape{10}{\magstep1}{OT1}
+\font\seci=cmmi12
+\font\secsy=cmsy10 scaled \magstep1
+\def\sececsize{1200}
+
+% Subsection fonts (10pt).
+\def\ssecnominalsize{10pt}
+\setfont\ssecrm\rmbshape{10}{1000}{OT1}
+\setfont\ssecit\itbshape{10}{1000}{OT1IT}
+\setfont\ssecsl\slbshape{10}{1000}{OT1}
+\setfont\ssectt\ttbshape{10}{1000}{OT1TT}
+\setfont\ssecttsl\ttslshape{10}{1000}{OT1TT}
+\setfont\ssecsf\sfbshape{10}{1000}{OT1}
+\let\ssecbf\ssecrm
+\setfont\ssecsc\scbshape{10}{1000}{OT1}
+\font\sseci=cmmi10
+\font\ssecsy=cmsy10
+\def\ssececsize{1000}
+
+% Reduced fonts for @acro in text (9pt).
+\def\reducednominalsize{9pt}
+\setfont\reducedrm\rmshape{9}{1000}{OT1}
+\setfont\reducedtt\ttshape{9}{1000}{OT1TT}
+\setfont\reducedbf\bfshape{10}{900}{OT1}
+\setfont\reducedit\itshape{9}{1000}{OT1IT}
+\setfont\reducedsl\slshape{9}{1000}{OT1}
+\setfont\reducedsf\sfshape{9}{1000}{OT1}
+\setfont\reducedsc\scshape{10}{900}{OT1}
+\setfont\reducedttsl\ttslshape{10}{900}{OT1TT}
+\font\reducedi=cmmi9
+\font\reducedsy=cmsy9
+\def\reducedecsize{0900}
+
+% reduce space between paragraphs
+\divide\parskip by 2
+
+% reset the current fonts
+\textfonts
+\rm
+} % end of 10pt text font size definitions
+
+
+% We provide the user-level command
+% @fonttextsize 10
+% (or 11) to redefine the text font size. pt is assumed.
+%
+\def\xword{10}
+\def\xiword{11}
+%
+\parseargdef\fonttextsize{%
+ \def\textsizearg{#1}%
+ \wlog{doing @fonttextsize \textsizearg}%
+ %
+ % Set \globaldefs so that documents can use this inside @tex, since
+ % makeinfo 4.8 does not support it, but we need it nonetheless.
+ %
+ \begingroup \globaldefs=1
+ \ifx\textsizearg\xword \definetextfontsizex
+ \else \ifx\textsizearg\xiword \definetextfontsizexi
+ \else
+ \errhelp=\EMsimple
+ \errmessage{@fonttextsize only supports `10' or `11', not `\textsizearg'}
+ \fi\fi
+ \endgroup
+}
+
% In order for the font changes to affect most math symbols and letters,
% we have to define the \textfont of the standard families. Since
@@ -1691,7 +2339,7 @@ where each line of input produces a line of output.}
% Set up the default fonts, so we can use them for creating boxes.
%
-\textfonts \rm
+\definetextfontsizexi
% Define these so they can be easily changed for other fonts.
\def\angleleft{$\langle$}
@@ -1701,10 +2349,10 @@ where each line of input produces a line of output.}
\newcount\fontdepth \fontdepth=0
% Fonts for short table of contents.
-\setfont\shortcontrm\rmshape{12}{1000}
-\setfont\shortcontbf\bfshape{10}{\magstep1} % no cmb12
-\setfont\shortcontsl\slshape{12}{1000}
-\setfont\shortconttt\ttshape{12}{1000}
+\setfont\shortcontrm\rmshape{12}{1000}{OT1}
+\setfont\shortcontbf\bfshape{10}{\magstep1}{OT1} % no cmb12
+\setfont\shortcontsl\slshape{12}{1000}{OT1}
+\setfont\shortconttt\ttshape{12}{1000}{OT1TT}
%% Add scribe-like font environments, plus @l for inline lisp (usually sans
%% serif) and @ii for TeX italic
@@ -1749,18 +2397,25 @@ where each line of input produces a line of output.}
% sometimes \x has an active definition that messes things up.
%
\catcode`@=11
- \def\frenchspacing{%
+ \def\plainfrenchspacing{%
\sfcode\dotChar =\@m \sfcode\questChar=\@m \sfcode\exclamChar=\@m
\sfcode\colonChar=\@m \sfcode\semiChar =\@m \sfcode\commaChar =\@m
+ \def\endofsentencespacefactor{1000}% for @. and friends
+ }
+ \def\plainnonfrenchspacing{%
+ \sfcode`\.3000\sfcode`\?3000\sfcode`\!3000
+ \sfcode`\:2000\sfcode`\;1500\sfcode`\,1250
+ \def\endofsentencespacefactor{3000}% for @. and friends
}
\catcode`@=\other
+\def\endofsentencespacefactor{3000}% default
\def\t#1{%
- {\tt \rawbackslash \frenchspacing #1}%
+ {\tt \rawbackslash \plainfrenchspacing #1}%
\null
}
\def\samp#1{`\tclose{#1}'\null}
-\setfont\keyrm\rmshape{8}{1000}
+\setfont\keyrm\rmshape{8}{1000}{OT1}
\font\keysy=cmsy9
\def\key#1{{\keyrm\textfont2=\keysy \leavevmode\hbox{%
\raise0.4pt\hbox{\angleleft}\kern-.08em\vtop{%
@@ -1768,6 +2423,7 @@ where each line of input produces a line of output.}
\hbox{\raise0.4pt\hbox{\vphantom{\angleleft}}#1}}%
\kern-0.4pt\hrule}%
\kern-.06em\raise0.4pt\hbox{\angleright}}}}
+\def\key #1{{\nohyphenation \uppercase{#1}}\null}
% The old definition, with no lozenge:
%\def\key #1{{\ttsl \nohyphenation \uppercase{#1}}\null}
\def\ctrl #1{{\tt \rawbackslash \hat}#1}
@@ -1793,7 +2449,7 @@ where each line of input produces a line of output.}
\nohyphenation
%
\rawbackslash
- \frenchspacing
+ \plainfrenchspacing
#1%
}%
\null
@@ -1809,12 +2465,21 @@ where each line of input produces a line of output.}
% and arrange explicitly to hyphenate at a dash.
% -- rms.
{
- \catcode`\-=\active
- \catcode`\_=\active
+ \catcode`\-=\active \catcode`\_=\active
+ \catcode`\'=\active \catcode`\`=\active
%
\global\def\code{\begingroup
- \catcode`\-=\active \let-\codedash
- \catcode`\_=\active \let_\codeunder
+ \catcode\rquoteChar=\active \catcode\lquoteChar=\active
+ \let'\codequoteright \let`\codequoteleft
+ %
+ \catcode\dashChar=\active \catcode\underChar=\active
+ \ifallowcodebreaks
+ \let-\codedash
+ \let_\codeunder
+ \else
+ \let-\realdash
+ \let_\realunder
+ \fi
\codex
}
}
@@ -1834,6 +2499,28 @@ where each line of input produces a line of output.}
}
\def\codex #1{\tclose{#1}\endgroup}
+% An additional complication: the above will allow breaks after, e.g.,
+% each of the four underscores in __typeof__. This is undesirable in
+% some manuals, especially if they don't have long identifiers in
+% general. @allowcodebreaks provides a way to control this.
+%
+\newif\ifallowcodebreaks \allowcodebreakstrue
+
+\def\keywordtrue{true}
+\def\keywordfalse{false}
+
+\parseargdef\allowcodebreaks{%
+ \def\txiarg{#1}%
+ \ifx\txiarg\keywordtrue
+ \allowcodebreakstrue
+ \else\ifx\txiarg\keywordfalse
+ \allowcodebreaksfalse
+ \else
+ \errhelp = \EMsimple
+ \errmessage{Unknown @allowcodebreaks option `\txiarg'}%
+ \fi\fi
+}
+
% @kbd is like @code, except that if the argument is just one @key command,
% then @kbd has no effect.
@@ -1841,16 +2528,16 @@ where each line of input produces a line of output.}
% `example' (@kbd uses ttsl only inside of @example and friends),
% or `code' (@kbd uses normal tty font always).
\parseargdef\kbdinputstyle{%
- \def\arg{#1}%
- \ifx\arg\worddistinct
+ \def\txiarg{#1}%
+ \ifx\txiarg\worddistinct
\gdef\kbdexamplefont{\ttsl}\gdef\kbdfont{\ttsl}%
- \else\ifx\arg\wordexample
+ \else\ifx\txiarg\wordexample
\gdef\kbdexamplefont{\ttsl}\gdef\kbdfont{\tt}%
- \else\ifx\arg\wordcode
+ \else\ifx\txiarg\wordcode
\gdef\kbdexamplefont{\tt}\gdef\kbdfont{\tt}%
\else
\errhelp = \EMsimple
- \errmessage{Unknown @kbdinputstyle option `\arg'}%
+ \errmessage{Unknown @kbdinputstyle option `\txiarg'}%
\fi\fi\fi
}
\def\worddistinct{distinct}
@@ -1962,7 +2649,7 @@ where each line of input produces a line of output.}
%
\def\abbr#1{\doabbr #1,,\finish}
\def\doabbr#1,#2,#3\finish{%
- {\frenchspacing #1}%
+ {\plainfrenchspacing #1}%
\def\temp{#2}%
\ifx\temp\empty \else
\space ({\unsepspaces \ignorespaces \temp \unskip})%
@@ -2021,6 +2708,35 @@ where each line of input produces a line of output.}
\thiseurofont
}
+% Hacks for glyphs from the EC fonts similar to \euro. We don't
+% use \let for the aliases, because sometimes we redefine the original
+% macro, and the alias should reflect the redefinition.
+\def\guillemetleft{{\ecfont \char"13}}
+\def\guillemotleft{\guillemetleft}
+\def\guillemetright{{\ecfont \char"14}}
+\def\guillemotright{\guillemetright}
+\def\guilsinglleft{{\ecfont \char"0E}}
+\def\guilsinglright{{\ecfont \char"0F}}
+\def\quotedblbase{{\ecfont \char"12}}
+\def\quotesinglbase{{\ecfont \char"0D}}
+%
+\def\ecfont{%
+ % We can't distinguish serif/sanserif and italic/slanted, but this
+ % is used for crude hacks anyway (like adding French and German
+ % quotes to documents typeset with CM, where we lose kerning), so
+ % hopefully nobody will notice/care.
+ \edef\ecsize{\csname\curfontsize ecsize\endcsname}%
+ \edef\nominalsize{\csname\curfontsize nominalsize\endcsname}%
+ \ifx\curfontstyle\bfstylename
+ % bold:
+ \font\thisecfont = ecb\ifusingit{i}{x}\ecsize \space at \nominalsize
+ \else
+ % regular:
+ \font\thisecfont = ec\ifusingit{ti}{rm}\ecsize \space at \nominalsize
+ \fi
+ \thisecfont
+}
+
% @registeredsymbol - R in a circle. The font for the R should really
% be smaller yet, but lllsize is the best we can do for now.
% Adapted from the plain.tex definition of \copyright.
@@ -2031,6 +2747,10 @@ where each line of input produces a line of output.}
}$%
}
+% @textdegree - the normal degrees sign.
+%
+\def\textdegree{$^\circ$}
+
% Laurent Siebenmann reports \Orb undefined with:
% Textures 1.7.7 (preloaded format=plain 93.10.14) (68K) 16 APR 2004 02:38
% so we'll define it if necessary.
@@ -2039,6 +2759,11 @@ where each line of input produces a line of output.}
\def\Orb{\mathhexbox20D}
\fi
+% Quotes.
+\chardef\quotedblleft="5C
+\chardef\quotedblright=`\"
+\chardef\quoteleft=`\`
+\chardef\quoteright=`\'
\message{page headings,}
@@ -2202,12 +2927,39 @@ where each line of input produces a line of output.}
%
% Leave some space for the footline. Hopefully ok to assume
% @evenfooting will not be used by itself.
- \global\advance\pageheight by -\baselineskip
- \global\advance\vsize by -\baselineskip
+ \global\advance\pageheight by -12pt
+ \global\advance\vsize by -12pt
}
\parseargdef\everyfooting{\oddfootingxxx{#1}\evenfootingxxx{#1}}
+% @evenheadingmarks top \thischapter <- chapter at the top of a page
+% @evenheadingmarks bottom \thischapter <- chapter at the bottom of a page
+%
+% The same set of arguments for:
+%
+% @oddheadingmarks
+% @evenfootingmarks
+% @oddfootingmarks
+% @everyheadingmarks
+% @everyfootingmarks
+
+\def\evenheadingmarks{\headingmarks{even}{heading}}
+\def\oddheadingmarks{\headingmarks{odd}{heading}}
+\def\evenfootingmarks{\headingmarks{even}{footing}}
+\def\oddfootingmarks{\headingmarks{odd}{footing}}
+\def\everyheadingmarks#1 {\headingmarks{even}{heading}{#1}
+ \headingmarks{odd}{heading}{#1} }
+\def\everyfootingmarks#1 {\headingmarks{even}{footing}{#1}
+ \headingmarks{odd}{footing}{#1} }
+% #1 = even/odd, #2 = heading/footing, #3 = top/bottom.
+\def\headingmarks#1#2#3 {%
+ \expandafter\let\expandafter\temp \csname get#3headingmarks\endcsname
+ \global\expandafter\let\csname get#1#2marks\endcsname \temp
+}
+
+\everyheadingmarks bottom
+\everyfootingmarks bottom
% @headings double turns headings on for double-sided printing.
% @headings single turns headings on for single-sided printing.
@@ -2862,6 +3614,7 @@ where each line of input produces a line of output.}
\def\doignore#1{\begingroup
% Scan in ``verbatim'' mode:
+ \obeylines
\catcode`\@ = \other
\catcode`\{ = \other
\catcode`\} = \other
@@ -2882,16 +3635,16 @@ where each line of input produces a line of output.}
\gdef\dodoignore#1{%
% #1 contains the command name as a string, e.g., `ifinfo'.
%
- % Define a command to find the next `@end #1', which must be on a line
- % by itself.
- \long\def\doignoretext##1^^M@end #1{\doignoretextyyy##1^^M@#1\_STOP_}%
+ % Define a command to find the next `@end #1'.
+ \long\def\doignoretext##1^^M@end #1{%
+ \doignoretextyyy##1^^M@#1\_STOP_}%
+ %
% And this command to find another #1 command, at the beginning of a
% line. (Otherwise, we would consider a line `@c @ifset', for
% example, to count as an @ifset for nesting.)
\long\def\doignoretextyyy##1^^M@#1##2\_STOP_{\doignoreyyy{##2}\_STOP_}%
%
% And now expand that command.
- \obeylines %
\doignoretext ^^M%
}%
}
@@ -2921,7 +3674,12 @@ where each line of input produces a line of output.}
}
% Finish off ignored text.
-\def\enddoignore{\endgroup\ignorespaces}
+{ \obeylines%
+ % Ignore anything after the last `@end #1'; this matters in verbatim
+ % environments, where otherwise the newline after an ignored conditional
+ % would result in a blank line in the output.
+ \gdef\enddoignore#1^^M{\endgroup\ignorespaces}%
+}
% @set VAR sets the variable VAR to an empty value.
@@ -3121,42 +3879,50 @@ where each line of input produces a line of output.}
% we have to laboriously prevent expansion for those that we don't.
%
\def\indexdummies{%
+ \escapechar = `\\ % use backslash in output files.
\def\@{@}% change to @@ when we switch to @ as escape char in index files.
\def\ {\realbackslash\space }%
+ %
% Need these in case \tex is in effect and \{ is a \delimiter again.
% But can't use \lbracecmd and \rbracecmd because texindex assumes
% braces and backslashes are used only as delimiters.
\let\{ = \mylbrace
\let\} = \myrbrace
%
- % \definedummyword defines \#1 as \realbackslash #1\space, thus
- % effectively preventing its expansion. This is used only for control
- % words, not control letters, because the \space would be incorrect
- % for control characters, but is needed to separate the control word
- % from whatever follows.
- %
- % For control letters, we have \definedummyletter, which omits the
- % space.
- %
- % These can be used both for control words that take an argument and
- % those that do not. If it is followed by {arg} in the input, then
- % that will dutifully get written to the index (or wherever).
- %
- \def\definedummyword##1{%
- \expandafter\def\csname ##1\endcsname{\realbackslash ##1\space}%
- }%
- \def\definedummyletter##1{%
- \expandafter\def\csname ##1\endcsname{\realbackslash ##1}%
- }%
- \let\definedummyaccent\definedummyletter
+ % I don't entirely understand this, but when an index entry is
+ % generated from a macro call, the \endinput which \scanmacro inserts
+ % causes processing to be prematurely terminated. This is,
+ % apparently, because \indexsorttmp is fully expanded, and \endinput
+ % is an expandable command. The redefinition below makes \endinput
+ % disappear altogether for that purpose -- although logging shows that
+ % processing continues to some further point. On the other hand, it
+ % seems \endinput does not hurt in the printed index arg, since that
+ % is still getting written without apparent harm.
+ %
+ % Sample source (mac-idx3.tex, reported by Graham Percival to
+ % help-texinfo, 22may06):
+ % @macro funindex {WORD}
+ % @findex xyz
+ % @end macro
+ % ...
+ % @funindex commtest
+ %
+ % The above is not enough to reproduce the bug, but it gives the flavor.
+ %
+ % Sample whatsit resulting:
+ % .@write3{\entry{xyz}{@folio }{@code {xyz@endinput }}}
+ %
+ % So:
+ \let\endinput = \empty
%
% Do the redefinitions.
\commondummies
}
-% For the aux file, @ is the escape character. So we want to redefine
-% everything using @ instead of \realbackslash. When everything uses
-% @, this will be simpler.
+% For the aux and toc files, @ is the escape character. So we want to
+% redefine everything using @ as the escape character (instead of
+% \realbackslash, still used for index files). When everything uses @,
+% this will be simpler.
%
\def\atdummies{%
\def\@{@@}%
@@ -3164,147 +3930,162 @@ where each line of input produces a line of output.}
\let\{ = \lbraceatcmd
\let\} = \rbraceatcmd
%
- % (See comments in \indexdummies.)
- \def\definedummyword##1{%
- \expandafter\def\csname ##1\endcsname{@##1\space}%
- }%
- \def\definedummyletter##1{%
- \expandafter\def\csname ##1\endcsname{@##1}%
- }%
- \let\definedummyaccent\definedummyletter
- %
% Do the redefinitions.
\commondummies
+ \otherbackslash
}
-% Called from \indexdummies and \atdummies. \definedummyword and
-% \definedummyletter must be defined first.
+% Called from \indexdummies and \atdummies.
%
\def\commondummies{%
%
- \normalturnoffactive
+ % \definedummyword defines \#1 as \string\#1\space, thus effectively
+ % preventing its expansion. This is used only for control% words,
+ % not control letters, because the \space would be incorrect for
+ % control characters, but is needed to separate the control word
+ % from whatever follows.
+ %
+ % For control letters, we have \definedummyletter, which omits the
+ % space.
+ %
+ % These can be used both for control words that take an argument and
+ % those that do not. If it is followed by {arg} in the input, then
+ % that will dutifully get written to the index (or wherever).
+ %
+ \def\definedummyword ##1{\def##1{\string##1\space}}%
+ \def\definedummyletter##1{\def##1{\string##1}}%
+ \let\definedummyaccent\definedummyletter
%
\commondummiesnofonts
%
- \definedummyletter{_}%
+ \definedummyletter\_%
%
% Non-English letters.
- \definedummyword{AA}%
- \definedummyword{AE}%
- \definedummyword{L}%
- \definedummyword{OE}%
- \definedummyword{O}%
- \definedummyword{aa}%
- \definedummyword{ae}%
- \definedummyword{l}%
- \definedummyword{oe}%
- \definedummyword{o}%
- \definedummyword{ss}%
- \definedummyword{exclamdown}%
- \definedummyword{questiondown}%
- \definedummyword{ordf}%
- \definedummyword{ordm}%
+ \definedummyword\AA
+ \definedummyword\AE
+ \definedummyword\L
+ \definedummyword\OE
+ \definedummyword\O
+ \definedummyword\aa
+ \definedummyword\ae
+ \definedummyword\l
+ \definedummyword\oe
+ \definedummyword\o
+ \definedummyword\ss
+ \definedummyword\exclamdown
+ \definedummyword\questiondown
+ \definedummyword\ordf
+ \definedummyword\ordm
%
% Although these internal commands shouldn't show up, sometimes they do.
- \definedummyword{bf}%
- \definedummyword{gtr}%
- \definedummyword{hat}%
- \definedummyword{less}%
- \definedummyword{sf}%
- \definedummyword{sl}%
- \definedummyword{tclose}%
- \definedummyword{tt}%
- %
- \definedummyword{LaTeX}%
- \definedummyword{TeX}%
+ \definedummyword\bf
+ \definedummyword\gtr
+ \definedummyword\hat
+ \definedummyword\less
+ \definedummyword\sf
+ \definedummyword\sl
+ \definedummyword\tclose
+ \definedummyword\tt
+ %
+ \definedummyword\LaTeX
+ \definedummyword\TeX
%
% Assorted special characters.
- \definedummyword{bullet}%
- \definedummyword{comma}%
- \definedummyword{copyright}%
- \definedummyword{registeredsymbol}%
- \definedummyword{dots}%
- \definedummyword{enddots}%
- \definedummyword{equiv}%
- \definedummyword{error}%
- \definedummyword{euro}%
- \definedummyword{expansion}%
- \definedummyword{minus}%
- \definedummyword{pounds}%
- \definedummyword{point}%
- \definedummyword{print}%
- \definedummyword{result}%
+ \definedummyword\bullet
+ \definedummyword\comma
+ \definedummyword\copyright
+ \definedummyword\registeredsymbol
+ \definedummyword\dots
+ \definedummyword\enddots
+ \definedummyword\equiv
+ \definedummyword\error
+ \definedummyword\euro
+ \definedummyword\guillemetleft
+ \definedummyword\guillemetright
+ \definedummyword\guilsinglleft
+ \definedummyword\guilsinglright
+ \definedummyword\expansion
+ \definedummyword\minus
+ \definedummyword\pounds
+ \definedummyword\point
+ \definedummyword\print
+ \definedummyword\quotedblbase
+ \definedummyword\quotedblleft
+ \definedummyword\quotedblright
+ \definedummyword\quoteleft
+ \definedummyword\quoteright
+ \definedummyword\quotesinglbase
+ \definedummyword\result
+ \definedummyword\textdegree
+ %
+ % We want to disable all macros so that they are not expanded by \write.
+ \macrolist
+ %
+ \normalturnoffactive
%
% Handle some cases of @value -- where it does not contain any
% (non-fully-expandable) commands.
\makevalueexpandable
- %
- % Normal spaces, not active ones.
- \unsepspaces
- %
- % No macro expansion.
- \turnoffmacros
}
% \commondummiesnofonts: common to \commondummies and \indexnofonts.
%
-% Better have this without active chars.
-{
- \catcode`\~=\other
- \gdef\commondummiesnofonts{%
- % Control letters and accents.
- \definedummyletter{!}%
- \definedummyaccent{"}%
- \definedummyaccent{'}%
- \definedummyletter{*}%
- \definedummyaccent{,}%
- \definedummyletter{.}%
- \definedummyletter{/}%
- \definedummyletter{:}%
- \definedummyaccent{=}%
- \definedummyletter{?}%
- \definedummyaccent{^}%
- \definedummyaccent{`}%
- \definedummyaccent{~}%
- \definedummyword{u}%
- \definedummyword{v}%
- \definedummyword{H}%
- \definedummyword{dotaccent}%
- \definedummyword{ringaccent}%
- \definedummyword{tieaccent}%
- \definedummyword{ubaraccent}%
- \definedummyword{udotaccent}%
- \definedummyword{dotless}%
- %
- % Texinfo font commands.
- \definedummyword{b}%
- \definedummyword{i}%
- \definedummyword{r}%
- \definedummyword{sc}%
- \definedummyword{t}%
- %
- % Commands that take arguments.
- \definedummyword{acronym}%
- \definedummyword{cite}%
- \definedummyword{code}%
- \definedummyword{command}%
- \definedummyword{dfn}%
- \definedummyword{emph}%
- \definedummyword{env}%
- \definedummyword{file}%
- \definedummyword{kbd}%
- \definedummyword{key}%
- \definedummyword{math}%
- \definedummyword{option}%
- \definedummyword{samp}%
- \definedummyword{strong}%
- \definedummyword{tie}%
- \definedummyword{uref}%
- \definedummyword{url}%
- \definedummyword{var}%
- \definedummyword{verb}%
- \definedummyword{w}%
- }
+\def\commondummiesnofonts{%
+ % Control letters and accents.
+ \definedummyletter\!%
+ \definedummyaccent\"%
+ \definedummyaccent\'%
+ \definedummyletter\*%
+ \definedummyaccent\,%
+ \definedummyletter\.%
+ \definedummyletter\/%
+ \definedummyletter\:%
+ \definedummyaccent\=%
+ \definedummyletter\?%
+ \definedummyaccent\^%
+ \definedummyaccent\`%
+ \definedummyaccent\~%
+ \definedummyword\u
+ \definedummyword\v
+ \definedummyword\H
+ \definedummyword\dotaccent
+ \definedummyword\ringaccent
+ \definedummyword\tieaccent
+ \definedummyword\ubaraccent
+ \definedummyword\udotaccent
+ \definedummyword\dotless
+ %
+ % Texinfo font commands.
+ \definedummyword\b
+ \definedummyword\i
+ \definedummyword\r
+ \definedummyword\sc
+ \definedummyword\t
+ %
+ % Commands that take arguments.
+ \definedummyword\acronym
+ \definedummyword\cite
+ \definedummyword\code
+ \definedummyword\command
+ \definedummyword\dfn
+ \definedummyword\emph
+ \definedummyword\env
+ \definedummyword\file
+ \definedummyword\kbd
+ \definedummyword\key
+ \definedummyword\math
+ \definedummyword\option
+ \definedummyword\pxref
+ \definedummyword\ref
+ \definedummyword\samp
+ \definedummyword\strong
+ \definedummyword\tie
+ \definedummyword\uref
+ \definedummyword\url
+ \definedummyword\var
+ \definedummyword\verb
+ \definedummyword\w
+ \definedummyword\xref
}
% \indexnofonts is used when outputting the strings to sort the index
@@ -3314,13 +4095,9 @@ where each line of input produces a line of output.}
%
\def\indexnofonts{%
% Accent commands should become @asis.
- \def\definedummyaccent##1{%
- \expandafter\let\csname ##1\endcsname\asis
- }%
+ \def\definedummyaccent##1{\let##1\asis}%
% We can just ignore other control letters.
- \def\definedummyletter##1{%
- \expandafter\def\csname ##1\endcsname{}%
- }%
+ \def\definedummyletter##1{\let##1\empty}%
% Hopefully, all control words can become @asis.
\let\definedummyword\definedummyaccent
%
@@ -3367,15 +4144,35 @@ where each line of input produces a line of output.}
\def\equiv{==}%
\def\error{error}%
\def\euro{euro}%
+ \def\guillemetleft{<<}%
+ \def\guillemetright{>>}%
+ \def\guilsinglleft{<}%
+ \def\guilsinglright{>}%
\def\expansion{==>}%
\def\minus{-}%
\def\pounds{pounds}%
\def\point{.}%
\def\print{-|}%
+ \def\quotedblbase{"}%
+ \def\quotedblleft{"}%
+ \def\quotedblright{"}%
+ \def\quoteleft{`}%
+ \def\quoteright{'}%
+ \def\quotesinglbase{,}%
\def\result{=>}%
+ \def\textdegree{degrees}%
%
- % Don't write macro names.
- \emptyusermacros
+ % We need to get rid of all macros, leaving only the arguments (if present).
+ % Of course this is not nearly correct, but it is the best we can do for now.
+ % makeinfo does not expand macros in the argument to @deffn, which ends up
+ % writing an index entry, and texindex isn't prepared for an index sort entry
+ % that starts with \.
+ %
+ % Since macro invocations are followed by braces, we can just redefine them
+ % to take a single TeX argument. The case of a macro invocation that
+ % goes to end-of-line is not handled.
+ %
+ \macrolist
}
\let\indexbackslash=0 %overridden during \printindex.
@@ -3403,11 +4200,7 @@ where each line of input produces a line of output.}
%
\edef\writeto{\csname#1indfile\endcsname}%
%
- \ifvmode
- \dosubindsanitize
- \else
- \dosubindwrite
- \fi
+ \safewhatsit\dosubindwrite
}%
\fi
}
@@ -3422,7 +4215,6 @@ where each line of input produces a line of output.}
%
% Remember, we are within a group.
\indexdummies % Must do this here, since \bf, etc expand at this stage
- \escapechar=`\\
\def\backslashcurfont{\indexbackslash}% \indexbackslash isn't defined now
% so it will be output as is; and it will print as backslash.
%
@@ -3445,13 +4237,13 @@ where each line of input produces a line of output.}
\temp
}
-% Take care of unwanted page breaks:
+% Take care of unwanted page breaks/skips around a whatsit:
%
% If a skip is the last thing on the list now, preserve it
% by backing up by \lastskip, doing the \write, then inserting
% the skip again. Otherwise, the whatsit generated by the
-% \write will make \lastskip zero. The result is that sequences
-% like this:
+% \write or \pdfdest will make \lastskip zero. The result is that
+% sequences like this:
% @end defun
% @tindex whatever
% @defun ...
@@ -3475,25 +4267,31 @@ where each line of input produces a line of output.}
%
\edef\zeroskipmacro{\expandafter\the\csname z@skip\endcsname}
%
+\newskip\whatsitskip
+\newcount\whatsitpenalty
+%
% ..., ready, GO:
%
-\def\dosubindsanitize{%
+\def\safewhatsit#1{%
+\ifhmode
+ #1%
+\else
% \lastskip and \lastpenalty cannot both be nonzero simultaneously.
- \skip0 = \lastskip
+ \whatsitskip = \lastskip
\edef\lastskipmacro{\the\lastskip}%
- \count255 = \lastpenalty
+ \whatsitpenalty = \lastpenalty
%
% If \lastskip is nonzero, that means the last item was a
% skip. And since a skip is discardable, that means this
- % -\skip0 glue we're inserting is preceded by a
+ % -\whatsitskip glue we're inserting is preceded by a
% non-discardable item, therefore it is not a potential
% breakpoint, therefore no \nobreak needed.
\ifx\lastskipmacro\zeroskipmacro
\else
- \vskip-\skip0
+ \vskip-\whatsitskip
\fi
%
- \dosubindwrite
+ #1%
%
\ifx\lastskipmacro\zeroskipmacro
% If \lastskip was zero, perhaps the last item was a penalty, and
@@ -3507,13 +4305,14 @@ where each line of input produces a line of output.}
% Description.
% would allow a break between the index-whatever whatsit
% and the "Description." paragraph.
- \ifnum\count255>9999 \penalty\count255 \fi
+ \ifnum\whatsitpenalty>9999 \penalty\whatsitpenalty \fi
\else
% On the other hand, if we had a nonzero \lastskip,
% this make-up glue would be preceded by a non-discardable item
% (the whatsit from the \write), so we must insert a \nobreak.
- \nobreak\vskip\skip0
+ \nobreak\vskip\whatsitskip
\fi
+\fi
}
% The index entry written in the file actually looks like
@@ -3556,6 +4355,7 @@ where each line of input produces a line of output.}
%
\smallfonts \rm
\tolerance = 9500
+ \plainfrenchspacing
\everypar = {}% don't want the \kern\-parindent from indentation suppression.
%
% See if the index file exists and is nonempty.
@@ -3685,11 +4485,8 @@ where each line of input produces a line of output.}
% The following is kludged to not output a line of dots in the index if
% there are no page numbers. The next person who breaks this will be
% cursed by a Unix daemon.
- \def\tempa{{\rm }}%
- \def\tempb{#1}%
- \edef\tempc{\tempa}%
- \edef\tempd{\tempb}%
- \ifx\tempc\tempd
+ \setbox\boxA = \hbox{#1}%
+ \ifdim\wd\boxA = 0pt
\ %
\else
%
@@ -3713,9 +4510,9 @@ where each line of input produces a line of output.}
\endgroup
}
-% Like \dotfill except takes at least 1 em.
+% Like plain.tex's \dotfill, except uses up at least 1 em.
\def\indexdotfill{\cleaders
- \hbox{$\mathsurround=0pt \mkern1.5mu ${\it .}$ \mkern1.5mu$}\hskip 1em plus 1fill}
+ \hbox{$\mathsurround=0pt \mkern1.5mu.\mkern1.5mu$}\hskip 1em plus 1fill}
\def\primary #1{\line{#1\hfil}}
@@ -3825,6 +4622,34 @@ where each line of input produces a line of output.}
%
% All done with double columns.
\def\enddoublecolumns{%
+ % The following penalty ensures that the page builder is exercised
+ % _before_ we change the output routine. This is necessary in the
+ % following situation:
+ %
+ % The last section of the index consists only of a single entry.
+ % Before this section, \pagetotal is less than \pagegoal, so no
+ % break occurs before the last section starts. However, the last
+ % section, consisting of \initial and the single \entry, does not
+ % fit on the page and has to be broken off. Without the following
+ % penalty the page builder will not be exercised until \eject
+ % below, and by that time we'll already have changed the output
+ % routine to the \balancecolumns version, so the next-to-last
+ % double-column page will be processed with \balancecolumns, which
+ % is wrong: The two columns will go to the main vertical list, with
+ % the broken-off section in the recent contributions. As soon as
+ % the output routine finishes, TeX starts reconsidering the page
+ % break. The two columns and the broken-off section both fit on the
+ % page, because the two columns now take up only half of the page
+ % goal. When TeX sees \eject from below which follows the final
+ % section, it invokes the new output routine that we've set after
+ % \balancecolumns below; \onepageout will try to fit the two columns
+ % and the final section into the vbox of \pageheight (see
+ % \pagebody), causing an overfull box.
+ %
+ % Note that glue won't work here, because glue does not exercise the
+ % page builder, unlike penalties (see The TeXbook, pp. 280-281).
+ \penalty0
+ %
\output = {%
% Split the last of the double-column material. Leave it on the
% current page, no automatic page break.
@@ -3934,11 +4759,15 @@ where each line of input produces a line of output.}
\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi
\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi\fi}
-% Each @chapter defines this as the name of the chapter.
-% page headings and footings can use it. @section does likewise.
-% However, they are not reliable, because we don't use marks.
+% Each @chapter defines these (using marks) as the number+name, number
+% and name of the chapter. Page headings and footings can use
+% these. @section does likewise.
\def\thischapter{}
+\def\thischapternum{}
+\def\thischaptername{}
\def\thissection{}
+\def\thissectionnum{}
+\def\thissectionname{}
\newcount\absseclevel % used to calculate proper heading level
\newcount\secbase\secbase=0 % @raisesections/@lowersections modify this count
@@ -4239,7 +5068,20 @@ where each line of input produces a line of output.}
\def\chapbreak{\dobreak \chapheadingskip {-4000}}
\def\chappager{\par\vfill\supereject}
-\def\chapoddpage{\chappager \ifodd\pageno \else \hbox to 0pt{} \chappager\fi}
+% Because \domark is called before \chapoddpage, the filler page will
+% get the headings for the next chapter, which is wrong. But we don't
+% care -- we just disable all headings on the filler page.
+\def\chapoddpage{%
+ \chappager
+ \ifodd\pageno \else
+ \begingroup
+ \evenheadline={\hfil}\evenfootline={\hfil}%
+ \oddheadline={\hfil}\oddfootline={\hfil}%
+ \hbox to 0pt{}%
+ \chappager
+ \endgroup
+ \fi
+}
\def\setchapternewpage #1 {\csname CHAPPAG#1\endcsname}
@@ -4273,41 +5115,72 @@ where each line of input produces a line of output.}
\def\Yappendixkeyword{Yappendix}
%
\def\chapmacro#1#2#3{%
+ % Insert the first mark before the heading break (see notes for \domark).
+ \let\prevchapterdefs=\lastchapterdefs
+ \let\prevsectiondefs=\lastsectiondefs
+ \gdef\lastsectiondefs{\gdef\thissectionname{}\gdef\thissectionnum{}%
+ \gdef\thissection{}}%
+ %
+ \def\temptype{#2}%
+ \ifx\temptype\Ynothingkeyword
+ \gdef\lastchapterdefs{\gdef\thischaptername{#1}\gdef\thischapternum{}%
+ \gdef\thischapter{\thischaptername}}%
+ \else\ifx\temptype\Yomitfromtockeyword
+ \gdef\lastchapterdefs{\gdef\thischaptername{#1}\gdef\thischapternum{}%
+ \gdef\thischapter{}}%
+ \else\ifx\temptype\Yappendixkeyword
+ \toks0={#1}%
+ \xdef\lastchapterdefs{%
+ \gdef\noexpand\thischaptername{\the\toks0}%
+ \gdef\noexpand\thischapternum{\appendixletter}%
+ \gdef\noexpand\thischapter{\putwordAppendix{} \noexpand\thischapternum:
+ \noexpand\thischaptername}%
+ }%
+ \else
+ \toks0={#1}%
+ \xdef\lastchapterdefs{%
+ \gdef\noexpand\thischaptername{\the\toks0}%
+ \gdef\noexpand\thischapternum{\the\chapno}%
+ \gdef\noexpand\thischapter{\putwordChapter{} \noexpand\thischapternum:
+ \noexpand\thischaptername}%
+ }%
+ \fi\fi\fi
+ %
+ % Output the mark. Pass it through \safewhatsit, to take care of
+ % the preceding space.
+ \safewhatsit\domark
+ %
+ % Insert the chapter heading break.
\pchapsepmacro
+ %
+ % Now the second mark, after the heading break. No break points
+ % between here and the heading.
+ \let\prevchapterdefs=\lastchapterdefs
+ \let\prevsectiondefs=\lastsectiondefs
+ \domark
+ %
{%
\chapfonts \rm
%
- % Have to define \thissection before calling \donoderef, because the
+ % Have to define \lastsection before calling \donoderef, because the
% xref code eventually uses it. On the other hand, it has to be called
% after \pchapsepmacro, or the headline will change too soon.
- \gdef\thissection{#1}%
- \gdef\thischaptername{#1}%
+ \gdef\lastsection{#1}%
%
% Only insert the separating space if we have a chapter/appendix
% number, and don't print the unnumbered ``number''.
- \def\temptype{#2}%
\ifx\temptype\Ynothingkeyword
\setbox0 = \hbox{}%
\def\toctype{unnchap}%
- \gdef\thischapter{#1}%
\else\ifx\temptype\Yomitfromtockeyword
\setbox0 = \hbox{}% contents like unnumbered, but no toc entry
\def\toctype{omit}%
- \gdef\thischapter{}%
\else\ifx\temptype\Yappendixkeyword
\setbox0 = \hbox{\putwordAppendix{} #3\enspace}%
\def\toctype{app}%
- % We don't substitute the actual chapter name into \thischapter
- % because we don't want its macros evaluated now. And we don't
- % use \thissection because that changes with each section.
- %
- \xdef\thischapter{\putwordAppendix{} \appendixletter:
- \noexpand\thischaptername}%
\else
\setbox0 = \hbox{#3\enspace}%
\def\toctype{numchap}%
- \xdef\thischapter{\putwordChapter{} \the\chapno:
- \noexpand\thischaptername}%
\fi\fi\fi
%
% Write the toc entry for this chapter. Must come before the
@@ -4323,6 +5196,7 @@ where each line of input produces a line of output.}
\donoderef{#2}%
%
% Typeset the actual heading.
+ \nobreak % Avoid page breaks at the interline glue.
\vbox{\hyphenpenalty=10000 \tolerance=5000 \parindent=0pt \raggedright
\hangindent=\wd0 \centerparametersmaybe
\unhbox0 #1\par}%
@@ -4385,45 +5259,95 @@ where each line of input produces a line of output.}
% the section type for xrefs (Ynumbered, Ynothing, Yappendix), #4 is the
% section number.
%
+\def\seckeyword{sec}
+%
\def\sectionheading#1#2#3#4{%
{%
% Switch to the right set of fonts.
\csname #2fonts\endcsname \rm
%
+ \def\sectionlevel{#2}%
+ \def\temptype{#3}%
+ %
+ % Insert first mark before the heading break (see notes for \domark).
+ \let\prevsectiondefs=\lastsectiondefs
+ \ifx\temptype\Ynothingkeyword
+ \ifx\sectionlevel\seckeyword
+ \gdef\lastsectiondefs{\gdef\thissectionname{#1}\gdef\thissectionnum{}%
+ \gdef\thissection{\thissectionname}}%
+ \fi
+ \else\ifx\temptype\Yomitfromtockeyword
+ % Don't redefine \thissection.
+ \else\ifx\temptype\Yappendixkeyword
+ \ifx\sectionlevel\seckeyword
+ \toks0={#1}%
+ \xdef\lastsectiondefs{%
+ \gdef\noexpand\thissectionname{\the\toks0}%
+ \gdef\noexpand\thissectionnum{#4}%
+ \gdef\noexpand\thissection{\putwordSection{} \noexpand\thissectionnum:
+ \noexpand\thissectionname}%
+ }%
+ \fi
+ \else
+ \ifx\sectionlevel\seckeyword
+ \toks0={#1}%
+ \xdef\lastsectiondefs{%
+ \gdef\noexpand\thissectionname{\the\toks0}%
+ \gdef\noexpand\thissectionnum{#4}%
+ \gdef\noexpand\thissection{\putwordSection{} \noexpand\thissectionnum:
+ \noexpand\thissectionname}%
+ }%
+ \fi
+ \fi\fi\fi
+ %
+ % Output the mark. Pass it through \safewhatsit, to take care of
+ % the preceding space.
+ \safewhatsit\domark
+ %
% Insert space above the heading.
\csname #2headingbreak\endcsname
%
- % Only insert the space after the number if we have a section number.
- \def\sectionlevel{#2}%
- \def\temptype{#3}%
+ % Now the second mark, after the heading break. No break points
+ % between here and the heading.
+ \let\prevsectiondefs=\lastsectiondefs
+ \domark
%
+ % Only insert the space after the number if we have a section number.
\ifx\temptype\Ynothingkeyword
\setbox0 = \hbox{}%
\def\toctype{unn}%
- \gdef\thissection{#1}%
+ \gdef\lastsection{#1}%
\else\ifx\temptype\Yomitfromtockeyword
% for @headings -- no section number, don't include in toc,
- % and don't redefine \thissection.
+ % and don't redefine \lastsection.
\setbox0 = \hbox{}%
\def\toctype{omit}%
\let\sectionlevel=\empty
\else\ifx\temptype\Yappendixkeyword
\setbox0 = \hbox{#4\enspace}%
\def\toctype{app}%
- \gdef\thissection{#1}%
+ \gdef\lastsection{#1}%
\else
\setbox0 = \hbox{#4\enspace}%
\def\toctype{num}%
- \gdef\thissection{#1}%
+ \gdef\lastsection{#1}%
\fi\fi\fi
%
- % Write the toc entry (before \donoderef). See comments in \chfplain.
+ % Write the toc entry (before \donoderef). See comments in \chapmacro.
\writetocentry{\toctype\sectionlevel}{#1}{#4}%
%
% Write the node reference (= pdf destination for pdftex).
- % Again, see comments in \chfplain.
+ % Again, see comments in \chapmacro.
\donoderef{#3}%
%
+ % Interline glue will be inserted when the vbox is completed.
+ % That glue will be a valid breakpoint for the page, since it'll be
+ % preceded by a whatsit (usually from the \donoderef, or from the
+ % \writetocentry if there was no node). We don't want to allow that
+ % break, since then the whatsits could end up on page n while the
+ % section is on page n+1, thus toc/etc. are wrong. Debian bug 276000.
+ \nobreak
+ %
% Output the actual section heading.
\vbox{\hyphenpenalty=10000 \tolerance=5000 \parindent=0pt \raggedright
\hangindent=\wd0 % zero if no section number
@@ -4482,11 +5406,11 @@ where each line of input produces a line of output.}
\fi
%
\iflinks
- \toks0 = {#2}%
- \toks2 = \expandafter{\lastnode}%
- \edef\temp{\write\tocfile{\realbackslash #1entry{\the\toks0}{#3}%
- {\the\toks2}{\noexpand\folio}}}%
- \temp
+ {\atdummies
+ \edef\temp{%
+ \write\tocfile{@#1entry{#2}{#3}{\lastnode}{\noexpand\folio}}}%
+ \temp
+ }%
\fi
\fi
%
@@ -4499,6 +5423,31 @@ where each line of input produces a line of output.}
\ifpdf \global\pdfmakepagedesttrue \fi
}
+
+% These characters do not print properly in the Computer Modern roman
+% fonts, so we must take special care. This is more or less redundant
+% with the Texinfo input format setup at the end of this file.
+%
+\def\activecatcodes{%
+ \catcode`\"=\active
+ \catcode`\$=\active
+ \catcode`\<=\active
+ \catcode`\>=\active
+ \catcode`\\=\active
+ \catcode`\^=\active
+ \catcode`\_=\active
+ \catcode`\|=\active
+ \catcode`\~=\active
+}
+
+
+% Read the toc file, which is essentially Texinfo input.
+\def\readtocfile{%
+ \setupdatafile
+ \activecatcodes
+ \input \tocreadfilename
+}
+
\newskip\contentsrightmargin \contentsrightmargin=1in
\newcount\savepageno
\newcount\lastnegativepageno \lastnegativepageno = -1
@@ -4515,29 +5464,29 @@ where each line of input produces a line of output.}
%
% Don't need to put `Contents' or `Short Contents' in the headline.
% It is abundantly clear what they are.
- \def\thischapter{}%
\chapmacro{#1}{Yomitfromtoc}{}%
%
\savepageno = \pageno
\begingroup % Set up to handle contents files properly.
- \catcode`\\=0 \catcode`\{=1 \catcode`\}=2 \catcode`\@=11
- % We can't do this, because then an actual ^ in a section
- % title fails, e.g., @chapter ^ -- exponentiation. --karl, 9jul97.
- %\catcode`\^=7 % to see ^^e4 as \"a etc. juha@piuha.ydi.vtt.fi
- \raggedbottom % Worry more about breakpoints than the bottom.
+ \raggedbottom % Worry more about breakpoints than the bottom.
\advance\hsize by -\contentsrightmargin % Don't use the full line length.
%
% Roman numerals for page numbers.
\ifnum \pageno>0 \global\pageno = \lastnegativepageno \fi
}
+% redefined for the two-volume lispref. We always output on
+% \jobname.toc even if this is redefined.
+%
+\def\tocreadfilename{\jobname.toc}
% Normal (long) toc.
+%
\def\contents{%
\startcontents{\putwordTOC}%
- \openin 1 \jobname.toc
+ \openin 1 \tocreadfilename\space
\ifeof 1 \else
- \input \jobname.toc
+ \readtocfile
\fi
\vfill \eject
\contentsalignmacro % in case @setchapternewpage odd is in effect
@@ -4573,9 +5522,9 @@ where each line of input produces a line of output.}
\let\numsubsubsecentry = \numsecentry
\let\appsubsubsecentry = \numsecentry
\let\unnsubsubsecentry = \numsecentry
- \openin 1 \jobname.toc
+ \openin 1 \tocreadfilename\space
\ifeof 1 \else
- \input \jobname.toc
+ \readtocfile
\fi
\closein 1
\vfill \eject
@@ -4717,7 +5666,7 @@ where each line of input produces a line of output.}
{\tentt \global\dimen0 = 3em}% Width of the box.
\dimen2 = .55pt % Thickness of rules
% The text. (`r' is open on the right, `e' somewhat less so on the left.)
-\setbox0 = \hbox{\kern-.75pt \tensf error\kern-1.5pt}
+\setbox0 = \hbox{\kern-.75pt \reducedsf error\kern-1.5pt}
%
\setbox\errorbox=\hbox to \dimen0{\hfil
\hsize = \dimen0 \advance\hsize by -5.8pt % Space to left+right.
@@ -4765,6 +5714,7 @@ where each line of input produces a line of output.}
\let\/=\ptexslash
\let\*=\ptexstar
\let\t=\ptext
+ \let\frenchspacing=\plainfrenchspacing
%
\def\endldots{\mathinner{\ldots\ldots\ldots\ldots}}%
\def\enddots{\relax\ifmmode\endldots\else$\mathsurround=0pt \endldots\,$\fi}%
@@ -4810,7 +5760,8 @@ where each line of input produces a line of output.}
\let\afterenvbreak = \aboveenvbreak
-% \nonarrowing is a flag. If "set", @lisp etc don't narrow margins.
+% \nonarrowing is a flag. If "set", @lisp etc don't narrow margins; it will
+% also clear it, so that its embedded environments do the narrowing again.
\let\nonarrowing=\relax
% @cartouche ... @end cartouche: draw rectangle w/rounded corners around
@@ -4847,7 +5798,7 @@ where each line of input produces a line of output.}
% each corner char, and rule thickness
\normbskip=\baselineskip \normpskip=\parskip \normlskip=\lineskip
% Flag to tell @lisp, etc., not to narrow margin.
- \let\nonarrowing=\comment
+ \let\nonarrowing = t%
\vbox\bgroup
\baselineskip=0pt\parskip=0pt\lineskip=0pt
\carttop
@@ -4887,11 +5838,11 @@ where each line of input produces a line of output.}
\parskip = 0pt
\parindent = 0pt
\emergencystretch = 0pt % don't try to avoid overfull boxes
- % @cartouche defines \nonarrowing to inhibit narrowing
- % at next level down.
\ifx\nonarrowing\relax
\advance \leftskip by \lispnarrowing
\exdentamount=\lispnarrowing
+ \else
+ \let\nonarrowing = \relax
\fi
\let\exdent=\nofillexdent
}
@@ -4906,12 +5857,18 @@ where each line of input produces a line of output.}
\let\SETdispenvsize\relax
\def\setnormaldispenv{%
\ifx\SETdispenvsize\smallword
+ % end paragraph for sake of leading, in case document has no blank
+ % line. This is redundant with what happens in \aboveenvbreak, but
+ % we need to do it before changing the fonts, and it's inconvenient
+ % to change the fonts afterward.
+ \ifnum \lastpenalty=10000 \else \endgraf \fi
\smallexamplefonts \rm
\fi
}
\def\setsmalldispenv{%
\ifx\SETdispenvsize\nosmallword
\else
+ \ifnum \lastpenalty=10000 \else \endgraf \fi
\smallexamplefonts \rm
\fi
}
@@ -4938,11 +5895,10 @@ where each line of input produces a line of output.}
%
\maketwodispenvs {lisp}{example}{%
\nonfillstart
- \tt
+ \tt\quoteexpand
\let\kbdfont = \kbdexamplefont % Allow @kbd to do something special.
\gobble % eat return
}
-
% @display/@smalldisplay: same as @lisp except keep current font.
%
\makedispenv {display}{%
@@ -4991,6 +5947,7 @@ where each line of input produces a line of output.}
\advance\leftskip by \lispnarrowing
\advance\rightskip by \lispnarrowing
\exdentamount = \lispnarrowing
+ \else
\let\nonarrowing = \relax
\fi
\parsearg\quotationlabel
@@ -5069,6 +6026,34 @@ where each line of input produces a line of output.}
\newdimen\tabw \setbox0=\hbox{\tt\space} \tabw=8\wd0 % tab amount
%
\def\starttabbox{\setbox0=\hbox\bgroup}
+
+% Allow an option to not replace quotes with a regular directed right
+% quote/apostrophe (char 0x27), but instead use the undirected quote
+% from cmtt (char 0x0d). The undirected quote is ugly, so don't make it
+% the default, but it works for pasting with more pdf viewers (at least
+% evince), the lilypond developers report. xpdf does work with the
+% regular 0x27.
+%
+\def\codequoteright{%
+ \expandafter\ifx\csname SETtxicodequoteundirected\endcsname\relax
+ \expandafter\ifx\csname SETcodequoteundirected\endcsname\relax
+ '%
+ \else \char'15 \fi
+ \else \char'15 \fi
+}
+%
+% and a similar option for the left quote char vs. a grave accent.
+% Modern fonts display ASCII 0x60 as a grave accent, so some people like
+% the code environments to do likewise.
+%
+\def\codequoteleft{%
+ \expandafter\ifx\csname SETtxicodequotebacktick\endcsname\relax
+ \expandafter\ifx\csname SETcodequotebacktick\endcsname\relax
+ `%
+ \else \char'22 \fi
+ \else \char'22 \fi
+}
+%
\begingroup
\catcode`\^^I=\active
\gdef\tabexpand{%
@@ -5081,15 +6066,25 @@ where each line of input produces a line of output.}
\wd0=\dimen0 \box0 \starttabbox
}%
}
+ \catcode`\'=\active
+ \gdef\rquoteexpand{\catcode\rquoteChar=\active \def'{\codequoteright}}%
+ %
+ \catcode`\`=\active
+ \gdef\lquoteexpand{\catcode\lquoteChar=\active \def`{\codequoteleft}}%
+ %
+ \gdef\quoteexpand{\rquoteexpand \lquoteexpand}%
\endgroup
+
+% start the verbatim environment.
\def\setupverbatim{%
+ \let\nonarrowing = t%
\nonfillstart
- \advance\leftskip by -\defbodyindent
% Easiest (and conventionally used) font for verbatim
\tt
\def\par{\leavevmode\egroup\box0\endgraf}%
\catcode`\`=\active
\tabexpand
+ \quoteexpand
% Respect line breaks,
% print special symbols as themselves, and
% make each space count
@@ -5174,27 +6169,35 @@ where each line of input produces a line of output.}
\endgroup
}
+
\message{defuns,}
% @defun etc.
\newskip\defbodyindent \defbodyindent=.4in
\newskip\defargsindent \defargsindent=50pt
\newskip\deflastargmargin \deflastargmargin=18pt
+\newcount\defunpenalty
% Start the processing of @deffn:
\def\startdefun{%
\ifnum\lastpenalty<10000
\medbreak
+ \defunpenalty=10003 % Will keep this @deffn together with the
+ % following @def command, see below.
\else
% If there are two @def commands in a row, we'll have a \nobreak,
% which is there to keep the function description together with its
% header. But if there's nothing but headers, we need to allow a
% break somewhere. Check specifically for penalty 10002, inserted
- % by \defargscommonending, instead of 10000, since the sectioning
+ % by \printdefunline, instead of 10000, since the sectioning
% commands also insert a nobreak penalty, and we don't want to allow
% a break between a section heading and a defun.
- %
- \ifnum\lastpenalty=10002 \penalty2000 \fi
+ %
+ % As a minor refinement, we avoid "club" headers by signalling
+ % with penalty of 10003 after the very first @deffn in the
+ % sequence (see above), and penalty of 10002 after any following
+ % @def command.
+ \ifnum\lastpenalty=10002 \penalty2000 \else \defunpenalty=10002 \fi
%
% Similarly, after a section heading, do not allow a break.
% But do insert the glue.
@@ -5212,7 +6215,7 @@ where each line of input produces a line of output.}
%
% As above, allow line break if we have multiple x headers in a row.
% It's not a great place, though.
- \ifnum\lastpenalty=10002 \penalty3000 \fi
+ \ifnum\lastpenalty=10002 \penalty3000 \else \defunpenalty=10002 \fi
%
% And now, it's time to reuse the body of the original defun:
\expandafter\gobbledefun#1%
@@ -5230,7 +6233,7 @@ where each line of input produces a line of output.}
\advance\rightskip by 0pt plus 1fil
\endgraf
\nobreak\vskip -\parskip
- \penalty 10002 % signal to \startdefun and \dodefunx
+ \penalty\defunpenalty % signal to \startdefun and \dodefunx
% Some of the @defun-type tags do not enable magic parentheses,
% rendering the following check redundant. But we don't optimize.
\checkparencounts
@@ -5499,12 +6502,14 @@ where each line of input produces a line of output.}
\ifnum\parencount=0 \else \badparencount \fi
\ifnum\brackcount=0 \else \badbrackcount \fi
}
+% these should not use \errmessage; the glibc manual, at least, actually
+% has such constructs (when documenting function pointers).
\def\badparencount{%
- \errmessage{Unbalanced parentheses in @def}%
+ \message{Warning: unbalanced parentheses in @def...}%
\global\parencount=0
}
\def\badbrackcount{%
- \errmessage{Unbalanced square braces in @def}%
+ \message{Warning: unbalanced square brackets in @def...}%
\global\brackcount=0
}
@@ -5539,7 +6544,6 @@ where each line of input produces a line of output.}
\spaceisspace
%
% Append \endinput to make sure that TeX does not see the ending newline.
- %
% I've verified that it is necessary both for e-TeX and for ordinary TeX
% --kasal, 29nov03
\scantokens{#1\endinput}%
@@ -5554,8 +6558,19 @@ where each line of input produces a line of output.}
\newcount\paramno % Count of parameters
\newtoks\macname % Macro name
\newif\ifrecursive % Is it recursive?
-\def\macrolist{} % List of all defined macros in the form
- % \do\macro1\do\macro2...
+
+% List of all defined macros in the form
+% \definedummyword\macro1\definedummyword\macro2...
+% Currently is also contains all @aliases; the list can be split
+% if there is a need.
+\def\macrolist{}
+
+% Add the macro to \macrolist
+\def\addtomacrolist#1{\expandafter \addtomacrolistxxx \csname#1\endcsname}
+\def\addtomacrolistxxx#1{%
+ \toks0 = \expandafter{\macrolist\definedummyword#1}%
+ \xdef\macrolist{\the\toks0}%
+}
% Utility routines.
% This does \let #1 = #2, with \csnames; that is,
@@ -5589,6 +6604,10 @@ where each line of input produces a line of output.}
% all characters are catcode 10, 11 or 12, except \ which is active
% (as in normal texinfo). It is necessary to change the definition of \.
+% Non-ASCII encodings make 8-bit characters active, so un-activate
+% them to avoid their expansion. Must do this non-globally, to
+% confine the change to the current group.
+
% It's necessary to have hard CRs when the macro is executed. This is
% done by making ^^M (\endlinechar) catcode 12 when reading the macro
% body, and then making it the \newlinechar in \scanmacro.
@@ -5603,6 +6622,7 @@ where each line of input produces a line of output.}
\catcode`\_=\other
\catcode`\|=\other
\catcode`\~=\other
+ \ifx\declaredencoding\ascii \else \setnonasciicharscatcodenonglobal\other \fi
}
\def\scanargctxt{%
@@ -5653,10 +6673,7 @@ where each line of input produces a line of output.}
\else \errmessage{Macro name \the\macname\space already defined}\fi
\global\cslet{macsave.\the\macname}{\the\macname}%
\global\expandafter\let\csname ismacro.\the\macname\endcsname=1%
- % Add the macroname to \macrolist
- \toks0 = \expandafter{\macrolist\do}%
- \xdef\macrolist{\the\toks0
- \expandafter\noexpand\csname\the\macname\endcsname}%
+ \addtomacrolist{\the\macname}%
\fi
\begingroup \macrobodyctxt
\ifrecursive \expandafter\parsermacbody
@@ -5670,7 +6687,7 @@ where each line of input produces a line of output.}
% Remove the macro name from \macrolist:
\begingroup
\expandafter\let\csname#1\endcsname \relax
- \let\do\unmacrodo
+ \let\definedummyword\unmacrodo
\xdef\macrolist{\macrolist}%
\endgroup
\else
@@ -5682,10 +6699,10 @@ where each line of input produces a line of output.}
% macro definitions that have been changed to \relax.
%
\def\unmacrodo#1{%
- \ifx#1\relax
+ \ifx #1\relax
% remove this
\else
- \noexpand\do \noexpand #1%
+ \noexpand\definedummyword \noexpand#1%
\fi
}
@@ -5798,30 +6815,11 @@ where each line of input produces a line of output.}
% {. If so it reads up to the closing }, if not, it reads the whole
% line. Whatever was read is then fed to the next control sequence
% as an argument (by \parsebrace or \parsearg)
-\def\braceorline#1{\let\next=#1\futurelet\nchar\braceorlinexxx}
+\def\braceorline#1{\let\macnamexxx=#1\futurelet\nchar\braceorlinexxx}
\def\braceorlinexxx{%
\ifx\nchar\bgroup\else
\expandafter\parsearg
- \fi \next}
-
-% We want to disable all macros during \shipout so that they are not
-% expanded by \write.
-\def\turnoffmacros{\begingroup \def\do##1{\let\noexpand##1=\relax}%
- \edef\next{\macrolist}\expandafter\endgroup\next}
-
-% For \indexnofonts, we need to get rid of all macros, leaving only the
-% arguments (if present). Of course this is not nearly correct, but it
-% is the best we can do for now. makeinfo does not expand macros in the
-% argument to @deffn, which ends up writing an index entry, and texindex
-% isn't prepared for an index sort entry that starts with \.
-%
-% Since macro invocations are followed by braces, we can just redefine them
-% to take a single TeX argument. The case of a macro invocation that
-% goes to end-of-line is not handled.
-%
-\def\emptyusermacros{\begingroup
- \def\do##1{\let\noexpand##1=\noexpand\asis}%
- \edef\next{\macrolist}\expandafter\endgroup\next}
+ \fi \macnamexxx}
% @alias.
@@ -5832,6 +6830,7 @@ where each line of input produces a line of output.}
\def\aliasyyy #1=#2\relax{%
{%
\expandafter\let\obeyedspace=\empty
+ \addtomacrolist{#1}%
\xdef\next{\global\let\makecsname{#1}=\makecsname{#2}}%
}%
\next
@@ -5841,7 +6840,6 @@ where each line of input produces a line of output.}
\message{cross references,}
\newwrite\auxfile
-
\newif\ifhavexrefs % True if xref values are known.
\newif\ifwarnedxrefs % True if we warned once that they aren't known.
@@ -5886,7 +6884,7 @@ where each line of input produces a line of output.}
% \setref{NAME}{SNT} defines a cross-reference point NAME (a node or an
% anchor), which consists of three parts:
-% 1) NAME-title - the current sectioning name taken from \thissection,
+% 1) NAME-title - the current sectioning name taken from \lastsection,
% or the anchor name.
% 2) NAME-snt - section number and type, passed as the SNT arg, or
% empty for anchors.
@@ -5901,16 +6899,14 @@ where each line of input produces a line of output.}
\iflinks
{%
\atdummies % preserve commands, but don't expand them
- \turnoffactive
- \otherbackslash
\edef\writexrdef##1##2{%
\write\auxfile{@xrdef{#1-% #1 of \setref, expanded by the \edef
##1}{##2}}% these are parameters of \writexrdef
}%
- \toks0 = \expandafter{\thissection}%
+ \toks0 = \expandafter{\lastsection}%
\immediate \writexrdef{title}{\the\toks0 }%
\immediate \writexrdef{snt}{\csname #2\endcsname}% \Ynumbered etc.
- \writexrdef{pg}{\folio}% will be written later, during \shipout
+ \safewhatsit{\writexrdef{pg}{\folio}}% will be written later, during \shipout
}%
\fi
}
@@ -5956,16 +6952,21 @@ where each line of input produces a line of output.}
\ifpdf
\leavevmode
\getfilename{#4}%
- {\turnoffactive \otherbackslash
+ {\indexnofonts
+ \turnoffactive
+ % See comments at \activebackslashdouble.
+ {\activebackslashdouble \xdef\pdfxrefdest{#1}%
+ \backslashparens\pdfxrefdest}%
+ %
\ifnum\filenamelength>0
\startlink attr{/Border [0 0 0]}%
- goto file{\the\filename.pdf} name{#1}%
+ goto file{\the\filename.pdf} name{\pdfxrefdest}%
\else
\startlink attr{/Border [0 0 0]}%
- goto name{\pdfmkpgn{#1}}%
+ goto name{\pdfmkpgn{\pdfxrefdest}}%
\fi
}%
- \linkcolor
+ \setcolor{\linkcolor}%
\fi
%
% Float references are printed completely differently: "Figure 1.2"
@@ -5976,7 +6977,6 @@ where each line of input produces a line of output.}
% include an _ in the xref name, etc.
\indexnofonts
\turnoffactive
- \otherbackslash
\expandafter\global\expandafter\let\expandafter\Xthisreftitle
\csname XR#1-title\endcsname
}%
@@ -5984,7 +6984,7 @@ where each line of input produces a line of output.}
% If the user specified the print name (third arg) to the ref,
% print it instead of our usual "Figure 1.2".
\ifdim\wd0 = 0pt
- \refx{#1-snt}%
+ \refx{#1-snt}{}%
\else
\printedrefname
\fi
@@ -6004,14 +7004,14 @@ where each line of input produces a line of output.}
% is a loss. Therefore, we give the text of the node name again, so it
% is as if TeX is seeing it for the first time.
\ifdim \wd1 > 0pt
- \putwordsection{} ``\printedrefname'' \putwordin{} \cite{\printedmanual}%
+ \putwordSection{} ``\printedrefname'' \putwordin{} \cite{\printedmanual}%
\else
% _ (for example) has to be the character _ for the purposes of the
% control sequence corresponding to the node, but it has to expand
% into the usual \leavevmode...\vrule stuff for purposes of
% printing. So we \turnoffactive for the \refx-snt, back on for the
% printing, back off for the \refx-pg.
- {\turnoffactive \otherbackslash
+ {\turnoffactive
% Only output a following space if the -snt ref is nonempty; for
% @unnumbered and @anchor, it won't be.
\setbox2 = \hbox{\ignorespaces \refx{#1-snt}{}}%
@@ -6024,7 +7024,7 @@ where each line of input produces a line of output.}
,\space
%
% output the `page 3'.
- \turnoffactive \otherbackslash \putwordpage\tie\refx{#1-pg}{}%
+ \turnoffactive \putwordpage\tie\refx{#1-pg}{}%
\fi
\fi
\endlink
@@ -6100,10 +7100,18 @@ where each line of input produces a line of output.}
% collisions). But if this is a float type, we have more work to do.
%
\def\xrdef#1#2{%
- \expandafter\gdef\csname XR#1\endcsname{#2}% remember this xref value.
+ {% The node name might contain 8-bit characters, which in our current
+ % implementation are changed to commands like @'e. Don't let these
+ % mess up the control sequence name.
+ \indexnofonts
+ \turnoffactive
+ \xdef\safexrefname{#1}%
+ }%
+ %
+ \expandafter\gdef\csname XR\safexrefname\endcsname{#2}% remember this xref
%
% Was that xref control sequence that we just defined for a float?
- \expandafter\iffloat\csname XR#1\endcsname
+ \expandafter\iffloat\csname XR\safexrefname\endcsname
% it was a float, and we have the (safe) float type in \iffloattype.
\expandafter\let\expandafter\floatlist
\csname floatlist\iffloattype\endcsname
@@ -6118,7 +7126,8 @@ where each line of input produces a line of output.}
%
% Remember this xref in the control sequence \floatlistFLOATTYPE,
% for later use in \listoffloats.
- \expandafter\xdef\csname floatlist\iffloattype\endcsname{\the\toks0{#1}}%
+ \expandafter\xdef\csname floatlist\iffloattype\endcsname{\the\toks0
+ {\safexrefname}}%
\fi
}
@@ -6127,13 +7136,13 @@ where each line of input produces a line of output.}
\def\tryauxfile{%
\openin 1 \jobname.aux
\ifeof 1 \else
- \readauxfile
+ \readdatafile{aux}%
\global\havexrefstrue
\fi
\closein 1
}
-\def\readauxfile{\begingroup
+\def\setupdatafile{%
\catcode`\^^@=\other
\catcode`\^^A=\other
\catcode`\^^B=\other
@@ -6202,11 +7211,11 @@ where each line of input produces a line of output.}
%
% Make the characters 128-255 be printing characters.
{%
- \count 1=128
+ \count1=128
\def\loop{%
- \catcode\count 1=\other
- \advance\count 1 by 1
- \ifnum \count 1<256 \loop \fi
+ \catcode\count1=\other
+ \advance\count1 by 1
+ \ifnum \count1<256 \loop \fi
}%
}%
%
@@ -6214,8 +7223,12 @@ where each line of input produces a line of output.}
\catcode`\{=1
\catcode`\}=2
\catcode`\@=0
- %
- \input \jobname.aux
+}
+
+\def\readdatafile#1{%
+\begingroup
+ \setupdatafile
+ \input\jobname.#1
\endgroup}
@@ -6411,7 +7424,7 @@ where each line of input produces a line of output.}
% above and below.
\nobreak\vskip\parskip
\nobreak
- \line\bgroup\hss
+ \line\bgroup
\fi
%
% Output the image.
@@ -6424,7 +7437,7 @@ where each line of input produces a line of output.}
\epsfbox{#1.eps}%
\fi
%
- \ifimagevmode \hss \egroup \bigbreak \fi % space after the image
+ \ifimagevmode \egroup \bigbreak \fi % space after the image
\endgroup}
@@ -6491,13 +7504,13 @@ where each line of input produces a line of output.}
\global\advance\floatno by 1
%
{%
- % This magic value for \thissection is output by \setref as the
+ % This magic value for \lastsection is output by \setref as the
% XREFLABEL-title value. \xrefX uses it to distinguish float
% labels (which have a completely different output format) from
% node and anchor labels. And \xrdef uses it to construct the
% lists of floats.
%
- \edef\thissection{\floatmagic=\safefloattype}%
+ \edef\lastsection{\floatmagic=\safefloattype}%
\setref{\floatlabel}{Yfloat}%
}%
\fi
@@ -6564,7 +7577,8 @@ where each line of input produces a line of output.}
% \floatlabel-lof. Besides \floatident, we include the short
% caption if specified, else the full caption if specified, else nothing.
{%
- \atdummies \turnoffactive \otherbackslash
+ \atdummies
+ %
% since we read the caption text in the macro world, where ^^M
% is turned into a normal character, we have to scan it back, so
% we don't write the literal three characters "^^M" into the aux file.
@@ -6585,8 +7599,9 @@ where each line of input produces a line of output.}
%
% place the captured inserts
%
- % BEWARE: when the floats start float, we have to issue warning whenever an
- % insert appears inside a float which could possibly float. --kasal, 26may04
+ % BEWARE: when the floats start floating, we have to issue warning
+ % whenever an insert appears inside a float which could possibly
+ % float. --kasal, 26may04
%
\checkinserts
}
@@ -6630,7 +7645,7 @@ where each line of input produces a line of output.}
% #1 is the control sequence we are passed; we expand into a conditional
% which is true if #1 represents a float ref. That is, the magic
-% \thissection value which we \setref above.
+% \lastsection value which we \setref above.
%
\def\iffloat#1{\expandafter\doiffloat#1==\finish}
%
@@ -6691,39 +7706,871 @@ where each line of input produces a line of output.}
\writeentry
}}
+
\message{localization,}
-% and i18n.
% @documentlanguage is usually given very early, just after
% @setfilename. If done too late, it may not override everything
-% properly. Single argument is the language abbreviation.
-% It would be nice if we could set up a hyphenation file here.
+% properly. Single argument is the language (de) or locale (de_DE)
+% abbreviation. It would be nice if we could set up a hyphenation file.
%
-\parseargdef\documentlanguage{%
+{
+ \catcode`\_ = \active
+ \globaldefs=1
+\parseargdef\documentlanguage{\begingroup
+ \let_=\normalunderscore % normal _ character for filenames
\tex % read txi-??.tex file in plain TeX.
- % Read the file if it exists.
+ % Read the file by the name they passed if it exists.
\openin 1 txi-#1.tex
\ifeof 1
- \errhelp = \nolanghelp
- \errmessage{Cannot read language file txi-#1.tex}%
+ \documentlanguagetrywithoutunderscore{#1_\finish}%
\else
\input txi-#1.tex
\fi
\closein 1
\endgroup
+\endgroup}
}
+%
+% If they passed de_DE, and txi-de_DE.tex doesn't exist,
+% try txi-de.tex.
+%
+\def\documentlanguagetrywithoutunderscore#1_#2\finish{%
+ \openin 1 txi-#1.tex
+ \ifeof 1
+ \errhelp = \nolanghelp
+ \errmessage{Cannot read language file txi-#1.tex}%
+ \else
+ \input txi-#1.tex
+ \fi
+ \closein 1
+}
+%
\newhelp\nolanghelp{The given language definition file cannot be found or
is empty. Maybe you need to install it? In the current directory
should work if nowhere else does.}
+% Set the catcode of characters 128 through 255 to the specified number.
+%
+\def\setnonasciicharscatcode#1{%
+ \count255=128
+ \loop\ifnum\count255<256
+ \global\catcode\count255=#1\relax
+ \advance\count255 by 1
+ \repeat
+}
-% @documentencoding should change something in TeX eventually, most
-% likely, but for now just recognize it.
-\let\documentencoding = \comment
+\def\setnonasciicharscatcodenonglobal#1{%
+ \count255=128
+ \loop\ifnum\count255<256
+ \catcode\count255=#1\relax
+ \advance\count255 by 1
+ \repeat
+}
+% @documentencoding sets the definition of non-ASCII characters
+% according to the specified encoding.
+%
+\parseargdef\documentencoding{%
+ % Encoding being declared for the document.
+ \def\declaredencoding{\csname #1.enc\endcsname}%
+ %
+ % Supported encodings: names converted to tokens in order to be able
+ % to compare them with \ifx.
+ \def\ascii{\csname US-ASCII.enc\endcsname}%
+ \def\latnine{\csname ISO-8859-15.enc\endcsname}%
+ \def\latone{\csname ISO-8859-1.enc\endcsname}%
+ \def\lattwo{\csname ISO-8859-2.enc\endcsname}%
+ \def\utfeight{\csname UTF-8.enc\endcsname}%
+ %
+ \ifx \declaredencoding \ascii
+ \asciichardefs
+ %
+ \else \ifx \declaredencoding \lattwo
+ \setnonasciicharscatcode\active
+ \lattwochardefs
+ %
+ \else \ifx \declaredencoding \latone
+ \setnonasciicharscatcode\active
+ \latonechardefs
+ %
+ \else \ifx \declaredencoding \latnine
+ \setnonasciicharscatcode\active
+ \latninechardefs
+ %
+ \else \ifx \declaredencoding \utfeight
+ \setnonasciicharscatcode\active
+ \utfeightchardefs
+ %
+ \else
+ \message{Unknown document encoding #1, ignoring.}%
+ %
+ \fi % utfeight
+ \fi % latnine
+ \fi % latone
+ \fi % lattwo
+ \fi % ascii
+}
+
+% A message to be logged when using a character that isn't available
+% the default font encoding (OT1).
+%
+\def\missingcharmsg#1{\message{Character missing in OT1 encoding: #1.}}
+
+% Take account of \c (plain) vs. \, (Texinfo) difference.
+\def\cedilla#1{\ifx\c\ptexc\c{#1}\else\,{#1}\fi}
+
+% First, make active non-ASCII characters in order for them to be
+% correctly categorized when TeX reads the replacement text of
+% macros containing the character definitions.
+\setnonasciicharscatcode\active
+%
+% Latin1 (ISO-8859-1) character definitions.
+\def\latonechardefs{%
+ \gdef^^a0{~}
+ \gdef^^a1{\exclamdown}
+ \gdef^^a2{\missingcharmsg{CENT SIGN}}
+ \gdef^^a3{{\pounds}}
+ \gdef^^a4{\missingcharmsg{CURRENCY SIGN}}
+ \gdef^^a5{\missingcharmsg{YEN SIGN}}
+ \gdef^^a6{\missingcharmsg{BROKEN BAR}}
+ \gdef^^a7{\S}
+ \gdef^^a8{\"{}}
+ \gdef^^a9{\copyright}
+ \gdef^^aa{\ordf}
+ \gdef^^ab{\missingcharmsg{LEFT-POINTING DOUBLE ANGLE QUOTATION MARK}}
+ \gdef^^ac{$\lnot$}
+ \gdef^^ad{\-}
+ \gdef^^ae{\registeredsymbol}
+ \gdef^^af{\={}}
+ %
+ \gdef^^b0{\textdegree}
+ \gdef^^b1{$\pm$}
+ \gdef^^b2{$^2$}
+ \gdef^^b3{$^3$}
+ \gdef^^b4{\'{}}
+ \gdef^^b5{$\mu$}
+ \gdef^^b6{\P}
+ %
+ \gdef^^b7{$^.$}
+ \gdef^^b8{\cedilla\ }
+ \gdef^^b9{$^1$}
+ \gdef^^ba{\ordm}
+ %
+ \gdef^^bb{\missingcharmsg{RIGHT-POINTING DOUBLE ANGLE QUOTATION MARK}}
+ \gdef^^bc{$1\over4$}
+ \gdef^^bd{$1\over2$}
+ \gdef^^be{$3\over4$}
+ \gdef^^bf{\questiondown}
+ %
+ \gdef^^c0{\`A}
+ \gdef^^c1{\'A}
+ \gdef^^c2{\^A}
+ \gdef^^c3{\~A}
+ \gdef^^c4{\"A}
+ \gdef^^c5{\ringaccent A}
+ \gdef^^c6{\AE}
+ \gdef^^c7{\cedilla C}
+ \gdef^^c8{\`E}
+ \gdef^^c9{\'E}
+ \gdef^^ca{\^E}
+ \gdef^^cb{\"E}
+ \gdef^^cc{\`I}
+ \gdef^^cd{\'I}
+ \gdef^^ce{\^I}
+ \gdef^^cf{\"I}
+ %
+ \gdef^^d0{\missingcharmsg{LATIN CAPITAL LETTER ETH}}
+ \gdef^^d1{\~N}
+ \gdef^^d2{\`O}
+ \gdef^^d3{\'O}
+ \gdef^^d4{\^O}
+ \gdef^^d5{\~O}
+ \gdef^^d6{\"O}
+ \gdef^^d7{$\times$}
+ \gdef^^d8{\O}
+ \gdef^^d9{\`U}
+ \gdef^^da{\'U}
+ \gdef^^db{\^U}
+ \gdef^^dc{\"U}
+ \gdef^^dd{\'Y}
+ \gdef^^de{\missingcharmsg{LATIN CAPITAL LETTER THORN}}
+ \gdef^^df{\ss}
+ %
+ \gdef^^e0{\`a}
+ \gdef^^e1{\'a}
+ \gdef^^e2{\^a}
+ \gdef^^e3{\~a}
+ \gdef^^e4{\"a}
+ \gdef^^e5{\ringaccent a}
+ \gdef^^e6{\ae}
+ \gdef^^e7{\cedilla c}
+ \gdef^^e8{\`e}
+ \gdef^^e9{\'e}
+ \gdef^^ea{\^e}
+ \gdef^^eb{\"e}
+ \gdef^^ec{\`{\dotless i}}
+ \gdef^^ed{\'{\dotless i}}
+ \gdef^^ee{\^{\dotless i}}
+ \gdef^^ef{\"{\dotless i}}
+ %
+ \gdef^^f0{\missingcharmsg{LATIN SMALL LETTER ETH}}
+ \gdef^^f1{\~n}
+ \gdef^^f2{\`o}
+ \gdef^^f3{\'o}
+ \gdef^^f4{\^o}
+ \gdef^^f5{\~o}
+ \gdef^^f6{\"o}
+ \gdef^^f7{$\div$}
+ \gdef^^f8{\o}
+ \gdef^^f9{\`u}
+ \gdef^^fa{\'u}
+ \gdef^^fb{\^u}
+ \gdef^^fc{\"u}
+ \gdef^^fd{\'y}
+ \gdef^^fe{\missingcharmsg{LATIN SMALL LETTER THORN}}
+ \gdef^^ff{\"y}
+}
+
+% Latin9 (ISO-8859-15) encoding character definitions.
+\def\latninechardefs{%
+ % Encoding is almost identical to Latin1.
+ \latonechardefs
+ %
+ \gdef^^a4{\euro}
+ \gdef^^a6{\v S}
+ \gdef^^a8{\v s}
+ \gdef^^b4{\v Z}
+ \gdef^^b8{\v z}
+ \gdef^^bc{\OE}
+ \gdef^^bd{\oe}
+ \gdef^^be{\"Y}
+}
+
+% Latin2 (ISO-8859-2) character definitions.
+\def\lattwochardefs{%
+ \gdef^^a0{~}
+ \gdef^^a1{\missingcharmsg{LATIN CAPITAL LETTER A WITH OGONEK}}
+ \gdef^^a2{\u{}}
+ \gdef^^a3{\L}
+ \gdef^^a4{\missingcharmsg{CURRENCY SIGN}}
+ \gdef^^a5{\v L}
+ \gdef^^a6{\'S}
+ \gdef^^a7{\S}
+ \gdef^^a8{\"{}}
+ \gdef^^a9{\v S}
+ \gdef^^aa{\cedilla S}
+ \gdef^^ab{\v T}
+ \gdef^^ac{\'Z}
+ \gdef^^ad{\-}
+ \gdef^^ae{\v Z}
+ \gdef^^af{\dotaccent Z}
+ %
+ \gdef^^b0{\textdegree}
+ \gdef^^b1{\missingcharmsg{LATIN SMALL LETTER A WITH OGONEK}}
+ \gdef^^b2{\missingcharmsg{OGONEK}}
+ \gdef^^b3{\l}
+ \gdef^^b4{\'{}}
+ \gdef^^b5{\v l}
+ \gdef^^b6{\'s}
+ \gdef^^b7{\v{}}
+ \gdef^^b8{\cedilla\ }
+ \gdef^^b9{\v s}
+ \gdef^^ba{\cedilla s}
+ \gdef^^bb{\v t}
+ \gdef^^bc{\'z}
+ \gdef^^bd{\H{}}
+ \gdef^^be{\v z}
+ \gdef^^bf{\dotaccent z}
+ %
+ \gdef^^c0{\'R}
+ \gdef^^c1{\'A}
+ \gdef^^c2{\^A}
+ \gdef^^c3{\u A}
+ \gdef^^c4{\"A}
+ \gdef^^c5{\'L}
+ \gdef^^c6{\'C}
+ \gdef^^c7{\cedilla C}
+ \gdef^^c8{\v C}
+ \gdef^^c9{\'E}
+ \gdef^^ca{\missingcharmsg{LATIN CAPITAL LETTER E WITH OGONEK}}
+ \gdef^^cb{\"E}
+ \gdef^^cc{\v E}
+ \gdef^^cd{\'I}
+ \gdef^^ce{\^I}
+ \gdef^^cf{\v D}
+ %
+ \gdef^^d0{\missingcharmsg{LATIN CAPITAL LETTER D WITH STROKE}}
+ \gdef^^d1{\'N}
+ \gdef^^d2{\v N}
+ \gdef^^d3{\'O}
+ \gdef^^d4{\^O}
+ \gdef^^d5{\H O}
+ \gdef^^d6{\"O}
+ \gdef^^d7{$\times$}
+ \gdef^^d8{\v R}
+ \gdef^^d9{\ringaccent U}
+ \gdef^^da{\'U}
+ \gdef^^db{\H U}
+ \gdef^^dc{\"U}
+ \gdef^^dd{\'Y}
+ \gdef^^de{\cedilla T}
+ \gdef^^df{\ss}
+ %
+ \gdef^^e0{\'r}
+ \gdef^^e1{\'a}
+ \gdef^^e2{\^a}
+ \gdef^^e3{\u a}
+ \gdef^^e4{\"a}
+ \gdef^^e5{\'l}
+ \gdef^^e6{\'c}
+ \gdef^^e7{\cedilla c}
+ \gdef^^e8{\v c}
+ \gdef^^e9{\'e}
+ \gdef^^ea{\missingcharmsg{LATIN SMALL LETTER E WITH OGONEK}}
+ \gdef^^eb{\"e}
+ \gdef^^ec{\v e}
+ \gdef^^ed{\'\i}
+ \gdef^^ee{\^\i}
+ \gdef^^ef{\v d}
+ %
+ \gdef^^f0{\missingcharmsg{LATIN SMALL LETTER D WITH STROKE}}
+ \gdef^^f1{\'n}
+ \gdef^^f2{\v n}
+ \gdef^^f3{\'o}
+ \gdef^^f4{\^o}
+ \gdef^^f5{\H o}
+ \gdef^^f6{\"o}
+ \gdef^^f7{$\div$}
+ \gdef^^f8{\v r}
+ \gdef^^f9{\ringaccent u}
+ \gdef^^fa{\'u}
+ \gdef^^fb{\H u}
+ \gdef^^fc{\"u}
+ \gdef^^fd{\'y}
+ \gdef^^fe{\cedilla t}
+ \gdef^^ff{\dotaccent{}}
+}
+
+% UTF-8 character definitions.
+%
+% This code to support UTF-8 is based on LaTeX's utf8.def, with some
+% changes for Texinfo conventions. It is included here under the GPL by
+% permission from Frank Mittelbach and the LaTeX team.
+%
+\newcount\countUTFx
+\newcount\countUTFy
+\newcount\countUTFz
-% Page size parameters.
+\gdef\UTFviiiTwoOctets#1#2{\expandafter
+ \UTFviiiDefined\csname u8:#1\string #2\endcsname}
%
+\gdef\UTFviiiThreeOctets#1#2#3{\expandafter
+ \UTFviiiDefined\csname u8:#1\string #2\string #3\endcsname}
+%
+\gdef\UTFviiiFourOctets#1#2#3#4{\expandafter
+ \UTFviiiDefined\csname u8:#1\string #2\string #3\string #4\endcsname}
+
+\gdef\UTFviiiDefined#1{%
+ \ifx #1\relax
+ \message{\linenumber Unicode char \string #1 not defined for Texinfo}%
+ \else
+ \expandafter #1%
+ \fi
+}
+
+\begingroup
+ \catcode`\~13
+ \catcode`\"12
+
+ \def\UTFviiiLoop{%
+ \global\catcode\countUTFx\active
+ \uccode`\~\countUTFx
+ \uppercase\expandafter{\UTFviiiTmp}%
+ \advance\countUTFx by 1
+ \ifnum\countUTFx < \countUTFy
+ \expandafter\UTFviiiLoop
+ \fi}
+
+ \countUTFx = "C2
+ \countUTFy = "E0
+ \def\UTFviiiTmp{%
+ \xdef~{\noexpand\UTFviiiTwoOctets\string~}}
+ \UTFviiiLoop
+
+ \countUTFx = "E0
+ \countUTFy = "F0
+ \def\UTFviiiTmp{%
+ \xdef~{\noexpand\UTFviiiThreeOctets\string~}}
+ \UTFviiiLoop
+
+ \countUTFx = "F0
+ \countUTFy = "F4
+ \def\UTFviiiTmp{%
+ \xdef~{\noexpand\UTFviiiFourOctets\string~}}
+ \UTFviiiLoop
+\endgroup
+
+\begingroup
+ \catcode`\"=12
+ \catcode`\<=12
+ \catcode`\.=12
+ \catcode`\,=12
+ \catcode`\;=12
+ \catcode`\!=12
+ \catcode`\~=13
+
+ \gdef\DeclareUnicodeCharacter#1#2{%
+ \countUTFz = "#1\relax
+ \wlog{\space\space defining Unicode char U+#1 (decimal \the\countUTFz)}%
+ \begingroup
+ \parseXMLCharref
+ \def\UTFviiiTwoOctets##1##2{%
+ \csname u8:##1\string ##2\endcsname}%
+ \def\UTFviiiThreeOctets##1##2##3{%
+ \csname u8:##1\string ##2\string ##3\endcsname}%
+ \def\UTFviiiFourOctets##1##2##3##4{%
+ \csname u8:##1\string ##2\string ##3\string ##4\endcsname}%
+ \expandafter\expandafter\expandafter\expandafter
+ \expandafter\expandafter\expandafter
+ \gdef\UTFviiiTmp{#2}%
+ \endgroup}
+
+ \gdef\parseXMLCharref{%
+ \ifnum\countUTFz < "A0\relax
+ \errhelp = \EMsimple
+ \errmessage{Cannot define Unicode char value < 00A0}%
+ \else\ifnum\countUTFz < "800\relax
+ \parseUTFviiiA,%
+ \parseUTFviiiB C\UTFviiiTwoOctets.,%
+ \else\ifnum\countUTFz < "10000\relax
+ \parseUTFviiiA;%
+ \parseUTFviiiA,%
+ \parseUTFviiiB E\UTFviiiThreeOctets.{,;}%
+ \else
+ \parseUTFviiiA;%
+ \parseUTFviiiA,%
+ \parseUTFviiiA!%
+ \parseUTFviiiB F\UTFviiiFourOctets.{!,;}%
+ \fi\fi\fi
+ }
+
+ \gdef\parseUTFviiiA#1{%
+ \countUTFx = \countUTFz
+ \divide\countUTFz by 64
+ \countUTFy = \countUTFz
+ \multiply\countUTFz by 64
+ \advance\countUTFx by -\countUTFz
+ \advance\countUTFx by 128
+ \uccode `#1\countUTFx
+ \countUTFz = \countUTFy}
+
+ \gdef\parseUTFviiiB#1#2#3#4{%
+ \advance\countUTFz by "#10\relax
+ \uccode `#3\countUTFz
+ \uppercase{\gdef\UTFviiiTmp{#2#3#4}}}
+\endgroup
+
+\def\utfeightchardefs{%
+ \DeclareUnicodeCharacter{00A0}{\tie}
+ \DeclareUnicodeCharacter{00A1}{\exclamdown}
+ \DeclareUnicodeCharacter{00A3}{\pounds}
+ \DeclareUnicodeCharacter{00A8}{\"{ }}
+ \DeclareUnicodeCharacter{00A9}{\copyright}
+ \DeclareUnicodeCharacter{00AA}{\ordf}
+ \DeclareUnicodeCharacter{00AB}{\guillemetleft}
+ \DeclareUnicodeCharacter{00AD}{\-}
+ \DeclareUnicodeCharacter{00AE}{\registeredsymbol}
+ \DeclareUnicodeCharacter{00AF}{\={ }}
+
+ \DeclareUnicodeCharacter{00B0}{\ringaccent{ }}
+ \DeclareUnicodeCharacter{00B4}{\'{ }}
+ \DeclareUnicodeCharacter{00B8}{\cedilla{ }}
+ \DeclareUnicodeCharacter{00BA}{\ordm}
+ \DeclareUnicodeCharacter{00BB}{\guillemetright}
+ \DeclareUnicodeCharacter{00BF}{\questiondown}
+
+ \DeclareUnicodeCharacter{00C0}{\`A}
+ \DeclareUnicodeCharacter{00C1}{\'A}
+ \DeclareUnicodeCharacter{00C2}{\^A}
+ \DeclareUnicodeCharacter{00C3}{\~A}
+ \DeclareUnicodeCharacter{00C4}{\"A}
+ \DeclareUnicodeCharacter{00C5}{\AA}
+ \DeclareUnicodeCharacter{00C6}{\AE}
+ \DeclareUnicodeCharacter{00C7}{\cedilla{C}}
+ \DeclareUnicodeCharacter{00C8}{\`E}
+ \DeclareUnicodeCharacter{00C9}{\'E}
+ \DeclareUnicodeCharacter{00CA}{\^E}
+ \DeclareUnicodeCharacter{00CB}{\"E}
+ \DeclareUnicodeCharacter{00CC}{\`I}
+ \DeclareUnicodeCharacter{00CD}{\'I}
+ \DeclareUnicodeCharacter{00CE}{\^I}
+ \DeclareUnicodeCharacter{00CF}{\"I}
+
+ \DeclareUnicodeCharacter{00D1}{\~N}
+ \DeclareUnicodeCharacter{00D2}{\`O}
+ \DeclareUnicodeCharacter{00D3}{\'O}
+ \DeclareUnicodeCharacter{00D4}{\^O}
+ \DeclareUnicodeCharacter{00D5}{\~O}
+ \DeclareUnicodeCharacter{00D6}{\"O}
+ \DeclareUnicodeCharacter{00D8}{\O}
+ \DeclareUnicodeCharacter{00D9}{\`U}
+ \DeclareUnicodeCharacter{00DA}{\'U}
+ \DeclareUnicodeCharacter{00DB}{\^U}
+ \DeclareUnicodeCharacter{00DC}{\"U}
+ \DeclareUnicodeCharacter{00DD}{\'Y}
+ \DeclareUnicodeCharacter{00DF}{\ss}
+
+ \DeclareUnicodeCharacter{00E0}{\`a}
+ \DeclareUnicodeCharacter{00E1}{\'a}
+ \DeclareUnicodeCharacter{00E2}{\^a}
+ \DeclareUnicodeCharacter{00E3}{\~a}
+ \DeclareUnicodeCharacter{00E4}{\"a}
+ \DeclareUnicodeCharacter{00E5}{\aa}
+ \DeclareUnicodeCharacter{00E6}{\ae}
+ \DeclareUnicodeCharacter{00E7}{\cedilla{c}}
+ \DeclareUnicodeCharacter{00E8}{\`e}
+ \DeclareUnicodeCharacter{00E9}{\'e}
+ \DeclareUnicodeCharacter{00EA}{\^e}
+ \DeclareUnicodeCharacter{00EB}{\"e}
+ \DeclareUnicodeCharacter{00EC}{\`{\dotless{i}}}
+ \DeclareUnicodeCharacter{00ED}{\'{\dotless{i}}}
+ \DeclareUnicodeCharacter{00EE}{\^{\dotless{i}}}
+ \DeclareUnicodeCharacter{00EF}{\"{\dotless{i}}}
+
+ \DeclareUnicodeCharacter{00F1}{\~n}
+ \DeclareUnicodeCharacter{00F2}{\`o}
+ \DeclareUnicodeCharacter{00F3}{\'o}
+ \DeclareUnicodeCharacter{00F4}{\^o}
+ \DeclareUnicodeCharacter{00F5}{\~o}
+ \DeclareUnicodeCharacter{00F6}{\"o}
+ \DeclareUnicodeCharacter{00F8}{\o}
+ \DeclareUnicodeCharacter{00F9}{\`u}
+ \DeclareUnicodeCharacter{00FA}{\'u}
+ \DeclareUnicodeCharacter{00FB}{\^u}
+ \DeclareUnicodeCharacter{00FC}{\"u}
+ \DeclareUnicodeCharacter{00FD}{\'y}
+ \DeclareUnicodeCharacter{00FF}{\"y}
+
+ \DeclareUnicodeCharacter{0100}{\=A}
+ \DeclareUnicodeCharacter{0101}{\=a}
+ \DeclareUnicodeCharacter{0102}{\u{A}}
+ \DeclareUnicodeCharacter{0103}{\u{a}}
+ \DeclareUnicodeCharacter{0106}{\'C}
+ \DeclareUnicodeCharacter{0107}{\'c}
+ \DeclareUnicodeCharacter{0108}{\^C}
+ \DeclareUnicodeCharacter{0109}{\^c}
+ \DeclareUnicodeCharacter{010A}{\dotaccent{C}}
+ \DeclareUnicodeCharacter{010B}{\dotaccent{c}}
+ \DeclareUnicodeCharacter{010C}{\v{C}}
+ \DeclareUnicodeCharacter{010D}{\v{c}}
+ \DeclareUnicodeCharacter{010E}{\v{D}}
+
+ \DeclareUnicodeCharacter{0112}{\=E}
+ \DeclareUnicodeCharacter{0113}{\=e}
+ \DeclareUnicodeCharacter{0114}{\u{E}}
+ \DeclareUnicodeCharacter{0115}{\u{e}}
+ \DeclareUnicodeCharacter{0116}{\dotaccent{E}}
+ \DeclareUnicodeCharacter{0117}{\dotaccent{e}}
+ \DeclareUnicodeCharacter{011A}{\v{E}}
+ \DeclareUnicodeCharacter{011B}{\v{e}}
+ \DeclareUnicodeCharacter{011C}{\^G}
+ \DeclareUnicodeCharacter{011D}{\^g}
+ \DeclareUnicodeCharacter{011E}{\u{G}}
+ \DeclareUnicodeCharacter{011F}{\u{g}}
+
+ \DeclareUnicodeCharacter{0120}{\dotaccent{G}}
+ \DeclareUnicodeCharacter{0121}{\dotaccent{g}}
+ \DeclareUnicodeCharacter{0124}{\^H}
+ \DeclareUnicodeCharacter{0125}{\^h}
+ \DeclareUnicodeCharacter{0128}{\~I}
+ \DeclareUnicodeCharacter{0129}{\~{\dotless{i}}}
+ \DeclareUnicodeCharacter{012A}{\=I}
+ \DeclareUnicodeCharacter{012B}{\={\dotless{i}}}
+ \DeclareUnicodeCharacter{012C}{\u{I}}
+ \DeclareUnicodeCharacter{012D}{\u{\dotless{i}}}
+
+ \DeclareUnicodeCharacter{0130}{\dotaccent{I}}
+ \DeclareUnicodeCharacter{0131}{\dotless{i}}
+ \DeclareUnicodeCharacter{0132}{IJ}
+ \DeclareUnicodeCharacter{0133}{ij}
+ \DeclareUnicodeCharacter{0134}{\^J}
+ \DeclareUnicodeCharacter{0135}{\^{\dotless{j}}}
+ \DeclareUnicodeCharacter{0139}{\'L}
+ \DeclareUnicodeCharacter{013A}{\'l}
+
+ \DeclareUnicodeCharacter{0141}{\L}
+ \DeclareUnicodeCharacter{0142}{\l}
+ \DeclareUnicodeCharacter{0143}{\'N}
+ \DeclareUnicodeCharacter{0144}{\'n}
+ \DeclareUnicodeCharacter{0147}{\v{N}}
+ \DeclareUnicodeCharacter{0148}{\v{n}}
+ \DeclareUnicodeCharacter{014C}{\=O}
+ \DeclareUnicodeCharacter{014D}{\=o}
+ \DeclareUnicodeCharacter{014E}{\u{O}}
+ \DeclareUnicodeCharacter{014F}{\u{o}}
+
+ \DeclareUnicodeCharacter{0150}{\H{O}}
+ \DeclareUnicodeCharacter{0151}{\H{o}}
+ \DeclareUnicodeCharacter{0152}{\OE}
+ \DeclareUnicodeCharacter{0153}{\oe}
+ \DeclareUnicodeCharacter{0154}{\'R}
+ \DeclareUnicodeCharacter{0155}{\'r}
+ \DeclareUnicodeCharacter{0158}{\v{R}}
+ \DeclareUnicodeCharacter{0159}{\v{r}}
+ \DeclareUnicodeCharacter{015A}{\'S}
+ \DeclareUnicodeCharacter{015B}{\'s}
+ \DeclareUnicodeCharacter{015C}{\^S}
+ \DeclareUnicodeCharacter{015D}{\^s}
+ \DeclareUnicodeCharacter{015E}{\cedilla{S}}
+ \DeclareUnicodeCharacter{015F}{\cedilla{s}}
+
+ \DeclareUnicodeCharacter{0160}{\v{S}}
+ \DeclareUnicodeCharacter{0161}{\v{s}}
+ \DeclareUnicodeCharacter{0162}{\cedilla{t}}
+ \DeclareUnicodeCharacter{0163}{\cedilla{T}}
+ \DeclareUnicodeCharacter{0164}{\v{T}}
+
+ \DeclareUnicodeCharacter{0168}{\~U}
+ \DeclareUnicodeCharacter{0169}{\~u}
+ \DeclareUnicodeCharacter{016A}{\=U}
+ \DeclareUnicodeCharacter{016B}{\=u}
+ \DeclareUnicodeCharacter{016C}{\u{U}}
+ \DeclareUnicodeCharacter{016D}{\u{u}}
+ \DeclareUnicodeCharacter{016E}{\ringaccent{U}}
+ \DeclareUnicodeCharacter{016F}{\ringaccent{u}}
+
+ \DeclareUnicodeCharacter{0170}{\H{U}}
+ \DeclareUnicodeCharacter{0171}{\H{u}}
+ \DeclareUnicodeCharacter{0174}{\^W}
+ \DeclareUnicodeCharacter{0175}{\^w}
+ \DeclareUnicodeCharacter{0176}{\^Y}
+ \DeclareUnicodeCharacter{0177}{\^y}
+ \DeclareUnicodeCharacter{0178}{\"Y}
+ \DeclareUnicodeCharacter{0179}{\'Z}
+ \DeclareUnicodeCharacter{017A}{\'z}
+ \DeclareUnicodeCharacter{017B}{\dotaccent{Z}}
+ \DeclareUnicodeCharacter{017C}{\dotaccent{z}}
+ \DeclareUnicodeCharacter{017D}{\v{Z}}
+ \DeclareUnicodeCharacter{017E}{\v{z}}
+
+ \DeclareUnicodeCharacter{01C4}{D\v{Z}}
+ \DeclareUnicodeCharacter{01C5}{D\v{z}}
+ \DeclareUnicodeCharacter{01C6}{d\v{z}}
+ \DeclareUnicodeCharacter{01C7}{LJ}
+ \DeclareUnicodeCharacter{01C8}{Lj}
+ \DeclareUnicodeCharacter{01C9}{lj}
+ \DeclareUnicodeCharacter{01CA}{NJ}
+ \DeclareUnicodeCharacter{01CB}{Nj}
+ \DeclareUnicodeCharacter{01CC}{nj}
+ \DeclareUnicodeCharacter{01CD}{\v{A}}
+ \DeclareUnicodeCharacter{01CE}{\v{a}}
+ \DeclareUnicodeCharacter{01CF}{\v{I}}
+
+ \DeclareUnicodeCharacter{01D0}{\v{\dotless{i}}}
+ \DeclareUnicodeCharacter{01D1}{\v{O}}
+ \DeclareUnicodeCharacter{01D2}{\v{o}}
+ \DeclareUnicodeCharacter{01D3}{\v{U}}
+ \DeclareUnicodeCharacter{01D4}{\v{u}}
+
+ \DeclareUnicodeCharacter{01E2}{\={\AE}}
+ \DeclareUnicodeCharacter{01E3}{\={\ae}}
+ \DeclareUnicodeCharacter{01E6}{\v{G}}
+ \DeclareUnicodeCharacter{01E7}{\v{g}}
+ \DeclareUnicodeCharacter{01E8}{\v{K}}
+ \DeclareUnicodeCharacter{01E9}{\v{k}}
+
+ \DeclareUnicodeCharacter{01F0}{\v{\dotless{j}}}
+ \DeclareUnicodeCharacter{01F1}{DZ}
+ \DeclareUnicodeCharacter{01F2}{Dz}
+ \DeclareUnicodeCharacter{01F3}{dz}
+ \DeclareUnicodeCharacter{01F4}{\'G}
+ \DeclareUnicodeCharacter{01F5}{\'g}
+ \DeclareUnicodeCharacter{01F8}{\`N}
+ \DeclareUnicodeCharacter{01F9}{\`n}
+ \DeclareUnicodeCharacter{01FC}{\'{\AE}}
+ \DeclareUnicodeCharacter{01FD}{\'{\ae}}
+ \DeclareUnicodeCharacter{01FE}{\'{\O}}
+ \DeclareUnicodeCharacter{01FF}{\'{\o}}
+
+ \DeclareUnicodeCharacter{021E}{\v{H}}
+ \DeclareUnicodeCharacter{021F}{\v{h}}
+
+ \DeclareUnicodeCharacter{0226}{\dotaccent{A}}
+ \DeclareUnicodeCharacter{0227}{\dotaccent{a}}
+ \DeclareUnicodeCharacter{0228}{\cedilla{E}}
+ \DeclareUnicodeCharacter{0229}{\cedilla{e}}
+ \DeclareUnicodeCharacter{022E}{\dotaccent{O}}
+ \DeclareUnicodeCharacter{022F}{\dotaccent{o}}
+
+ \DeclareUnicodeCharacter{0232}{\=Y}
+ \DeclareUnicodeCharacter{0233}{\=y}
+ \DeclareUnicodeCharacter{0237}{\dotless{j}}
+
+ \DeclareUnicodeCharacter{1E02}{\dotaccent{B}}
+ \DeclareUnicodeCharacter{1E03}{\dotaccent{b}}
+ \DeclareUnicodeCharacter{1E04}{\udotaccent{B}}
+ \DeclareUnicodeCharacter{1E05}{\udotaccent{b}}
+ \DeclareUnicodeCharacter{1E06}{\ubaraccent{B}}
+ \DeclareUnicodeCharacter{1E07}{\ubaraccent{b}}
+ \DeclareUnicodeCharacter{1E0A}{\dotaccent{D}}
+ \DeclareUnicodeCharacter{1E0B}{\dotaccent{d}}
+ \DeclareUnicodeCharacter{1E0C}{\udotaccent{D}}
+ \DeclareUnicodeCharacter{1E0D}{\udotaccent{d}}
+ \DeclareUnicodeCharacter{1E0E}{\ubaraccent{D}}
+ \DeclareUnicodeCharacter{1E0F}{\ubaraccent{d}}
+
+ \DeclareUnicodeCharacter{1E1E}{\dotaccent{F}}
+ \DeclareUnicodeCharacter{1E1F}{\dotaccent{f}}
+
+ \DeclareUnicodeCharacter{1E20}{\=G}
+ \DeclareUnicodeCharacter{1E21}{\=g}
+ \DeclareUnicodeCharacter{1E22}{\dotaccent{H}}
+ \DeclareUnicodeCharacter{1E23}{\dotaccent{h}}
+ \DeclareUnicodeCharacter{1E24}{\udotaccent{H}}
+ \DeclareUnicodeCharacter{1E25}{\udotaccent{h}}
+ \DeclareUnicodeCharacter{1E26}{\"H}
+ \DeclareUnicodeCharacter{1E27}{\"h}
+
+ \DeclareUnicodeCharacter{1E30}{\'K}
+ \DeclareUnicodeCharacter{1E31}{\'k}
+ \DeclareUnicodeCharacter{1E32}{\udotaccent{K}}
+ \DeclareUnicodeCharacter{1E33}{\udotaccent{k}}
+ \DeclareUnicodeCharacter{1E34}{\ubaraccent{K}}
+ \DeclareUnicodeCharacter{1E35}{\ubaraccent{k}}
+ \DeclareUnicodeCharacter{1E36}{\udotaccent{L}}
+ \DeclareUnicodeCharacter{1E37}{\udotaccent{l}}
+ \DeclareUnicodeCharacter{1E3A}{\ubaraccent{L}}
+ \DeclareUnicodeCharacter{1E3B}{\ubaraccent{l}}
+ \DeclareUnicodeCharacter{1E3E}{\'M}
+ \DeclareUnicodeCharacter{1E3F}{\'m}
+
+ \DeclareUnicodeCharacter{1E40}{\dotaccent{M}}
+ \DeclareUnicodeCharacter{1E41}{\dotaccent{m}}
+ \DeclareUnicodeCharacter{1E42}{\udotaccent{M}}
+ \DeclareUnicodeCharacter{1E43}{\udotaccent{m}}
+ \DeclareUnicodeCharacter{1E44}{\dotaccent{N}}
+ \DeclareUnicodeCharacter{1E45}{\dotaccent{n}}
+ \DeclareUnicodeCharacter{1E46}{\udotaccent{N}}
+ \DeclareUnicodeCharacter{1E47}{\udotaccent{n}}
+ \DeclareUnicodeCharacter{1E48}{\ubaraccent{N}}
+ \DeclareUnicodeCharacter{1E49}{\ubaraccent{n}}
+
+ \DeclareUnicodeCharacter{1E54}{\'P}
+ \DeclareUnicodeCharacter{1E55}{\'p}
+ \DeclareUnicodeCharacter{1E56}{\dotaccent{P}}
+ \DeclareUnicodeCharacter{1E57}{\dotaccent{p}}
+ \DeclareUnicodeCharacter{1E58}{\dotaccent{R}}
+ \DeclareUnicodeCharacter{1E59}{\dotaccent{r}}
+ \DeclareUnicodeCharacter{1E5A}{\udotaccent{R}}
+ \DeclareUnicodeCharacter{1E5B}{\udotaccent{r}}
+ \DeclareUnicodeCharacter{1E5E}{\ubaraccent{R}}
+ \DeclareUnicodeCharacter{1E5F}{\ubaraccent{r}}
+
+ \DeclareUnicodeCharacter{1E60}{\dotaccent{S}}
+ \DeclareUnicodeCharacter{1E61}{\dotaccent{s}}
+ \DeclareUnicodeCharacter{1E62}{\udotaccent{S}}
+ \DeclareUnicodeCharacter{1E63}{\udotaccent{s}}
+ \DeclareUnicodeCharacter{1E6A}{\dotaccent{T}}
+ \DeclareUnicodeCharacter{1E6B}{\dotaccent{t}}
+ \DeclareUnicodeCharacter{1E6C}{\udotaccent{T}}
+ \DeclareUnicodeCharacter{1E6D}{\udotaccent{t}}
+ \DeclareUnicodeCharacter{1E6E}{\ubaraccent{T}}
+ \DeclareUnicodeCharacter{1E6F}{\ubaraccent{t}}
+
+ \DeclareUnicodeCharacter{1E7C}{\~V}
+ \DeclareUnicodeCharacter{1E7D}{\~v}
+ \DeclareUnicodeCharacter{1E7E}{\udotaccent{V}}
+ \DeclareUnicodeCharacter{1E7F}{\udotaccent{v}}
+
+ \DeclareUnicodeCharacter{1E80}{\`W}
+ \DeclareUnicodeCharacter{1E81}{\`w}
+ \DeclareUnicodeCharacter{1E82}{\'W}
+ \DeclareUnicodeCharacter{1E83}{\'w}
+ \DeclareUnicodeCharacter{1E84}{\"W}
+ \DeclareUnicodeCharacter{1E85}{\"w}
+ \DeclareUnicodeCharacter{1E86}{\dotaccent{W}}
+ \DeclareUnicodeCharacter{1E87}{\dotaccent{w}}
+ \DeclareUnicodeCharacter{1E88}{\udotaccent{W}}
+ \DeclareUnicodeCharacter{1E89}{\udotaccent{w}}
+ \DeclareUnicodeCharacter{1E8A}{\dotaccent{X}}
+ \DeclareUnicodeCharacter{1E8B}{\dotaccent{x}}
+ \DeclareUnicodeCharacter{1E8C}{\"X}
+ \DeclareUnicodeCharacter{1E8D}{\"x}
+ \DeclareUnicodeCharacter{1E8E}{\dotaccent{Y}}
+ \DeclareUnicodeCharacter{1E8F}{\dotaccent{y}}
+
+ \DeclareUnicodeCharacter{1E90}{\^Z}
+ \DeclareUnicodeCharacter{1E91}{\^z}
+ \DeclareUnicodeCharacter{1E92}{\udotaccent{Z}}
+ \DeclareUnicodeCharacter{1E93}{\udotaccent{z}}
+ \DeclareUnicodeCharacter{1E94}{\ubaraccent{Z}}
+ \DeclareUnicodeCharacter{1E95}{\ubaraccent{z}}
+ \DeclareUnicodeCharacter{1E96}{\ubaraccent{h}}
+ \DeclareUnicodeCharacter{1E97}{\"t}
+ \DeclareUnicodeCharacter{1E98}{\ringaccent{w}}
+ \DeclareUnicodeCharacter{1E99}{\ringaccent{y}}
+
+ \DeclareUnicodeCharacter{1EA0}{\udotaccent{A}}
+ \DeclareUnicodeCharacter{1EA1}{\udotaccent{a}}
+
+ \DeclareUnicodeCharacter{1EB8}{\udotaccent{E}}
+ \DeclareUnicodeCharacter{1EB9}{\udotaccent{e}}
+ \DeclareUnicodeCharacter{1EBC}{\~E}
+ \DeclareUnicodeCharacter{1EBD}{\~e}
+
+ \DeclareUnicodeCharacter{1ECA}{\udotaccent{I}}
+ \DeclareUnicodeCharacter{1ECB}{\udotaccent{i}}
+ \DeclareUnicodeCharacter{1ECC}{\udotaccent{O}}
+ \DeclareUnicodeCharacter{1ECD}{\udotaccent{o}}
+
+ \DeclareUnicodeCharacter{1EE4}{\udotaccent{U}}
+ \DeclareUnicodeCharacter{1EE5}{\udotaccent{u}}
+
+ \DeclareUnicodeCharacter{1EF2}{\`Y}
+ \DeclareUnicodeCharacter{1EF3}{\`y}
+ \DeclareUnicodeCharacter{1EF4}{\udotaccent{Y}}
+
+ \DeclareUnicodeCharacter{1EF8}{\~Y}
+ \DeclareUnicodeCharacter{1EF9}{\~y}
+
+ \DeclareUnicodeCharacter{2013}{--}
+ \DeclareUnicodeCharacter{2014}{---}
+ \DeclareUnicodeCharacter{2018}{\quoteleft}
+ \DeclareUnicodeCharacter{2019}{\quoteright}
+ \DeclareUnicodeCharacter{201A}{\quotesinglbase}
+ \DeclareUnicodeCharacter{201C}{\quotedblleft}
+ \DeclareUnicodeCharacter{201D}{\quotedblright}
+ \DeclareUnicodeCharacter{201E}{\quotedblbase}
+ \DeclareUnicodeCharacter{2022}{\bullet}
+ \DeclareUnicodeCharacter{2026}{\dots}
+ \DeclareUnicodeCharacter{2039}{\guilsinglleft}
+ \DeclareUnicodeCharacter{203A}{\guilsinglright}
+ \DeclareUnicodeCharacter{20AC}{\euro}
+
+ \DeclareUnicodeCharacter{2192}{\expansion}
+ \DeclareUnicodeCharacter{21D2}{\result}
+
+ \DeclareUnicodeCharacter{2212}{\minus}
+ \DeclareUnicodeCharacter{2217}{\point}
+ \DeclareUnicodeCharacter{2261}{\equiv}
+}% end of \utfeightchardefs
+
+
+% US-ASCII character definitions.
+\def\asciichardefs{% nothing need be done
+ \relax
+}
+
+% Make non-ASCII characters printable again for compatibility with
+% existing Texinfo documents that may use them, even without declaring a
+% document encoding.
+%
+\setnonasciicharscatcode \other
+
+
+\message{formatting,}
+
\newdimen\defaultparindent \defaultparindent = 15pt
\chapheadingskip = 15pt plus 4pt minus 2pt
@@ -6736,7 +8583,7 @@ should work if nowhere else does.}
% Don't be so finicky about underfull hboxes, either.
\hbadness = 2000
-% Following George Bush, just get rid of widows and orphans.
+% Following George Bush, get rid of widows and orphans.
\widowpenalty=10000
\clubpenalty=10000
@@ -6754,9 +8601,9 @@ should work if nowhere else does.}
\fi
}
-% Parameters in order: 1) textheight; 2) textwidth; 3) voffset;
-% 4) hoffset; 5) binding offset; 6) topskip; 7) physical page height; 8)
-% physical page width.
+% Parameters in order: 1) textheight; 2) textwidth;
+% 3) voffset; 4) hoffset; 5) binding offset; 6) topskip;
+% 7) physical page height; 8) physical page width.
%
% We also call \setleading{\textleading}, so the caller should define
% \textleading. The caller should also set \parskip.
@@ -6783,6 +8630,10 @@ should work if nowhere else does.}
\ifpdf
\pdfpageheight #7\relax
\pdfpagewidth #8\relax
+ % if we don't reset these, they will remain at "1 true in" of
+ % whatever layout pdftex was dumped with.
+ \pdfhorigin = 1 true in
+ \pdfvorigin = 1 true in
\fi
%
\setleading{\textleading}
@@ -6797,19 +8648,19 @@ should work if nowhere else does.}
\textleading = 13.2pt
%
% If page is nothing but text, make it come out even.
- \internalpagesizes{46\baselineskip}{6in}%
+ \internalpagesizes{607.2pt}{6in}% that's 46 lines
{\voffset}{.25in}%
{\bindingoffset}{36pt}%
{11in}{8.5in}%
}}
-% Use @smallbook to reset parameters for 7x9.5 (or so) format.
+% Use @smallbook to reset parameters for 7x9.25 trim size.
\def\smallbook{{\globaldefs = 1
\parskip = 2pt plus 1pt
\textleading = 12pt
%
\internalpagesizes{7.5in}{5in}%
- {\voffset}{.25in}%
+ {-.2in}{0in}%
{\bindingoffset}{16pt}%
{9.25in}{7in}%
%
@@ -6820,6 +8671,24 @@ should work if nowhere else does.}
\defbodyindent = .5cm
}}
+% Use @smallerbook to reset parameters for 6x9 trim size.
+% (Just testing, parameters still in flux.)
+\def\smallerbook{{\globaldefs = 1
+ \parskip = 1.5pt plus 1pt
+ \textleading = 12pt
+ %
+ \internalpagesizes{7.4in}{4.8in}%
+ {-.2in}{-.4in}%
+ {0pt}{14pt}%
+ {9in}{6in}%
+ %
+ \lispnarrowing = 0.25in
+ \tolerance = 700
+ \hfuzz = 1pt
+ \contentsrightmargin = 0pt
+ \defbodyindent = .4cm
+}}
+
% Use @afourpaper to print on European A4 paper.
\def\afourpaper{{\globaldefs = 1
\parskip = 3pt plus 2pt minus 1pt
@@ -6835,7 +8704,7 @@ should work if nowhere else does.}
% \global\normaloffset = -6mm
% \global\bindingoffset = 10mm
% @end tex
- \internalpagesizes{51\baselineskip}{160mm}
+ \internalpagesizes{673.2pt}{160mm}% that's 51 lines
{\voffset}{\hoffset}%
{\bindingoffset}{44pt}%
{297mm}{210mm}%
@@ -6900,7 +8769,7 @@ should work if nowhere else does.}
\parskip = 3pt plus 2pt minus 1pt
\setleading{\textleading}%
%
- \dimen0 = #1
+ \dimen0 = #1\relax
\advance\dimen0 by \voffset
%
\dimen2 = \hsize
@@ -6972,6 +8841,7 @@ should work if nowhere else does.}
\catcode`\_=\active
\def_{\ifusingtt\normalunderscore\_}
+\let\realunder=_
% Subroutine for the previous macro.
\def\_{\leavevmode \kern.07em \vbox{\hrule width.3em height.1ex}\kern .07em }
@@ -6994,6 +8864,13 @@ should work if nowhere else does.}
% \otherifyactive is called near the end of this file.
\def\otherifyactive{\catcode`+=\other \catcode`\_=\other}
+% Used sometimes to turn off (effectively) the active characters even after
+% parsing them.
+\def\turnoffactive{%
+ \normalturnoffactive
+ \otherbackslash
+}
+
\catcode`\@=0
% \backslashcurfont outputs one backslash character in current font,
@@ -7001,27 +8878,29 @@ should work if nowhere else does.}
\global\chardef\backslashcurfont=`\\
\global\let\rawbackslashxx=\backslashcurfont % let existing .??s files work
+% \realbackslash is an actual character `\' with catcode other, and
+% \doublebackslash is two of them (for the pdf outlines).
+{\catcode`\\=\other @gdef@realbackslash{\} @gdef@doublebackslash{\\}}
+
+% In texinfo, backslash is an active character; it prints the backslash
+% in fixed width font.
+\catcode`\\=\active
+@def@normalbackslash{{@tt@backslashcurfont}}
+% On startup, @fixbackslash assigns:
+% @let \ = @normalbackslash
+
% \rawbackslash defines an active \ to do \backslashcurfont.
% \otherbackslash defines an active \ to be a literal `\' character with
% catcode other.
-{\catcode`\\=\active
- @gdef@rawbackslash{@let\=@backslashcurfont}
- @gdef@otherbackslash{@let\=@realbackslash}
-}
-
-% \realbackslash is an actual character `\' with catcode other.
-{\catcode`\\=\other @gdef@realbackslash{\}}
-
-% \normalbackslash outputs one backslash in fixed width font.
-\def\normalbackslash{{\tt\backslashcurfont}}
-
-\catcode`\\=\active
+@gdef@rawbackslash{@let\=@backslashcurfont}
+@gdef@otherbackslash{@let\=@realbackslash}
-% Used sometimes to turn off (effectively) the active characters
-% even after parsing them.
-@def@turnoffactive{%
+% Same as @turnoffactive except outputs \ as {\tt\char`\\} instead of
+% the literal character `\'.
+%
+@def@normalturnoffactive{%
+ @let\=@normalbackslash
@let"=@normaldoublequote
- @let\=@realbackslash
@let~=@normaltilde
@let^=@normalcaret
@let_=@normalunderscore
@@ -7033,12 +8912,6 @@ should work if nowhere else does.}
@unsepspaces
}
-% Same as @turnoffactive except outputs \ as {\tt\char`\\} instead of
-% the literal character `\'. (Thus, \ is not expandable when this is in
-% effect.)
-%
-@def@normalturnoffactive{@turnoffactive @let\=@normalbackslash}
-
% Make _ and + \other characters, temporarily.
% This is canceled by @fixbackslash.
@otherifyactive
@@ -7051,9 +8924,9 @@ should work if nowhere else does.}
@global@let\ = @eatinput
% On the other hand, perhaps the file did not have a `\input texinfo'. Then
-% the first `\{ in the file would cause an error. This macro tries to fix
+% the first `\' in the file would cause an error. This macro tries to fix
% that, assuming it is called before the first `\' could plausibly occur.
-% Also back turn on active characters that might appear in the input
+% Also turn back on active characters that might appear in the input
% file name, in case not using a pre-dumped format.
%
@gdef@fixbackslash{%
generated by cgit v1.2.3 (git 2.25.1) at 2025-04-26 15:58:37 +0000