aboutsummaryrefslogtreecommitdiffstats
path: root/doc
diff options
context:
space:
mode:
Diffstat (limited to 'doc')
-rw-r--r--doc/ChangeLog2
-rw-r--r--doc/Makefile.am7
-rw-r--r--doc/Makefile.in7
-rw-r--r--doc/wordlist4597
4 files changed, 611 insertions, 2 deletions
diff --git a/doc/ChangeLog b/doc/ChangeLog
index 89b39459..bb6aa39e 100644
--- a/doc/ChangeLog
+++ b/doc/ChangeLog
@@ -4,6 +4,8 @@
* wordlist, wordlist2, wordlist3: Remove words that spell
now recognizes as real words.
* gawkinet.texi: Fix a spelling error.
+ * Makefile.am (spellinet): New target.
+ * wordlist4: New file.
2020-09-18 Arnold D. Robbins <arnold@skeeve.com>
diff --git a/doc/Makefile.am b/doc/Makefile.am
index 24dd0405..d95d5660 100644
--- a/doc/Makefile.am
+++ b/doc/Makefile.am
@@ -110,7 +110,7 @@ awkcard.nc: $(CARDFILES)
awkcard.pdf: awkcard.ps
ps2pdf awkcard.ps awkcard.pdf
-spell: spellmanual spellworkflow spellmanpage
+spell: spellmanual spellworkflow spellmanpage spellinet
spellmanual:
@echo ==== gawktexi.in ====;
@@ -126,3 +126,8 @@ spellmanpage:
@echo ==== gawk.1 ====
export LC_ALL=C ; spell "$(srcdir)"/gawk.1 | \
sort -u | comm -23 - "$(srcdir)"/wordlist3
+
+spellinet:
+ @echo ==== gawkinet.texi ====
+ export LC_ALL=C ; spell "$(srcdir)"/gawkinet.texi | \
+ sort -u | comm -23 - "$(srcdir)"/wordlist4
diff --git a/doc/Makefile.in b/doc/Makefile.in
index c457ea1a..5d33b8a5 100644
--- a/doc/Makefile.in
+++ b/doc/Makefile.in
@@ -933,7 +933,7 @@ awkcard.nc: $(CARDFILES)
awkcard.pdf: awkcard.ps
ps2pdf awkcard.ps awkcard.pdf
-spell: spellmanual spellworkflow spellmanpage
+spell: spellmanual spellworkflow spellmanpage spellinet
spellmanual:
@echo ==== gawktexi.in ====;
@@ -950,6 +950,11 @@ spellmanpage:
export LC_ALL=C ; spell "$(srcdir)"/gawk.1 | \
sort -u | comm -23 - "$(srcdir)"/wordlist3
+spellinet:
+ @echo ==== gawkinet.texi ====
+ export LC_ALL=C ; spell "$(srcdir)"/gawkinet.texi | \
+ sort -u | comm -23 - "$(srcdir)"/wordlist4
+
# Tell versions [3.59,3.63) of GNU make to not export all variables.
# Otherwise a system limit (for SysV at least) may be exceeded.
.NOEXPORT:
diff --git a/doc/wordlist4 b/doc/wordlist4
new file mode 100644
index 00000000..f267327a
--- /dev/null
+++ b/doc/wordlist4
@@ -0,0 +1,597 @@
+AA
+ADR
+ALINK
+API
+ARGC
+ARGV
+AWK
+AXP
+AboutELIZA
+AboutServer
+AvoidCount
+Awk
+Ayalon
+BGCOLOR
+BLASTService
+BR
+Boutell
+CC
+CELLPADDING
+CEST
+CGI
+CNN
+CSV
+CTD
+CatPipe
+ChangeConfig
+CheckConfig
+CleanUp
+ConfigFile
+CorrectCount
+DARKCORNER
+DATALIB
+DD
+DDBJ
+DECnet
+DEF
+DONT
+DTD
+Degeneres
+DownCount
+EK
+EMBL
+EPROMs
+EQUIV
+ElizaSays
+EndOfMySelf
+EnterParameters
+Etzioni
+FASTA
+FDL
+FFN
+FIXME
+FN
+FS
+FUNC
+Fasta
+Flannery
+GAWK's
+GETARG
+GETURL
+GNUPLOT
+GNUPlot
+GUIs
+GenBank
+GenInfo
+GetHeader
+GetThisHeader
+GnuPlot
+HD
+HREF
+HWP
+HandleGET
+Hethmon
+Hoare
+Hoare's
+HotCount
+HttpService
+Humphrys
+HyperText
+IM
+IMG
+INTC
+IPX
+IPv
+ISBN
+IUB
+IUPAC
+IVE
+Immuno
+Init
+Internetworking
+JK
+JNJ
+JPG
+JPM
+Juergen
+Jul
+Jun
+KAREL
+KO
+Kabat's
+Kahrs
+LF
+Loebner
+Loui
+MCD
+MMC
+MMM
+MOBAG
+MOBAGWHO
+MOBFUN
+MOBVAR
+MOT
+MRK
+MSFT
+MailPipe
+MakeMaze
+MiniSQL
+MobAg
+MobCode
+MobileAgent
+Multiauthor
+MyHost
+MyInit
+MyJob
+MyOrigin
+MyPort
+MyPrefix
+MyProxy
+NBRF
+NCBI
+NCBI's
+NF
+NR
+NetService
+NeutralCount
+NewLength
+Nof
+Nov
+Novell's
+ORS
+Oren
+PARAM
+PARAMS
+PARAMs
+PATCHLEVEL
+PDF
+PG
+PIR
+PNG
+POPService
+POSIXed
+PROT
+PROTBASE
+PS
+Param
+Perlis
+PointLight
+PostAgent
+PostScript
+Pragma
+Prez
+ProxyPort
+REMCONF
+RFCs
+RP
+RT
+ReadConfig
+ReadMySelf
+ReadQuotes
+Rumpelstilzchen
+SA
+SBC
+SNMP
+SPAK
+SRC
+STARTOFRANGE
+STATIST
+STOXPRED
+SUBSEP
+Salmagundi
+SaveConfig
+Sbjct
+SendMail
+Sep
+SetUpEliza
+SetUpServer
+StartELIZA
+StockCount
+TD
+TR
+Tck
+Tcl
+Teukolsky
+Texinfo
+Tk
+TopDoc
+TopFooter
+TopHeader
+UL
+UMBC
+URI
+URLCHK
+URLfile
+UTX
+UpCount
+VLINK
+VRML
+VRMLtest
+Vetterling
+WEBGRAB
+WINNT
+WMT
+Waterman's
+Weizenbaum
+WorldWideWeb
+XBM
+XCF
+XINU
+XOM
+XP
+XSIZE
+XYZ
+YOURE
+YOUVE
+YSIZE
+YahooData
+YouSay
+abcdef
+acm
+adelphia
+adenosine
+advperl
+ai
+ambientIntensity
+amd
+arnold
+asc
+ascii
+asis
+au
+awk
+awkforai
+awkinet
+bbs
+bierce
+bigskip
+bioskills
+bitcont
+biz
+blastcl
+blastmail
+blastn
+blasturl
+boutell
+br
+caccaccatggacagcaaa
+canberra
+cgi
+cgilib
+ch
+chargen
+charset
+chayden
+chrisc
+cindex
+codon
+columnfractions
+com
+compapp
+config
+conj
+cont
+contrib
+coprocess
+copyleft
+copyrightable
+coreserv
+cp
+cr
+crontab
+csv
+cytidine
+dartmouth
+datacount
+daycount
+dbj
+dcu
+dd
+de
+dec
+defeasible
+denhaag
+deontic
+detailmenu
+dev
+devvax
+df
+dfn
+dict
+diffuseColor
+dir
+dircategory
+direntry
+dist
+ducktown
+edu
+eg
+ek
+eliza
+emailhost
+emb
+embedpc
+emph
+endfile
+epd
+evenheading
+exp
+fakenode
+fasta
+ff
+ffffff
+fi
+filenet
+filll
+finalout
+fingerclient
+fn
+foo
+fr
+fsbassociates
+fsf
+ftest
+gawcon
+gawkinet
+gawknet
+gawnetf
+gd
+geninfo
+getline
+geturl
+gif
+gnl
+gnuawk
+gnuplot
+gov
+groundAngle
+groundColor
+gsub
+guanine
+halign
+headitem
+hexdigs
+hfil
+highgate
+hrule
+htm
+html
+htmlx
+http
+httpd
+https
+httpserver
+hughes
+humphrys
+iX
+ibeta
+ibm
+ie
+ifhtml
+ifinfo
+ifnotinfo
+ifnottex
+iftex
+igawk
+inet
+inetlib
+inmargin
+insertcopying
+int
+intc
+intel
+interline
+introcb
+invsqrt
+ip
+irc
+iso
+java
+jp
+jpl
+kabat
+kazusa
+keto
+keynes
+kohala
+laplace
+len
+lflashlight
+li
+libc
+lifeisgood
+lineo
+linespace
+linux
+localhost
+localport
+loebner
+loui
+mailto
+marx
+mkdir
+mobag
+moritz
+multiline
+multitable
+myhost
+nAgent
+nBEGIN
+nThe
+nThis
+nasa
+ncbi
+netblast
+netcon
+netcraft
+netfunny
+netgawf
+netgawk
+netscape
+netstat
+nih
+nl
+nlm
+nntp
+noalign
+nof
+noindent
+noncausal
+noncommercially
+nph
+nr
+nthese
+nwe
+oddheading
+offinterlineskip
+openURL
+oreilly
+org
+overfulls
+pF
+paris
+passwd
+pdb
+pdict
+perl
+pir
+png
+postoffice
+pre
+prepinfo
+prf
+printenv
+printf
+printindex
+protbase
+ps
+pt
+purdue
+purine
+pxref
+pyrimidine
+qold
+rand
+readnews
+remconf
+remoteport
+rendez
+retr
+rf
+rflashlight
+rhf
+rm
+rstevens
+rvices
+samp
+sapiens
+sc
+scriptics
+sd
+seealso
+seeentry
+serv
+serweb
+setTimeout
+setchapternewpage
+setfilename
+settitle
+sez
+shtml
+skeeve
+skyAngle
+skyColor
+smallbook
+smallexample
+smtp
+softbot
+sp
+spak
+spinoza
+spoonsful
+sprintf
+srand
+statist
+stderr
+stdin
+stdout
+stoxdata
+stoxpred
+str
+strftime
+subentry
+subj
+subjold
+sublicense
+subnode
+substr
+subsubsection
+suse
+synchronicity
+syncodeindex
+synindex
+systime
+tcl
+tcp
+tcpcon
+tcpip
+technicalinfo
+testserv
+tex
+texinfo
+tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
+tggtgaagtgtgtttcttg
+thischapter
+thispage
+thttp
+thymidine
+titlepage
+tjhsst
+tmp
+tolower
+toupper
+ttytst
+tutest
+txt
+uclinux
+udp
+uk
+ul
+umbc
+uname
+unnumberedsec
+unregarded
+untp
+uref
+urgen
+urgen's
+uri
+uridine
+url
+urlchk
+userfriendly
+utf
+uthscsa
+val
+var
+vars
+vbox
+vous
+vr
+vrml
+vrule
+vskip
+webclient
+webgrab
+webser
+webserx
+wold
+wotsit
+wouldnt
+wustl
+www
+xbm
+xinu
+xrds
+youre
+yrange