aboutsummaryrefslogtreecommitdiffstats
path: root/awklib/eg/network/protbase.request
blob: 4c5c3d2c1d2f0043147bfb50ddc0c6944770d869 (plain)
1
2
3
4
5
6
7
PROGRAM blastn
DATALIB month
EXPECT 0.75
BEGIN
>GAWK310 the gawking gene GNU AWK
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
caccaccatggacagcaaa
38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 2058 2059 2060 2061 2062 2063 2064 2065 2066 2067 2068 2069 2070 2071 2072 2073 2074 2075 2076 2077 2078 2079 2080 2081 2082 2083 2084 2085 2086 2087 2088 2089 2090 2091 2092 2093 2094 2095 2096 2097 2098 2099 2100 2101 2102 2103 2104 2105 2106 2107 2108 2109 2110 2111 2112 2113 2114 2115 2116 2117 2118 2119 2120 2121 2122 2123 2124 2125 2126 2127 2128 2129 2130 2131 2132 2133 2134 2135 2136 2137 2138 2139 2140 2141 2142 2143 2144 2145 2146 2147 2148 2149 2150 2151 2152 2153 2154 2155 2156 2157 2158 2159 2160 2161 2162 2163 2164 2165 2166 2167 2168 2169 2170 2171 2172 2173 2174 2175 2176 2177 2178 2179 2180 2181 2182 2183 2184 2185 2186 2187 2188 2189 2190 2191 2192 2193 2194 2195 2196 2197 2198 2199 2200 2201 2202 2203 2204 2205 2206 2207 2208 2209 2210 2211 2212 2213 2214 2215 2216 2217 2218 2219 2220 2221 2222 2223 2224 2225 2226 2227 2228 2229 2230 2231 2232 2233 2234 2235 2236 2237 2238 2239 2240 2241 2242 2243 2244 2245 2246 2247 2248 2249 2250 2251 2252 2253 2254 2255 2256 2257 2258 2259 2260 2261 2262 2263 2264 2265 2266 2267 2268 2269 2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280 2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291 2292 2293 2294 2295 2296 2297 2298 2299 2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317 2318 2319 2320 2321 2322 2323 2324 2325 2326 2327 2328 2329 2330 2331 2332 2333 2334 2335 2336 2337 2338 2339 2340 2341 2342 2343 2344 2345 2346 2347 2348 2349 2350 2351 2352 2353 2354 2355 2356 2357 2358 2359 2360 2361 2362 2363 2364 2365 2366 2367 2368 2369 2370 2371 2372 2373 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2395 2396 2397 2398 2399 2400 2401 2402 2403 2404 2405 2406 2407 2408 2409 2410 2411 2412 2413 2414 2415 2416 2417 2418 2419 2420 2421 2422 2423 2424 2425 2426 2427 2428 2429 2430 2431 2432 2433 2434 2435 2436 2437 2438 2439 2440 2441 2442 2443 2444 2445 2446 2447 2448 2449 2450 2451 2452 2453 2454 2455 2456 2457 2458 2459 2460 2461 2462 2463 2464 2465 2466 2467 2468 2469 2470 2471 2472 2473 2474 2475 2476 2477 2478 2479 2480 2481 2482 2483 2484 2485 2486 2487 2488 2489 2490 2491 2492 2493 2494 2495 2496 2497 2498 2499 2500 2501 2502 2503 2504 2505 2506 2507 2508 2509 2510 2511 2512 2513 2514 2515 2516 2517 2518 2519 2520 2521 2522 2523 2524 2525 2526 2527 2528 2529 2530 2531 2532 2533 2534 2535 2536 2537 2538 2539 2540 2541 2542 2543 2544 2545 2546 2547 2548 2549 2550 2551 2552 2553 2554 2555 2556 2557 2558 2559 2560 2561 2562 2563 2564 2565 2566 2567 2568 2569 2570 2571 2572 2573 2574 2575 2576 2577 2578 2579 2580 2581 2582 2583 2584 2585 2586 2587 2588 2589 2590 2591 2592 2593 2594 2595 2596 2597 2598 2599 2600 2601 2602 2603 2604 2605 2606 2607 2608 2609 2610 2611 2612 2613 2614 2615 2616 2617 2618 2619 2620 2621 2622 2623 2624 2625 2626 2627 2628 2629 2630 2631 2632 2633 2634 2635 2636 2637 2638 2639 2640 2641 2642 2643 2644 2645 2646 2647 2648 2649 2650 2651 2652 2653 2654 2655 2656 2657 2658 2659 2660 2661 2662 2663 2664 2665 2666 2667 2668 2669 2670 2671 2672 2673 2674 2675 2676 2677 2678 2679 2680 2681 2682 2683 2684 2685 2686 2687 2688 2689 2690 2691 2692 2693 2694 2695 2696 2697 2698 2699 2700 2701 2702 2703 2704 2705 2706 2707 2708 2709 2710 2711 2712 2713 2714 2715 2716 2717 2718 2719 2720 2721 2722 2723 2724 2725 2726 2727 2728 2729 2730 2731 2732 2733 2734 2735 2736 2737 2738 2739 2740 2741 2742 2743 2744 2745 2746 2747 2748 2749 2750 2751 2752 2753 2754 2755 2756 2757 2758 2759 2760 2761 2762 2763 2764 2765 2766 2767 2768 2769 2770 2771 2772 2773 2774 2775 2776 2777 2778 2779 2780 2781 2782 2783 2784 2785 2786 2787 2788 2789 2790 2791 2792 2793 2794 2795 2796 2797 2798 2799 2800 2801 2802 2803 2804 2805 2806 2807 2808 2809 2810 2811 2812 2813 2814 2815 2816 2817 2818 2819 2820 2821 2822 2823 2824 2825 2826 2827 2828 2829 2830 2831 2832 2833 2834 2835 2836 2837 2838 2839 2840 2841 2842 2843 2844 2845 2846 2847 2848 2849 2850 2851 2852 2853 2854 2855 2856 2857 2858 2859 2860 2861 2862 2863 2864 2865 2866 2867 2868 2869 2870 2871 2872 2873 2874 2875 2876 2877 2878 2879 2880 2881 2882 2883 2884 2885 2886 2887 2888 2889 2890 2891 2892 2893 2894 2895 2896 2897 2898 2899 2900 2901 2902 2903 2904 2905 2906 2907 2908 2909 2910 2911 2912 2913 2914 2915 2916 2917 2918 2919 2920 2921 2922 2923 2924 2925 2926 2927 2928 2929 2930 2931 2932 2933 2934 2935 2936 2937 2938 2939 2940 2941 2942 2943 2944 2945 2946 2947 2948 2949 2950 2951 2952 2953 2954 2955 2956 2957 2958 2959 2960 2961 2962 2963 2964 2965 2966 2967 2968 2969 2970 2971 2972 2973 2974 2975 2976 2977 2978 2979 2980 2981 2982 2983 2984 2985 2986 2987 2988 2989 2990 2991 2992 2993 2994 2995 2996 2997 2998 2999 3000 3001 3002 3003 3004 3005 3006 3007 3008 3009 3010 3011 3012 3013 3014 3015 3016 3017 3018 3019 3020 3021 3022 3023 3024 3025 3026 3027 3028 3029 3030 3031 3032 3033 3034 3035 3036 3037 3038 3039 3040 3041 3042 3043 3044 3045 3046 3047 3048 3049 3050 3051 3052 3053 3054 3055 3056 3057 3058 3059 3060 3061 3062 3063 3064 3065 3066 3067 3068 3069 3070 3071 3072 3073 3074 3075 3076 3077 3078 3079 3080 3081 3082 3083 3084 3085 3086 3087 3088 3089 3090 3091 3092 3093 3094 3095 3096 3097 3098 3099 3100 3101 3102 3103 3104 3105 3106 3107 3108 3109 3110 3111 3112 3113 3114 3115 3116 3117 3118 3119 3120 3121 3122 3123 3124 3125 3126 3127 3128 3129 3130 3131 3132 3133 3134 3135 3136 3137 3138 3139 3140 3141 3142 3143 3144 3145 3146 3147 3148 3149 3150 3151 3152 3153 3154 3155 3156 3157 3158 3159 3160 3161 3162 3163 3164 3165 3166 3167 3168 3169 3170 3171 3172 3173 3174 3175 3176 3177 3178 3179 3180 3181 3182 3183 3184 3185 3186 3187 3188 3189 3190 3191 3192 3193 3194 3195 3196 3197 3198 3199 3200 3201 3202 3203 3204 3205 3206 3207 3208 3209 3210 3211 3212 3213 3214 3215 3216 3217 3218 3219 3220 3221 3222 3223 3224 3225 3226 3227 3228 3229 3230 3231 3232 3233 3234 3235 3236 3237 3238 3239 3240 3241 3242 3243 3244 3245 3246 3247 3248 3249 3250 3251 3252 3253 3254 3255 3256 3257 3258 3259 3260 3261 3262 3263 3264 3265 3266 3267 3268 3269 3270 3271 3272 3273 3274 3275 3276 3277 3278 3279 3280 3281 3282 3283 3284 3285 3286 3287 3288 3289 3290 3291 3292 3293 3294 3295 3296 3297 3298 3299 3300 3301 3302 3303 3304 3305 3306 3307 3308 3309 3310 3311 3312 3313 3314 3315 3316 3317 3318 3319 3320 3321 3322 3323 3324 3325 3326 3327 3328 3329 3330 3331 3332 3333 3334 3335 3336 3337 3338 3339 3340 3341 3342 3343 3344 3345 3346 3347 3348 3349 3350 3351 3352 3353 3354 3355 3356 3357 3358 3359 3360 3361 3362 3363 3364 3365 3366 3367 3368 3369 3370 3371 3372 3373 3374 3375 3376 3377 3378 3379 3380 3381 3382 3383 3384 3385 3386 3387 3388 3389 3390 3391 3392 3393 3394 3395 3396 3397 3398 3399 3400 3401 3402 3403 3404 3405 3406 3407 3408 3409 3410 3411 3412 3413 3414 3415 3416 3417 3418 3419 3420 3421 3422 3423 3424 3425 3426 3427 3428 3429 3430 3431 3432 3433 3434 3435 3436 3437 3438 3439 3440 3441 3442 3443 3444 3445 3446 3447 3448 3449 3450 3451 3452 3453 3454 3455 3456 3457 3458 3459 3460 3461 3462 3463 3464 3465 3466 3467 3468 3469 3470 3471 3472 3473 3474 3475 3476 3477 3478 3479 3480 3481 3482 3483 3484 3485 3486 3487 3488 3489 3490 3491 3492 3493 3494 3495 3496 3497 3498 3499 3500 3501 3502 3503 3504 3505 3506 3507 3508 3509 3510 3511 3512 3513 3514 3515 3516 3517 3518 3519 3520 3521 3522 3523 3524 3525 3526 3527 3528 3529 3530 3531 3532 3533 3534 3535 3536 3537 3538 3539 3540 3541 3542 3543 3544 3545 3546 3547 3548 3549 3550 3551 3552 3553 3554 3555 3556 3557 3558 3559 3560 3561 3562 3563 3564 3565 3566 3567 3568 3569 3570 3571 3572 3573 3574 3575 3576 3577 3578 3579 3580 3581 3582 3583 3584 3585 3586 3587 3588 3589 3590 3591 3592 3593 3594 3595 3596 3597 3598 3599 3600 3601 3602 3603 3604 3605 3606 3607 3608 3609 3610 3611 3612 3613 3614 3615 3616 3617 3618 3619 3620 3621 3622 3623 3624 3625 3626 3627 3628 3629 3630 3631 3632 3633 3634 3635 3636 3637 3638 3639 3640 3641 3642 3643 3644 3645 3646 3647 3648 3649 3650 3651 3652 3653 3654 3655 3656 3657 3658 3659 3660 3661 3662 3663 3664 3665 3666 3667 3668 3669 3670 3671 3672 3673 3674 3675 3676 3677 3678 3679 3680 3681 3682 3683 3684 3685 3686 3687 3688 3689 3690 3691 3692 3693 3694 3695 3696 3697 3698 3699 3700 3701 3702 3703 3704 3705 3706 3707 3708 3709 3710 3711 3712 3713 3714 3715 3716 3717 3718 3719 3720 3721 3722 3723 3724 3725 3726 3727 3728 3729 3730 3731 3732 3733 3734 3735 3736 3737 3738 3739 3740 3741 3742 3743 3744 3745 3746 3747 3748 3749 3750 3751 3752 3753 3754 3755 3756 3757 3758 3759 3760 3761 3762 3763 3764 3765 3766 3767 3768 3769 3770 3771 3772 3773 3774 3775 3776 3777 3778 3779 3780 3781 3782 3783 3784 3785 3786 3787 3788 3789 3790 3791 3792 3793 3794 3795 3796 3797 3798 3799 3800 3801 3802 3803 3804 3805 3806 3807 3808 3809 3810 3811 3812 3813 3814 3815 3816 3817 3818 3819 3820 3821 3822 3823 3824 3825 3826 3827 3828 3829 3830 3831 3832 3833 3834 3835 3836 3837 3838 3839 3840 3841 3842 3843 3844 3845 3846 3847 3848 3849 3850 3851 3852 3853 3854 3855 3856 3857 3858 3859 3860 3861 3862 3863 3864 3865 3866 3867 3868 3869 3870 3871 3872 3873 3874 3875 3876 3877 3878 3879 3880 3881 3882 3883 3884 3885 3886 3887 3888 3889 3890 3891 3892 3893 3894 3895 3896 3897 3898 3899 3900 3901 3902 3903 3904 3905 3906 3907 3908 3909 3910 3911 3912 3913 3914 3915 3916 3917 3918 3919 3920 3921 3922 3923 3924 3925 3926 3927 3928 3929 3930 3931 3932 3933 3934 3935 3936 3937 3938 3939 3940 3941 3942 3943 3944 3945 3946 3947 3948 3949 3950 3951 3952 3953 3954 3955 3956 3957 3958 3959 3960 3961 3962 3963 3964 3965 3966 3967 3968 3969 3970 3971 3972 3973 3974 3975 3976 3977 3978 3979 3980 3981 3982 3983 3984 3985 3986 3987 3988 3989 3990 3991 3992 3993 3994 3995 3996 3997 3998 3999 4000 4001 4002 4003 4004 4005 4006 4007 4008 4009 4010 4011 4012 4013 4014 4015 4016 4017 4018 4019 4020 4021 4022 4023 4024 4025 4026 4027 4028 4029 4030 4031 4032 4033 4034 4035 4036 4037 4038 4039 4040 4041 4042 4043 4044 4045 4046 4047 4048 4049 4050 4051 4052 4053 4054 4055 4056 4057 4058 4059 4060 4061 4062 4063 4064 4065 4066 4067 4068 4069 4070 4071 4072 4073 4074 4075 4076 4077 4078 4079 4080 4081 4082 4083 4084 4085 4086 4087 4088 4089 4090 4091 4092 4093 4094 4095 4096 4097 4098 4099 4100 4101 4102 4103 4104 4105 4106 4107 4108 4109 4110 4111 4112 4113 4114 4115 4116 4117 4118 4119 4120 4121 4122 4123 4124 4125 4126 4127 4128 4129 4130 4131 4132 4133 4134 4135 4136 4137 4138 4139 4140 4141 4142 4143 4144 4145 4146 4147 4148 4149 4150 4151 4152 4153 4154 4155 4156 4157 4158 4159 4160 4161 4162 4163 4164 4165 4166 4167 4168 4169 4170 4171 4172 4173 4174 4175 4176 4177 4178 4179 4180 4181 4182 4183 4184 4185 4186 4187 4188 4189 4190 4191 4192 4193 4194 4195 4196 4197 4198 4199 4200 4201 4202 4203 4204 4205 4206 4207 4208 4209 4210 4211 4212 4213 4214 4215 4216 4217 4218 4219 4220 4221 4222 4223 4224 4225 4226 4227 4228 4229 4230 4231 4232 4233 4234 4235 4236 4237 4238 4239 4240 4241 4242 4243 4244 4245 4246 4247 4248 4249 4250 4251 4252 4253 4254 4255 4256 4257 4258 4259 4260 4261 4262 4263 4264 4265 4266 4267 4268 4269 4270 4271 4272 4273 4274 4275 4276 4277 4278 4279 4280 4281 4282 4283 4284 4285 4286 4287 4288 4289 4290 4291 4292 4293 4294 4295 4296 4297 4298 4299 4300 4301 4302 4303 4304 4305 4306 4307 4308 4309 4310 4311 4312 4313 4314 4315 4316 4317 4318 4319 4320 4321 4322 4323 4324 4325 4326 4327 4328 4329 4330 4331 4332 4333 4334 4335 4336 4337 4338 4339 4340 4341 4342 4343 4344 4345 4346 4347 4348 4349 4350 4351 4352 4353 4354 4355 4356 4357 4358 4359 4360 4361 4362 4363 4364 4365 4366 4367 4368 4369 4370 4371 4372 4373 4374 4375 4376 4377 4378 4379 4380 4381 4382 4383 4384 4385 4386 4387 4388 4389 4390 4391 4392 4393 4394 4395 4396 4397 4398 4399 4400 4401 4402 4403 4404 4405 4406 4407 4408 4409 4410 4411 4412 4413 4414 4415 4416 4417 4418 4419 4420 4421 4422 4423 4424 4425 4426 4427 4428 4429 4430 4431 4432 4433 4434 4435 4436 4437 4438 4439 4440 4441 4442 4443 4444 4445 4446 4447 4448 4449 4450 4451 4452 4453 4454 4455 4456 4457 4458 4459 4460 4461 4462 4463 4464 4465 4466 4467 4468 4469 4470 4471 4472 4473 4474 4475 4476 4477 4478 4479 4480 4481 4482 4483 4484 4485 4486 4487 4488 4489 4490 4491 4492 4493 4494 4495 4496 4497 4498 4499 4500 4501 4502 4503 4504 4505 4506 4507 4508 4509 4510 4511 4512 4513 4514 4515 4516 4517 4518 4519 4520 4521 4522 4523 4524 4525 4526 4527 4528 4529 4530 4531 4532 4533 4534 4535 4536 4537 4538 4539 4540 4541 4542 4543 4544 4545 4546 4547 4548 4549 4550 4551 4552 4553 4554 4555 4556 4557 4558 4559 4560 4561 4562 4563 4564 4565 4566 4567 4568 4569 4570 4571 4572 4573 4574 4575 4576 4577 4578 4579 4580 4581 4582 4583 4584 4585 4586 4587 4588 4589 4590 4591 4592 4593 4594 4595 4596 4597 4598 4599 4600 4601 4602 4603 4604 4605 4606 4607 4608 4609 4610 4611 4612 4613 4614 4615 4616 4617 4618 4619 4620 4621 4622 4623 4624 4625 4626 4627 4628 4629 4630 4631 4632 4633 4634 4635 4636 4637 4638 4639 4640 4641 4642 4643 4644 4645 4646 4647 4648 4649 4650 4651 4652 4653 4654 4655 4656 4657 4658 4659 4660 4661 4662 4663 4664 4665 4666 4667 4668 4669 4670 4671 4672 4673 4674 4675 4676 4677 4678 4679 4680 4681 4682 4683 4684 4685 4686 4687 4688 4689 4690 4691 4692 4693 4694 4695 4696 4697 4698 4699 4700 4701 4702 4703 4704 4705 4706 4707 4708 4709 4710 4711 4712 4713 4714 4715 4716 4717 4718 4719 4720 4721 4722 4723 4724 4725 4726 4727 4728 4729 4730 4731 4732 4733 4734 4735 4736 4737 4738 4739 4740 4741 4742 4743 4744 4745 4746 4747 4748 4749 4750 4751 4752 4753 4754 4755 4756 4757 4758 4759 4760 4761 4762 4763 4764 4765 4766 4767 4768 4769 4770 4771 4772 4773 4774 4775 4776 4777 4778 4779 4780 4781 4782 4783 4784 4785 4786 4787 4788 4789 4790 4791 4792 4793 4794 4795 4796 4797 4798 4799 4800 4801 4802 4803 4804 4805 4806 4807 4808 4809 4810 4811 4812 4813 4814 4815 4816 4817 4818 4819 4820 4821 4822 4823 4824 4825 4826 4827 4828 4829 4830 4831 4832 4833 4834 4835 4836 4837 4838 4839 4840 4841 4842 4843 4844 4845 4846 4847 4848 4849 4850 4851 4852 4853 4854 4855 4856 4857 4858 4859 4860 4861 4862 4863 4864 4865 4866 4867 4868 4869 4870 4871 4872 4873 4874 4875 4876 4877 4878 4879 4880 4881 4882 4883 4884 4885 4886 4887 4888 4889 4890 4891 4892 4893 4894 4895 4896 4897 4898 4899 4900 4901 4902 4903 4904 4905 4906 4907 4908 4909 4910 4911 4912 4913 4914 4915 4916 4917 4918 4919 4920 4921 4922 4923 4924 4925 4926 4927 4928 4929 4930 4931 4932 4933 4934 4935 4936 4937 4938 4939 4940 4941 4942 4943 4944 4945 4946 4947 4948 4949 4950 4951 4952 4953 4954 4955 4956 4957 4958 4959 4960 4961 4962 4963 4964 4965 4966 4967 4968 4969 4970 4971 4972 4973 4974 4975 4976 4977 4978 4979 4980 4981 4982 4983 4984 4985 4986 4987 4988 4989 4990 4991 4992 4993 4994 4995 4996 4997 4998 4999 5000 5001 5002 5003 5004 5005 5006 5007 5008 5009 5010 5011 5012 5013 5014 5015 5016 5017 5018 5019 5020 5021 5022 5023 5024 5025 5026 5027 5028 5029 5030 5031 5032 5033 5034 5035 5036 5037 5038 5039 5040 5041 5042 5043 5044 5045 5046 5047 5048 5049 5050 5051 5052 5053 5054 5055 5056 5057 5058 5059 5060 5061 5062 5063 5064 5065 5066 5067 5068 5069 5070 5071 5072 5073 5074 5075 5076 5077 5078 5079 5080 5081 5082 5083 5084 5085 5086 5087 5088 5089 5090 5091 5092 5093 5094 5095 5096 5097 5098 5099 5100 5101 5102 5103 5104 5105 5106 5107 5108 5109 5110 5111 5112 5113 5114 5115 5116 5117 5118 5119 5120 5121 5122 5123 5124 5125 5126 5127 5128 5129 5130 5131 5132 5133 5134 5135 5136 5137 5138 5139 5140 5141 5142 5143 5144 5145 5146 5147 5148 5149 5150 5151 5152 5153 5154 5155 5156 5157 5158 5159 5160 5161 5162 5163 5164 5165 5166 5167 5168 5169 5170 5171 5172 5173 5174 5175 5176 5177 5178 5179 5180 5181 5182 5183 5184 5185 5186 5187 5188 5189 5190 5191 5192 5193 5194 5195 5196 5197 5198 5199 5200 5201 5202 5203 5204 5205 5206 5207 5208 5209 5210 5211 5212 5213 5214 5215 5216 5217 5218 5219 5220 5221 5222 5223 5224 5225 5226 5227 5228 5229 5230 5231 5232 5233 5234 5235 5236 5237 5238 5239 5240 5241 5242 5243 5244 5245 5246 5247 5248 5249 5250 5251 5252 5253 5254 5255 5256 5257 5258 5259 5260 5261 5262 5263 5264 5265 5266 5267 5268 5269 5270 5271 5272 5273 5274 5275 5276 5277 5278 5279 5280 5281 5282 5283 5284 5285 5286 5287 5288 5289 5290 5291 5292 5293 5294 5295 5296 5297 5298 5299 5300 5301 5302 5303 5304 5305 5306 5307 5308 5309 5310 5311 5312 5313 5314 5315 5316 5317 5318 5319 5320 5321 5322 5323 5324 5325 5326 5327 5328 5329 5330 5331 5332 5333 5334 5335 5336 5337 5338 5339 5340 5341 5342 5343 5344 5345 5346 5347 5348 5349 5350 5351 5352 5353 5354 5355 5356 5357 5358 5359 5360 5361 5362 5363 5364 5365 5366 5367 5368 5369 5370 5371 5372 5373 5374 5375 5376 5377 5378 5379 5380 5381 5382 5383 5384 5385 5386 5387 5388 5389 5390 5391 5392 5393 5394 5395 5396 5397 5398 5399 5400 5401 5402 5403 5404 5405 5406 5407 5408 5409 5410 5411 5412 5413 5414 5415 5416 5417 5418 5419 5420 5421 5422 5423 5424 5425 5426 5427 5428 5429 5430 5431 5432 5433 5434 5435 5436 5437 5438 5439 5440 5441 5442 5443 5444 5445 5446 5447 5448 5449 5450 5451 5452 5453 5454 5455 5456 5457 5458 5459 5460 5461 5462 5463 5464 5465 5466 5467 5468 5469 5470 5471 5472 5473 5474 5475 5476 5477 5478 5479 5480 5481 5482 5483 5484 5485 5486 5487 5488 5489 5490 5491 5492 5493 5494 5495 5496 5497 5498 5499 5500 5501 5502 5503 5504 5505 5506 5507 5508 5509 5510 5511 5512 5513 5514 5515 5516 5517 5518 5519 5520 5521 5522 5523 5524 5525 5526 5527 5528 5529 5530 5531 5532 5533 5534 5535 5536 5537 5538 5539 5540 5541 5542 5543 5544 5545 5546 5547 5548 5549 5550 5551 5552 5553 5554 5555 5556 5557 5558 5559 5560 5561 5562 5563 5564 5565 5566 5567 5568 5569 5570 5571 5572 5573 5574 5575 5576 5577 5578 5579 5580 5581 5582 5583 5584 5585 5586 5587 5588 5589 5590 5591 5592 5593 5594 5595 5596 5597 5598 5599 5600 5601 5602 5603 5604 5605 5606 5607 5608 5609 5610 5611 5612 5613 5614 5615 5616 5617 5618 5619 5620 5621 5622 5623 5624 5625 5626 5627 5628 5629 5630 5631 5632 5633 5634 5635 5636 5637 5638 5639 5640 5641 5642 5643 5644 5645 5646 5647 5648 5649 5650 5651 5652 5653 5654 5655 5656 5657 5658 5659 5660 5661 5662 5663 5664 5665 5666 5667 5668 5669 5670 5671 5672 5673 5674 5675 5676 5677 5678 5679 5680 5681 5682 5683 5684 5685 5686 5687 5688 5689 5690 5691 5692 5693 5694 5695 5696 5697 5698 5699 5700 5701 5702 5703 5704 5705 5706 5707 5708 5709 5710 5711 5712 5713 5714 5715 5716 5717 5718 5719 5720 5721 5722 5723 5724 5725 5726 5727 5728 5729 5730 5731 5732 5733 5734 5735 5736 5737 5738 5739 5740 5741 5742 5743 5744 5745 5746 5747 5748 5749 5750 5751 5752 5753 5754 5755 5756 5757 5758 5759 5760 5761 5762 5763 5764 5765 5766 5767 5768 5769 5770 5771 5772 5773 5774 5775 5776 5777 5778 5779 5780 5781 5782 5783 5784 5785 5786 5787 5788 5789 5790 5791 5792 5793 5794 5795 5796 5797 5798 5799 5800 5801 5802 5803 5804 5805 5806 5807 5808 5809 5810 5811 5812 5813 5814 5815 5816 5817 5818 5819 5820 5821 5822 5823 5824 5825 5826 5827 5828 5829 5830 5831 5832 5833 5834 5835 5836 5837 5838 5839 5840 5841 5842 5843 5844 5845 5846 5847 5848 5849 5850 5851 5852 5853 5854 5855 5856 5857 5858 5859 5860 5861 5862 5863 5864 5865 5866 5867 5868 5869 5870 5871 5872 5873 5874 5875 5876 5877 5878 5879 5880 5881 5882 5883 5884 5885 5886 5887 5888 5889 5890 5891 5892 5893 5894 5895 5896 5897 5898 5899 5900 5901 5902 5903 5904 5905 5906 5907 5908 5909 5910 5911 5912 5913 5914 5915 5916 5917 5918 5919 5920 5921 5922 5923 5924 5925 5926 5927 5928 5929 5930 5931 5932 5933 5934 5935 5936 5937 5938 5939 5940 5941 5942 5943 5944 5945 5946 5947 5948 5949 5950 5951 5952 5953 5954 5955 5956 5957 5958 5959 5960 5961 5962 5963 5964 5965 5966 5967 5968 5969 5970 5971 5972 5973 5974 5975 5976 5977 5978 5979 5980 5981 5982 5983 5984 5985 5986 5987 5988 5989 5990 5991 5992 5993 5994 5995 5996 5997 5998 5999 6000 6001 6002 6003 6004 6005 6006 6007 6008 6009 6010 6011 6012 6013 6014 6015 6016 6017 6018 6019 6020 6021 6022 6023 6024 6025 6026 6027 6028 6029 6030 6031 6032 6033 6034 6035 6036 6037 6038 6039 6040 6041 6042 6043 6044 6045 6046 6047 6048 6049 6050 6051 6052 6053 6054 6055 6056 6057 6058 6059 6060 6061 6062 6063 6064 6065 6066 6067 6068 6069 6070 6071 6072 6073 6074 6075 6076 6077 6078 6079 6080 6081 6082 6083 6084 6085 6086 6087 6088 6089 6090 6091 6092 6093 6094 6095 6096 6097 6098 6099 6100 6101 6102 6103 6104 6105 6106 6107 6108 6109 6110 6111 6112 6113 6114 6115 6116 6117 6118 6119 6120 6121 6122 6123 6124 6125 6126 6127 6128 6129 6130 6131 6132 6133 6134 6135 6136 6137 6138 6139 6140 6141 6142 6143 6144 6145 6146 6147 6148 6149 6150 6151 6152 6153 6154 6155 6156 6157 6158 6159 6160 6161 6162 6163 6164 6165 6166 6167 6168 6169 6170 6171 6172 6173 6174 6175 6176 6177 6178 6179 6180 6181 6182 6183 6184 6185 6186 6187 6188 6189 6190 6191 6192 6193 6194 6195 6196 6197 6198 6199 6200 6201 6202 6203 6204 6205 6206 6207 6208 6209 6210 6211 6212 6213 6214 6215 6216 6217 6218 6219 6220 6221 6222 6223 6224 6225 6226 6227 6228 6229 6230 6231 6232 6233 6234 6235 6236 6237 6238 6239 6240 6241 6242 6243 6244 6245 6246 6247 6248 6249 6250 6251 6252 6253 6254 6255 6256 6257 6258 6259 6260 6261 6262 6263 6264 6265 6266 6267 6268 6269 6270 6271 6272 6273 6274 6275 6276 6277 6278 6279 6280 6281 6282 6283 6284 6285 6286 6287 6288 6289 6290 6291 6292 6293 6294 6295 6296 6297 6298 6299 6300 6301 6302 6303 6304 6305 6306 6307 6308 6309 6310 6311 6312 6313 6314 6315 6316 6317 6318 6319 6320 6321 6322 6323 6324 6325 6326 6327 6328 6329 6330 6331 6332 6333 6334 6335 6336 6337 6338 6339 6340 6341 6342 6343 6344 6345 6346 6347 6348 6349 6350 6351 6352 6353 6354 6355 6356 6357 6358 6359 6360 6361 6362 6363 6364 6365 6366 6367 6368 6369 6370 6371 6372 6373 6374 6375 6376 6377 6378 6379 6380 6381 6382 6383 6384 6385 6386 6387 6388 6389 6390 6391 6392 6393 6394 6395 6396 6397 6398 6399 6400 6401 6402 6403 6404 6405 6406 6407 6408 6409 6410 6411 6412 6413 6414 6415 6416 6417 6418 6419 6420 6421 6422 6423 6424 6425 6426 6427 6428 6429 6430 6431 6432 6433 6434 6435 6436 6437 6438 6439 6440 6441 6442 6443 6444 6445 6446 6447 6448 6449 6450 6451 6452 6453 6454 6455 6456 6457 6458 6459 6460 6461 6462 6463 6464 6465 6466 6467 6468 6469 6470 6471 6472 6473 6474 6475 6476 6477 6478 6479 6480 6481 6482 6483 6484 6485 6486 6487 6488 6489 6490 6491 6492 6493 6494 6495 6496 6497 6498 6499 6500 6501 6502 6503 6504 6505 6506 6507 6508 6509 6510 6511 6512 6513 6514 6515 6516 6517 6518 6519 6520 6521 6522 6523 6524 6525 6526 6527 6528 6529 6530 6531 6532 6533 6534 6535 6536 6537 6538 6539 6540 6541 6542 6543 6544 6545 6546 6547 6548 6549 6550 6551 6552 6553 6554 6555 6556 6557 6558 6559 6560 6561 6562 6563 6564 6565 6566 6567 6568 6569 6570 6571 6572 6573 6574 6575 6576 6577 6578 6579 6580 6581 6582 6583 6584 6585 6586 6587 6588 6589 6590 6591 6592 6593 6594 6595 6596 6597 6598 6599 6600 6601 6602 6603 6604 6605 6606 6607 6608 6609 6610 6611 6612 6613 6614 6615 6616 6617 6618 6619 6620 6621 6622 6623 6624 6625 6626 6627 6628 6629 6630 6631 6632 6633 6634 6635 6636 6637 6638 6639 6640 6641 6642 6643 6644 6645 6646 6647 6648 6649 6650 6651 6652 6653 6654 6655 6656 6657 6658 6659 6660 6661 6662 6663 6664 6665 6666 6667 6668 6669 6670 6671 6672 6673 6674 6675 6676 6677 6678 6679 6680 6681 6682 6683 6684 6685 6686 6687 6688 6689 6690 6691 6692 6693 6694 6695 6696 6697 6698 6699 6700 6701 6702 6703 6704 6705 6706 6707 6708 6709 6710 6711 6712 6713 6714 6715 6716 6717 6718 6719 6720 6721 6722 6723 6724 6725 6726 6727 6728 6729 6730 6731 6732 6733 6734 6735 6736 6737 6738 6739 6740 6741 6742 6743 6744 6745 6746 6747 6748 6749 6750 6751 6752 6753 6754 6755 6756 6757 6758 6759 6760 6761 6762 6763 6764 6765 6766 6767 6768 6769 6770 6771 6772 6773 6774 6775 6776 6777 6778 6779 6780 6781 6782 6783 6784 6785 6786 6787 6788 6789 6790 6791 6792 6793 6794 6795 6796 6797 6798 6799 6800 6801 6802 6803 6804 6805 6806 6807 6808 6809 6810 6811 6812 6813 6814 6815 6816 6817 6818 6819 6820 6821 6822 6823 6824 6825 6826 6827 6828 6829 6830 6831 6832 6833 6834 6835 6836 6837 6838 6839 6840 6841 6842 6843 6844 6845 6846 6847 6848 6849 6850 6851 6852 6853 6854 6855 6856 6857 6858 6859 6860 6861 6862 6863 6864 6865 6866 6867 6868 6869 6870 6871 6872 6873 6874 6875 6876 6877 6878 6879 6880 6881 6882 6883 6884 6885 6886 6887 6888 6889 6890 6891 6892 6893 6894 6895 6896 6897 6898 6899 6900 6901 6902 6903 6904 6905 6906 6907 6908 6909 6910 6911 6912 6913 6914 6915 6916 6917 6918 6919 6920 6921 6922 6923 6924 6925 6926 6927 6928 6929 6930 6931 6932 6933 6934 6935 6936 6937 6938 6939 6940 6941 6942 6943 6944 6945 6946 6947 6948 6949 6950 6951 6952 6953 6954 6955 6956 6957 6958 6959 6960 6961 6962 6963 6964 6965 6966 6967 6968 6969 6970 6971 6972 6973 6974 6975 6976 6977 6978 6979 6980 6981 6982 6983 6984 6985 6986 6987 6988 6989 6990 6991 6992 6993 6994 6995 6996 6997 6998 6999 7000 7001 7002 7003 7004 7005 7006 7007 7008 7009 7010 7011 7012 7013 7014 7015 7016 7017 7018 7019 7020 7021 7022 7023 7024 7025 7026 7027 7028 7029 7030 7031 7032 7033 7034 7035 7036 7037 7038 7039 7040 7041 7042 7043 7044 7045 7046 7047 7048 7049 7050 7051 7052 7053 7054 7055 7056 7057 7058 7059 7060 7061 7062 7063 7064 7065 7066 7067 7068 7069 7070 7071 7072 7073 7074 7075 7076 7077 7078 7079 7080 7081 7082 7083 7084 7085 7086 7087 7088 7089 7090 7091 7092 7093 7094 7095 7096 7097 7098 7099 7100 7101 7102 7103 7104 7105 7106 7107 7108 7109 7110 7111 7112 7113 7114 7115 7116 7117 7118 7119 7120 7121 7122 7123 7124 7125 7126 7127 7128 7129 7130 7131 7132 7133 7134 7135 7136 7137 7138 7139 7140 7141 7142 7143 7144 7145 7146 7147 7148 7149 7150 7151 7152 7153 7154 7155 7156 7157 7158 7159 7160 7161 7162 7163 7164 7165 7166 7167 7168 7169 7170 7171 7172 7173 7174 7175 7176 7177 7178 7179 7180 7181 7182 7183 7184 7185 7186 7187 7188 7189 7190 7191 7192 7193 7194 7195 7196 7197 7198 7199 7200 7201 7202 7203 7204 7205 7206 7207 7208 7209 7210 7211 7212 7213 7214 7215 7216 7217 7218 7219 7220 7221 7222 7223 7224 7225 7226 7227 7228 7229 7230 7231 7232 7233 7234 7235 7236 7237 7238 7239 7240 7241 7242 7243 7244 7245 7246 7247 7248 7249 7250 7251 7252 7253 7254 7255 7256 7257 7258 7259 7260 7261 7262 7263 7264 7265 7266 7267 7268 7269 7270 7271 7272 7273 7274 7275 7276 7277 7278 7279 7280 7281 7282 7283 7284 7285 7286 7287 7288 7289 7290 7291 7292 7293 7294 7295 7296 7297 7298 7299 7300 7301 7302 7303 7304 7305 7306 7307 7308 7309 7310 7311 7312 7313 7314 7315 7316 7317 7318 7319 7320 7321 7322 7323 7324 7325 7326 7327 7328 7329 7330 7331 7332 7333 7334 7335 7336 7337 7338 7339 7340 7341 7342 7343 7344 7345 7346 7347 7348 7349 7350 7351 7352 7353 7354 7355 7356 7357 7358 7359 7360 7361 7362 7363 7364 7365 7366 7367 7368 7369 7370 7371 7372 7373 7374 7375 7376 7377 7378 7379 7380 7381 7382 7383 7384 7385 7386 7387 7388 7389 7390 7391 7392 7393 7394 7395 7396 7397 7398 7399 7400 7401 7402 7403 7404 7405 7406 7407 7408 7409 7410 7411 7412 7413 7414 7415 7416 7417 7418 7419 7420 7421 7422 7423 7424 7425 7426 7427 7428 7429 7430 7431 7432 7433 7434 7435 7436 7437 7438 7439 7440 7441 7442 7443 7444 7445 7446 7447 7448 7449 7450 7451 7452 7453 7454 7455 7456 7457 7458 7459 7460 7461 7462 7463 7464 7465 7466 7467 7468 7469 7470 7471 7472 7473 7474 7475 7476 7477 7478 7479 7480 7481 7482 7483 7484 7485 7486 7487 7488 7489 7490 7491 7492 7493 7494 7495 7496 7497 7498 7499 7500 7501 7502 7503 7504 7505 7506 7507 7508 7509 7510 7511 7512 7513 7514 7515 7516 7517 7518 7519 7520 7521 7522 7523 7524 7525 7526 7527 7528 7529 7530 7531 7532 7533 7534 7535 7536 7537 7538 7539 7540 7541 7542 7543 7544 7545 7546 7547 7548 7549 7550 7551 7552 7553 7554 7555 7556 7557 7558 7559 7560 7561 7562 7563 7564 7565 7566 7567 7568 7569 7570 7571 7572 7573 7574 7575 7576 7577 7578 7579 7580 7581 7582 7583 7584 7585 7586 7587 7588 7589 7590 7591 7592 7593 7594 7595 7596 7597 7598 7599 7600 7601 7602 7603 7604 7605 7606 7607 7608 7609 7610 7611 7612 7613 7614 7615 7616 7617 7618 7619 7620 7621 7622 7623 7624 7625 7626 7627 7628 7629 7630 7631 7632 7633 7634 7635 7636 7637 7638 7639 7640 7641 7642 7643 7644 7645 7646 7647 7648 7649 7650 7651 7652 7653 7654 7655 7656 7657 7658 7659 7660 7661 7662 7663 7664 7665 7666 7667 7668 7669 7670 7671 7672 7673 7674 7675 7676 7677 7678 7679 7680 7681 7682 7683 7684 7685 7686 7687 7688 7689 7690 7691 7692 7693 7694 7695 7696 7697 7698 7699 7700 7701 7702 7703 7704 7705 7706 7707 7708 7709 7710 7711 7712 7713 7714 7715 7716 7717 7718 7719 7720 7721 7722 7723 7724 7725 7726 7727 7728 7729 7730 7731 7732 7733 7734 7735 7736 7737 7738 7739 7740 7741 7742 7743 7744 7745 7746 7747 7748 7749 7750 7751 7752 7753 7754 7755 7756 7757 7758 7759 7760 7761 7762 7763 7764 7765 7766 7767 7768 7769 7770 7771 7772 7773 7774 7775 7776 7777 7778 7779 7780 7781 7782 7783 7784 7785 7786 7787 7788 7789 7790 7791 7792 7793 7794 7795 7796 7797 7798 7799 7800 7801 7802 7803 7804 7805 7806 7807 7808 7809 7810 7811 7812 7813 7814 7815 7816 7817 7818 7819 7820 7821 7822 7823 7824 7825 7826 7827 7828 7829 7830 7831 7832 7833 7834 7835 7836 7837 7838 7839 7840 7841 7842 7843 7844 7845 7846 7847 7848 7849 7850 7851 7852 7853 7854 7855 7856 7857 7858 7859 7860 7861 7862 7863 7864 7865 7866 7867 7868 7869 7870 7871 7872 7873 7874 7875 7876 7877 7878 7879 7880 7881 7882 7883 7884 7885 7886 7887 7888 7889 7890 7891 7892 7893 7894 7895 7896 7897 7898 7899 7900 7901 7902 7903 7904 7905 7906 7907 7908 7909 7910 7911 7912 7913 7914 7915 7916 7917 7918 7919 7920 7921 7922 7923 7924 7925 7926 7927 7928 7929 7930 7931 7932 7933 7934 7935 7936 7937 7938 7939 7940 7941 7942 7943 7944 7945 7946 7947 7948 7949 7950 7951 7952 7953 7954 7955 7956 7957 7958 7959 7960 7961 7962 7963 7964 7965 7966 7967 7968 7969 7970 7971 7972 7973 7974 7975 7976 7977 7978 7979 7980 7981 7982 7983 7984 7985 7986 7987 7988 7989 7990 7991 7992 7993 7994 7995 7996 7997 7998 7999 8000 8001 8002 8003 8004 8005 8006 8007 8008 8009 8010 8011 8012 8013 8014 8015 8016 8017 8018 8019 8020 8021 8022 8023 8024 8025 8026 8027 8028 8029 8030 8031 8032 8033 8034 8035 8036 8037 8038 8039 8040 8041 8042 8043 8044 8045 8046 8047 8048 8049 8050 8051 8052 8053 8054 8055 8056 8057 8058 8059 8060 8061 8062 8063 8064 8065 8066 8067 8068 8069 8070 8071 8072 8073 8074 8075 8076 8077 8078 8079 8080 8081 8082 8083 8084 8085 8086 8087 8088 8089 8090 8091 8092 8093 8094 8095 8096 8097 8098 8099 8100 8101 8102 8103 8104 8105 8106 8107 8108 8109 8110 8111 8112 8113 8114 8115 8116 8117 8118 8119 8120 8121 8122 8123 8124 8125 8126 8127 8128 8129 8130 8131 8132 8133 8134 8135 8136 8137 8138 8139 8140 8141 8142 8143 8144 8145 8146 8147 8148 8149 8150 8151 8152 8153 8154 8155 8156 8157 8158 8159 8160 8161 8162 8163 8164 8165 8166 8167 8168 8169 8170 8171 8172 8173 8174 8175 8176 8177 8178 8179 8180 8181 8182 8183 8184 8185 8186 8187 8188 8189 8190 8191 8192 8193 8194 8195 8196 8197 8198 8199 8200 8201 8202 8203 8204 8205 8206 8207 8208 8209 8210 8211 8212 8213 8214 8215 8216 8217 8218 8219 8220 8221 8222 8223 8224 8225 8226 8227 8228 8229 8230 8231 8232 8233 8234 8235 8236 8237 8238 8239 8240 8241 8242 8243 8244 8245 8246 8247 8248 8249 8250 8251 8252 8253 8254 8255 8256 8257 8258 8259 8260 8261 8262 8263 8264 8265 8266 8267 8268 8269 8270 8271 8272 8273 8274 8275 8276 8277 8278 8279 8280 8281 8282 8283 8284 8285 8286 8287 8288 8289 8290 8291 8292 8293 8294 8295 8296 8297 8298 8299 8300 8301 8302 8303 8304 8305 8306 8307 8308 8309 8310 8311 8312 8313 8314 8315 8316 8317 8318 8319 8320 8321 8322 8323 8324 8325 8326 8327 8328 8329 8330 8331 8332 8333 8334 8335 8336 8337 8338 8339 8340 8341 8342 8343 8344 8345 8346 8347 8348 8349 8350 8351 8352 8353 8354 8355 8356 8357 8358 8359 8360 8361 8362 8363 8364 8365 8366 8367 8368 8369 8370 8371 8372 8373 8374 8375 8376 8377 8378 8379 8380 8381 8382 8383 8384 8385 8386 8387 8388 8389 8390 8391 8392 8393 8394 8395 8396 8397 8398 8399 8400 8401 8402 8403 8404 8405 8406 8407 8408 8409 8410 8411 8412 8413 8414 8415 8416 8417 8418 8419 8420 8421 8422 8423 8424 8425 8426 8427 8428 8429 8430 8431 8432 8433 8434 8435 8436 8437 8438 8439 8440 8441 8442 8443 8444 8445 8446 8447 8448 8449 8450 8451 8452 8453 8454 8455 8456 8457 8458 8459 8460 8461 8462 8463 8464 8465 8466 8467 8468 8469 8470 8471 8472 8473 8474 8475 8476 8477 8478 8479 8480 8481 8482 8483 8484 8485 8486 8487 8488 8489 8490 8491 8492 8493 8494 8495 8496 8497 8498 8499 8500 8501 8502 8503 8504 8505 8506 8507 8508 8509 8510 8511 8512 8513 8514 8515 8516 8517 8518 8519 8520 8521 8522 8523 8524 8525 8526 8527 8528 8529 8530 8531 8532 8533 8534 8535 8536 8537 8538 8539 8540 8541 8542 8543 8544 8545 8546 8547 8548 8549 8550 8551 8552 8553 8554 8555 8556 8557 8558 8559 8560 8561 8562 8563 8564 8565 8566 8567 8568 8569 8570 8571 8572 8573 8574 8575 8576 8577 8578 8579 8580 8581 8582 8583 8584 8585 8586 8587 8588 8589 8590 8591 8592 8593 8594 8595 8596 8597 8598 8599 8600 8601 8602 8603 8604 8605 8606 8607 8608 8609 8610 8611 8612 8613 8614 8615 8616 8617 8618 8619 8620 8621 8622 8623 8624 8625 8626 8627 8628 8629 8630 8631 8632 8633 8634 8635 8636 8637 8638 8639 8640 8641 8642 8643 8644 8645 8646 8647 8648 8649 8650 8651 8652 8653 8654 8655 8656 8657 8658 8659 8660 8661 8662 8663 8664 8665 8666 8667 8668 8669 8670 8671 8672 8673 8674 8675 8676 8677 8678 8679 8680 8681 8682 8683 8684 8685 8686 8687 8688 8689 8690 8691 8692 8693 8694 8695 8696 8697 8698 8699 8700 8701 8702 8703 8704 8705 8706 8707 8708 8709 8710 8711 8712 8713 8714 8715 8716 8717 8718 8719 8720 8721 8722 8723 8724 8725 8726 8727 8728 8729 8730 8731 8732 8733 8734 8735 8736 8737 8738 8739 8740 8741 8742 8743 8744 8745 8746 8747 8748 8749 8750 8751 8752 8753 8754 8755 8756 8757 8758 8759 8760 8761 8762 8763 8764 8765 8766 8767 8768 8769 8770 8771 8772 8773 8774 8775 8776 8777 8778 8779 8780 8781 8782 8783 8784 8785 8786 8787 8788 8789 8790 8791 8792 8793 8794 8795 8796 8797 8798 8799 8800 8801 8802 8803 8804 8805 8806 8807 8808 8809 8810 8811 8812 8813 8814 8815 8816 8817 8818 8819 8820 8821 8822 8823 8824 8825 8826 8827 8828 8829 8830 8831 8832 8833 8834 8835 8836 8837 8838 8839 8840 8841 8842 8843 8844 8845 8846 8847 8848 8849 8850 8851 8852 8853 8854 8855 8856 8857 8858 8859 8860 8861 8862 8863 8864 8865 8866 8867 8868 8869 8870 8871 8872 8873 8874 8875 8876 8877 8878 8879 8880 8881 8882 8883 8884 8885 8886 8887 8888 8889 8890 8891 8892 8893 8894 8895 8896 8897 8898 8899 8900 8901 8902 8903 8904 8905 8906 8907 8908 8909 8910 8911 8912 8913 8914 8915 8916 8917 8918 8919 8920 8921 8922 8923 8924 8925 8926 8927 8928 8929 8930 8931 8932 8933 8934 8935 8936 8937 8938 8939 8940 8941 8942 8943 8944 8945 8946 8947 8948 8949 8950 8951 8952 8953 8954 8955 8956 8957 8958 8959 8960 8961 8962 8963 8964 8965 8966 8967 8968 8969 8970 8971 8972 8973 8974 8975 8976 8977 8978 8979 8980 8981 8982 8983 8984 8985 8986 8987 8988 8989 8990 8991 8992 8993 8994 8995 8996 8997 8998 8999 9000 9001 9002 9003 9004 9005 9006 9007 9008 9009 9010 9011 9012 9013 9014 9015 9016 9017 9018 9019 9020 9021 9022 9023 9024 9025 9026 9027 9028 9029 9030 9031 9032 9033 9034 9035 9036 9037 9038 9039 9040 9041 9042 9043 9044 9045 9046 9047 9048 9049 9050 9051 9052 9053 9054 9055 9056 9057 9058 9059 9060 9061 9062 9063 9064 9065 9066 9067 9068 9069 9070 9071 9072 9073 9074 9075 9076 9077 9078 9079 9080 9081 9082 9083 9084 9085 9086 9087 9088 9089 9090 9091 9092 9093 9094 9095 9096 9097 9098 9099 9100 9101 9102 9103 9104 9105 9106 9107 9108 9109 9110 9111 9112 9113 9114 9115 9116 9117 9118 9119 9120 9121 9122 9123 9124 9125 9126 9127 9128 9129 9130 9131 9132 9133 9134 9135 9136 9137 9138 9139 9140 9141 9142 9143 9144 9145 9146 9147 9148 9149 9150 9151 9152 9153 9154 9155 9156 9157 9158 9159 9160 9161 9162 9163 9164 9165 9166 9167 9168 9169 9170 9171 9172 9173 9174 9175 9176 9177 9178 9179 9180 9181 9182 9183 9184 9185 9186 9187 9188 9189 9190 9191 9192 9193 9194 9195 9196 9197 9198 9199 9200 9201 9202 9203 9204 9205 9206 9207 9208 9209 9210 9211 9212 9213 9214 9215 9216 9217 9218 9219 9220 9221 9222 9223 9224 9225 9226 9227 9228 9229 9230 9231 9232 9233 9234 9235 9236 9237 9238 9239 9240 9241 9242 9243 9244 9245 9246 9247 9248 9249 9250 9251 9252 9253 9254 9255 9256 9257 9258 9259 9260 9261 9262 9263 9264 9265 9266 9267 9268 9269 9270 9271 9272 9273 9274 9275 9276 9277 9278 9279 9280 9281 9282 9283 9284 9285 9286 9287 9288 9289 9290 9291 9292 9293 9294 9295 9296 9297 9298 9299 9300 9301 9302 9303 9304 9305 9306 9307 9308 9309 9310 9311 9312 9313 9314 9315 9316 9317 9318 9319 9320 9321 9322 9323 9324 9325 9326 9327 9328 9329 9330 9331 9332 9333 9334 9335 9336 9337 9338 9339 9340 9341 9342 9343 9344 9345 9346 9347 9348 9349 9350 9351 9352 9353 9354 9355 9356 9357 9358 9359 9360 9361 9362 9363 9364 9365 9366 9367 9368 9369 9370 9371 9372 9373 9374 9375 9376 9377 9378 9379 9380 9381 9382 9383 9384 9385 9386 9387 9388 9389 9390 9391 9392 9393 9394 9395 9396 9397 9398 9399 9400 9401 9402 9403 9404 9405 9406 9407 9408 9409 9410 9411 9412 9413 9414 9415 9416 9417 9418 9419 9420 9421 9422 9423 9424 9425 9426 9427 9428 9429 9430 9431 9432 9433 9434 9435 9436 9437 9438 9439 9440 9441 9442 9443 9444 9445 9446 9447 9448 9449 9450 9451 9452 9453 9454 9455 9456 9457 9458 9459 9460 9461 9462 9463 9464 9465 9466 9467 9468 9469 9470 9471 9472 9473 9474 9475 9476 9477 9478 9479 9480 9481 9482 9483 9484 9485 9486 9487 9488 9489 9490 9491 9492 9493 9494 9495 9496 9497 9498 9499 9500 9501 9502 9503 9504 9505 9506 9507 9508 9509 9510 9511 9512 9513 9514 9515 9516 9517 9518 9519 9520 9521 9522 9523 9524 9525 9526 9527 9528 9529 9530 9531 9532 9533 9534 9535 9536 9537 9538 9539 9540 9541 9542 9543 9544 9545 9546 9547 9548 9549 9550 9551 9552 9553 9554 9555 9556 9557 9558 9559 9560 9561 9562 9563 9564 9565 9566 9567 9568 9569 9570 9571 9572 9573 9574 9575 9576 9577 9578 9579 9580 9581 9582 9583 9584 9585 9586 9587 9588 9589 9590 9591 9592 9593 9594 9595 9596 9597 9598 9599 9600 9601 9602 9603 9604 9605 9606 9607 9608 9609 9610 9611 9612 9613 9614 9615 9616 9617 9618 9619 9620 9621 9622 9623 9624 9625 9626 9627 9628 9629 9630 9631 9632 9633 9634 9635 9636 9637 9638 9639 9640 9641 9642 9643 9644 9645 9646 9647 9648 9649 9650 9651 9652 9653 9654 9655 9656 9657 9658 9659 9660 9661 9662 9663 9664 9665 9666 9667 9668 9669 9670 9671 9672 9673 9674 9675 9676 9677 9678 9679 9680 9681 9682 9683 9684 9685 9686 9687 9688 9689 9690 9691 9692 9693 9694 9695 9696 9697 9698 9699 9700 9701 9702 9703 9704 9705 9706 9707 9708 9709 9710 9711 9712 9713 9714 9715 9716 9717 9718 9719 9720 9721 9722 9723 9724 9725 9726 9727 9728 9729 9730 9731 9732 9733 9734 9735 9736 9737 9738 9739 9740 9741 9742 9743 9744 9745 9746 9747 9748 9749 9750 9751 9752 9753 9754 9755 9756 9757 9758 9759 9760 9761 9762 9763 9764 9765 9766 9767 9768 9769 9770 9771 9772 9773 9774 9775 9776 9777 9778 9779 9780 9781 9782 9783 9784 9785 9786 9787 9788 9789 9790 9791 9792 9793 9794 9795 9796 9797 9798 9799 9800 9801 9802 9803 9804 9805 9806 9807 9808 9809 9810 9811 9812 9813 9814 9815 9816 9817 9818 9819 9820 9821 9822 9823 9824 9825 9826 9827 9828 9829 9830 9831 9832 9833 9834 9835 9836 9837 9838 9839 9840 9841 9842 9843 9844 9845 9846 9847 9848 9849 9850 9851 9852 9853 9854 9855 9856 9857 9858 9859 9860 9861 9862 9863 9864 9865 9866 9867 9868 9869 9870 9871 9872 9873 9874 9875 9876 9877 9878 9879 9880 9881 9882 9883 9884 9885 9886 9887 9888 9889 9890 9891 9892 9893 9894 9895 9896 9897 9898 9899 9900 9901 9902 9903 9904 9905 9906 9907 9908 9909 9910 9911 9912 9913 9914 9915 9916 9917 9918 9919 9920 9921 9922 9923 9924 9925 9926 9927 9928 9929 9930 9931 9932 9933 9934 9935 9936 9937 9938 9939 9940 9941 9942 9943 9944 9945 9946 9947 9948 9949 9950 9951 9952 9953 9954 9955 9956 9957 9958 9959 9960 9961 9962 9963 9964 9965 9966 9967 9968 9969 9970 9971 9972 9973 9974 9975 9976 9977 9978 9979 9980 9981 9982 9983 9984 9985 9986 9987 9988 9989 9990 9991 9992 9993 9994 9995 9996 9997 9998 9999 10000 10001 10002 10003 10004 10005 10006 10007 10008 10009 10010 10011 10012 10013 10014 10015 10016 10017 10018 10019 10020 10021 10022 10023 10024 10025 10026 10027 10028 10029 10030 10031 10032 10033 10034 10035 10036 10037 10038 10039 10040 10041 10042 10043 10044 10045 10046 10047 10048 10049 10050 10051 10052 10053 10054 10055 10056 10057 10058 10059 10060 10061 10062 10063 10064 10065 10066 10067 10068 10069 10070 10071 10072 10073 10074 10075 10076 10077 10078 10079 10080 10081 10082 10083 10084 10085 10086 10087 10088 10089 10090 10091 10092 10093 10094 10095 10096 10097 10098 10099 10100 10101 10102 10103 10104 10105 10106 10107 10108 10109 10110 10111 10112 10113 10114 10115 10116 10117 10118 10119 10120 10121 10122 10123 10124 10125 10126 10127 10128 10129 10130 10131 10132 10133 10134 10135 10136 10137 10138 10139 10140 10141 10142 10143 10144 10145 10146 10147 10148 10149 10150 10151 10152 10153 10154 10155 10156 10157 10158 10159 10160 10161 10162 10163 10164 10165 10166 10167 10168 10169 10170 10171 10172 10173 10174 10175 10176 10177 10178 10179 10180 10181 10182 10183 10184 10185 10186 10187 10188 10189 10190 10191 10192 10193 10194 10195 10196 10197 10198 10199 10200 10201 10202 10203 10204 10205 10206 10207 10208 10209 10210 10211 10212 10213 10214 10215 10216 10217 10218 10219 10220 10221 10222 10223 10224 10225 10226 10227 10228 10229 10230 10231 10232 10233 10234 10235 10236 10237 10238 10239 10240 10241 10242 10243 10244 10245 10246 10247 10248 10249 10250 10251 10252 10253 10254 10255 10256 10257 10258 10259 10260 10261 10262 10263 10264 10265 10266 10267 10268 10269 10270 10271 10272 10273 10274 10275 10276 10277 10278 10279 10280 10281 10282 10283 10284 10285 10286 10287 10288 10289 10290 10291 10292 10293 10294 10295 10296 10297 10298 10299 10300 10301 10302 10303 10304 10305 10306 10307 10308 10309 10310 10311 10312 10313 10314 10315 10316 10317 10318 10319 10320 10321 10322 10323 10324 10325 10326 10327 10328 10329 10330 10331 10332 10333 10334 10335 10336 10337 10338 10339 10340 10341 10342 10343 10344 10345 10346 10347 10348 10349 10350 10351 10352 10353 10354 10355 10356 10357 10358 10359 10360 10361 10362 10363 10364 10365 10366 10367 10368 10369 10370 10371 10372 10373 10374 10375 10376 10377 10378 10379 10380 10381 10382 10383 10384 10385 10386 10387 10388 10389 10390 10391 10392 10393 10394 10395 10396 10397 10398 10399 10400 10401 10402 10403 10404 10405 10406 10407 10408 10409 10410 10411 10412 10413 10414 10415 10416 10417 10418 10419 10420 10421 10422 10423 10424 10425 10426 10427 10428 10429 10430 10431 10432 10433 10434 10435 10436 10437 10438 10439 10440 10441 10442 10443 10444 10445 10446 10447 10448 10449 10450 10451 10452 10453 10454 10455 10456 10457 10458 10459 10460 10461 10462 10463 10464 10465 10466 10467 10468 10469 10470 10471 10472 10473 10474 10475 10476 10477 10478 10479 10480 10481 10482 10483 10484 10485 10486 10487 10488 10489 10490 10491 10492 10493 10494 10495 10496 10497 10498 10499 10500 10501 10502 10503 10504 10505 10506 10507 10508 10509 10510 10511 10512 10513 10514 10515 10516 10517 10518 10519 10520 10521 10522 10523 10524 10525 10526 10527 10528 10529 10530 10531 10532 10533 10534 10535 10536 10537 10538 10539 10540 10541 10542 10543 10544 10545 10546 10547 10548 10549 10550 10551 10552 10553 10554 10555 10556 10557 10558 10559 10560 10561 10562 10563 10564 10565 10566 10567 10568 10569 10570 10571 10572 10573 10574 10575 10576 10577 10578 10579 10580 10581 10582 10583 10584 10585 10586 10587 10588 10589 10590 10591 10592 10593 10594 10595 10596 10597 10598 10599 10600 10601 10602 10603 10604 10605 10606 10607 10608 10609 10610 10611 10612 10613 10614 10615 10616 10617 10618 10619 10620 10621 10622 10623 10624 10625 10626 10627 10628 10629 10630 10631 10632 10633 10634 10635 10636 10637 10638 10639 10640 10641 10642 10643 10644 10645 10646 10647 10648 10649 10650 10651 10652 10653 10654 10655 10656 10657 10658 10659 10660 10661 10662 10663 10664 10665 10666 10667 10668 10669 10670 10671 10672 10673 10674 10675 10676 10677 10678 10679 10680 10681 10682 10683 10684 10685 10686 10687 10688 10689 10690 10691 10692 10693 10694 10695 10696 10697 10698 10699 10700 10701 10702 10703 10704 10705 10706 10707 10708 10709 10710 10711 10712 10713 10714 10715 10716 10717 10718 10719 10720 10721 10722 10723 10724 10725 10726 10727 10728 10729 10730 10731 10732 10733 10734 10735 10736 10737 10738 10739 10740 10741 10742 10743 10744 10745 10746 10747 10748 10749 10750 10751 10752 10753 10754 10755 10756 10757 10758 10759 10760 10761 10762 10763 10764 10765 10766 10767 10768 10769 10770 10771 10772 10773 10774 10775 10776 10777 10778 10779 10780 10781 10782 10783 10784 10785 10786 10787 10788 10789 10790 10791 10792 10793 10794 10795 10796 10797 10798 10799 10800 10801 10802 10803 10804 10805 10806 10807 10808 10809 10810 10811 10812 10813 10814 10815 10816 10817 10818 10819 10820 10821 10822 10823 10824 10825 10826 10827 10828 10829 10830 10831 10832 10833 10834 10835 10836 10837 10838 10839 10840 10841 10842 10843 10844 10845 10846 10847 10848 10849 10850 10851 10852 10853 10854 10855 10856 10857 10858 10859 10860 10861 10862 10863 10864 10865 10866 10867 10868 10869 10870 10871 10872 10873 10874 10875 10876 10877 10878 10879 10880 10881 10882 10883 10884 10885 10886 10887 10888 10889 10890 10891 10892 10893 10894 10895 10896 10897 10898 10899 10900 10901 10902 10903 10904 10905 10906 10907 10908 10909 10910 10911 10912 10913 10914 10915 10916 10917 10918 10919 10920 10921 10922 10923 10924 10925 10926 10927 10928 10929 10930 10931 10932 10933 10934 10935 10936 10937 10938 10939 10940 10941 10942 10943 10944 10945 10946 10947 10948 10949 10950 10951 10952 10953 10954 10955 10956 10957 10958 10959 10960 10961 10962 10963 10964 10965 10966 10967 10968 10969 10970 10971 10972 10973 10974 10975 10976 10977 10978 10979 10980 10981 10982 10983 10984 10985 10986 10987 10988 10989 10990 10991 10992 10993 10994 10995 10996 10997 10998 10999 11000 11001 11002 11003 11004 11005 11006 11007 11008 11009 11010 11011 11012 11013 11014 11015 11016 11017 11018 11019 11020 11021 11022 11023 11024 11025 11026 11027 11028 11029 11030 11031 11032 11033 11034 11035 11036 11037 11038 11039 11040 11041 11042 11043 11044 11045 11046 11047 11048 11049 11050 11051 11052 11053 11054 11055 11056 11057 11058 11059 11060 11061 11062 11063 11064 11065 11066 11067 11068 11069 11070 11071 11072 11073 11074 11075 11076 11077 11078 11079 11080 11081 11082 11083 11084 11085 11086 11087 11088 11089 11090 11091 11092 11093 11094 11095 11096 11097 11098 11099 11100 11101 11102 11103 11104 11105 11106 11107 11108 11109 11110 11111 11112 11113 11114 11115 11116 11117 11118 11119 11120 11121 11122 11123 11124 11125 11126 11127 11128 11129 11130 11131 11132 11133 11134 11135 11136 11137 11138 11139 11140 11141 11142 11143 11144 11145 11146 11147 11148 11149 11150 11151 11152 11153 11154 11155 11156 11157 11158 11159 11160 11161 11162 11163 11164 11165 11166 11167 11168 11169 11170 11171 11172 11173 11174 11175 11176 11177 11178 11179 11180 11181 11182 11183 11184 11185 11186 11187 11188 11189 11190 11191 11192 11193 11194 11195 11196 11197 11198 11199 11200 11201 11202 11203 11204 11205 11206 11207 11208 11209 11210 11211 11212 11213 11214 11215 11216 11217 11218 11219 11220 11221 11222 11223 11224 11225 11226 11227 11228 11229 11230 11231 11232 11233 11234 11235 11236 11237 11238 11239 11240 11241 11242 11243 11244 11245 11246 11247 11248 11249 11250 11251 11252 11253 11254 11255 11256 11257 11258 11259 11260 11261 11262 11263 11264 11265 11266 11267 11268 11269 11270 11271 11272 11273 11274 11275 11276 11277 11278 11279 11280 11281 11282 11283 11284 11285 11286 11287 11288 11289 11290 11291 11292 11293 11294 11295 11296 11297 11298 11299 11300 11301 11302 11303 11304 11305 11306 11307 11308 11309 11310 11311 11312 11313 11314 11315 11316 11317 11318 11319 11320 11321 11322 11323 11324 11325 11326 11327 11328 11329 11330 11331 11332 11333 11334 11335 11336 11337 11338 11339 11340 11341 11342 11343 11344 11345 11346 11347 11348 11349 11350 11351 11352 11353 11354 11355 11356 11357 11358 11359 11360 11361 11362 11363 11364 11365 11366 11367 11368 11369 11370 11371 11372 11373 11374 11375 11376 11377 11378 11379 11380 11381 11382 11383 11384 11385 11386 11387 11388 11389 11390 11391 11392 11393 11394 11395 11396 11397 11398 11399 11400 11401 11402 11403 11404 11405 11406 11407 11408 11409 11410 11411 11412 11413 11414 11415 11416 11417 11418 11419 11420 11421 11422 11423 11424 11425 11426 11427 11428 11429 11430 11431 11432 11433 11434 11435 11436 11437 11438 11439 11440 11441 11442 11443 11444 11445 11446 11447 11448 11449 11450 11451 11452 11453 11454 11455 11456 11457 11458 11459 11460 11461 11462 11463 11464 11465 11466 11467 11468 11469 11470 11471 11472 11473 11474 11475 11476 11477 11478 11479 11480 11481 11482 11483 11484 11485 11486 11487 11488 11489 11490 11491 11492 11493 11494 11495 11496 11497 11498 11499 11500 11501 11502 11503 11504 11505 11506 11507 11508 11509 11510 11511 11512 11513 11514 11515 11516 11517 11518 11519 11520 11521 11522 11523 11524 11525 11526 11527 11528 11529 11530 11531 11532 11533 11534 11535 11536 11537 11538 11539 11540 11541 11542 11543 11544 11545 11546 11547 11548 11549 11550 11551 11552 11553 11554 11555 11556 11557 11558 11559 11560 11561 11562 11563 11564 11565 11566 11567 11568 11569 11570 11571 11572 11573 11574 11575 11576 11577 11578 11579 11580 11581 11582 11583 11584 11585 11586 11587 11588 11589 11590 11591 11592 11593 11594 11595 11596 11597 11598 11599 11600 11601 11602 11603 11604 11605 11606 11607 11608 11609 11610 11611 11612 11613 11614 11615 11616 11617 11618 11619 11620 11621 11622 11623 11624 11625 11626 11627 11628 11629 11630 11631 11632 11633 11634 11635 11636 11637 11638 11639 11640 11641 11642 11643 11644 11645 11646 11647 11648 11649 11650 11651 11652 11653 11654 11655 11656 11657 11658 11659 11660 11661 11662 11663 11664 11665 11666 11667 11668 11669 11670 11671 11672 11673 11674 11675 11676 11677 11678 11679 11680 11681 11682 11683 11684 11685 11686 11687 11688 11689 11690 11691 11692 11693 11694 11695 11696 11697 11698 11699 11700 11701 11702 11703 11704 11705 11706 11707 11708 11709 11710 11711 11712 11713 11714 11715 11716 11717 11718 11719 11720 11721 11722 11723 11724 11725 11726 11727 11728 11729 11730 11731 11732 11733 11734 11735 11736 11737 11738 11739 11740 11741 11742 11743 11744 11745 11746 11747 11748 11749 11750 11751 11752 11753 11754 11755 11756 11757 11758 11759 11760 11761 11762 11763 11764 11765 11766 11767 11768 11769 11770 11771 11772 11773 11774 11775 11776 11777 11778 11779 11780 11781 11782 11783 11784 11785 11786 11787 11788 11789 11790 11791 11792 11793 11794 11795 11796 11797 11798 11799 11800 11801 11802 11803 11804 11805 11806 11807 11808 11809 11810 11811 11812 11813 11814 11815 11816 11817 11818 11819 11820 11821 11822 11823 11824 11825 11826 11827 11828 11829 11830 11831 11832 11833 11834 11835 11836 11837 11838 11839 11840 11841 11842 11843 11844 11845 11846 11847 11848 11849 11850 11851 11852 11853 11854 11855 11856 11857 11858 11859 11860 11861 11862 11863 11864 11865 11866 11867 11868 11869 11870 11871 11872 11873 11874 11875 11876 11877 11878 11879 11880 11881 11882 11883 11884 11885 11886 11887 11888 11889 11890 11891 11892 11893 11894 11895 11896 11897 11898 11899 11900 11901 11902 11903 11904 11905 11906 11907 11908 11909 11910 11911 11912 11913 11914 11915 11916 11917 11918 11919 11920 11921 11922 11923 11924 11925 11926 11927 11928 11929 11930 11931 11932 11933 11934 11935 11936 11937 11938 11939 11940 11941 11942 11943 11944 11945 11946 11947 11948 11949 11950 11951 11952 11953 11954 11955 11956 11957 11958 11959 11960 11961 11962 11963 11964 11965 11966 11967 11968 11969 11970 11971 11972 11973 11974 11975 11976 11977 11978 11979 11980 11981 11982 11983 11984 11985 11986 11987 11988 11989 11990 11991 11992 11993 11994 11995 11996 11997 11998 11999 12000 12001 12002 12003 12004 12005 12006 12007 12008 12009 12010 12011 12012 12013 12014 12015 12016 12017 12018 12019 12020 12021 12022 12023 12024 12025 12026 12027 12028 12029 12030 12031 12032 12033 12034 12035 12036 12037 12038 12039 12040 12041 12042 12043 12044 12045 12046 12047 12048 12049 12050 12051 12052 12053 12054 12055 12056 12057 12058 12059 12060 12061 12062 12063 12064 12065 12066 12067 12068 12069 12070 12071 12072 12073 12074 12075 12076 12077 12078 12079 12080 12081 12082 12083 12084 12085 12086 12087 12088 12089 12090 12091 12092 12093 12094 12095 12096 12097 12098 12099 12100 12101 12102 12103 12104 12105 12106 12107 12108 12109 12110 12111 12112 12113 12114 12115 12116 12117 12118 12119 12120 12121 12122 12123 12124 12125 12126 12127 12128 12129 12130 12131 12132 12133 12134 12135 12136 12137 12138 12139 12140 12141 12142 12143 12144 12145 12146 12147 12148 12149 12150 12151 12152 12153 12154 12155 12156 12157 12158 12159 12160 12161 12162 12163 12164 12165 12166 12167 12168 12169 12170 12171 12172 12173 12174 12175 12176 12177 12178 12179 12180 12181 12182 12183 12184 12185 12186 12187 12188 12189 12190 12191 12192 12193 12194 12195 12196 12197 12198 12199 12200 12201 12202 12203 12204 12205 12206 12207 12208 12209 12210 12211 12212 12213 12214 12215 12216 12217 12218 12219 12220 12221 12222 12223 12224 12225 12226 12227 12228 12229 12230 12231 12232 12233 12234 12235 12236 12237 12238 12239 12240 12241 12242 12243 12244 12245 12246 12247 12248 12249 12250 12251 12252 12253 12254 12255 12256 12257 12258 12259 12260 12261 12262 12263 12264 12265 12266 12267 12268 12269 12270 12271 12272 12273 12274 12275 12276 12277 12278 12279 12280 12281 12282 12283 12284 12285 12286 12287 12288 12289 12290 12291 12292 12293 12294 12295 12296 12297 12298 12299 12300 12301 12302 12303 12304 12305 12306 12307 12308 12309 12310 12311 12312 12313 12314 12315 12316 12317 12318 12319 12320 12321 12322 12323 12324 12325 12326 12327 12328 12329 12330 12331 12332 12333 12334 12335 12336 12337 12338 12339 12340 12341 12342 12343 12344 12345 12346 12347 12348 12349 12350 12351 12352 12353 12354 12355 12356 12357 12358 12359 12360 12361 12362 12363 12364 12365 12366 12367 12368 12369 12370 12371 12372 12373 12374 12375 12376 12377 12378 12379 12380 12381 12382 12383 12384 12385 12386 12387 12388 12389 12390 12391 12392 12393 12394 12395 12396 12397 12398 12399 12400 12401 12402 12403 12404 12405 12406 12407 12408 12409 12410 12411 12412 12413 12414 12415 12416 12417 12418 12419 12420 12421 12422 12423 12424 12425 12426 12427 12428 12429 12430 12431 12432 12433 12434 12435 12436 12437 12438 12439 12440 12441 12442 12443 12444 12445 12446 12447 12448 12449 12450 12451 12452 12453 12454 12455 12456 12457 12458 12459 12460 12461 12462 12463 12464 12465 12466 12467 12468 12469 12470 12471 12472 12473 12474 12475 12476 12477 12478 12479 12480 12481 12482 12483 12484 12485 12486 12487 12488 12489 12490 12491 12492 12493 12494 12495 12496 12497 12498 12499 12500 12501 12502 12503 12504 12505 12506 12507 12508 12509 12510 12511 12512 12513 12514 12515 12516 12517 12518 12519 12520 12521 12522 12523 12524 12525 12526 12527 12528 12529 12530 12531 12532 12533 12534 12535 12536 12537 12538 12539 12540 12541 12542 12543 12544 12545 12546 12547 12548 12549 12550 12551 12552 12553 12554 12555 12556 12557 12558 12559 12560 12561 12562 12563 12564 12565 12566 12567 12568 12569 12570 12571 12572 12573 12574 12575 12576 12577 12578 12579 12580 12581 12582 12583 12584 12585 12586 12587 12588 12589 12590 12591 12592 12593 12594 12595 12596 12597 12598 12599 12600 12601 12602 12603 12604 12605 12606 12607 12608 12609 12610 12611 12612 12613 12614 12615 12616 12617 12618 12619 12620 12621 12622 12623 12624 12625 12626 12627 12628 12629 12630 12631 12632 12633 12634 12635 12636 12637 12638 12639 12640 12641 12642 12643 12644 12645 12646 12647 12648 12649 12650 12651 12652 12653 12654 12655 12656 12657 12658 12659 12660 12661 12662 12663 12664 12665 12666 12667 12668 12669 12670 12671 12672 12673 12674 12675 12676 12677 12678 12679 12680 12681 12682 12683 12684 12685 12686 12687 12688 12689 12690 12691 12692 12693 12694 12695 12696 12697 12698 12699 12700 12701 12702 12703 12704 12705 12706 12707 12708 12709 12710 12711 12712 12713 12714 12715 12716 12717 12718 12719 12720 12721 12722 12723 12724 12725 12726 12727 12728 12729 12730 12731 12732 12733 12734 12735 12736 12737 12738 12739 12740 12741 12742 12743 12744 12745 12746 12747 12748 12749 12750 12751 12752 12753 12754 12755 12756 12757 12758 12759 12760 12761 12762 12763 12764 12765 12766 12767 12768 12769 12770 12771 12772 12773 12774 12775 12776 12777 12778 12779 12780 12781 12782 12783 12784 12785 12786 12787 12788 12789 12790 12791 12792 12793 12794 12795 12796 12797 12798 12799 12800 12801 12802 12803 12804 12805 12806 12807 12808 12809 12810 12811 12812 12813 12814 12815 12816 12817 12818 12819 12820 12821 12822 12823 12824 12825 12826 12827 12828 12829 12830 12831 12832 12833 12834 12835 12836 12837 12838 12839 12840 12841 12842 12843 12844 12845 12846 12847 12848 12849 12850 12851 12852 12853 12854 12855 12856 12857 12858 12859 12860 12861 12862 12863 12864 12865 12866 12867 12868 12869 12870 12871 12872 12873 12874 12875 12876 12877 12878 12879 12880 12881 12882 12883 12884 12885 12886 12887 12888 12889 12890 12891 12892 12893 12894 12895 12896 12897 12898 12899 12900 12901 12902 12903 12904 12905 12906 12907 12908 12909 12910 12911 12912 12913 12914 12915 12916 12917 12918 12919 12920 12921 12922 12923 12924 12925 12926 12927 12928 12929 12930 12931 12932 12933 12934 12935 12936 12937 12938 12939 12940 12941 12942 12943 12944 12945 12946 12947 12948 12949 12950 12951 12952 12953 12954 12955 12956 12957 12958 12959 12960 12961 12962 12963 12964 12965 12966 12967 12968 12969 12970 12971 12972 12973 12974 12975 12976 12977 12978 12979 12980 12981 12982 12983 12984 12985 12986 12987 12988 12989 12990 12991 12992 12993 12994 12995 12996 12997 12998 12999 13000 13001 13002 13003 13004 13005 13006 13007 13008 13009 13010 13011 13012 13013 13014 13015 13016 13017 13018 13019 13020 13021 13022 13023 13024 13025 13026 13027 13028 13029 13030 13031 13032 13033 13034 13035 13036 13037 13038 13039 13040 13041 13042 13043 13044 13045 13046 13047 13048 13049 13050 13051 13052 13053 13054 13055 13056 13057 13058 13059 13060 13061 13062 13063 13064 13065 13066 13067 13068 13069 13070 13071 13072 13073 13074 13075 13076 13077 13078 13079 13080 13081 13082 13083 13084 13085 13086 13087 13088 13089 13090 13091 13092 13093 13094 13095 13096 13097 13098 13099 13100 13101 13102 13103 13104 13105 13106 13107 13108 13109 13110 13111 13112 13113 13114 13115 13116 13117 13118 13119 13120 13121 13122 13123 13124 13125 13126 13127 13128 13129 13130 13131 13132 13133 13134 13135 13136 13137 13138 13139 13140 13141 13142 13143 13144 13145 13146 13147 13148 13149 13150 13151 13152 13153 13154 13155 13156 13157 13158 13159 13160 13161 13162 13163 13164 13165 13166 13167 13168 13169 13170 13171 13172 13173 13174 13175 13176 13177 13178 13179 13180 13181 13182 13183 13184 13185 13186 13187 13188 13189 13190 13191 13192 13193 13194 13195 13196 13197 13198 13199 13200 13201 13202 13203 13204 13205 13206 13207 13208 13209 13210 13211 13212 13213 13214 13215 13216 13217 13218 13219 13220 13221 13222 13223 13224 13225 13226 13227 13228 13229 13230 13231 13232 13233 13234 13235 13236 13237 13238 13239 13240 13241 13242 13243 13244 13245 13246 13247 13248 13249 13250 13251 13252 13253 13254 13255 13256 13257 13258 13259 13260 13261 13262 13263 13264 13265 13266 13267 13268 13269 13270 13271 13272 13273 13274 13275 13276 13277 13278 13279 13280 13281 13282 13283 13284 13285 13286 13287 13288 13289 13290 13291 13292 13293 13294 13295 13296 13297 13298 13299 13300 13301 13302 13303 13304 13305 13306 13307 13308 13309 13310 13311 13312 13313 13314 13315 13316 13317 13318 13319 13320 13321 13322 13323 13324 13325 13326 13327 13328 13329 13330 13331 13332 13333 13334 13335 13336 13337 13338 13339 13340 13341 13342 13343 13344 13345 13346 13347 13348 13349 13350 13351 13352 13353 13354 13355 13356 13357 13358 13359 13360 13361 13362 13363 13364 13365 13366 13367 13368 13369 13370 13371 13372 13373 13374 13375 13376 13377 13378 13379 13380 13381 13382 13383 13384 13385 13386 13387 13388 13389 13390 13391 13392 13393 13394 13395 13396 13397 13398 13399 13400 13401 13402 13403 13404 13405 13406 13407 13408 13409 13410 13411 13412 13413 13414 13415 13416 13417 13418 13419 13420 13421 13422 13423 13424 13425 13426 13427 13428 13429 13430 13431 13432 13433 13434 13435 13436 13437 13438 13439 13440 13441 13442 13443 13444 13445 13446 13447 13448 13449 13450 13451 13452 13453 13454 13455 13456 13457 13458 13459 13460 13461 13462 13463 13464 13465 13466 13467 13468 13469 13470 13471 13472 13473 13474 13475 13476 13477 13478 13479 13480 13481 13482 13483 13484 13485 13486 13487 13488 13489 13490 13491 13492 13493 13494 13495 13496 13497 13498 13499 13500 13501 13502 13503 13504 13505 13506 13507 13508 13509 13510 13511 13512 13513 13514 13515 13516 13517 13518 13519 13520 13521 13522 13523 13524 13525 13526 13527 13528 13529 13530 13531 13532 13533 13534 13535 13536 13537 13538 13539 13540 13541 13542 13543 13544 13545 13546 13547 13548 13549 13550 13551 13552 13553 13554 13555 13556 13557 13558 13559 13560 13561 13562 13563 13564 13565 13566 13567 13568 13569 13570 13571 13572 13573 13574 13575 13576 13577 13578 13579 13580 13581 13582 13583 13584 13585 13586 13587 13588 13589 13590 13591 13592 13593 13594 13595 13596 13597 13598 13599 13600 13601 13602 13603 13604 13605 13606 13607 13608 13609 13610 13611 13612 13613 13614 13615 13616 13617 13618 13619 13620 13621 13622 13623 13624 13625 13626 13627 13628 13629 13630 13631 13632 13633 13634 13635 13636 13637 13638 13639 13640 13641 13642 13643 13644 13645 13646 13647 13648 13649 13650 13651 13652 13653 13654 13655 13656 13657 13658 13659 13660 13661 13662 13663 13664 13665 13666 13667 13668 13669 13670 13671 13672 13673 13674 13675 13676 13677 13678 13679 13680 13681 13682 13683 13684 13685 13686 13687 13688 13689 13690 13691 13692 13693 13694 13695 13696 13697 13698 13699 13700 13701 13702 13703 13704 13705 13706 13707 13708 13709 13710 13711 13712 13713 13714 13715 13716 13717 13718 13719 13720 13721 13722 13723 13724 13725 13726 13727 13728 13729 13730 13731 13732 13733 13734 13735 13736 13737 13738 13739 13740 13741 13742 13743 13744 13745 13746 13747 13748 13749 13750 13751 13752 13753 13754 13755 13756 13757 13758 13759 13760 13761 13762 13763 13764 13765 13766 13767 13768 13769 13770 13771 13772 13773 13774 13775 13776 13777 13778 13779 13780 13781 13782 13783 13784 13785 13786 13787 13788 13789 13790 13791 13792 13793 13794 13795 13796 13797 13798 13799 13800 13801 13802 13803 13804 13805 13806 13807 13808 13809 13810 13811 13812 13813 13814 13815 13816 13817 13818 13819 13820 13821 13822 13823 13824 13825 13826 13827 13828 13829 13830 13831 13832 13833 13834 13835 13836 13837 13838 13839 13840 13841 13842 13843 13844 13845 13846 13847 13848 13849 13850 13851 13852 13853 13854 13855 13856 13857 13858 13859 13860 13861 13862 13863 13864 13865 13866 13867 13868 13869 13870 13871 13872 13873 13874 13875 13876 13877 13878 13879 13880 13881 13882 13883 13884 13885 13886 13887 13888 13889 13890 13891 13892 13893 13894 13895 13896 13897 13898 13899 13900 13901 13902 13903 13904 13905 13906 13907 13908 13909 13910 13911 13912 13913 13914 13915 13916 13917 13918 13919 13920 13921 13922 13923 13924 13925 13926 13927 13928 13929 13930 13931 13932 13933 13934 13935 13936 13937 13938 13939 13940 13941 13942 13943 13944 13945 13946 13947 13948 13949 13950 13951 13952 13953 13954 13955 13956 13957 13958 13959 13960 13961 13962 13963 13964 13965 13966 13967 13968 13969 13970 13971 13972 13973 13974 13975 13976 13977 13978 13979 13980 13981 13982 13983 13984 13985 13986 13987 13988 13989 13990 13991 13992 13993 13994 13995 13996 13997 13998 13999 14000 14001 14002 14003 14004 14005 14006 14007 14008 14009 14010 14011 14012 14013 14014 14015 14016 14017 14018 14019 14020 14021 14022 14023 14024 14025 14026 14027 14028 14029 14030 14031 14032 14033 14034 14035 14036 14037 14038 14039 14040 14041 14042 14043 14044 14045 14046 14047 14048 14049 14050 14051 14052 14053 14054 14055 14056 14057 14058 14059 14060 14061 14062 14063 14064 14065 14066 14067 14068 14069 14070 14071 14072 14073 14074 14075 14076 14077 14078 14079 14080 14081 14082 14083 14084 14085 14086 14087 14088 14089 14090 14091 14092 14093 14094 14095 14096 14097 14098 14099 14100 14101 14102 14103 14104 14105 14106 14107 14108 14109 14110 14111 14112 14113 14114 14115 14116 14117 14118 14119 14120 14121 14122 14123 14124 14125 14126 14127 14128 14129 14130 14131 14132 14133 14134 14135 14136 14137 14138 14139 14140 14141 14142 14143 14144 14145 14146 14147 14148 14149 14150 14151 14152 14153 14154 14155 14156 14157 14158 14159 14160 14161 14162 14163 14164 14165 14166 14167 14168 14169 14170 14171 14172 14173 14174 14175 14176 14177 14178 14179 14180 14181 14182 14183 14184 14185 14186 14187 14188 14189 14190 14191 14192 14193 14194 14195 14196 14197 14198 14199 14200 14201 14202 14203 14204 14205 14206 14207 14208 14209 14210 14211 14212 14213 14214 14215 14216 14217 14218 14219 14220 14221 14222 14223 14224 14225 14226 14227 14228 14229 14230 14231 14232 14233 14234 14235 14236 14237 14238 14239 14240 14241 14242 14243 14244 14245 14246 14247 14248 14249 14250 14251 14252 14253 14254 14255 14256 14257 14258 14259 14260 14261 14262 14263 14264 14265 14266 14267 14268 14269 14270 14271 14272 14273 14274 14275 14276 14277 14278 14279 14280 14281 14282 14283 14284 14285 14286 14287 14288 14289 14290 14291 14292 14293 14294 14295 14296 14297 14298 14299 14300 14301 14302 14303 14304 14305 14306 14307 14308 14309 14310 14311 14312 14313 14314 14315 14316 14317 14318 14319 14320 14321 14322 14323 14324 14325 14326 14327 14328 14329 14330 14331 14332 14333 14334 14335 14336 14337 14338 14339 14340 14341 14342 14343 14344 14345 14346 14347 14348 14349 14350 14351 14352 14353 14354 14355 14356 14357 14358 14359 14360 14361 14362 14363 14364 14365 14366 14367 14368 14369 14370 14371 14372 14373 14374 14375 14376 14377 14378 14379 14380 14381 14382 14383 14384 14385 14386 14387 14388 14389 14390 14391 14392 14393 14394 14395 14396 14397 14398 14399 14400 14401 14402 14403 14404 14405 14406 14407 14408 14409 14410 14411 14412 14413 14414 14415 14416 14417 14418 14419 14420 14421 14422 14423 14424 14425 14426 14427 14428 14429 14430 14431 14432 14433 14434 14435 14436 14437 14438 14439 14440 14441 14442 14443 14444 14445 14446 14447 14448 14449 14450 14451 14452 14453 14454 14455 14456 14457 14458 14459 14460 14461 14462 14463 14464 14465 14466 14467 14468 14469 14470 14471 14472 14473 14474 14475 14476 14477 14478 14479 14480 14481 14482 14483 14484 14485 14486 14487 14488 14489 14490 14491 14492 14493 14494 14495 14496 14497 14498 14499 14500 14501 14502 14503 14504 14505 14506 14507 14508 14509 14510 14511 14512 14513 14514 14515 14516 14517 14518 14519 14520 14521 14522 14523 14524 14525 14526 14527 14528 14529 14530 14531 14532 14533 14534 14535 14536 14537 14538 14539 14540 14541 14542 14543 14544 14545 14546 14547 14548 14549 14550 14551 14552 14553 14554 14555 14556 14557 14558 14559 14560 14561 14562 14563 14564 14565 14566 14567 14568 14569 14570 14571 14572 14573 14574 14575 14576 14577 14578 14579 14580 14581 14582 14583 14584 14585 14586 14587 14588 14589 14590 14591 14592 14593 14594 14595 14596 14597 14598 14599 14600 14601 14602 14603 14604 14605 14606 14607 14608 14609 14610 14611 14612 14613 14614 14615 14616 14617 14618 14619 14620 14621 14622 14623 14624 14625 14626 14627 14628 14629 14630 14631 14632 14633 14634 14635 14636 14637 14638 14639 14640 14641 14642 14643 14644 14645 14646 14647 14648 14649 14650 14651 14652 14653 14654 14655 14656 14657 14658 14659 14660 14661 14662 14663 14664 14665 14666 14667 14668 14669 14670 14671 14672 14673 14674 14675 14676 14677 14678 14679 14680 14681 14682 14683 14684 14685 14686 14687 14688 14689 14690 14691 14692 14693 14694 14695 14696 14697 14698 14699 14700 14701 14702 14703 14704 14705 14706 14707 14708 14709 14710 14711 14712 14713 14714 14715 14716 14717 14718 14719 14720 14721 14722 14723 14724 14725 14726 14727 14728 14729 14730 14731 14732 14733 14734 14735 14736 14737 14738 14739 14740 14741 14742 14743 14744 14745 14746 14747 14748 14749 14750 14751 14752 14753 14754 14755 14756 14757 14758 14759 14760 14761 14762 14763 14764 14765 14766 14767 14768 14769 14770 14771 14772 14773 14774 14775 14776 14777 14778 14779 14780 14781 14782 14783 14784 14785 14786 14787 14788 14789 14790 14791 14792 14793 14794 14795 14796 14797 14798 14799 14800 14801 14802 14803 14804 14805 14806 14807 14808 14809 14810 14811 14812 14813 14814 14815 14816 14817 14818 14819 14820 14821 14822 14823 14824 14825 14826 14827 14828 14829 14830 14831 14832 14833 14834 14835 14836 14837 14838 14839 14840 14841 14842 14843 14844 14845 14846 14847 14848 14849 14850 14851 14852 14853 14854 14855 14856 14857 14858 14859 14860 14861 14862 14863 14864 14865 14866 14867 14868 14869 14870 14871 14872 14873 14874 14875 14876 14877 14878 14879 14880 14881 14882 14883 14884 14885 14886 14887 14888 14889 14890 14891 14892 14893 14894 14895 14896 14897 14898 14899 14900 14901 14902 14903 14904 14905 14906 14907 14908 14909 14910 14911 14912 14913 14914 14915 14916 14917 14918 14919 14920 14921 14922 14923 14924 14925 14926 14927 14928 14929 14930 14931 14932 14933 14934 14935 14936 14937 14938 14939 14940 14941 14942 14943 14944 14945 14946 14947 14948 14949 14950 14951 14952 14953 14954 14955 14956 14957 14958 14959 14960 14961 14962 14963 14964 14965 14966 14967 14968 14969 14970 14971 14972 14973 14974 14975 14976 14977 14978 14979 14980 14981 14982 14983 14984 14985 14986 14987 14988 14989 14990 14991 14992 14993 14994 14995 14996 14997 14998 14999 15000 15001 15002 15003 15004 15005 15006 15007 15008 15009 15010 15011 15012 15013 15014 15015 15016 15017 15018 15019 15020 15021 15022 15023 15024 15025 15026 15027 15028 15029 15030 15031 15032 15033 15034 15035 15036 15037 15038 15039 15040 15041 15042 15043 15044 15045 15046 15047 15048 15049 15050 15051 15052 15053 15054 15055 15056 15057 15058 15059 15060 15061 15062 15063 15064 15065 15066 15067 15068 15069 15070 15071 15072 15073 15074 15075 15076 15077 15078 15079 15080 15081 15082 15083 15084 15085 15086 15087 15088 15089 15090 15091 15092 15093 15094 15095 15096 15097 15098 15099 15100 15101 15102 15103 15104 15105 15106 15107 15108 15109 15110 15111 15112 15113 15114 15115 15116 15117 15118 15119 15120 15121 15122 15123 15124 15125 15126 15127 15128 15129 15130 15131 15132 15133 15134 15135 15136 15137 15138 15139 15140 15141 15142 15143 15144 15145 15146 15147 15148 15149 15150 15151 15152 15153 15154 15155 15156 15157 15158 15159 15160 15161 15162 15163 15164 15165 15166 15167 15168 15169 15170 15171 15172 15173 15174 15175 15176 15177 15178 15179 15180 15181 15182 15183 15184 15185 15186 15187 15188 15189 15190 15191 15192 15193 15194 15195 15196 15197 15198 15199 15200 15201 15202 15203 15204 15205 15206 15207 15208 15209 15210 15211 15212 15213 15214 15215 15216 15217 15218 15219 15220 15221 15222 15223 15224 15225 15226 15227 15228 15229 15230 15231 15232 15233 15234 15235 15236 15237 15238 15239 15240 15241 15242 15243 15244 15245 15246 15247 15248 15249 15250 15251 15252 15253 15254 15255 15256 15257 15258 15259 15260 15261 15262 15263 15264 15265 15266 15267 15268 15269 15270 15271 15272 15273 15274 15275 15276 15277 15278 15279 15280 15281 15282 15283 15284 15285 15286 15287 15288 15289 15290 15291 15292 15293 15294 15295 15296 15297 15298 15299 15300 15301 15302 15303 15304 15305 15306 15307 15308 15309 15310 15311 15312 15313 15314 15315 15316 15317 15318 15319 15320 15321 15322 15323 15324 15325 15326 15327 15328 15329 15330 15331 15332 15333 15334 15335 15336 15337 15338 15339 15340 15341 15342 15343 15344 15345 15346 15347 15348 15349 15350 15351 15352 15353 15354 15355 15356 15357 15358 15359 15360 15361 15362 15363 15364 15365 15366 15367 15368 15369 15370 15371 15372 15373 15374 15375 15376 15377 15378 15379 15380 15381 15382 15383 15384 15385 15386 15387 15388 15389 15390 15391 15392 15393 15394 15395 15396 15397 15398 15399 15400 15401 15402 15403 15404 15405 15406 15407 15408 15409 15410 15411 15412 15413 15414 15415 15416 15417 15418 15419 15420 15421 15422 15423 15424 15425 15426 15427 15428 15429 15430 15431 15432 15433 15434 15435 15436 15437 15438 15439 15440 15441 15442 15443 15444 15445 15446 15447 15448 15449 15450 15451 15452 15453 15454 15455 15456 15457 15458 15459 15460 15461 15462 15463 15464 15465 15466 15467 15468 15469 15470 15471 15472 15473 15474 15475 15476 15477 15478 15479 15480 15481 15482 15483 15484 15485 15486 15487 15488 15489 15490 15491 15492 15493 15494 15495 15496 15497 15498 15499 15500 15501 15502 15503 15504 15505 15506 15507 15508 15509 15510 15511 15512 15513 15514 15515 15516 15517 15518 15519 15520 15521 15522 15523 15524 15525 15526 15527 15528 15529 15530 15531 15532 15533 15534 15535 15536 15537 15538 15539 15540 15541 15542 15543 15544 15545 15546 15547 15548 15549 15550 15551 15552 15553 15554 15555 15556 15557 15558 15559 15560 15561 15562 15563 15564 15565 15566 15567 15568 15569 15570 15571 15572 15573 15574 15575 15576 15577 15578 15579 15580 15581 15582 15583 15584 15585 15586 15587 15588 15589 15590 15591 15592 15593 15594 15595 15596 15597 15598 15599 15600 15601 15602 15603 15604 15605 15606 15607 15608 15609 15610 15611 15612 15613 15614 15615 15616 15617 15618 15619 15620 15621 15622 15623 15624 15625 15626 15627 15628 15629 15630 15631 15632 15633 15634 15635 15636 15637 15638 15639 15640 15641 15642 15643 15644 15645 15646 15647 15648 15649 15650 15651 15652 15653 15654 15655 15656 15657 15658 15659 15660 15661 15662 15663 15664 15665 15666 15667 15668 15669 15670 15671 15672 15673 15674 15675 15676 15677 15678 15679 15680 15681 15682 15683 15684 15685 15686 15687 15688 15689 15690 15691 15692 15693 15694 15695 15696 15697 15698 15699 15700 15701 15702 15703 15704 15705 15706 15707 15708 15709 15710 15711 15712 15713 15714 15715 15716 15717 15718 15719 15720 15721 15722 15723 15724 15725 15726 15727 15728 15729 15730 15731 15732 15733 15734 15735 15736 15737 15738 15739 15740 15741 15742 15743 15744 15745 15746 15747 15748 15749 15750 15751 15752 15753 15754 15755 15756 15757 15758 15759 15760 15761 15762 15763 15764 15765 15766 15767 15768 15769 15770 15771 15772 15773 15774 15775 15776 15777 15778 15779 15780 15781 15782 15783 15784 15785 15786 15787 15788 15789 15790 15791 15792 15793 15794 15795 15796 15797 15798 15799 15800 15801 15802 15803 15804 15805 15806 15807 15808 15809 15810 15811 15812 15813 15814 15815 15816 15817 15818 15819 15820 15821 15822 15823 15824 15825 15826 15827 15828 15829 15830 15831 15832 15833 15834 15835 15836 15837 15838 15839 15840 15841 15842 15843 15844 15845 15846 15847 15848 15849 15850 15851 15852 15853 15854 15855 15856 15857 15858 15859 15860 15861 15862 15863 15864 15865 15866 15867 15868 15869 15870 15871 15872 15873 15874 15875 15876 15877 15878 15879 15880 15881 15882 15883 15884 15885 15886 15887 15888 15889 15890 15891 15892 15893 15894 15895 15896 15897 15898 15899 15900 15901 15902 15903 15904 15905 15906 15907 15908 15909 15910 15911 15912 15913 15914 15915 15916 15917 15918 15919 15920 15921 15922 15923 15924 15925 15926 15927 15928 15929 15930 15931 15932 15933 15934 15935 15936 15937 15938 15939 15940 15941 15942 15943 15944 15945 15946 15947 15948 15949 15950 15951 15952 15953 15954 15955 15956 15957 15958 15959 15960 15961 15962 15963 15964 15965 15966 15967 15968 15969 15970 15971 15972 15973 15974 15975 15976 15977 15978 15979 15980 15981 15982 15983 15984 15985 15986 15987 15988 15989 15990 15991 15992 15993 15994 15995 15996 15997 15998 15999 16000 16001 16002 16003 16004 16005 16006 16007 16008 16009 16010 16011 16012 16013 16014 16015 16016 16017 16018 16019 16020 16021 16022 16023 16024 16025 16026 16027 16028 16029 16030 16031 16032 16033 16034 16035 16036 16037 16038 16039 16040 16041 16042 16043 16044 16045 16046 16047 16048 16049 16050 16051 16052 16053 16054 16055 16056 16057 16058 16059 16060 16061 16062 16063 16064 16065 16066 16067 16068 16069 16070 16071 16072 16073 16074 16075 16076 16077 16078 16079 16080 16081 16082 16083 16084 16085 16086 16087 16088 16089 16090 16091 16092 16093 16094 16095 16096 16097 16098 16099 16100 16101 16102 16103 16104 16105 16106 16107 16108 16109 16110 16111 16112 16113 16114 16115 16116 16117 16118 16119 16120 16121 16122 16123 16124 16125 16126 16127 16128 16129 16130 16131 16132 16133 16134 16135 16136 16137 16138 16139 16140 16141 16142 16143 16144 16145 16146 16147 16148 16149 16150 16151 16152 16153 16154 16155 16156 16157 16158 16159 16160 16161 16162 16163 16164 16165 16166 16167 16168 16169 16170 16171 16172 16173 16174 16175 16176 16177 16178 16179 16180 16181 16182 16183 16184 16185 16186 16187 16188 16189 16190 16191 16192 16193 16194 16195 16196 16197 16198 16199 16200 16201 16202 16203 16204 16205 16206 16207 16208 16209 16210 16211 16212 16213 16214 16215 16216 16217 16218 16219 16220 16221 16222 16223 16224 16225 16226 16227 16228 16229 16230 16231 16232 16233 16234 16235 16236 16237 16238 16239 16240 16241 16242 16243 16244 16245 16246 16247 16248 16249 16250 16251 16252 16253 16254 16255 16256 16257 16258 16259 16260 16261 16262 16263 16264 16265 16266 16267 16268 16269 16270 16271 16272 16273 16274 16275 16276 16277 16278 16279 16280 16281 16282 16283 16284 16285 16286 16287 16288 16289 16290 16291 16292 16293 16294 16295 16296 16297 16298 16299 16300 16301 16302 16303 16304 16305 16306 16307 16308 16309 16310 16311 16312 16313 16314 16315 16316 16317 16318 16319 16320 16321 16322 16323 16324 16325 16326 16327 16328 16329 16330 16331 16332 16333 16334 16335 16336 16337 16338 16339 16340 16341 16342 16343 16344 16345 16346 16347 16348 16349 16350 16351 16352 16353 16354 16355 16356 16357 16358 16359 16360 16361 16362 16363 16364 16365 16366 16367 16368 16369 16370 16371 16372 16373 16374 16375 16376 16377 16378 16379 16380 16381 16382 16383 16384 16385 16386 16387 16388 16389 16390 16391 16392 16393 16394 16395 16396 16397 16398 16399 16400 16401 16402 16403 16404 16405 16406 16407 16408 16409 16410 16411 16412 16413 16414 16415 16416 16417 16418 16419 16420 16421 16422 16423 16424 16425 16426 16427 16428 16429 16430 16431 16432 16433 16434 16435 16436 16437 16438 16439 16440 16441 16442 16443 16444 16445 16446 16447 16448 16449 16450 16451 16452 16453 16454 16455 16456 16457 16458 16459 16460 16461 16462 16463 16464 16465 16466 16467 16468 16469 16470 16471 16472 16473 16474 16475 16476 16477 16478 16479 16480 16481 16482 16483 16484 16485 16486 16487 16488 16489 16490 16491 16492 16493 16494 16495 16496 16497 16498 16499 16500 16501 16502 16503 16504 16505 16506 16507 16508 16509 16510 16511 16512 16513 16514 16515 16516 16517 16518 16519 16520 16521 16522 16523 16524 16525 16526 16527 16528 16529 16530 16531 16532 16533 16534 16535 16536 16537 16538 16539 16540 16541 16542 16543 16544 16545 16546 16547 16548 16549 16550 16551 16552 16553 16554 16555 16556 16557 16558 16559 16560 16561 16562 16563 16564 16565 16566 16567 16568 16569 16570 16571 16572 16573 16574 16575 16576 16577 16578 16579 16580 16581 16582 16583 16584 16585 16586 16587 16588 16589 16590 16591 16592 16593 16594 16595 16596 16597 16598 16599 16600 16601 16602 16603 16604 16605 16606 16607 16608 16609 16610 16611 16612 16613 16614 16615 16616 16617 16618 16619 16620 16621 16622 16623 16624 16625 16626 16627 16628 16629 16630 16631 16632 16633 16634 16635 16636 16637 16638 16639 16640 16641 16642 16643 16644 16645 16646 16647 16648 16649 16650 16651 16652 16653 16654 16655 16656 16657 16658 16659 16660 16661 16662 16663 16664 16665 16666 16667 16668 16669 16670 16671 16672 16673 16674 16675 16676 16677 16678 16679 16680 16681 16682 16683 16684 16685 16686 16687 16688 16689 16690 16691 16692 16693 16694 16695 16696 16697 16698 16699 16700 16701 16702 16703 16704 16705 16706 16707 16708 16709 16710 16711 16712 16713 16714 16715 16716 16717 16718 16719 16720 16721 16722 16723 16724 16725 16726 16727 16728 16729 16730 16731 16732 16733 16734 16735 16736 16737 16738 16739 16740 16741 16742 16743 16744 16745 16746 16747 16748 16749 16750 16751 16752 16753 16754 16755 16756 16757 16758 16759 16760 16761 16762 16763 16764 16765 16766 16767 16768 16769 16770 16771 16772 16773 16774 16775 16776 16777 16778 16779 16780 16781 16782 16783 16784 16785 16786 16787 16788 16789 16790 16791 16792 16793 16794 16795 16796 16797 16798 16799 16800 16801 16802 16803 16804 16805 16806 16807 16808 16809 16810 16811 16812 16813 16814 16815 16816 16817 16818 16819 16820 16821 16822 16823 16824 16825 16826 16827 16828 16829 16830 16831 16832 16833 16834 16835 16836 16837 16838 16839 16840 16841 16842 16843 16844 16845 16846 16847 16848 16849 16850 16851 16852 16853 16854 16855 16856 16857 16858 16859 16860 16861 16862 16863 16864 16865 16866 16867 16868 16869 16870 16871 16872 16873 16874 16875 16876 16877 16878 16879 16880 16881 16882 16883 16884 16885 16886 16887 16888 16889 16890 16891 16892 16893 16894 16895 16896 16897 16898 16899 16900 16901 16902 16903 16904 16905 16906 16907 16908 16909 16910 16911 16912 16913 16914 16915 16916 16917 16918 16919 16920 16921 16922 16923 16924 16925 16926 16927 16928 16929 16930 16931 16932 16933 16934 16935 16936 16937 16938 16939 16940 16941 16942 16943 16944 16945 16946 16947 16948 16949 16950 16951 16952 16953 16954 16955 16956 16957 16958 16959 16960 16961 16962 16963 16964 16965 16966 16967 16968 16969 16970 16971 16972 16973 16974 16975 16976 16977 16978 16979 16980 16981 16982 16983 16984 16985 16986 16987 16988 16989 16990 16991 16992 16993 16994 16995 16996 16997 16998 16999 17000 17001 17002 17003 17004 17005 17006 17007 17008 17009 17010 17011 17012 17013 17014 17015 17016 17017 17018 17019 17020 17021 17022 17023 17024 17025 17026 17027 17028 17029 17030 17031 17032 17033 17034 17035 17036 17037 17038 17039 17040 17041 17042 17043 17044 17045 17046 17047 17048 17049 17050 17051 17052 17053 17054 17055 17056 17057 17058 17059 17060 17061 17062 17063 17064 17065 17066 17067 17068 17069 17070 17071 17072 17073 17074 17075 17076 17077 17078 17079 17080 17081 17082 17083 17084 17085 17086 17087 17088 17089 17090 17091 17092 17093 17094 17095 17096 17097 17098 17099 17100 17101 17102 17103 17104 17105 17106 17107 17108 17109 17110 17111 17112 17113 17114 17115 17116 17117 17118 17119 17120 17121 17122 17123 17124 17125 17126 17127 17128 17129 17130 17131 17132 17133 17134 17135 17136 17137 17138 17139 17140 17141 17142 17143 17144 17145 17146 17147 17148 17149 17150 17151 17152 17153 17154 17155 17156 17157 17158 17159 17160 17161 17162 17163 17164 17165 17166 17167 17168 17169 17170 17171 17172 17173 17174 17175 17176 17177 17178 17179 17180 17181 17182 17183 17184 17185 17186 17187 17188 17189 17190 17191 17192 17193 17194 17195 17196 17197 17198 17199 17200 17201 17202 17203 17204 17205 17206 17207 17208 17209 17210 17211 17212 17213 17214 17215 17216 17217 17218 17219 17220 17221 17222 17223 17224 17225 17226 17227 17228 17229 17230 17231 17232 17233 17234 17235 17236 17237 17238 17239 17240 17241 17242 17243 17244 17245 17246 17247 17248 17249 17250 17251 17252 17253 17254 17255 17256 17257 17258 17259 17260 17261 17262 17263 17264 17265 17266 17267 17268 17269 17270 17271 17272 17273 17274 17275 17276 17277 17278 17279 17280 17281 17282 17283 17284 17285 17286 17287 17288 17289 17290 17291 17292 17293 17294 17295 17296 17297 17298 17299 17300 17301 17302 17303 17304 17305 17306 17307 17308 17309 17310 17311 17312 17313 17314 17315 17316 17317 17318 17319 17320 17321 17322 17323 17324 17325 17326 17327 17328 17329 17330 17331 17332 17333 17334 17335 17336 17337 17338 17339 17340 17341 17342 17343 17344 17345 17346 17347 17348 17349 17350 17351 17352 17353 17354 17355 17356 17357 17358 17359 17360 17361 17362 17363 17364 17365 17366 17367 17368 17369 17370 17371 17372 17373 17374 17375 17376 17377 17378 17379 17380 17381 17382 17383 17384 17385 17386 17387 17388 17389 17390 17391 17392 17393 17394 17395 17396 17397 17398 17399 17400 17401 17402 17403 17404 17405 17406 17407 17408 17409 17410 17411 17412 17413 17414 17415 17416 17417 17418 17419 17420 17421 17422 17423 17424 17425 17426 17427 17428 17429 17430 17431 17432 17433 17434 17435 17436 17437 17438 17439 17440 17441 17442 17443 17444 17445 17446 17447 17448 17449 17450 17451 17452 17453 17454 17455 17456 17457 17458 17459 17460 17461 17462 17463 17464 17465 17466 17467 17468 17469 17470 17471 17472 17473 17474 17475 17476 17477 17478 17479 17480 17481 17482 17483 17484 17485 17486 17487 17488 17489 17490 17491 17492 17493 17494 17495 17496 17497 17498 17499 17500 17501 17502 17503 17504 17505 17506 17507 17508 17509 17510 17511 17512 17513 17514 17515 17516 17517 17518 17519 17520 17521 17522 17523 17524 17525 17526 17527 17528 17529 17530 17531 17532 17533 17534 17535 17536 17537 17538 17539 17540 17541 17542 17543 17544 17545 17546 17547 17548 17549 17550 17551 17552 17553 17554 17555 17556 17557 17558 17559 17560 17561 17562 17563 17564 17565 17566 17567 17568 17569 17570 17571 17572 17573 17574 17575 17576 17577 17578 17579 17580 17581 17582 17583 17584 17585 17586 17587 17588 17589 17590 17591 17592 17593 17594 17595 17596 17597 17598 17599 17600 17601 17602 17603 17604 17605 17606 17607 17608 17609 17610 17611 17612 17613 17614 17615 17616 17617 17618 17619 17620 17621 17622 17623 17624 17625 17626 17627 17628 17629 17630 17631 17632 17633 17634 17635 17636 17637 17638 17639 17640 17641 17642 17643 17644 17645 17646 17647 17648 17649 17650 17651 17652 17653 17654 17655 17656 17657 17658 17659 17660 17661 17662 17663 17664 17665 17666 17667 17668 17669 17670 17671 17672 17673 17674 17675 17676 17677 17678 17679 17680 17681 17682 17683 17684 17685 17686 17687 17688 17689 17690 17691 17692 17693 17694 17695 17696 17697 17698 17699 17700 17701 17702 17703 17704 17705 17706 17707 17708 17709 17710 17711 17712 17713 17714 17715 17716 17717 17718 17719 17720 17721 17722 17723 17724 17725 17726 17727 17728 17729 17730 17731 17732 17733 17734 17735 17736 17737 17738 17739 17740 17741 17742 17743 17744 17745 17746 17747 17748 17749 17750 17751 17752 17753 17754 17755 17756 17757 17758 17759 17760 17761 17762 17763 17764 17765 17766 17767 17768 17769 17770 17771 17772 17773 17774 17775 17776 17777 17778 17779 17780 17781 17782 17783 17784 17785 17786 17787 17788 17789 17790 17791 17792 17793 17794 17795 17796 17797 17798 17799 17800 17801 17802 17803 17804 17805 17806 17807 17808 17809 17810 17811 17812 17813 17814 17815 17816 17817 17818 17819 17820 17821 17822 17823 17824 17825 17826 17827 17828 17829 17830 17831 17832 17833 17834 17835 17836 17837 17838 17839 17840 17841 17842 17843 17844 17845 17846 17847 17848 17849 17850 17851 17852 17853 17854 17855 17856 17857 17858 17859 17860 17861 17862 17863 17864 17865 17866 17867 17868 17869 17870 17871 17872 17873 17874 17875 17876 17877 17878 17879 17880 17881 17882 17883 17884 17885 17886 17887 17888 17889 17890 17891 17892 17893 17894 17895 17896 17897 17898 17899 17900 17901 17902 17903 17904 17905 17906 17907 17908 17909 17910 17911 17912 17913 17914 17915 17916 17917 17918 17919 17920 17921 17922 17923 17924 17925 17926 17927 17928 17929 17930 17931 17932 17933 17934 17935 17936 17937 17938 17939 17940 17941 17942 17943 17944 17945 17946 17947 17948 17949 17950 17951 17952 17953 17954 17955 17956 17957 17958 17959 17960 17961 17962 17963 17964 17965 17966 17967 17968 17969 17970 17971 17972 17973 17974 17975 17976 17977 17978 17979 17980 17981 17982 17983 17984 17985 17986 17987 17988 17989 17990 17991 17992 17993 17994 17995 17996 17997 17998 17999 18000 18001 18002 18003 18004 18005 18006 18007 18008 18009 18010 18011 18012 18013 18014 18015 18016 18017 18018 18019 18020 18021 18022 18023 18024 18025 18026 18027 18028 18029 18030 18031 18032 18033 18034 18035 18036 18037 18038 18039 18040 18041 18042 18043 18044 18045 18046 18047 18048 18049 18050 18051 18052 18053 18054 18055 18056 18057 18058 18059 18060 18061 18062 18063 18064 18065 18066 18067 18068 18069 18070 18071 18072 18073 18074 18075 18076 18077 18078 18079 18080 18081 18082 18083 18084 18085 18086 18087 18088 18089 18090 18091 18092 18093 18094 18095 18096 18097 18098 18099 18100 18101 18102 18103 18104 18105 18106 18107 18108 18109 18110 18111 18112 18113 18114 18115 18116 18117 18118 18119 18120 18121 18122 18123 18124 18125 18126 18127 18128 18129 18130 18131 18132 18133 18134 18135 18136 18137 18138 18139 18140 18141 18142 18143 18144 18145 18146 18147 18148 18149 18150 18151 18152 18153 18154 18155 18156 18157 18158 18159 18160 18161 18162 18163 18164 18165 18166 18167 18168 18169 18170 18171 18172 18173 18174 18175 18176 18177 18178 18179 18180 18181 18182 18183 18184 18185 18186 18187 18188 18189 18190 18191 18192 18193 18194 18195 18196 18197 18198 18199 18200 18201 18202 18203 18204 18205 18206 18207 18208 18209 18210 18211 18212 18213 18214 18215 18216 18217 18218 18219 18220 18221 18222 18223 18224 18225 18226 18227 18228 18229 18230 18231 18232 18233 18234 18235 18236 18237 18238 18239 18240 18241 18242 18243 18244 18245 18246 18247 18248 18249 18250 18251 18252 18253 18254 18255 18256 18257 18258 18259 18260 18261 18262 18263 18264 18265 18266 18267 18268 18269 18270 18271 18272 18273 18274 18275 18276 18277 18278 18279 18280 18281 18282 18283 18284 18285 18286 18287 18288 18289 18290 18291 18292 18293 18294 18295 18296 18297 18298 18299 18300 18301 18302 18303 18304 18305 18306 18307 18308 18309 18310 18311 18312 18313 18314 18315 18316 18317 18318 18319 18320 18321 18322 18323 18324 18325 18326 18327 18328 18329 18330 18331 18332 18333 18334 18335 18336 18337 18338 18339 18340 18341 18342 18343 18344 18345 18346 18347 18348 18349 18350 18351 18352 18353 18354 18355 18356 18357 18358 18359 18360 18361 18362 18363 18364 18365 18366 18367 18368 18369 18370 18371 18372 18373 18374 18375 18376 18377 18378 18379 18380 18381 18382 18383 18384 18385 18386 18387 18388 18389 18390 18391 18392 18393 18394 18395 18396 18397 18398 18399 18400 18401 18402 18403 18404 18405 18406 18407 18408 18409 18410 18411 18412 18413 18414 18415 18416 18417 18418 18419 18420 18421 18422 18423 18424 18425 18426 18427 18428 18429 18430 18431 18432 18433 18434 18435 18436 18437 18438 18439 18440 18441 18442 18443 18444 18445 18446 18447 18448 18449 18450 18451 18452 18453 18454 18455 18456 18457 18458 18459 18460 18461 18462 18463 18464 18465 18466 18467 18468 18469 18470 18471 18472 18473 18474 18475 18476 18477 18478 18479 18480 18481 18482 18483 18484 18485 18486 18487 18488 18489 18490 18491 18492 18493 18494 18495 18496 18497 18498 18499 18500 18501 18502 18503 18504 18505 18506 18507 18508 18509 18510 18511 18512 18513 18514 18515 18516 18517 18518 18519 18520 18521 18522 18523 18524 18525 18526 18527 18528 18529 18530 18531 18532 18533 18534 18535 18536 18537 18538 18539 18540 18541 18542 18543 18544 18545 18546 18547 18548 18549 18550 18551 18552 18553 18554 18555 18556 18557 18558 18559 18560 18561 18562 18563 18564 18565 18566 18567 18568 18569 18570 18571 18572 18573 18574 18575 18576 18577 18578 18579 18580 18581 18582 18583 18584 18585 18586 18587 18588 18589 18590 18591 18592 18593 18594 18595 18596 18597 18598 18599 18600 18601 18602 18603 18604 18605 18606 18607 18608 18609 18610 18611 18612 18613 18614 18615 18616 18617 18618 18619 18620 18621 18622 18623 18624 18625 18626 18627 18628 18629 18630 18631 18632 18633 18634 18635 18636 18637 18638 18639 18640 18641 18642 18643 18644 18645 18646 18647 18648 18649 18650 18651 18652 18653 18654 18655 18656 18657 18658 18659 18660 18661 18662 18663 18664 18665 18666 18667 18668 18669 18670 18671 18672 18673 18674 18675 18676 18677 18678 18679 18680 18681 18682 18683 18684 18685 18686 18687 18688 18689 18690 18691 18692 18693 18694 18695 18696 18697 18698 18699 18700 18701 18702 18703 18704 18705 18706 18707 18708 18709 18710 18711 18712 18713 18714 18715 18716 18717 18718 18719 18720 18721 18722 18723 18724 18725 18726 18727 18728 18729 18730 18731 18732 18733 18734 18735 18736 18737 18738 18739 18740 18741 18742 18743 18744 18745 18746 18747 18748 18749 18750 18751 18752 18753 18754 18755 18756 18757 18758 18759 18760 18761 18762 18763 18764 18765 18766 18767 18768 18769 18770 18771 18772 18773 18774 18775 18776 18777 18778 18779 18780 18781 18782 18783 18784 18785 18786 18787 18788 18789 18790 18791 18792 18793 18794 18795 18796 18797 18798 18799 18800 18801 18802 18803 18804 18805 18806 18807 18808 18809 18810 18811 18812 18813 18814 18815 18816 18817 18818 18819 18820 18821 18822 18823 18824 18825 18826 18827 18828 18829 18830 18831 18832 18833 18834 18835 18836 18837 18838 18839 18840 18841 18842 18843 18844 18845 18846 18847 18848 18849 18850 18851 18852 18853 18854 18855 18856 18857 18858 18859 18860 18861 18862 18863 18864 18865 18866 18867 18868 18869 18870 18871 18872 18873 18874 18875 18876 18877 18878 18879 18880 18881 18882 18883 18884 18885 18886 18887 18888 18889 18890 18891 18892 18893 18894 18895 18896 18897 18898 18899 18900 18901 18902 18903 18904 18905 18906 18907 18908 18909 18910 18911 18912 18913 18914 18915 18916 18917 18918 18919 18920 18921 18922 18923 18924 18925 18926 18927 18928 18929 18930 18931 18932 18933 18934 18935 18936 18937 18938 18939 18940 18941 18942 18943 18944 18945 18946 18947 18948 18949 18950 18951 18952 18953 18954 18955 18956 18957 18958 18959 18960 18961 18962 18963 18964 18965 18966 18967 18968 18969 18970 18971 18972 18973 18974 18975 18976 18977 18978 18979 18980 18981 18982 18983 18984 18985 18986 18987 18988 18989 18990 18991 18992 18993 18994 18995 18996 18997 18998 18999 19000 19001 19002 19003 19004 19005 19006 19007 19008 19009 19010 19011 19012 19013 19014 19015 19016 19017 19018 19019 19020 19021 19022 19023 19024 19025 19026 19027 19028 19029 19030 19031 19032 19033 19034 19035 19036 19037 19038 19039 19040 19041 19042 19043 19044 19045 19046 19047 19048 19049 19050 19051 19052 19053 19054 19055 19056 19057 19058 19059 19060 19061 19062 19063 19064 19065 19066 19067 19068 19069 19070 19071 19072 19073 19074 19075 19076 19077 19078 19079 19080 19081 19082 19083 19084 19085 19086 19087 19088 19089 19090 19091 19092 19093 19094 19095 19096 19097 19098 19099 19100 19101 19102 19103 19104 19105 19106 19107 19108 19109 19110 19111 19112 19113 19114 19115 19116 19117 19118 19119 19120 19121 19122 19123 19124 19125 19126 19127 19128 19129 19130 19131 19132 19133 19134 19135 19136 19137 19138 19139 19140 19141 19142 19143 19144 19145 19146 19147 19148 19149 19150 19151 19152 19153 19154 19155 19156 19157 19158 19159 19160 19161 19162 19163 19164 19165 19166 19167 19168 19169 19170 19171 19172 19173 19174 19175 19176 19177 19178 19179 19180 19181 19182 19183 19184 19185 19186 19187 19188 19189 19190 19191 19192 19193 19194 19195 19196 19197 19198 19199 19200 19201 19202 19203 19204 19205 19206 19207 19208 19209 19210 19211 19212 19213 19214 19215 19216 19217 19218 19219 19220 19221 19222 19223 19224 19225 19226 19227 19228 19229 19230 19231 19232 19233 19234 19235 19236 19237 19238 19239 19240 19241 19242 19243 19244 19245 19246 19247 19248 19249 19250 19251 19252 19253 19254 19255 19256 19257 19258 19259 19260 19261 19262 19263 19264 19265 19266 19267 19268 19269 19270 19271 19272 19273 19274 19275 19276 19277 19278 19279 19280 19281 19282 19283 19284 19285 19286 19287 19288 19289 19290 19291 19292 19293 19294 19295 19296 19297 19298 19299 19300 19301 19302 19303 19304 19305 19306 19307 19308 19309 19310 19311 19312 19313 19314 19315 19316 19317 19318 19319 19320 19321 19322 19323 19324 19325 19326 19327 19328 19329 19330 19331 19332 19333 19334 19335 19336 19337 19338 19339 19340 19341 19342 19343 19344 19345 19346 19347 19348 19349 19350 19351 19352 19353 19354 19355 19356 19357 19358 19359 19360 19361 19362 19363 19364 19365 19366 19367 19368 19369 19370 19371 19372 19373 19374 19375 19376 19377 19378 19379 19380 19381 19382 19383 19384 19385 19386 19387 19388 19389 19390 19391 19392 19393 19394 19395 19396 19397 19398 19399 19400 19401 19402 19403 19404 19405 19406 19407 19408 19409 19410 19411 19412 19413 19414 19415 19416 19417 19418 19419 19420 19421 19422 19423 19424 19425 19426 19427 19428 19429 19430 19431 19432 19433 19434 19435 19436 19437 19438 19439 19440 19441 19442 19443 19444 19445 19446 19447 19448 19449 19450 19451 19452 19453 19454 19455 19456 19457 19458 19459 19460 19461 19462 19463 19464 19465 19466 19467 19468 19469 19470 19471 19472 19473 19474 19475 19476 19477 19478 19479 19480 19481 19482 19483 19484 19485 19486 19487 19488 19489 19490 19491 19492 19493 19494 19495 19496 19497 19498 19499 19500 19501 19502 19503 19504 19505 19506 19507 19508 19509 19510 19511 19512 19513 19514 19515 19516 19517 19518 19519 19520 19521 19522 19523 19524 19525 19526 19527 19528 19529 19530 19531 19532 19533 19534 19535 19536 19537 19538 19539 19540 19541 19542 19543 19544 19545 19546 19547 19548 19549 19550 19551 19552 19553 19554 19555 19556 19557 19558 19559 19560 19561 19562 19563 19564 19565 19566 19567 19568 19569 19570 19571 19572 19573 19574 19575 19576 19577 19578 19579 19580 19581 19582 19583 19584 19585 19586 19587 19588 19589 19590 19591 19592 19593 19594 19595 19596 19597 19598 19599 19600 19601 19602 19603 19604 19605 19606 19607 19608 19609 19610 19611 19612 19613 19614 19615 19616 19617 19618 19619 19620 19621 19622 19623 19624 19625 19626 19627 19628 19629 19630 19631 19632 19633 19634 19635 19636 19637 19638 19639 19640 19641 19642 19643 19644 19645 19646 19647 19648 19649 19650 19651 19652 19653 19654 19655 19656 19657 19658 19659 19660 19661 19662 19663 19664 19665 19666 19667 19668 19669 19670 19671 19672 19673 19674 19675 19676 19677 19678 19679 19680 19681 19682 19683 19684 19685 19686 19687 19688 19689 19690 19691 19692 19693 19694 19695 19696 19697 19698 19699 19700 19701 19702 19703 19704 19705 19706 19707 19708 19709 19710 19711 19712 19713 19714 19715 19716 19717 19718 19719 19720 19721 19722 19723 19724 19725 19726 19727 19728 19729 19730 19731 19732 19733 19734 19735 19736 19737 19738 19739 19740 19741 19742 19743 19744 19745 19746 19747 19748 19749 19750 19751 19752 19753 19754 19755 19756 19757 19758 19759 19760 19761 19762 19763 19764 19765 19766 19767 19768 19769 19770 19771 19772 19773 19774 19775 19776 19777 19778 19779 19780 19781 19782 19783 19784 19785 19786 19787 19788 19789 19790 19791 19792 19793 19794 19795 19796 19797 19798 19799 19800 19801 19802 19803 19804 19805 19806 19807 19808 19809 19810 19811 19812 19813 19814 19815 19816 19817 19818 19819 19820 19821 19822 19823 19824 19825 19826 19827 19828 19829 19830 19831 19832 19833 19834 19835 19836 19837 19838 19839 19840 19841 19842 19843 19844 19845 19846 19847 19848 19849 19850 19851 19852 19853 19854 19855 19856 19857 19858 19859 19860 19861 19862 19863 19864 19865 19866 19867 19868 19869 19870 19871 19872 19873 19874 19875 19876 19877 19878 19879 19880 19881 19882 19883 19884 19885 19886 19887 19888 19889 19890 19891 19892 19893 19894 19895 19896 19897 19898 19899 19900 19901 19902 19903 19904 19905 19906 19907 19908 19909 19910 19911 19912 19913 19914 19915 19916 19917 19918 19919 19920 19921 19922 19923 19924 19925 19926 19927 19928 19929 19930 19931 19932 19933 19934 19935 19936 19937 19938 19939 19940 19941 19942 19943 19944 19945 19946 19947 19948 19949 19950 19951 19952 19953 19954 19955 19956 19957 19958 19959 19960 19961 19962 19963 19964 19965 19966 19967 19968 19969 19970 19971 19972 19973 19974 19975 19976 19977 19978 19979 19980 19981 19982 19983 19984 19985 19986 19987 19988 19989 19990 19991 19992 19993 19994 19995 19996 19997 19998 19999 20000 20001 20002 20003 20004 20005 20006 20007 20008 20009 20010 20011 20012 20013 20014 20015 20016 20017 20018 20019 20020 20021 20022 20023 20024 20025 20026 20027 20028 20029 20030 20031 20032 20033 20034 20035 20036 20037 20038 20039 20040 20041 20042 20043 20044 20045 20046 20047 20048 20049 20050 20051 20052 20053 20054 20055 20056 20057 20058 20059 20060 20061 20062 20063 20064 20065 20066 20067 20068 20069 20070 20071 20072 20073 20074 20075 20076 20077 20078 20079 20080 20081 20082 20083 20084 20085 20086 20087 20088 20089 20090 20091 20092 20093 20094 20095 20096 20097 20098 20099 20100 20101 20102 20103 20104 20105 20106 20107 20108 20109 20110 20111 20112 20113 20114 20115 20116 20117 20118 20119 20120 20121 20122 20123 20124 20125 20126 20127 20128 20129 20130 20131 20132 20133 20134 20135 20136 20137 20138 20139 20140 20141 20142 20143 20144 20145 20146 20147 20148 20149 20150 20151 20152 20153 20154 20155 20156 20157 20158 20159 20160 20161 20162 20163 20164 20165 20166 20167 20168 20169 20170 20171 20172 20173 20174 20175 20176 20177 20178 20179 20180 20181 20182 20183 20184 20185 20186 20187 20188 20189 20190 20191 20192 20193 20194 20195 20196 20197 20198 20199 20200 20201 20202 20203 20204 20205 20206 20207 20208 20209 20210 20211 20212 20213 20214 20215 20216 20217 20218 20219 20220 20221 20222 20223 20224 20225 20226 20227 20228 20229 20230 20231 20232 20233 20234 20235 20236 20237 20238 20239 20240 20241 20242 20243 20244 20245 20246 20247 20248 20249 20250 20251 20252 20253 20254 20255 20256 20257 20258 20259 20260 20261 20262 20263 20264 20265 20266 20267 20268 20269 20270 20271 20272 20273 20274 20275 20276 20277 20278 20279 20280 20281 20282 20283 20284 20285 20286 20287 20288 20289 20290 20291 20292 20293 20294 20295 20296 20297 20298 20299 20300 20301 20302 20303 20304 20305 20306 20307 20308 20309 20310 20311 20312 20313 20314 20315 20316 20317 20318 20319 20320 20321 20322 20323 20324 20325 20326 20327 20328 20329 20330 20331 20332 20333 20334 20335 20336 20337 20338 20339 20340 20341 20342 20343 20344 20345 20346 20347 20348 20349 20350 20351 20352 20353 20354 20355 20356 20357 20358 20359 20360 20361 20362 20363 20364 20365 20366 20367 20368 20369 20370 20371 20372 20373 20374 20375 20376 20377 20378 20379 20380 20381 20382 20383 20384 20385 20386 20387 20388 20389 20390 20391 20392 20393 20394 20395 20396 20397 20398 20399 20400 20401 20402 20403 20404 20405 20406 20407 20408 20409 20410 20411 20412 20413 20414 20415 20416 20417 20418 20419 20420 20421 20422 20423 20424 20425 20426 20427 20428 20429 20430 20431 20432 20433 20434 20435 20436 20437 20438 20439 20440 20441 20442 20443 20444 20445 20446 20447 20448 20449 20450 20451 20452 20453 20454 20455 20456 20457 20458 20459 20460 20461 20462 20463 20464 20465 20466 20467 20468 20469 20470 20471 20472 20473 20474 20475 20476 20477 20478 20479 20480 20481 20482 20483 20484 20485 20486 20487 20488 20489 20490 20491 20492 20493 20494 20495 20496 20497 20498 20499 20500 20501 20502 20503 20504 20505 20506 20507 20508 20509 20510 20511 20512 20513 20514 20515 20516 20517 20518 20519 20520 20521 20522 20523 20524 20525 20526 20527 20528 20529 20530 20531 20532 20533 20534 20535 20536 20537 20538 20539 20540 20541 20542 20543 20544 20545 20546 20547 20548 20549 20550 20551 20552 20553 20554 20555 20556 20557 20558 20559 20560 20561 20562 20563 20564 20565 20566 20567 20568 20569 20570 20571 20572 20573 20574 20575 20576 20577 20578 20579 20580 20581 20582 20583 20584 20585 20586 20587 20588 20589 20590 20591 20592 20593 20594 20595 20596 20597 20598 20599 20600 20601 20602 20603 20604 20605 20606 20607 20608 20609 20610 20611 20612 20613 20614 20615 20616 20617 20618 20619 20620 20621 20622 20623 20624 20625 20626 20627 20628 20629 20630 20631 20632 20633 20634 20635 20636 20637 20638 20639 20640 20641 20642 20643 20644 20645 20646 20647 20648 20649 20650 20651 20652 20653 20654 20655 20656 20657 20658 20659 20660 20661 20662 20663 20664 20665 20666 20667 20668 20669 20670 20671 20672 20673 20674 20675 20676 20677 20678 20679 20680 20681 20682 20683 20684 20685 20686 20687 20688 20689 20690 20691 20692 20693 20694 20695 20696 20697 20698 20699 20700 20701 20702 20703 20704 20705 20706 20707 20708 20709 20710 20711 20712 20713 20714 20715 20716 20717 20718 20719 20720 20721 20722 20723 20724 20725 20726 20727 20728 20729 20730 20731 20732 20733 20734 20735 20736 20737 20738 20739 20740 20741 20742 20743 20744 20745 20746 20747 20748 20749 20750 20751 20752 20753 20754 20755 20756 20757 20758 20759 20760 20761 20762 20763 20764 20765 20766 20767 20768 20769 20770 20771 20772 20773 20774 20775 20776 20777 20778 20779 20780 20781 20782 20783 20784 20785 20786 20787 20788 20789 20790 20791 20792 20793 20794 20795 20796 20797 20798 20799 20800 20801 20802 20803 20804 20805 20806 20807 20808 20809 20810 20811 20812 20813 20814 20815 20816 20817 20818 20819 20820 20821 20822 20823 20824 20825 20826 20827 20828 20829 20830 20831 20832 20833 20834 20835 20836 20837 20838 20839 20840 20841 20842 20843 20844 20845 20846 20847 20848 20849 20850 20851 20852 20853 20854 20855 20856 20857 20858 20859 20860 20861 20862 20863 20864 20865 20866 20867 20868 20869 20870 20871 20872 20873 20874 20875 20876 20877 20878 20879 20880 20881 20882 20883 20884 20885 20886 20887 20888 20889 20890 20891 20892 20893 20894 20895 20896 20897 20898 20899 20900 20901 20902 20903 20904 20905 20906 20907 20908 20909 20910 20911 20912 20913 20914 20915 20916 20917 20918 20919 20920 20921 20922 20923 20924 20925 20926 20927 20928 20929 20930 20931 20932 20933 20934 20935 20936 20937 20938 20939 20940 20941 20942 20943 20944 20945 20946 20947 20948 20949 20950 20951 20952 20953 20954 20955 20956 20957 20958 20959 20960 20961 20962 20963 20964 20965 20966 20967 20968 20969 20970 20971 20972 20973 20974 20975 20976 20977 20978 20979 20980 20981 20982 20983 20984 20985 20986 20987 20988 20989 20990 20991 20992 20993 20994 20995 20996 20997 20998 20999 21000 21001 21002 21003 21004 21005 21006 21007 21008 21009 21010 21011 21012 21013 21014 21015 21016 21017 21018 21019 21020 21021 21022 21023 21024 21025 21026 21027 21028 21029 21030 21031 21032 21033 21034 21035 21036 21037 21038 21039 21040 21041 21042 21043 21044 21045 21046 21047 21048 21049 21050 21051 21052 21053 21054 21055 21056 21057 21058 21059 21060 21061 21062 21063 21064 21065 21066 21067 21068 21069 21070 21071 21072 21073 21074 21075 21076 21077 21078 21079 21080 21081 21082 21083 21084 21085 21086 21087 21088 21089 21090 21091 21092 21093 21094 21095 21096 21097 21098 21099 21100 21101 21102 21103 21104 21105 21106 21107 21108 21109 21110 21111 21112 21113 21114 21115 21116 21117 21118 21119 21120 21121 21122 21123 21124 21125 21126 21127 21128 21129 21130 21131 21132 21133 21134 21135 21136 21137 21138 21139 21140 21141 21142 21143 21144 21145 21146 21147 21148 21149 21150 21151 21152 21153 21154 21155 21156 21157 21158 21159 21160 21161 21162 21163 21164 21165 21166 21167 21168 21169 21170 21171 21172 21173 21174 21175 21176 21177 21178 21179 21180 21181 21182 21183 21184 21185 21186 21187 21188 21189 21190 21191 21192 21193 21194 21195 21196 21197 21198 21199 21200 21201 21202 21203 21204 21205 21206 21207 21208 21209 21210 21211 21212 21213 21214 21215 21216 21217 21218 21219 21220 21221 21222 21223 21224 21225 21226 21227 21228 21229 21230 21231 21232 21233 21234 21235 21236 21237 21238 21239 21240 21241 21242 21243 21244 21245 21246 21247 21248 21249 21250 21251 21252 21253 21254 21255 21256 21257 21258 21259 21260 21261 21262 21263 21264 21265 21266 21267 21268 21269 21270 21271 21272 21273 21274 21275 21276 21277 21278 21279 21280 21281 21282 21283 21284 21285 21286 21287 21288 21289 21290 21291 21292 21293 21294 21295 21296 21297 21298 21299 21300 21301 21302 21303 21304 21305 21306 21307 21308 21309 21310 21311 21312 21313 21314 21315 21316 21317 21318 21319 21320 21321 21322 21323 21324 21325 21326 21327 21328 21329 21330 21331 21332 21333 21334 21335 21336 21337 21338 21339 21340 21341 21342 21343 21344 21345 21346 21347 21348 21349 21350 21351 21352 21353 21354 21355 21356 21357 21358 21359 21360 21361 21362 21363 21364 21365 21366 21367 21368 21369 21370 21371 21372 21373 21374 21375 21376 21377 21378 21379 21380 21381 21382 21383 21384 21385 21386 21387 21388 21389 21390 21391 21392 21393 21394 21395 21396 21397 21398 21399 21400 21401 21402 21403 21404 21405 21406 21407 21408 21409 21410 21411 21412 21413 21414 21415 21416 21417 21418 21419 21420 21421 21422 21423 21424 21425 21426 21427 21428 21429 21430 21431 21432 21433 21434 21435 21436 21437 21438 21439 21440 21441 21442 21443 21444 21445 21446 21447 21448 21449 21450 21451 21452 21453 21454 21455 21456 21457 21458 21459 21460 21461 21462 21463 21464 21465 21466 21467 21468 21469 21470 21471 21472 21473 21474 21475 21476 21477 21478 21479 21480 21481 21482 21483 21484 21485 21486 21487 21488 21489 21490 21491 21492 21493 21494 21495 21496 21497 21498 21499 21500 21501 21502 21503 21504 21505 21506 21507 21508 21509 21510 21511 21512 21513 21514 21515 21516 21517 21518 21519 21520 21521 21522 21523 21524 21525 21526 21527 21528 21529 21530 21531 21532 21533 21534 21535 21536 21537 21538 21539 21540 21541 21542 21543 21544 21545 21546 21547 21548 21549 21550 21551 21552 21553 21554 21555 21556 21557 21558 21559 21560 21561 21562 21563 21564 21565 21566 21567 21568 21569 21570 21571 21572 21573 21574 21575 21576 21577 21578 21579 21580 21581 21582 21583 21584 21585 21586 21587 21588 21589 21590 21591 21592 21593 21594 21595 21596 21597 21598 21599 21600 21601 21602 21603 21604 21605 21606 21607 21608 21609 21610 21611 21612 21613 21614 21615 21616 21617 21618 21619 21620 21621 21622 21623 21624 21625 21626 21627 21628 21629 21630 21631 21632 21633 21634 21635 21636 21637 21638 21639 21640 21641 21642 21643 21644 21645 21646 21647 21648 21649 21650 21651 21652 21653 21654 21655 21656 21657 21658 21659 21660 21661 21662 21663 21664 21665 21666 21667 21668 21669 21670 21671 21672 21673 21674 21675 21676 21677 21678 21679 21680 21681 21682 21683 21684 21685 21686 21687 21688 21689 21690 21691 21692 21693 21694 21695 21696 21697 21698 21699 21700 21701 21702 21703 21704 21705 21706 21707 21708 21709 21710 21711 21712 21713 21714 21715 21716 21717 21718 21719 21720 21721 21722 21723 21724 21725 21726 21727 21728 21729 21730 21731 21732 21733 21734 21735 21736 21737 21738 21739 21740 21741 21742 21743 21744 21745 21746 21747 21748 21749 21750 21751 21752 21753 21754 21755 21756 21757 21758 21759 21760 21761 21762 21763 21764 21765 21766 21767 21768 21769 21770 21771 21772 21773 21774 21775 21776 21777 21778 21779 21780 21781 21782 21783 21784 21785 21786 21787 21788 21789 21790 21791 21792 21793 21794 21795 21796 21797 21798 21799 21800 21801 21802 21803 21804 21805 21806 21807 21808 21809 21810 21811 21812 21813 21814 21815 21816 21817 21818 21819 21820 21821 21822 21823 21824 21825 21826 21827 21828 21829 21830 21831 21832 21833 21834 21835 21836 21837 21838 21839 21840 21841 21842 21843 21844 21845 21846 21847 21848 21849 21850 21851 21852 21853 21854 21855 21856 21857 21858 21859 21860 21861 21862 21863 21864 21865 21866 21867 21868 21869 21870 21871 21872 21873 21874 21875 21876 21877 21878 21879 21880 21881 21882 21883 21884 21885 21886 21887 21888 21889 21890 21891 21892 21893 21894 21895 21896 21897 21898 21899 21900 21901 21902 21903 21904 21905 21906 21907 21908 21909 21910 21911 21912 21913 21914 21915 21916 21917 21918 21919 21920 21921 21922 21923 21924 21925 21926 21927 21928 21929 21930 21931 21932 21933 21934 21935 21936 21937 21938 21939 21940 21941 21942 21943 21944 21945 21946 21947 21948 21949 21950 21951 21952 21953 21954 21955 21956 21957 21958 21959 21960 21961 21962 21963 21964 21965 21966 21967 21968 21969 21970 21971 21972 21973 21974 21975 21976 21977 21978 21979 21980 21981 21982 21983 21984 21985 21986 21987 21988 21989 21990 21991 21992 21993 21994 21995 21996 21997 21998 21999 22000 22001 22002 22003 22004 22005 22006 22007 22008 22009 22010 22011 22012 22013 22014 22015 22016 22017 22018 22019 22020 22021 22022 22023 22024 22025 22026 22027 22028 22029 22030 22031 22032 22033 22034 22035 22036 22037 22038 22039 22040 22041 22042 22043 22044 22045 22046 22047 22048 22049 22050 22051 22052 22053 22054 22055 22056 22057 22058 22059 22060 22061 22062 22063 22064 22065 22066 22067 22068 22069 22070 22071 22072 22073 22074 22075 22076 22077 22078 22079 22080 22081 22082 22083 22084 22085 22086 22087 22088 22089 22090 22091 22092 22093 22094 22095 22096 22097 22098 22099 22100 22101 22102 22103 22104 22105 22106 22107 22108 22109 22110 22111 22112 22113 22114 22115 22116 22117 22118 22119 22120 22121 22122 22123 22124 22125 22126 22127 22128 22129 22130 22131 22132 22133 22134 22135 22136 22137 22138 22139 22140 22141 22142 22143 22144 22145 22146 22147 22148 22149 22150 22151 22152 22153 22154 22155 22156 22157 22158 22159 22160 22161 22162 22163 22164 22165 22166 22167 22168 22169 22170 22171 22172 22173 22174 22175 22176 22177 22178 22179 22180 22181 22182 22183 22184 22185 22186 22187 22188 22189 22190 22191 22192 22193 22194 22195 22196 22197 22198 22199 22200 22201 22202 22203 22204 22205 22206 22207 22208 22209 22210 22211 22212 22213 22214 22215 22216 22217 22218 22219 22220 22221 22222 22223 22224 22225 22226 22227 22228 22229 22230 22231 22232 22233 22234 22235 22236 22237 22238 22239 22240 22241 22242 22243 22244 22245 22246 22247 22248 22249 22250 22251 22252 22253 22254 22255 22256 22257 22258 22259 22260 22261 22262 22263 22264 22265 22266 22267 22268 22269 22270 22271 22272 22273 22274 22275 22276 22277 22278 22279 22280 22281 22282 22283 22284 22285 22286 22287 22288 22289 22290 22291 22292 22293 22294 22295 22296 22297 22298 22299 22300 22301 22302 22303 22304 22305 22306 22307 22308 22309 22310 22311 22312 22313 22314 22315 22316 22317 22318 22319 22320 22321 22322 22323 22324 22325 22326 22327 22328 22329 22330 22331 22332 22333 22334 22335 22336 22337 22338 22339 22340 22341 22342 22343 22344 22345 22346 22347 22348 22349 22350 22351 22352 22353 22354 22355 22356 22357 22358 22359 22360 22361 22362 22363 22364 22365 22366 22367 22368 22369 22370 22371 22372 22373 22374 22375 22376 22377 22378 22379 22380 22381 22382 22383 22384 22385 22386 22387 22388 22389 22390 22391 22392 22393 22394 22395 22396 22397 22398 22399 22400 22401 22402 22403 22404 22405 22406 22407 22408 22409 22410 22411 22412 22413 22414 22415 22416 22417 22418 22419 22420 22421 22422 22423 22424 22425 22426 22427 22428 22429 22430 22431 22432 22433 22434 22435 22436 22437 22438 22439 22440 22441 22442 22443 22444 22445 22446 22447 22448 22449 22450 22451 22452 22453 22454 22455 22456 22457 22458 22459 22460 22461 22462 22463 22464 22465 22466 22467 22468 22469 22470 22471 22472 22473 22474 22475 22476 22477 22478 22479 22480 22481 22482 22483 22484 22485 22486 22487 22488 22489 22490 22491 22492 22493 22494 22495 22496 22497 22498 22499 22500 22501 22502 22503 22504 22505 22506 22507 22508 22509 22510 22511 22512 22513 22514 22515 22516 22517 22518 22519 22520 22521 22522 22523 22524 22525 22526 22527 22528 22529 22530 22531 22532 22533 22534 22535 22536 22537 22538 22539 22540 22541 22542 22543 22544 22545 22546 22547 22548 22549 22550 22551 22552 22553 22554 22555 22556 22557 22558 22559 22560 22561 22562 22563 22564 22565 22566 22567 22568 22569 22570 22571 22572 22573 22574 22575 22576 22577 22578 22579 22580 22581 22582 22583 22584 22585 22586 22587 22588 22589 22590 22591 22592 22593 22594 22595 22596 22597 22598 22599 22600 22601 22602 22603 22604 22605 22606 22607 22608 22609 22610 22611 22612 22613 22614 22615 22616 22617 22618 22619 22620 22621 22622 22623 22624 22625 22626 22627 22628 22629 22630 22631 22632 22633 22634 22635 22636 22637 22638 22639 22640 22641 22642 22643 22644 22645 22646 22647 22648 22649 22650 22651 22652 22653 22654 22655 22656 22657 22658 22659 22660 22661 22662 22663 22664 22665 22666 22667 22668 22669 22670 22671 22672 22673 22674 22675 22676 22677 22678 22679 22680 22681 22682 22683 22684 22685 22686 22687 22688 22689 22690 22691 22692 22693 22694 22695 22696 22697 22698 22699 22700 22701 22702 22703 22704 22705 22706 22707 22708 22709 22710 22711 22712 22713 22714 22715 22716 22717 22718 22719 22720 22721 22722 22723 22724 22725 22726 22727 22728 22729 22730 22731 22732 22733 22734 22735 22736 22737 22738 22739 22740 22741 22742 22743 22744 22745 22746 22747 22748 22749 22750 22751 22752 22753 22754 22755 22756 22757 22758 22759 22760 22761 22762 22763 22764 22765 22766 22767 22768 22769 22770 22771 22772 22773 22774 22775 22776 22777 22778 22779 22780 22781 22782 22783 22784 22785 22786 22787 22788 22789 22790 22791 22792 22793 22794 22795 22796 22797 22798 22799 22800 22801 22802 22803 22804 22805 22806 22807 22808 22809 22810 22811 22812 22813 22814 22815 22816 22817 22818 22819 22820 22821 22822 22823 22824 22825 22826 22827 22828 22829 22830 22831 22832 22833 22834 22835 22836 22837 22838 22839 22840 22841 22842 22843 22844 22845 22846 22847 22848 22849 22850 22851 22852 22853 22854 22855 22856 22857 22858 22859 22860 22861 22862 22863 22864 22865 22866 22867 22868 22869 22870 22871 22872 22873 22874 22875 22876 22877 22878 22879 22880 22881 22882 22883 22884 22885 22886 22887 22888 22889 22890 22891 22892 22893 22894 22895 22896 22897 22898 22899 22900 22901 22902 22903 22904 22905 22906 22907 22908 22909 22910 22911 22912 22913 22914 22915 22916 22917 22918 22919 22920 22921 22922 22923 22924 22925 22926 22927 22928 22929 22930 22931 22932 22933 22934 22935 22936 22937 22938 22939 22940 22941 22942 22943 22944 22945 22946 22947 22948 22949 22950 22951 22952 22953 22954 22955 22956 22957 22958 22959 22960 22961 22962 22963 22964 22965 22966 22967 22968 22969 22970 22971 22972 22973 22974 22975 22976 22977 22978 22979 22980 22981 22982 22983 22984 22985 22986 22987 22988 22989 22990 22991 22992 22993 22994 22995 22996 22997 22998 22999 23000 23001 23002 23003 23004 23005 23006 23007 23008 23009 23010 23011 23012 23013 23014 23015 23016 23017 23018 23019 23020 23021 23022 23023 23024 23025 23026 23027 23028 23029 23030 23031 23032 23033 23034 23035 23036 23037 23038 23039 23040 23041 23042 23043 23044 23045 23046 23047 23048 23049 23050 23051 23052 23053 23054 23055 23056 23057 23058 23059 23060 23061 23062 23063 23064 23065 23066 23067 23068 23069 23070 23071 23072 23073 23074 23075 23076 23077 23078 23079 23080 23081 23082 23083 23084 23085 23086 23087 23088 23089 23090 23091 23092 23093 23094 23095 23096 23097 23098 23099 23100 23101 23102 23103 23104 23105 23106 23107 23108 23109 23110 23111 23112 23113 23114 23115 23116 23117 23118 23119 23120 23121 23122 23123 23124 23125 23126 23127 23128 23129 23130 23131 23132 23133 23134 23135 23136 23137 23138 23139 23140 23141 23142 23143 23144 23145 23146 23147 23148 23149 23150 23151 23152 23153 23154 23155 23156 23157 23158 23159 23160 23161 23162 23163 23164 23165 23166 23167 23168 23169 23170 23171 23172 23173 23174 23175 23176 23177 23178 23179 23180 23181 23182 23183 23184 23185 23186 23187 23188 23189 23190 23191 23192 23193 23194 23195 23196 23197 23198 23199 23200 23201 23202 23203 23204 23205 23206 23207 23208 23209 23210 23211 23212 23213 23214 23215 23216 23217 23218 23219 23220 23221 23222 23223 23224 23225 23226 23227 23228 23229 23230 23231 23232 23233 23234 23235 23236 23237 23238 23239 23240 23241 23242 23243 23244 23245 23246 23247 23248 23249 23250 23251 23252 23253 23254 23255 23256 23257 23258 23259 23260 23261 23262 23263 23264 23265 23266 23267 23268 23269 23270 23271 23272 23273 23274 23275 23276 23277 23278 23279 23280 23281 23282 23283 23284 23285 23286 23287 23288 23289 23290 23291 23292 23293 23294 23295 23296 23297 23298 23299 23300 23301 23302 23303 23304 23305 23306 23307 23308 23309 23310 23311 23312 23313 23314 23315 23316 23317 23318 23319 23320 23321 23322 23323 23324 23325 23326 23327 23328 23329 23330 23331 23332 23333 23334 23335 23336 23337 23338 23339 23340 23341 23342 23343 23344 23345 23346 23347 23348 23349 23350 23351 23352 23353 23354 23355 23356 23357 23358 23359 23360 23361 23362 23363 23364 23365 23366 23367 23368 23369 23370 23371 23372 23373 23374 23375 23376 23377 23378 23379 23380 23381 23382 23383 23384 23385 23386 23387 23388 23389 23390 23391 23392 23393 23394 23395 23396 23397 23398 23399 23400 23401 23402 23403 23404 23405 23406 23407 23408 23409 23410 23411 23412 23413 23414 23415 23416 23417 23418 23419 23420 23421 23422 23423 23424 23425 23426 23427 23428 23429 23430 23431 23432 23433 23434 23435 23436 23437 23438 23439 23440 23441 23442 23443 23444 23445 23446 23447 23448 23449 23450 23451 23452 23453 23454 23455 23456 23457 23458 23459 23460 23461 23462 23463 23464 23465 23466 23467 23468 23469 23470 23471 23472 23473 23474 23475 23476 23477 23478 23479 23480 23481 23482 23483 23484 23485 23486 23487 23488 23489 23490 23491 23492 23493 23494 23495 23496 23497 23498 23499 23500 23501 23502 23503 23504 23505 23506 23507 23508 23509 23510 23511 23512 23513 23514 23515 23516 23517 23518 23519 23520 23521 23522 23523 23524 23525 23526 23527 23528 23529 23530 23531 23532 23533 23534 23535 23536 23537 23538 23539 23540 23541 23542 23543 23544 23545 23546 23547 23548 23549 23550 23551 23552 23553 23554 23555 23556 23557 23558 23559 23560 23561 23562 23563 23564 23565 23566 23567 23568 23569 23570 23571 23572 23573 23574 23575 23576 23577 23578 23579 23580 23581 23582 23583 23584 23585 23586 23587 23588 23589 23590 23591 23592 23593 23594 23595 23596 23597 23598 23599 23600 23601 23602 23603 23604 23605 23606 23607 23608 23609 23610 23611 23612 23613 23614 23615 23616 23617 23618 23619 23620 23621 23622 23623 23624 23625 23626 23627 23628 23629 23630 23631 23632 23633 23634 23635 23636 23637 23638 23639 23640 23641 23642 23643 23644 23645 23646 23647 23648 23649 23650 23651 23652 23653 23654 23655 23656 23657 23658 23659 23660 23661 23662 23663 23664 23665 23666 23667 23668 23669 23670 23671 23672 23673 23674 23675 23676 23677 23678 23679 23680 23681 23682 23683 23684 23685 23686 23687 23688 23689 23690 23691 23692 23693 23694 23695 23696 23697 23698 23699 23700 23701 23702 23703 23704 23705 23706 23707 23708 23709 23710 23711 23712 23713 23714 23715 23716 23717 23718 23719 23720 23721 23722 23723 23724 23725 23726 23727 23728 23729 23730 23731 23732 23733 23734 23735 23736 23737 23738 23739 23740 23741 23742 23743 23744 23745 23746 23747 23748 23749 23750 23751 23752 23753 23754 23755 23756 23757 23758 23759 23760 23761 23762 23763 23764 23765 23766 23767 23768 23769 23770 23771 23772 23773 23774 23775 23776 23777 23778 23779 23780 23781 23782 23783 23784 23785 23786 23787 23788 23789 23790 23791 23792 23793 23794 23795 23796 23797 23798 23799 23800 23801 23802 23803 23804 23805 23806 23807 23808 23809 23810 23811 23812 23813 23814 23815 23816 23817 23818 23819 23820 23821 23822 23823 23824 23825 23826 23827 23828 23829 23830 23831 23832 23833 23834 23835 23836 23837 23838 23839 23840 23841 23842 23843 23844 23845 23846 23847 23848 23849 23850 23851 23852 23853 23854 23855 23856 23857 23858 23859 23860 23861 23862 23863 23864 23865 23866 23867 23868 23869 23870 23871 23872 23873 23874 23875 23876 23877 23878 23879 23880 23881 23882 23883 23884 23885 23886 23887 23888 23889 23890 23891 23892 23893 23894 23895 23896 23897 23898 23899 23900 23901 23902 23903 23904 23905 23906 23907 23908 23909 23910 23911 23912 23913 23914 23915 23916 23917 23918 23919 23920 23921 23922 23923 23924 23925 23926 23927 23928 23929 23930 23931 23932 23933 23934 23935 23936 23937 23938 23939 23940 23941 23942 23943 23944 23945 23946 23947 23948 23949 23950 23951 23952 23953 23954 23955 23956 23957 23958 23959 23960 23961 23962 23963 23964 23965 23966 23967 23968 23969 23970 23971 23972 23973 23974 23975 23976 23977 23978 23979 23980 23981 23982 23983 23984 23985 23986 23987 23988 23989 23990 23991 23992 23993 23994 23995 23996 23997 23998 23999 24000 24001 24002 24003 24004 24005 24006 24007 24008 24009 24010 24011 24012 24013 24014 24015 24016 24017 24018 24019 24020 24021 24022 24023 24024 24025 24026 24027 24028 24029 24030 24031 24032 24033 24034 24035 24036 24037 24038 24039 24040 24041 24042 24043 24044 24045 24046 24047 24048 24049 24050 24051 24052 24053 24054 24055 24056 24057 24058 24059 24060 24061 24062 24063 24064 24065 24066 24067 24068 24069 24070 24071 24072 24073 24074 24075 24076 24077 24078 24079 24080 24081 24082 24083 24084 24085 24086 24087 24088 24089 24090 24091 24092 24093 24094 24095 24096 24097 24098 24099 24100 24101 24102 24103 24104 24105 24106 24107 24108 24109 24110 24111 24112 24113 24114 24115 24116 24117 24118 24119 24120 24121 24122 24123 24124 24125 24126 24127 24128 24129 24130 24131 24132 24133 24134 24135 24136 24137 24138 24139 24140 24141 24142 24143 24144 24145 24146 24147 24148 24149 24150 24151 24152 24153 24154 24155 24156 24157 24158 24159 24160 24161 24162 24163 24164 24165 24166 24167 24168 24169 24170 24171 24172 24173 24174 24175 24176 24177 24178 24179 24180 24181 24182 24183 24184 24185 24186 24187 24188 24189 24190 24191 24192 24193 24194 24195 24196 24197 24198 24199 24200 24201 24202 24203 24204 24205 24206 24207 24208 24209 24210 24211 24212 24213 24214 24215 24216 24217 24218 24219 24220 24221 24222 24223 24224 24225 24226 24227 24228 24229 24230 24231 24232 24233 24234 24235 24236 24237 24238 24239 24240 24241 24242 24243 24244 24245 24246 24247 24248 24249 24250 24251 24252 24253 24254 24255 24256 24257 24258 24259 24260 24261 24262 24263 24264 24265 24266 24267 24268 24269 24270 24271 24272 24273 24274 24275 24276 24277 24278 24279 24280 24281 24282 24283 24284 24285 24286 24287 24288 24289 24290 24291 24292 24293 24294 24295 24296 24297 24298 24299 24300 24301 24302 24303 24304 24305 24306 24307 24308 24309 24310 24311 24312 24313 24314 24315 24316 24317 24318 24319 24320 24321 24322 24323 24324 24325 24326 24327 24328 24329 24330 24331 24332 24333 24334 24335 24336 24337 24338 24339 24340 24341 24342 24343 24344 24345 24346 24347 24348 24349 24350 24351 24352 24353 24354 24355 24356 24357 24358 24359 24360 24361 24362 24363 24364 24365 24366 24367 24368 24369 24370 24371 24372 24373 24374 24375 24376 24377 24378 24379 24380 24381 24382 24383 24384 24385 24386 24387 24388 24389 24390 24391 24392 24393 24394 24395 24396 24397 24398 24399 24400 24401 24402 24403 24404 24405 24406 24407 24408 24409 24410 24411 24412 24413 24414 24415 24416 24417 24418 24419 24420 24421 24422 24423 24424 24425 24426 24427 24428 24429 24430 24431 24432 24433 24434 24435 24436 24437 24438 24439 24440 24441 24442 24443 24444 24445 24446 24447 24448 24449 24450 24451 24452 24453 24454 24455 24456 24457 24458 24459 24460 24461 24462 24463 24464 24465 24466 24467 24468 24469 24470 24471 24472 24473 24474 24475 24476 24477 24478 24479 24480 24481 24482 24483 24484 24485 24486 24487 24488 24489 24490 24491 24492 24493 24494 24495 24496 24497 24498 24499 24500 24501 24502 24503 24504 24505 24506 24507 24508 24509 24510 24511 24512 24513 24514 24515 24516 24517 24518 24519 24520 24521 24522 24523 24524 24525 24526 24527 24528 24529 24530 24531 24532 24533 24534 24535 24536 24537 24538 24539 24540 24541 24542 24543 24544 24545 24546 24547 24548 24549 24550 24551 24552 24553 24554 24555 24556 24557 24558 24559 24560 24561 24562 24563 24564 24565 24566 24567 24568 24569 24570 24571 24572 24573 24574 24575 24576 24577 24578 24579 24580 24581 24582 24583 24584 24585 24586 24587 24588 24589 24590 24591 24592 24593 24594 24595 24596 24597 24598 24599 24600 24601 24602 24603 24604 24605 24606 24607 24608 24609 24610 24611 24612 24613 24614 24615 24616 24617 24618 24619 24620 24621 24622 24623 24624 24625 24626 24627 24628 24629 24630 24631 24632 24633 24634 24635 24636 24637 24638 24639 24640 24641 24642 24643 24644 24645 24646 24647 24648 24649 24650 24651 24652 24653 24654 24655 24656 24657 24658 24659 24660 24661 24662 24663 24664 24665 24666 24667 24668 24669 24670 24671 24672 24673 24674 24675 24676 24677 24678 24679 24680 24681 24682 24683 24684 24685 24686 24687 24688 24689 24690 24691 24692 24693 24694 24695 24696 24697 24698 24699 24700 24701 24702 24703 24704 24705 24706 24707 24708 24709 24710 24711 24712 24713 24714 24715 24716 24717 24718 24719 24720 24721 24722 24723 24724 24725 24726 24727 24728 24729 24730 24731 24732 24733 24734 24735 24736 24737 24738 24739 24740 24741 24742 24743 24744 24745 24746 24747 24748 24749 24750 24751 24752 24753 24754 24755 24756 24757 24758 24759 24760 24761 24762 24763 24764 24765 24766 24767 24768 24769 24770 24771 24772 24773 24774 24775 24776 24777 24778 24779 24780 24781 24782 24783 24784 24785 24786 24787 24788 24789 24790 24791 24792 24793 24794 24795 24796 24797 24798 24799 24800 24801 24802 24803 24804 24805 24806 24807 24808 24809 24810 24811 24812 24813 24814 24815 24816 24817 24818 24819 24820 24821 24822 24823 24824 24825 24826 24827 24828 24829 24830 24831 24832 24833 24834 24835 24836 24837 24838 24839 24840 24841 24842 24843 24844 24845 24846 24847 24848 24849 24850 24851 24852 24853 24854 24855 24856 24857 24858 24859 24860 24861 24862 24863 24864 24865 24866 24867 24868 24869 24870 24871 24872 24873 24874 24875 24876 24877 24878 24879 24880 24881 24882 24883 24884 24885 24886 24887 24888 24889 24890 24891 24892 24893 24894 24895 24896 24897 24898 24899 24900 24901 24902 24903 24904 24905 24906 24907 24908 24909 24910 24911 24912 24913 24914 24915 24916 24917 24918 24919 24920 24921 24922 24923 24924 24925 24926 24927 24928 24929 24930 24931 24932 24933 24934 24935 24936 24937 24938 24939 24940 24941 24942 24943 24944 24945 24946 24947 24948 24949 24950 24951 24952 24953 24954 24955 24956 24957 24958 24959 24960 24961 24962 24963 24964 24965 24966 24967 24968 24969 24970 24971 24972 24973 24974 24975 24976 24977 24978 24979 24980 24981 24982 24983 24984 24985 24986 24987 24988 24989 24990 24991 24992 24993 24994 24995 24996 24997 24998 24999 25000 25001 25002 25003 25004 25005 25006 25007 25008 25009 25010 25011 25012 25013 25014 25015 25016 25017 25018 25019 25020 25021 25022 25023 25024 25025 25026 25027 25028 25029 25030 25031 25032 25033 25034 25035 25036 25037 25038 25039 25040 25041 25042 25043 25044 25045 25046 25047 25048 25049 25050 25051 25052 25053 25054 25055 25056 25057 25058 25059 25060 25061 25062 25063 25064 25065 25066 25067 25068 25069 25070 25071 25072 25073 25074 25075 25076 25077 25078 25079 25080 25081 25082 25083 25084 25085 25086 25087 25088 25089 25090 25091 25092 25093 25094 25095 25096 25097 25098 25099 25100 25101 25102 25103 25104 25105 25106 25107 25108 25109 25110 25111 25112 25113 25114 25115 25116 25117 25118 25119 25120 25121 25122 25123 25124 25125 25126 25127 25128 25129 25130 25131 25132 25133 25134 25135 25136 25137 25138 25139 25140 25141 25142 25143 25144 25145 25146 25147 25148 25149 25150 25151 25152 25153 25154 25155 25156 25157 25158 25159 25160 25161 25162 25163 25164 25165 25166 25167 25168 25169 25170 25171 25172 25173 25174 25175 25176 25177 25178 25179 25180 25181 25182 25183 25184 25185 25186 25187 25188 25189 25190 25191 25192 25193 25194 25195 25196 25197 25198 25199 25200 25201 25202 25203 25204 25205 25206 25207 25208 25209 25210 25211 25212 25213 25214 25215 25216 25217 25218 25219 25220 25221 25222 25223 25224 25225 25226 25227 25228 25229 25230 25231 25232 25233 25234 25235 25236 25237 25238 25239 25240 25241 25242 25243 25244 25245 25246 25247 25248 25249 25250 25251 25252 25253 25254 25255 25256 25257 25258 25259 25260 25261 25262 25263 25264 25265 25266 25267 25268 25269 25270 25271 25272 25273 25274 25275 25276 25277 25278 25279 25280 25281 25282 25283 25284 25285 25286 25287 25288 25289 25290 25291 25292 25293 25294 25295 25296 25297 25298 25299 25300 25301 25302 25303 25304 25305 25306 25307 25308 25309 25310 25311 25312 25313 25314 25315 25316 25317 25318 25319 25320 25321 25322 25323 25324 25325 25326 25327 25328 25329 25330 25331 25332 25333 25334 25335 25336 25337 25338 25339 25340 25341 25342 25343 25344 25345 25346 25347 25348 25349 25350 25351 25352 25353 25354 25355 25356 25357 25358 25359 25360 25361 25362 25363 25364 25365 25366 25367 25368 25369 25370 25371 25372 25373 25374 25375 25376 25377 25378 25379 25380 25381 25382 25383 25384 25385 25386 25387 25388 25389 25390 25391 25392 25393 25394 25395 25396 25397 25398 25399 25400 25401 25402 25403 25404 25405 25406 25407 25408 25409 25410 25411 25412 25413 25414 25415 25416 25417 25418 25419 25420 25421 25422 25423 25424 25425 25426 25427 25428 25429 25430 25431 25432 25433 25434 25435 25436 25437 25438 25439 25440 25441 25442 25443 25444 25445 25446 25447 25448 25449 25450 25451 25452 25453 25454 25455 25456 25457 25458 25459 25460 25461 25462 25463 25464 25465 25466 25467 25468 25469 25470 25471 25472 25473 25474 25475 25476 25477 25478 25479 25480 25481 25482 25483 25484 25485 25486 25487 25488 25489 25490 25491 25492 25493 25494 25495 25496 25497 25498 25499 25500 25501 25502 25503 25504 25505 25506 25507 25508 25509 25510 25511 25512 25513 25514 25515 25516 25517 25518 25519 25520 25521 25522 25523 25524 25525 25526 25527 25528 25529 25530 25531 25532 25533 25534 25535 25536 25537 25538 25539 25540 25541 25542 25543 25544 25545 25546 25547 25548 25549 25550 25551 25552 25553 25554 25555 25556 25557 25558 25559 25560 25561 25562 25563 25564 25565 25566 25567 25568 25569 25570 25571 25572 25573 25574 25575 25576 25577 25578 25579 25580 25581 25582 25583 25584 25585 25586 25587 25588 25589 25590 25591 25592 25593 25594 25595 25596 25597 25598 25599 25600 25601 25602 25603 25604 25605 25606 25607 25608 25609 25610 25611 25612 25613 25614 25615 25616 25617 25618 25619 25620 25621 25622 25623 25624 25625 25626 25627 25628 25629 25630 25631 25632 25633 25634 25635 25636 25637 25638 25639 25640 25641 25642 25643 25644 25645 25646 25647 25648 25649 25650 25651 25652 25653 25654 25655 25656 25657 25658 25659 25660 25661 25662 25663 25664 25665 25666 25667 25668 25669 25670 25671 25672 25673 25674 25675 25676 25677 25678 25679 25680 25681 25682 25683 25684 25685 25686 25687 25688 25689 25690 25691 25692 25693 25694 25695 25696 25697 25698 25699 25700 25701 25702 25703 25704 25705 25706 25707 25708 25709 25710 25711 25712 25713 25714 25715 25716 25717 25718 25719 25720 25721 25722 25723 25724 25725 25726 25727 25728 25729 25730 25731 25732 25733 25734 25735 25736 25737 25738 25739 25740 25741 25742 25743 25744 25745 25746 25747 25748 25749 25750 25751 25752 25753 25754 25755 25756 25757 25758 25759 25760 25761 25762 25763 25764 25765 25766 25767 25768 25769 25770 25771 25772 25773 25774 25775 25776 25777 25778 25779 25780 25781 25782 25783 25784 25785 25786 25787 25788 25789 25790 25791 25792 25793 25794 25795 25796 25797 25798 25799 25800 25801 25802 25803 25804 25805 25806 25807 25808 25809 25810 25811 25812 25813 25814 25815 25816 25817 25818 25819 25820 25821 25822 25823 25824 25825 25826 25827 25828 25829 25830 25831 25832 25833 25834 25835 25836 25837 25838 25839 25840 25841 25842 25843 25844 25845 25846 25847 25848 25849 25850 25851 25852 25853 25854 25855 25856 25857 25858 25859 25860 25861 25862 25863 25864 25865 25866 25867 25868 25869 25870 25871 25872 25873 25874 25875 25876 25877 25878 25879 25880 25881 25882 25883 25884 25885 25886 25887 25888 25889 25890 25891 25892 25893 25894 25895 25896 25897 25898 25899 25900 25901 25902 25903 25904 25905 25906 25907 25908 25909 25910 25911 25912 25913 25914 25915 25916 25917 25918 25919 25920 25921 25922 25923 25924 25925 25926 25927 25928 25929 25930 25931 25932 25933 25934 25935 25936 25937 25938 25939 25940 25941 25942 25943 25944 25945 25946 25947 25948 25949 25950 25951 25952 25953 25954 25955 25956 25957 25958 25959 25960 25961 25962 25963 25964 25965 25966 25967 25968 25969 25970 25971 25972 25973 25974 25975 25976 25977 25978 25979 25980 25981 25982 25983 25984 25985 25986 25987 25988 25989 25990 25991 25992 25993 25994 25995 25996 25997 25998 25999 26000 26001 26002 26003 26004 26005 26006 26007 26008 26009 26010 26011 26012 26013 26014 26015 26016 26017 26018 26019 26020 26021 26022 26023 26024 26025 26026 26027 26028 26029 26030 26031 26032 26033 26034 26035 26036 26037 26038 26039 26040 26041 26042 26043 26044 26045 26046 26047 26048 26049 26050 26051 26052 26053 26054 26055 26056 26057 26058 26059 26060 26061 26062 26063 26064 26065 26066 26067 26068 26069 26070 26071 26072 26073 26074 26075 26076 26077 26078 26079 26080 26081 26082 26083 26084 26085 26086 26087 26088 26089 26090 26091 26092 26093 26094 26095 26096 26097 26098 26099 26100 26101 26102 26103 26104 26105 26106 26107 26108 26109 26110 26111 26112 26113 26114 26115 26116 26117 26118 26119 26120 26121 26122 26123 26124 26125 26126 26127 26128 26129 26130 26131 26132 26133 26134 26135 26136 26137 26138 26139 26140 26141 26142 26143 26144 26145 26146 26147 26148 26149 26150 26151 26152 26153 26154 26155 26156 26157 26158 26159 26160 26161 26162 26163 26164 26165 26166 26167 26168 26169 26170 26171 26172 26173 26174 26175 26176 26177 26178 26179 26180 26181 26182 26183 26184 26185 26186 26187 26188 26189 26190 26191 26192 26193 26194 26195 26196 26197 26198 26199 26200 26201 26202 26203 26204 26205 26206 26207 26208 26209 26210 26211 26212 26213 26214 26215 26216 26217 26218 26219 26220 26221 26222 26223 26224 26225 26226 26227 26228 26229 26230 26231 26232 26233 26234 26235 26236 26237 26238 26239 26240 26241 26242 26243 26244 26245 26246 26247 26248 26249 26250 26251 26252 26253 26254 26255 26256 26257 26258 26259 26260 26261 26262 26263 26264 26265 26266 26267 26268 26269 26270 26271 26272 26273 26274 26275 26276 26277 26278 26279 26280 26281 26282 26283 26284 26285 26286 26287 26288 26289 26290 26291 26292 26293 26294 26295 26296 26297 26298 26299 26300 26301 26302 26303 26304 26305 26306 26307 26308 26309 26310 26311 26312 26313 26314 26315 26316 26317 26318 26319 26320 26321 26322 26323 26324 26325 26326 26327 26328 26329 26330 26331 26332 26333 26334 26335 26336 26337 26338 26339 26340 26341 26342 26343 26344 26345 26346 26347 26348 26349 26350 26351 26352 26353 26354 26355 26356 26357 26358 26359 26360 26361 26362 26363 26364 26365 26366 26367 26368 26369 26370 26371 26372 26373 26374 26375 26376 26377 26378 26379 26380 26381 26382 26383 26384 26385 26386 26387 26388 26389 26390 26391 26392 26393 26394 26395 26396 26397 26398 26399 26400 26401 26402 26403 26404 26405 26406 26407 26408 26409 26410 26411 26412 26413 26414 26415 26416 26417 26418 26419 26420 26421 26422 26423 26424 26425 26426 26427 26428 26429 26430 26431 26432 26433 26434 26435 26436 26437 26438 26439 26440 26441 26442 26443 26444 26445 26446 26447 26448 26449 26450 26451 26452 26453 26454 26455 26456 26457 26458 26459 26460 26461 26462 26463 26464 26465 26466 26467 26468 26469 26470 26471 26472 26473 26474 26475 26476 26477 26478 26479 26480 26481 26482 26483 26484 26485 26486 26487 26488 26489 26490 26491 26492 26493 26494 26495 26496 26497 26498 26499 26500 26501 26502 26503 26504 26505 26506 26507 26508 26509 26510 26511 26512 26513 26514 26515 26516 26517 26518 26519 26520 26521 26522 26523 26524 26525 26526 26527 26528 26529 26530 26531 26532 26533 26534 26535 26536 26537 26538 26539 26540 26541 26542 26543 26544 26545 26546 26547 26548 26549 26550 26551 26552 26553 26554 26555 26556 26557 26558 26559 26560 26561 26562 26563 26564 26565 26566 26567 26568 26569 26570 26571 26572 26573 26574 26575 26576 26577 26578 26579 26580 26581 26582 26583 26584 26585 26586 26587 26588 26589 26590 26591 26592 26593 26594 26595 26596 26597 26598 26599 26600 26601 26602 26603 26604 26605 26606 26607 26608 26609 26610 26611 26612 26613 26614 26615 26616 26617 26618 26619 26620 26621 26622 26623 26624 26625 26626 26627 26628 26629 26630 26631 26632 26633 26634 26635 26636 26637 26638 26639 26640 26641 26642 26643 26644 26645 26646 26647 26648 26649 26650 26651 26652 26653 26654 26655 26656 26657 26658 26659 26660 26661 26662 26663 26664 26665 26666 26667 26668 26669 26670 26671 26672 26673 26674 26675 26676 26677 26678 26679 26680 26681 26682 26683 26684 26685 26686 26687 26688 26689 26690 26691 26692 26693 26694 26695 26696 26697 26698 26699 26700 26701 26702 26703 26704 26705 26706 26707 26708 26709 26710 26711 26712 26713 26714 26715 26716 26717 26718 26719 26720 26721 26722 26723 26724 26725 26726 26727 26728 26729 26730 26731 26732 26733 26734 26735 26736 26737 26738 26739 26740 26741 26742 26743 26744 26745 26746 26747 26748 26749 26750 26751 26752 26753 26754 26755 26756 26757 26758 26759 26760 26761 26762 26763 26764 26765 26766 26767 26768 26769 26770 26771 26772 26773 26774 26775 26776 26777 26778 26779 26780 26781 26782 26783 26784 26785 26786 26787 26788 26789 26790 26791 26792 26793 26794 26795 26796 26797 26798 26799 26800 26801 26802 26803 26804 26805 26806 26807 26808 26809 26810 26811 26812 26813 26814 26815 26816 26817 26818 26819 26820 26821 26822 26823 26824 26825 26826 26827 26828 26829 26830 26831 26832 26833 26834 26835 26836 26837 26838 26839 26840 26841 26842 26843 26844 26845 26846 26847 26848 26849 26850 26851 26852 26853 26854 26855 26856 26857 26858 26859 26860 26861 26862 26863 26864 26865 26866 26867 26868 26869 26870 26871 26872 26873 26874 26875 26876 26877 26878 26879 26880 26881 26882 26883 26884 26885 26886 26887 26888 26889 26890 26891 26892 26893 26894 26895 26896 26897 26898 26899 26900 26901 26902 26903 26904 26905 26906 26907 26908 26909 26910 26911 26912 26913 26914 26915 26916 26917 26918 26919 26920 26921 26922 26923 26924 26925 26926 26927 26928 26929 26930 26931 26932 26933 26934 26935 26936 26937 26938 26939 26940 26941 26942 26943 26944 26945 26946 26947 26948 26949 26950 26951 26952 26953 26954 26955 26956 26957 26958 26959 26960 26961 26962 26963 26964 26965 26966 26967 26968 26969 26970 26971 26972 26973 26974 26975 26976 26977 26978 26979 26980 26981 26982 26983 26984 26985 26986 26987 26988 26989 26990 26991 26992 26993 26994 26995 26996 26997 26998 26999 27000 27001 27002 27003 27004 27005 27006 27007 27008 27009 27010 27011 27012 27013 27014 27015 27016 27017 27018 27019 27020 27021 27022 27023 27024 27025 27026 27027 27028 27029 27030 27031 27032 27033 27034 27035 27036 27037 27038 27039 27040 27041 27042 27043 27044 27045 27046 27047 27048 27049 27050 27051 27052 27053 27054 27055 27056 27057 27058 27059 27060 27061 27062 27063 27064 27065 27066 27067 27068 27069 27070 27071 27072 27073 27074 27075 27076 27077 27078 27079 27080 27081 27082 27083 27084 27085 27086 27087 27088 27089 27090 27091 27092 27093 27094 27095 27096 27097 27098 27099 27100 27101 27102 27103 27104 27105 27106 27107 27108 27109 27110 27111 27112 27113 27114 27115 27116 27117 27118 27119 27120 27121 27122 27123 27124 27125 27126 27127 27128 27129 27130 27131 27132 27133 27134 27135 27136 27137 27138 27139 27140 27141 27142 27143 27144 27145 27146 27147 27148 27149 27150 27151 27152 27153 27154 27155 27156 27157 27158 27159 27160 27161 27162 27163 27164 27165 27166 27167 27168 27169 27170 27171 27172 27173 27174 27175 27176 27177 27178 27179 27180 27181 27182 27183 27184 27185 27186 27187 27188 27189 27190 27191 27192 27193 27194 27195 27196 27197 27198 27199 27200 27201 27202 27203 27204 27205 27206 27207 27208 27209 27210 27211 27212 27213 27214 27215 27216 27217 27218 27219 27220 27221 27222 27223 27224 27225 27226 27227 27228 27229 27230 27231 27232 27233 27234 27235 27236 27237 27238 27239 27240 27241 27242 27243 27244 27245 27246 27247 27248 27249 27250 27251 27252 27253 27254 27255 27256 27257 27258 27259 27260 27261 27262 27263 27264 27265 27266 27267 27268 27269 27270 27271 27272 27273 27274 27275 27276 27277 27278 27279 27280 27281 27282 27283 27284 27285 27286 27287 27288 27289 27290 27291 27292 27293 27294 27295 27296 27297 27298 27299 27300 27301 27302 27303 27304 27305 27306 27307 27308 27309 27310 27311 27312 27313 27314 27315 27316 27317 27318 27319 27320 27321 27322 27323 27324 27325 27326 27327 27328 27329 27330 27331 27332 27333 27334 27335 27336 27337 27338 27339 27340 27341 27342 27343 27344 27345 27346 27347 27348 27349 27350 27351 27352 27353 27354 27355 27356 27357 27358 27359 27360 27361 27362 27363 27364 27365 27366 27367 27368 27369 27370 27371 27372 27373 27374 27375 27376 27377 27378 27379 27380 27381 27382 27383 27384 27385 27386 27387 27388 27389 27390 27391 27392 27393 27394 27395 27396 27397 27398 27399 27400 27401 27402 27403 27404 27405 27406 27407 27408 27409 27410 27411 27412 27413 27414 27415 27416 27417 27418 27419 27420 27421 27422 27423 27424 27425 27426 27427 27428 27429 27430 27431 27432 27433 27434 27435 27436 27437 27438 27439 27440 27441 27442 27443 27444 27445 27446 27447 27448 27449 27450 27451 27452 27453 27454 27455 27456 27457 27458 27459 27460 27461 27462 27463 27464 27465 27466 27467 27468 27469 27470 27471 27472 27473 27474 27475 27476 27477 27478 27479 27480 27481 27482 27483 27484 27485 27486 27487 27488 27489 27490 27491 27492 27493 27494 27495 27496 27497 27498 27499 27500 27501 27502 27503 27504 27505 27506 27507 27508 27509 27510 27511 27512 27513 27514 27515 27516 27517 27518 27519 27520 27521 27522 27523 27524 27525 27526 27527 27528 27529 27530 27531 27532 27533 27534 27535 27536 27537 27538 27539 27540 27541 27542 27543 27544 27545 27546 27547 27548 27549 27550 27551 27552 27553 27554 27555 27556 27557 27558 27559 27560 27561 27562 27563 27564 27565 27566 27567 27568 27569 27570 27571 27572 27573 27574 27575 27576 27577 27578 27579 27580 27581 27582 27583 27584 27585 27586 27587 27588 27589 27590 27591 27592 27593 27594 27595 27596 27597 27598 27599 27600 27601 27602 27603 27604 27605 27606 27607 27608 27609 27610 27611 27612 27613 27614 27615 27616 27617 27618 27619 27620 27621 27622 27623 27624 27625 27626 27627 27628 27629 27630 27631 27632 27633 27634 27635 27636 27637 27638 27639 27640 27641 27642 27643 27644 27645 27646 27647 27648 27649 27650 27651 27652 27653 27654 27655 27656 27657 27658 27659 27660 27661 27662 27663 27664 27665 27666 27667 27668 27669 27670 27671 27672 27673 27674 27675 27676 27677 27678 27679 27680 27681 27682 27683 27684 27685 27686 27687 27688 27689 27690 27691 27692 27693 27694 27695 27696 27697 27698 27699 27700 27701 27702 27703 27704 27705 27706 27707 27708 27709 27710 27711 27712 27713 27714 27715 27716 27717 27718 27719 27720 27721 27722 27723 27724 27725 27726 27727 27728 27729 27730 27731 27732 27733 27734 27735 27736 27737 27738 27739 27740 27741 27742 27743 27744 27745 27746 27747 27748 27749 27750 27751 27752 27753 27754 27755 27756 27757 27758 27759 27760 27761 27762 27763 27764 27765 27766 27767 27768 27769 27770 27771 27772 27773 27774 27775 27776 27777 27778 27779 27780 27781 27782 27783 27784 27785 27786 27787 27788 27789 27790 27791 27792 27793 27794 27795 27796 27797 27798 27799 27800 27801 27802 27803 27804 27805 27806 27807 27808 27809 27810 27811 27812 27813 27814 27815 27816 27817 27818 27819 27820 27821 27822 27823 27824 27825 27826 27827 27828 27829 27830 27831 27832 27833 27834 27835 27836 27837 27838 27839 27840 27841 27842 27843 27844 27845 27846 27847 27848 27849 27850 27851 27852 27853 27854 27855 27856 27857 27858 27859 27860 27861 27862 27863 27864 27865 27866 27867 27868 27869 27870 27871 27872 27873 27874 27875 27876 27877 27878 27879 27880 27881 27882 27883 27884 27885 27886 27887 27888 27889 27890 27891 27892 27893 27894 27895 27896 27897 27898 27899 27900 27901 27902 27903 27904 27905 27906 27907 27908 27909 27910 27911 27912 27913 27914 27915 27916 27917 27918 27919 27920 27921 27922 27923 27924 27925 27926 27927 27928 27929 27930 27931 27932 27933 27934 27935 27936 27937 27938 27939 27940 27941 27942 27943 27944 27945 27946 27947 27948 27949 27950 27951 27952 27953 27954 27955 27956 27957 27958 27959 27960 27961 27962 27963 27964 27965 27966 27967 27968 27969 27970 27971 27972 27973 27974 27975 27976 27977 27978 27979 27980 27981 27982 27983 27984 27985 27986 27987 27988 27989 27990 27991 27992 27993 27994 27995 27996 27997 27998 27999 28000 28001 28002 28003 28004 28005 28006 28007 28008 28009 28010 28011 28012 28013 28014 28015 28016 28017 28018 28019 28020 28021 28022 28023 28024 28025 28026 28027 28028 28029 28030 28031 28032 28033 28034 28035 28036 28037 28038 28039 28040 28041 28042 28043 28044 28045 28046 28047 28048 28049 28050 28051 28052 28053 28054 28055 28056 28057 28058 28059 28060 28061 28062 28063 28064 28065 28066 28067 28068 28069 28070 28071 28072 28073 28074 28075 28076 28077 28078 28079 28080 28081 28082 28083 28084 28085 28086 28087 28088 28089 28090 28091 28092 28093 28094 28095 28096 28097 28098 28099 28100 28101 28102 28103 28104 28105 28106 28107 28108 28109 28110 28111 28112 28113 28114 28115 28116 28117 28118 28119 28120 28121 28122 28123 28124 28125 28126 28127 28128 28129 28130 28131 28132 28133 28134 28135 28136 28137 28138 28139 28140 28141 28142 28143 28144 28145 28146 28147 28148 28149 28150 28151 28152 28153 28154 28155 28156 28157 28158 28159 28160 28161 28162 28163 28164 28165 28166 28167 28168 28169 28170 28171 28172 28173 28174 28175 28176 28177 28178 28179 28180 28181 28182 28183 28184 28185 28186 28187 28188 28189 28190 28191 28192 28193 28194 28195 28196 28197 28198 28199 28200 28201 28202 28203 28204 28205 28206 28207 28208 28209 28210 28211 28212 28213 28214 28215 28216 28217 28218 28219 28220 28221 28222 28223 28224 28225 28226 28227 28228 28229 28230 28231 28232 28233 28234 28235 28236 28237 28238 28239 28240 28241 28242 28243 28244 28245 28246 28247 28248 28249 28250 28251 28252 28253 28254 28255 28256 28257 28258 28259 28260 28261 28262 28263 28264 28265 28266 28267 28268 28269 28270 28271 28272 28273 28274 28275 28276 28277 28278 28279 28280 28281 28282 28283 28284 28285 28286 28287 28288 28289 28290 28291 28292 28293 28294 28295 28296 28297 28298 28299 28300 28301 28302 28303 28304 28305 28306 28307 28308 28309 28310 28311 28312 28313 28314 28315 28316 28317 28318 28319 28320 28321 28322 28323 28324 28325 28326 28327 28328 28329 28330 28331 28332 28333 28334 28335 28336 28337 28338 28339 28340 28341 28342 28343 28344 28345 28346 28347 28348 28349 28350 28351 28352 28353 28354 28355 28356 28357 28358 28359 28360 28361 28362 28363 28364 28365 28366 28367 28368 28369 28370 28371 28372 28373 28374 28375 28376 28377 28378 28379 28380 28381 28382 28383 28384 28385 28386 28387 28388 28389 28390 28391 28392 28393 28394 28395 28396 28397 28398 28399 28400 28401 28402 28403 28404 28405 28406 28407 28408 28409 28410 28411 28412 28413 28414 28415 28416 28417 28418 28419 28420 28421 28422 28423 28424 28425 28426 28427 28428 28429 28430 28431 28432 28433 28434 28435 28436 28437 28438 28439 28440 28441 28442 28443 28444 28445 28446 28447 28448 28449 28450 28451 28452 28453 28454 28455 28456 28457 28458 28459 28460 28461 28462 28463 28464 28465 28466 28467 28468 28469 28470 28471 28472 28473 28474 28475 28476 28477 28478 28479 28480 28481 28482 28483 28484 28485 28486 28487 28488 28489 28490 28491 28492 28493 28494 28495 28496 28497 28498 28499 28500 28501 28502 28503 28504 28505 28506 28507 28508 28509 28510 28511 28512 28513 28514 28515 28516 28517 28518 28519 28520 28521 28522 28523 28524 28525 28526 28527 28528 28529 28530 28531 28532 28533 28534 28535 28536 28537 28538 28539 28540 28541 28542 28543 28544 28545 28546 28547 28548 28549 28550 28551 28552 28553 28554 28555 28556 28557 28558 28559 28560 28561 28562 28563 28564 28565 28566 28567 28568 28569 28570 28571 28572 28573 28574 28575 28576 28577 28578 28579 28580 28581 28582 28583 28584 28585 28586 28587 28588 28589 28590 28591 28592 28593 28594 28595 28596 28597 28598 28599 28600 28601 28602 28603 28604 28605 28606 28607 28608 28609 28610 28611 28612 28613 28614 28615 28616 28617 28618 28619 28620 28621 28622 28623 28624 28625 28626 28627 28628 28629 28630 28631 28632 28633 28634 28635 28636 28637 28638 28639 28640 28641 28642 28643 28644 28645 28646 28647 28648 28649 28650 28651 28652 28653 28654 28655 28656 28657 28658 28659 28660 28661 28662 28663 28664 28665 28666 28667 28668 28669 28670 28671 28672 28673 28674 28675 28676 28677 28678 28679 28680 28681 28682 28683 28684 28685 28686 28687 28688 28689 28690 28691 28692 28693 28694 28695 28696 28697 28698 28699 28700 28701 28702 28703 28704 28705 28706 28707 28708 28709 28710 28711 28712 28713 28714 28715 28716 28717 28718 28719 28720 28721 28722 28723 28724 28725 28726 28727 28728 28729 28730 28731 28732 28733 28734 28735 28736 28737 28738 28739 28740 28741 28742 28743 28744 28745 28746 28747 28748 28749 28750 28751 28752 28753 28754 28755 28756 28757 28758 28759 28760 28761 28762 28763 28764 28765 28766 28767 28768 28769 28770 28771 28772 28773 28774 28775 28776 28777 28778 28779 28780 28781 28782 28783 28784 28785 28786 28787 28788 28789 28790 28791 28792 28793 28794 28795 28796 28797 28798 28799 28800 28801 28802 28803 28804 28805 28806 28807 28808 28809 28810 28811 28812 28813 28814 28815 28816 28817 28818 28819 28820 28821 28822 28823 28824 28825 28826 28827 28828 28829 28830 28831 28832 28833 28834 28835 28836 28837 28838 28839 28840 28841 28842 28843 28844 28845 28846 28847 28848 28849 28850 28851 28852 28853 28854 28855 28856 28857 28858 28859 28860 28861 28862 28863 28864 28865 28866 28867 28868 28869 28870 28871 28872 28873 28874 28875 28876 28877 28878 28879 28880 28881 28882 28883 28884 28885 28886 28887 28888 28889 28890 28891 28892 28893 28894 28895 28896 28897 28898 28899 28900 28901 28902 28903 28904 28905 28906 28907 28908 28909 28910 28911 28912 28913 28914 28915 28916 28917 28918 28919 28920 28921 28922 28923 28924 28925 28926 28927 28928 28929 28930 28931 28932 28933 28934 28935 28936 28937 28938 28939 28940 28941 28942 28943 28944 28945 28946 28947 28948 28949 28950 28951 28952 28953 28954 28955 28956 28957 28958 28959 28960 28961 28962 28963 28964 28965 28966 28967 28968 28969 28970 28971 28972 28973 28974 28975 28976 28977 28978 28979 28980 28981 28982 28983 28984 28985 28986 28987 28988 28989 28990 28991 28992 28993 28994 28995 28996 28997 28998 28999 29000 29001 29002 29003 29004 29005 29006 29007 29008 29009 29010 29011 29012 29013 29014 29015 29016 29017 29018 29019 29020 29021 29022 29023 29024 29025 29026 29027 29028 29029 29030 29031 29032 29033 29034 29035 29036 29037 29038 29039 29040 29041 29042 29043 29044 29045 29046 29047 29048 29049 29050 29051 29052 29053 29054 29055 29056 29057 29058 29059 29060 29061 29062 29063 29064 29065 29066 29067 29068 29069 29070 29071 29072 29073 29074 29075 29076 29077 29078 29079 29080 29081 29082 29083 29084 29085 29086 29087 29088 29089 29090 29091 29092 29093 29094 29095 29096 29097 29098 29099 29100 29101 29102 29103 29104 29105 29106 29107 29108 29109 29110 29111 29112 29113 29114 29115 29116 29117 29118 29119 29120 29121 29122 29123 29124 29125 29126 29127 29128 29129 29130 29131 29132 29133 29134 29135 29136 29137 29138 29139 29140 29141 29142 29143 29144 29145 29146 29147 29148 29149 29150 29151 29152 29153 29154 29155 29156 29157 29158 29159 29160 29161 29162 29163 29164 29165 29166 29167 29168 29169 29170 29171 29172 29173 29174 29175 29176 29177 29178 29179 29180 29181 29182 29183 29184 29185 29186 29187 29188 29189 29190 29191 29192 29193 29194 29195 29196 29197 29198 29199 29200 29201 29202 29203 29204 29205 29206 29207 29208 29209 29210 29211 29212 29213 29214 29215 29216 29217 29218 29219 29220 29221 29222 29223 29224 29225 29226 29227 29228 29229 29230 29231 29232 29233 29234 29235 29236 29237 29238 29239 29240 29241 29242 29243 29244 29245 29246 29247 29248 29249 29250 29251 29252 29253 29254 29255 29256 29257 29258 29259 29260 29261 29262 29263 29264 29265 29266 29267 29268 29269 29270 29271 29272 29273 29274 29275 29276 29277 29278 29279 29280 29281 29282 29283 29284 29285 29286 29287 29288 29289 29290 29291 29292 29293 29294 29295 29296 29297 29298 29299 29300 29301 29302 29303 29304 29305 29306 29307 29308 29309 29310 29311 29312 29313 29314 29315 29316 29317 29318 29319 29320 29321 29322 29323 29324 29325 29326 29327 29328 29329 29330 29331 29332 29333 29334 29335 29336 29337 29338 29339 29340 29341 29342 29343 29344 29345 29346 29347 29348 29349 29350 29351 29352 29353 29354 29355 29356 29357 29358 29359 29360 29361 29362 29363 29364 29365 29366 29367 29368 29369 29370 29371 29372 29373 29374 29375 29376 29377 29378 29379 29380 29381 29382 29383 29384 29385 29386 29387 29388 29389 29390 29391 29392 29393 29394 29395 29396 29397 29398 29399 29400 29401 29402 29403 29404 29405 29406 29407 29408 29409 29410 29411 29412 29413 29414 29415 29416 29417 29418 29419 29420 29421 29422 29423 29424 29425 29426 29427 29428 29429 29430 29431 29432 29433 29434 29435 29436 29437 29438 29439 29440 29441 29442 29443 29444 29445 29446 29447 29448 29449 29450 29451 29452 29453 29454 29455 29456 29457 29458 29459 29460 29461 29462 29463 29464 29465 29466 29467 29468 29469 29470 29471 29472 29473 29474 29475 29476 29477 29478 29479 29480 29481 29482 29483 29484 29485 29486 29487 29488 29489 29490 29491 29492 29493 29494 29495 29496 29497 29498 29499 29500 29501 29502 29503 29504 29505 29506 29507 29508 29509 29510 29511 29512 29513 29514 29515 29516 29517 29518 29519 29520 29521 29522 29523 29524 29525 29526 29527 29528 29529 29530 29531 29532 29533 29534 29535 29536 29537 29538 29539 29540 29541 29542 29543 29544 29545 29546 29547 29548 29549 29550 29551 29552 29553 29554 29555 29556 29557 29558 29559 29560 29561 29562 29563 29564 29565 29566 29567 29568 29569 29570 29571 29572 29573 29574 29575 29576 29577 29578 29579 29580 29581 29582 29583 29584 29585 29586 29587 29588 29589 29590 29591 29592 29593 29594 29595 29596 29597 29598 29599 29600 29601 29602 29603 29604 29605 29606 29607 29608 29609 29610 29611 29612 29613 29614 29615 29616 29617 29618 29619 29620 29621 29622 29623 29624 29625 29626 29627 29628 29629 29630 29631 29632 29633 29634 29635 29636 29637 29638 29639 29640 29641 29642 29643 29644 29645 29646 29647 29648 29649 29650 29651 29652 29653 29654 29655 29656 29657 29658 29659 29660 29661 29662 29663 29664 29665 29666 29667 29668 29669 29670 29671 29672 29673 29674 29675 29676 29677 29678 29679 29680 29681 29682 29683 29684 29685 29686 29687 29688 29689 29690 29691 29692 29693 29694 29695 29696 29697 29698 29699 29700 29701 29702 29703 29704 29705 29706 29707 29708 29709 29710 29711 29712 29713 29714 29715 29716 29717 29718 29719 29720 29721 29722 29723 29724 29725 29726 29727 29728 29729 29730 29731 29732 29733 29734 29735 29736 29737 29738 29739 29740 29741 29742 29743 29744 29745 29746 29747 29748 29749 29750 29751 29752 29753 29754 29755 29756 29757 29758 29759 29760 29761 29762 29763 29764 29765 29766 29767 29768 29769 29770 29771 29772 29773 29774 29775 29776 29777 29778 29779 29780 29781 29782 29783 29784 29785 29786 29787 29788 29789 29790 29791 29792 29793 29794 29795 29796 29797 29798 29799 29800 29801 29802 29803 29804 29805 29806 29807 29808 29809 29810 29811 29812 29813 29814 29815 29816 29817 29818 29819 29820 29821 29822 29823 29824 29825 29826 29827 29828 29829 29830 29831 29832 29833 29834 29835 29836 29837 29838 29839 29840 29841 29842 29843 29844 29845 29846 29847 29848 29849 29850 29851 29852 29853 29854 29855 29856 29857 29858 29859 29860 29861 29862 29863 29864 29865 29866 29867 29868 29869 29870 29871 29872 29873 29874 29875 29876 29877 29878 29879 29880 29881 29882 29883 29884 29885 29886 29887 29888 29889 29890 29891 29892 29893 29894 29895 29896 29897 29898 29899 29900 29901 29902 29903 29904 29905 29906 29907 29908 29909 29910 29911 29912 29913 29914 29915 29916 29917 29918 29919 29920 29921 29922 29923 29924 29925 29926 29927 29928 29929 29930 29931 29932 29933 29934 29935 29936 29937 29938 29939 29940 29941 29942 29943 29944 29945 29946 29947 29948 29949 29950 29951 29952 29953 29954 29955 29956 29957 29958 29959 29960 29961 29962 29963 29964 29965 29966 29967 29968 29969 29970 29971 29972 29973 29974 29975 29976 29977 29978 29979 29980 29981 29982 29983 29984 29985 29986 29987 29988 29989 29990 29991 29992 29993 29994 29995 29996 29997 29998 29999 30000 30001 30002 30003 30004 30005 30006 30007 30008 30009 30010 30011 30012 30013 30014 30015 30016 30017 30018 30019 30020 30021 30022 30023 30024 30025 30026 30027 30028 30029 30030 30031 30032 30033 30034 30035 30036 30037 30038 30039 30040 30041 30042 30043 30044 30045 30046 30047 30048 30049 30050 30051 30052 30053 30054 30055 30056 30057 30058 30059 30060 30061 30062 30063 30064 30065 30066 30067 30068 30069 30070 30071 30072 30073 30074 30075 30076 30077 30078 30079 30080 30081 30082 30083 30084 30085 30086 30087 30088 30089 30090 30091 30092 30093 30094 30095 30096 30097 30098 30099 30100 30101 30102 30103 30104 30105 30106 30107 30108 30109 30110 30111 30112 30113 30114 30115 30116 30117 30118 30119 30120 30121 30122 30123 30124 30125 30126 30127 30128 30129 30130 30131 30132 30133 30134 30135 30136 30137 30138 30139 30140 30141 30142 30143 30144 30145 30146 30147 30148 30149 30150 30151 30152 30153 30154 30155 30156 30157 30158 30159 30160 30161 30162 30163 30164 30165 30166 30167 30168 30169 30170 30171 30172 30173 30174 30175 30176 30177 30178 30179 30180 30181 30182 30183 30184 30185 30186 30187 30188 30189 30190 30191 30192 30193 30194 30195 30196 30197 30198 30199 30200 30201 30202 30203 30204 30205 30206 30207 30208 30209 30210 30211 30212 30213 30214 30215 30216 30217 30218 30219 30220 30221 30222 30223 30224 30225 30226 30227 30228 30229 30230 30231 30232 30233 30234 30235 30236 30237 30238 30239 30240 30241 30242 30243 30244 30245 30246 30247 30248 30249 30250 30251 30252 30253 30254 30255 30256 30257 30258 30259 30260 30261 30262 30263 30264 30265 30266 30267 30268 30269 30270 30271 30272 30273 30274 30275 30276 30277 30278 30279 30280 30281 30282 30283 30284 30285 30286 30287 30288 30289 30290 30291 30292 30293 30294 30295 30296 30297 30298 30299 30300 30301 30302 30303 30304 30305 30306 30307 30308 30309 30310 30311 30312 30313 30314 30315 30316 30317 30318 30319 30320 30321 30322 30323 30324 30325 30326 30327 30328 30329 30330 30331 30332 30333 30334 30335 30336 30337 30338 30339 30340 30341 30342 30343 30344 30345 30346 30347 30348 30349 30350 30351 30352 30353 30354 30355 30356 30357 30358 30359 30360 30361 30362 30363 30364 30365 30366 30367 30368 30369 30370 30371 30372 30373 30374 30375 30376 30377 30378 30379 30380 30381 30382 30383 30384 30385 30386 30387 30388 30389 30390 30391 30392 30393 30394 30395 30396 30397 30398 30399 30400 30401 30402 30403 30404 30405 30406 30407 30408 30409 30410 30411 30412 30413 30414 30415 30416 30417 30418 30419 30420 30421 30422 30423 30424 30425 30426 30427 30428 30429 30430 30431 30432 30433 30434 30435 30436 30437 30438 30439 30440 30441 30442 30443 30444 30445 30446 30447 30448 30449 30450 30451 30452 30453 30454 30455 30456 30457 30458 30459 30460 30461 30462 30463 30464 30465 30466 30467 30468 30469 30470 30471 30472 30473 30474 30475 30476 30477 30478 30479 30480 30481 30482 30483 30484 30485 30486 30487 30488 30489 30490 30491 30492 30493 30494 30495 30496 30497 30498 30499 30500 30501 30502 30503 30504 30505 30506 30507 30508 30509 30510 30511 30512 30513 30514 30515 30516 30517 30518 30519 30520 30521 30522 30523 30524 30525 30526 30527 30528 30529 30530 30531 30532 30533 30534 30535 30536 30537 30538 30539 30540 30541 30542 30543 30544 30545 30546 30547 30548 30549 30550 30551 30552 30553 30554 30555 30556 30557 30558 30559 30560 30561 30562 30563 30564 30565 30566 30567 30568 30569 30570 30571 30572 30573 30574 30575 30576 30577 30578 30579 30580 30581 30582 30583 30584 30585 30586 30587 30588 30589 30590 30591 30592 30593 30594 30595 30596 30597 30598 30599 30600 30601 30602 30603 30604 30605 30606 30607 30608 30609 30610 30611 30612 30613 30614 30615 30616 30617 30618 30619 30620 30621 30622 30623 30624 30625 30626 30627 30628 30629 30630 30631 30632 30633 30634 30635 30636 30637 30638 30639 30640 30641 30642 30643 30644 30645 30646 30647 30648 30649 30650 30651 30652 30653 30654 30655 30656 30657 30658 30659 30660 30661 30662 30663 30664 30665 30666 30667 30668 30669 30670 30671 30672 30673 30674 30675 30676 30677 30678 30679 30680 30681 30682 30683 30684 30685 30686 30687 30688 30689 30690 30691 30692 30693 30694 30695 30696 30697 30698 30699 30700 30701 30702 30703 30704 30705 30706 30707 30708 30709 30710 30711 30712 30713 30714 30715 30716 30717 30718 30719 30720 30721 30722 30723 30724 30725 30726 30727 30728 30729 30730 30731 30732 30733 30734 30735 30736 30737 30738 30739 30740 30741 30742 30743 30744 30745 30746 30747 30748 30749 30750 30751 30752 30753 30754 30755 30756 30757 30758 30759 30760 30761 30762 30763 30764 30765 30766 30767 30768 30769 30770 30771 30772 30773 30774 30775 30776 30777 30778 30779 30780 30781 30782 30783 30784 30785 30786 30787 30788 30789 30790 30791 30792 30793 30794 30795 30796 30797 30798 30799 30800 30801 30802 30803 30804 30805 30806 30807 30808 30809 30810 30811 30812 30813 30814 30815 30816 30817 30818 30819 30820 30821 30822 30823 30824 30825 30826 30827 30828 30829 30830 30831 30832 30833 30834 30835 30836 30837 30838 30839 30840 30841 30842 30843 30844 30845 30846 30847 30848 30849 30850 30851 30852 30853 30854 30855 30856 30857 30858 30859 30860 30861 30862 30863 30864 30865 30866 30867 30868 30869 30870 30871 30872 30873 30874 30875 30876 30877 30878 30879 30880 30881 30882 30883 30884 30885 30886 30887 30888 30889 30890 30891 30892 30893 30894 30895 30896 30897 30898 30899 30900 30901 30902 30903 30904 30905 30906 30907 30908 30909 30910 30911 30912 30913 30914 30915 30916 30917 30918 30919 30920 30921 30922 30923 30924 30925 30926 30927 30928 30929 30930 30931 30932 30933 30934 30935 30936 30937 30938 30939 30940 30941 30942 30943 30944 30945 30946 30947 30948 30949 30950 30951 30952 30953 30954 30955 30956 30957 30958 30959 30960 30961 30962 30963 30964 30965 30966 30967 30968 30969 30970 30971 30972 30973 30974 30975 30976 30977 30978 30979 30980 30981 30982 30983 30984 30985 30986 30987 30988 30989 30990 30991 30992 30993 30994 30995 30996 30997 30998 30999 31000 31001 31002 31003 31004 31005 31006 31007 31008 31009 31010 31011 31012 31013 31014 31015 31016 31017 31018 31019 31020 31021 31022 31023 31024 31025 31026 31027 31028 31029 31030 31031 31032 31033 31034 31035 31036 31037 31038 31039 31040 31041 31042 31043 31044 31045 31046 31047 31048 31049 31050 31051 31052 31053 31054 31055 31056 31057 31058 31059 31060 31061 31062 31063 31064 31065 31066 31067 31068 31069 31070 31071 31072 31073 31074 31075 31076 31077 31078 31079 31080 31081 31082 31083 31084 31085 31086 31087 31088 31089 31090 31091 31092 31093 31094 31095 31096 31097 31098 31099 31100 31101 31102 31103 31104 31105 31106 31107 31108 31109 31110 31111 31112 31113 31114 31115 31116 31117 31118 31119 31120 31121 31122 31123 31124 31125 31126 31127 31128 31129 31130 31131 31132 31133 31134 31135 31136 31137 31138 31139 31140 31141 31142 31143 31144 31145 31146 31147 31148 31149 31150 31151 31152 31153 31154 31155 31156 31157 31158 31159 31160 31161 31162 31163 31164 31165 31166 31167 31168 31169 31170 31171 31172 31173 31174 31175 31176 31177 31178 31179 31180 31181 31182 31183 31184 31185 31186 31187 31188 31189 31190 31191 31192 31193 31194 31195 31196 31197 31198 31199 31200 31201 31202 31203 31204 31205 31206 31207 31208 31209 31210 31211 31212 31213 31214 31215 31216 31217 31218 31219 31220 31221 31222 31223 31224 31225 31226 31227 31228 31229 31230 31231 31232 31233 31234 31235 31236 31237 31238 31239 31240 31241 31242 31243 31244 31245 31246 31247 31248 31249 31250 31251 31252 31253 31254 31255 31256 31257 31258 31259 31260 31261 31262 31263 31264 31265 31266 31267 31268 31269 31270 31271 31272 31273 31274 31275 31276 31277 31278 31279 31280 31281 31282 31283 31284 31285 31286 31287 31288 31289 31290 31291 31292 31293 31294 31295 31296 31297 31298 31299 31300 31301 31302 31303 31304 31305 31306 31307 31308 31309 31310 31311 31312 31313 31314 31315 31316 31317 31318 31319 31320 31321 31322 31323 31324 31325 31326 31327 31328 31329 31330 31331 31332 31333 31334 31335 31336 31337 31338 31339 31340 31341 31342 31343 31344 31345 31346 31347 31348 31349 31350 31351 31352 31353 31354 31355 31356 31357 31358 31359 31360 31361 31362 31363 31364 31365 31366 31367 31368 31369 31370 31371 31372 31373 31374 31375 31376 31377 31378 31379 31380 31381 31382 31383 31384 31385 31386 31387 31388 31389 31390 31391 31392 31393 31394 31395 31396 31397 31398 31399 31400 31401 31402 31403 31404 31405 31406 31407 31408 31409 31410 31411 31412 31413 31414 31415 31416 31417 31418 31419 31420 31421 31422 31423 31424 31425 31426 31427 31428 31429 31430 31431 31432 31433 31434 31435 31436 31437 31438 31439 31440 31441 31442 31443 31444 31445 31446 31447 31448 31449 31450 31451 31452 31453 31454 31455 31456 31457 31458 31459 31460 31461 31462 31463 31464 31465 31466 31467 31468 31469 31470 31471 31472 31473 31474 31475 31476 31477 31478 31479 31480 31481 31482 31483 31484 31485 31486 31487 31488 31489 31490 31491 31492 31493 31494 31495 31496 31497 31498 31499 31500 31501 31502 31503 31504 31505 31506 31507 31508 31509 31510 31511 31512 31513 31514 31515 31516 31517 31518 31519 31520 31521 31522 31523 31524 31525 31526 31527 31528 31529 31530 31531 31532 31533 31534 31535 31536 31537 31538 31539 31540 31541 31542 31543 31544 31545 31546 31547 31548 31549 31550 31551 31552 31553 31554 31555 31556 31557 31558 31559 31560 31561 31562 31563 31564 31565 31566 31567 31568 31569 31570 31571 31572 31573 31574 31575 31576 31577 31578 31579 31580 31581 31582 31583 31584 31585 31586 31587 31588 31589 31590 31591 31592 31593 31594 31595 31596 31597 31598 31599 31600 31601 31602 31603 31604 31605 31606 31607 31608 31609 31610 31611 31612 31613 31614 31615 31616 31617 31618 31619 31620 31621 31622 31623 31624 31625 31626 31627 31628 31629 31630 31631 31632 31633 31634 31635 31636 31637 31638 31639 31640 31641 31642 31643 31644 31645 31646 31647 31648 31649 31650 31651 31652 31653 31654 31655 31656 31657 31658 31659 31660 31661 31662 31663 31664 31665 31666 31667 31668 31669 31670 31671 31672 31673 31674 31675 31676 31677 31678 31679 31680 31681 31682 31683 31684 31685 31686 31687 31688 31689 31690 31691 31692 31693 31694 31695 31696 31697 31698 31699 31700 31701 31702 31703 31704 31705 31706 31707 31708 31709 31710 31711 31712 31713 31714 31715 31716 31717 31718 31719 31720 31721 31722 31723 31724 31725 31726 31727 31728 31729 31730 31731 31732 31733 31734 31735 31736 31737 31738 31739 31740 31741 31742 31743 31744 31745 31746 31747 31748 31749 31750 31751 31752 31753 31754 31755 31756 31757 31758 31759 31760 31761 31762 31763 31764 31765 31766 31767 31768 31769 31770 31771 31772 31773 31774 31775 31776 31777 31778 31779 31780 31781 31782 31783 31784 31785 31786 31787 31788 31789 31790 31791 31792 31793 31794 31795 31796 31797 31798 31799 31800 31801 31802 31803 31804 31805 31806 31807 31808 31809 31810 31811 31812 31813 31814 31815 31816 31817 31818 31819 31820 31821 31822 31823 31824 31825 31826 31827 31828 31829 31830 31831 31832 31833 31834 31835 31836 31837 31838 31839 31840 31841 31842 31843 31844 31845 31846 31847 31848 31849 31850 31851 31852 31853 31854 31855 31856 31857 31858 31859 31860 31861 31862 31863 31864 31865 31866 31867 31868 31869 31870 31871 31872 31873 31874 31875 31876 31877 31878 31879 31880 31881 31882 31883 31884 31885 31886 31887 31888 31889 31890 31891 31892 31893 31894 31895 31896 31897 31898 31899 31900 31901 31902 31903 31904 31905 31906 31907 31908 31909 31910 31911 31912 31913 31914 31915 31916 31917 31918 31919 31920 31921 31922 31923 31924 31925 31926 31927 31928 31929 31930 31931 31932 31933 31934 31935 31936 31937 31938 31939 31940 31941 31942 31943 31944 31945 31946 31947 31948 31949 31950 31951 31952 31953 31954 31955 31956 31957 31958 31959 31960 31961 31962 31963 31964 31965 31966 31967 31968 31969 31970 31971 31972 31973 31974 31975 31976 31977 31978 31979 31980 31981 31982 31983 31984 31985 31986 31987 31988 31989 31990 31991 31992 31993 31994 31995 31996 31997 31998 31999 32000 32001 32002 32003 32004 32005 32006 32007 32008 32009 32010 32011 32012 32013 32014 32015 32016 32017 32018 32019 32020 32021 32022 32023 32024 32025 32026 32027 32028 32029 32030 32031 32032 32033 32034 32035 32036 32037 32038 32039 32040 32041 32042 32043 32044 32045 32046 32047 32048 32049 32050 32051 32052 32053 32054 32055 32056 32057 32058 32059 32060 32061 32062 32063 32064 32065 32066 32067 32068 32069 32070 32071 32072 32073 32074 32075 32076 32077 32078 32079 32080 32081 32082 32083 32084 32085 32086 32087 32088 32089 32090 32091 32092 32093 32094 32095 32096 32097 32098 32099 32100 32101 32102 32103 32104 32105 32106 32107 32108 32109 32110 32111 32112 32113 32114 32115 32116 32117 32118 32119 32120 32121 32122 32123 32124 32125 32126 32127 32128 32129 32130 32131 32132 32133 32134 32135 32136 32137 32138 32139 32140 32141 32142 32143 32144 32145 32146 32147 32148 32149 32150 32151 32152 32153 32154 32155 32156 32157 32158 32159 32160 32161 32162 32163 32164 32165 32166 32167 32168 32169 32170 32171 32172 32173 32174 32175 32176 32177 32178 32179 32180 32181 32182 32183 32184 32185 32186 32187 32188 32189 32190 32191 32192 32193 32194 32195 32196 32197 32198 32199 32200 32201 32202 32203 32204 32205 32206 32207 32208 32209 32210 32211 32212 32213 32214 32215 32216 32217 32218 32219 32220 32221 32222 32223 32224 32225 32226 32227 32228 32229 32230 32231 32232 32233 32234 32235 32236 32237 32238 32239 32240 32241 32242 32243 32244 32245 32246 32247 32248 32249 32250 32251 32252 32253 32254 32255 32256 32257 32258 32259 32260 32261 32262 32263 32264 32265 32266 32267 32268 32269 32270 32271 32272 32273 32274 32275 32276 32277 32278 32279 32280 32281 32282 32283 32284 32285 32286 32287 32288 32289 32290 32291 32292 32293 32294 32295 32296 32297 32298 32299 32300 32301 32302 32303 32304 32305 32306 32307 32308 32309 32310 32311 32312 32313 32314 32315 32316 32317 32318 32319 32320 32321 32322 32323 32324 32325 32326 32327 32328 32329 32330 32331 32332 32333 32334 32335 32336 32337 32338 32339 32340 32341 32342 32343 32344 32345 32346 32347 32348 32349 32350 32351 32352 32353 32354 32355 32356 32357 32358 32359 32360 32361 32362 32363 32364 32365 32366 32367 32368 32369 32370 32371 32372 32373 32374 32375 32376 32377 32378 32379 32380 32381 32382 32383 32384 32385 32386 32387 32388 32389 32390 32391 32392 32393 32394 32395 32396 32397 32398 32399 32400 32401 32402 32403 32404 32405 32406 32407 32408 32409 32410 32411 32412 32413 32414 32415 32416 32417 32418 32419 32420 32421 32422 32423 32424 32425 32426 32427 32428 32429 32430 32431 32432 32433 32434 32435 32436 32437 32438 32439 32440 32441 32442 32443 32444 32445 32446 32447 32448 32449 32450 32451 32452 32453 32454 32455 32456 32457 32458 32459 32460 32461 32462 32463 32464 32465 32466 32467 32468 32469 32470 32471 32472 32473 32474 32475 32476 32477 32478 32479 32480 32481 32482 32483 32484 32485 32486 32487 32488 32489 32490 32491 32492 32493 32494 32495 32496 32497 32498 32499 32500 32501 32502 32503 32504 32505 32506 32507 32508 32509 32510 32511 32512 32513 32514 32515 32516 32517 32518 32519 32520 32521 32522 32523 32524 32525 32526 32527 32528 32529 32530 32531 32532 32533 32534 32535 32536 32537 32538 32539 32540 32541 32542 32543 32544 32545 32546 32547 32548 32549 32550 32551 32552 32553 32554 32555 32556 32557 32558 32559 32560 32561 32562 32563 32564 32565 32566 32567 32568 32569 32570 32571 32572 32573 32574 32575 32576 32577 32578 32579 32580 32581 32582 32583 32584 32585 32586 32587 32588 32589 32590 32591 32592 32593 32594 32595 32596 32597 32598 32599 32600 32601 32602 32603 32604 32605 32606 32607 32608 32609 32610 32611 32612 32613 32614 32615 32616 32617 32618 32619 32620 32621 32622 32623 32624 32625 32626 32627 32628 32629 32630 32631 32632 32633 32634 32635 32636 32637 32638 32639 32640 32641 32642 32643 32644 32645 32646 32647 32648 32649 32650 32651 32652 32653 32654 32655 32656 32657 32658 32659 32660 32661 32662 32663 32664 32665 32666 32667 32668 32669 32670 32671 32672 32673 32674 32675 32676 32677 32678 32679 32680 32681 32682 32683 32684 32685 32686 32687 32688 32689 32690 32691 32692 32693 32694 32695 32696 32697 32698 32699 32700 32701 32702 32703 32704 32705
This is gawk.info, produced by makeinfo version 4.13 from gawk.texi.

INFO-DIR-SECTION Text creation and manipulation
START-INFO-DIR-ENTRY
* Gawk: (gawk).                 A text scanning and processing language.
END-INFO-DIR-ENTRY
INFO-DIR-SECTION Individual utilities
START-INFO-DIR-ENTRY
* awk: (gawk)Invoking gawk.                     Text scanning and processing.
END-INFO-DIR-ENTRY

   Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000,
2001, 2002, 2003, 2004, 2005, 2007, 2009, 2010, 2011, 2012, 2013 Free
Software Foundation, Inc.


   This is Edition 4.1 of `GAWK: Effective AWK Programming: A User's
Guide for GNU Awk', for the 4.1.0 (or later) version of the GNU
implementation of AWK.

   Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.3 or
any later version published by the Free Software Foundation; with the
Invariant Sections being "GNU General Public License", the Front-Cover
texts being (a) (see below), and with the Back-Cover Texts being (b)
(see below).  A copy of the license is included in the section entitled
"GNU Free Documentation License".

  a. "A GNU Manual"

  b. "You have the freedom to copy and modify this GNU manual.  Buying
     copies from the FSF supports it in developing GNU and promoting
     software freedom."


File: gawk.info,  Node: Top,  Next: Foreword,  Up: (dir)

General Introduction
********************

This file documents `awk', a program that you can use to select
particular records in a file and perform operations upon them.

   Copyright (C) 1989, 1991, 1992, 1993, 1996, 1997, 1998, 1999, 2000,
2001, 2002, 2003, 2004, 2005, 2007, 2009, 2010, 2011, 2012, 2013 Free
Software Foundation, Inc.


   This is Edition 4.1 of `GAWK: Effective AWK Programming: A User's
Guide for GNU Awk', for the 4.1.0 (or later) version of the GNU
implementation of AWK.

   Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.3 or
any later version published by the Free Software Foundation; with the
Invariant Sections being "GNU General Public License", the Front-Cover
texts being (a) (see below), and with the Back-Cover Texts being (b)
(see below).  A copy of the license is included in the section entitled
"GNU Free Documentation License".

  a. "A GNU Manual"

  b. "You have the freedom to copy and modify this GNU manual.  Buying
     copies from the FSF supports it in developing GNU and promoting
     software freedom."

* Menu:

* Foreword::                       Some nice words about this
                                   Info file.
* Preface::                        What this Info file is about; brief
                                   history and acknowledgments.
* Getting Started::                A basic introduction to using
                                   `awk'. How to run an `awk'
                                   program. Command-line syntax.
* Invoking Gawk::                  How to run `gawk'.
* Regexp::                         All about matching things using regular
                                   expressions.
* Reading Files::                  How to read files and manipulate fields.
* Printing::                       How to print using `awk'. Describes
                                   the `print' and `printf'
                                   statements. Also describes redirection of
                                   output.
* Expressions::                    Expressions are the basic building blocks
                                   of statements.
* Patterns and Actions::           Overviews of patterns and actions.
* Arrays::                         The description and use of arrays. Also
                                   includes array-oriented control statements.
* Functions::                      Built-in and user-defined functions.
* Library Functions::              A Library of `awk' Functions.
* Sample Programs::                Many `awk' programs with complete
                                   explanations.
* Advanced Features::              Stuff for advanced users, specific to
                                   `gawk'.
* Internationalization::           Getting `gawk' to speak your
                                   language.
* Debugger::                       The `gawk' debugger.
* Arbitrary Precision Arithmetic:: Arbitrary precision arithmetic with
                                   `gawk'.
* Dynamic Extensions::             Adding new built-in functions to
                                   `gawk'.
* Language History::               The evolution of the `awk'
                                   language.
* Installation::                   Installing `gawk' under various
                                   operating systems.
* Notes::                          Notes about adding things to `gawk'
                                   and possible future work.
* Basic Concepts::                 A very quick introduction to programming
                                   concepts.
* Glossary::                       An explanation of some unfamiliar terms.
* Copying::                        Your right to copy and distribute
                                   `gawk'.
* GNU Free Documentation License:: The license for this Info file.
* Index::                          Concept and Variable Index.

* History::                             The history of `gawk' and
                                        `awk'.
* Names::                               What name to use to find
                                        `awk'.
* This Manual::                         Using this Info file. Includes
                                        sample input files that you can use.
* Conventions::                         Typographical Conventions.
* Manual History::                      Brief history of the GNU project and
                                        this Info file.
* How To Contribute::                   Helping to save the world.
* Acknowledgments::                     Acknowledgments.
* Running gawk::                        How to run `gawk' programs;
                                        includes command-line syntax.
* One-shot::                            Running a short throwaway
                                        `awk' program.
* Read Terminal::                       Using no input files (input from
                                        terminal instead).
* Long::                                Putting permanent `awk'
                                        programs in files.
* Executable Scripts::                  Making self-contained `awk'
                                        programs.
* Comments::                            Adding documentation to `gawk'
                                        programs.
* Quoting::                             More discussion of shell quoting
                                        issues.
* DOS Quoting::                         Quoting in Windows Batch Files.
* Sample Data Files::                   Sample data files for use in the
                                        `awk' programs illustrated in
                                        this Info file.
* Very Simple::                         A very simple example.
* Two Rules::                           A less simple one-line example using
                                        two rules.
* More Complex::                        A more complex example.
* Statements/Lines::                    Subdividing or combining statements
                                        into lines.
* Other Features::                      Other Features of `awk'.
* When::                                When to use `gawk' and when to
                                        use other things.
* Command Line::                        How to run `awk'.
* Options::                             Command-line options and their
                                        meanings.
* Other Arguments::                     Input file names and variable
                                        assignments.
* Naming Standard Input::               How to specify standard input with
                                        other files.
* Environment Variables::               The environment variables
                                        `gawk' uses.
* AWKPATH Variable::                    Searching directories for
                                        `awk' programs.
* AWKLIBPATH Variable::                 Searching directories for
                                        `awk' shared libraries.
* Other Environment Variables::         The environment variables.
* Exit Status::                         `gawk''s exit status.
* Include Files::                       Including other files into your
                                        program.
* Loading Shared Libraries::            Loading shared libraries into your
                                        program.
* Obsolete::                            Obsolete Options and/or features.
* Undocumented::                        Undocumented Options and Features.
* Regexp Usage::                        How to Use Regular Expressions.
* Escape Sequences::                    How to write nonprinting characters.
* Regexp Operators::                    Regular Expression Operators.
* Bracket Expressions::                 What can go between `[...]'.
* GNU Regexp Operators::                Operators specific to GNU software.
* Case-sensitivity::                    How to do case-insensitive matching.
* Leftmost Longest::                    How much text matches.
* Computed Regexps::                    Using Dynamic Regexps.
* Records::                             Controlling how data is split into
                                        records.
* Fields::                              An introduction to fields.
* Nonconstant Fields::                  Nonconstant Field Numbers.
* Changing Fields::                     Changing the Contents of a Field.
* Field Separators::                    The field separator and how to change
                                        it.
* Default Field Splitting::             How fields are normally separated.
* Regexp Field Splitting::              Using regexps as the field separator.
* Single Character Fields::             Making each character a separate
                                        field.
* Command Line Field Separator::        Setting `FS' from the
                                        command-line.
* Field Splitting Summary::             Some final points and a summary table.
* Constant Size::                       Reading constant width data.
* Splitting By Content::                Defining Fields By Content
* Multiple Line::                       Reading multiline records.
* Getline::                             Reading files under explicit program
                                        control using the `getline'
                                        function.
* Plain Getline::                       Using `getline' with no
                                        arguments.
* Getline/Variable::                    Using `getline' into a variable.
* Getline/File::                        Using `getline' from a file.
* Getline/Variable/File::               Using `getline' into a variable
                                        from a file.
* Getline/Pipe::                        Using `getline' from a pipe.
* Getline/Variable/Pipe::               Using `getline' into a variable
                                        from a pipe.
* Getline/Coprocess::                   Using `getline' from a coprocess.
* Getline/Variable/Coprocess::          Using `getline' into a variable
                                        from a coprocess.
* Getline Notes::                       Important things to know about
                                        `getline'.
* Getline Summary::                     Summary of `getline' Variants.
* Read Timeout::                        Reading input with a timeout.
* Command line directories::            What happens if you put a directory on
                                        the command line.
* Print::                               The `print' statement.
* Print Examples::                      Simple examples of `print'
                                        statements.
* Output Separators::                   The output separators and how to
                                        change them.
* OFMT::                                Controlling Numeric Output With
                                        `print'.
* Printf::                              The `printf' statement.
* Basic Printf::                        Syntax of the `printf' statement.
* Control Letters::                     Format-control letters.
* Format Modifiers::                    Format-specification modifiers.
* Printf Examples::                     Several examples.
* Redirection::                         How to redirect output to multiple
                                        files and pipes.
* Special Files::                       File name interpretation in
                                        `gawk'. `gawk' allows
                                        access to inherited file descriptors.
* Special FD::                          Special files for I/O.
* Special Network::                     Special files for network
                                        communications.
* Special Caveats::                     Things to watch out for.
* Close Files And Pipes::               Closing Input and Output Files and
                                        Pipes.
* Values::                              Constants, Variables, and Regular
                                        Expressions.
* Constants::                           String, numeric and regexp constants.
* Scalar Constants::                    Numeric and string constants.
* Nondecimal-numbers::                  What are octal and hex numbers.
* Regexp Constants::                    Regular Expression constants.
* Using Constant Regexps::              When and how to use a regexp constant.
* Variables::                           Variables give names to values for
                                        later use.
* Using Variables::                     Using variables in your programs.
* Assignment Options::                  Setting variables on the command-line
                                        and a summary of command-line syntax.
                                        This is an advanced method of input.
* Conversion::                          The conversion of strings to numbers
                                        and vice versa.
* All Operators::                       `gawk''s operators.
* Arithmetic Ops::                      Arithmetic operations (`+',
                                        `-', etc.)
* Concatenation::                       Concatenating strings.
* Assignment Ops::                      Changing the value of a variable or a
                                        field.
* Increment Ops::                       Incrementing the numeric value of a
                                        variable.
* Truth Values and Conditions::         Testing for true and false.
* Truth Values::                        What is ``true'' and what is
                                        ``false''.
* Typing and Comparison::               How variables acquire types and how
                                        this affects comparison of numbers and
                                        strings with `<', etc.
* Variable Typing::                     String type versus numeric type.
* Comparison Operators::                The comparison operators.
* POSIX String Comparison::             String comparison with POSIX rules.
* Boolean Ops::                         Combining comparison expressions using
                                        boolean operators `||' (``or''),
                                        `&&' (``and'') and `!'
                                        (``not'').
* Conditional Exp::                     Conditional expressions select between
                                        two subexpressions under control of a
                                        third subexpression.
* Function Calls::                      A function call is an expression.
* Precedence::                          How various operators nest.
* Locales::                             How the locale affects things.
* Pattern Overview::                    What goes into a pattern.
* Regexp Patterns::                     Using regexps as patterns.
* Expression Patterns::                 Any expression can be used as a
                                        pattern.
* Ranges::                              Pairs of patterns specify record
                                        ranges.
* BEGIN/END::                           Specifying initialization and cleanup
                                        rules.
* Using BEGIN/END::                     How and why to use BEGIN/END rules.
* I/O And BEGIN/END::                   I/O issues in BEGIN/END rules.
* BEGINFILE/ENDFILE::                   Two special patterns for advanced
                                        control.
* Empty::                               The empty pattern, which matches every
                                        record.
* Using Shell Variables::               How to use shell variables with
                                        `awk'.
* Action Overview::                     What goes into an action.
* Statements::                          Describes the various control
                                        statements in detail.
* If Statement::                        Conditionally execute some
                                        `awk' statements.
* While Statement::                     Loop until some condition is
                                        satisfied.
* Do Statement::                        Do specified action while looping
                                        until some condition is satisfied.
* For Statement::                       Another looping statement, that
                                        provides initialization and increment
                                        clauses.
* Switch Statement::                    Switch/case evaluation for conditional
                                        execution of statements based on a
                                        value.
* Break Statement::                     Immediately exit the innermost
                                        enclosing loop.
* Continue Statement::                  Skip to the end of the innermost
                                        enclosing loop.
* Next Statement::                      Stop processing the current input
                                        record.
* Nextfile Statement::                  Stop processing the current file.
* Exit Statement::                      Stop execution of `awk'.
* Built-in Variables::                  Summarizes the built-in variables.
* User-modified::                       Built-in variables that you change to
                                        control `awk'.
* Auto-set::                            Built-in variables where `awk'
                                        gives you information.
* ARGC and ARGV::                       Ways to use `ARGC' and
                                        `ARGV'.
* Array Basics::                        The basics of arrays.
* Array Intro::                         Introduction to Arrays
* Reference to Elements::               How to examine one element of an
                                        array.
* Assigning Elements::                  How to change an element of an array.
* Array Example::                       Basic Example of an Array
* Scanning an Array::                   A variation of the `for'
                                        statement. It loops through the
                                        indices of an array's existing
                                        elements.
* Controlling Scanning::                Controlling the order in which arrays
                                        are scanned.
* Delete::                              The `delete' statement removes an
                                        element from an array.
* Numeric Array Subscripts::            How to use numbers as subscripts in
                                        `awk'.
* Uninitialized Subscripts::            Using Uninitialized variables as
                                        subscripts.
* Multidimensional::                    Emulating multidimensional arrays in
                                        `awk'.
* Multiscanning::                       Scanning multidimensional arrays.
* Arrays of Arrays::                    True multidimensional arrays.
* Built-in::                            Summarizes the built-in functions.
* Calling Built-in::                    How to call built-in functions.
* Numeric Functions::                   Functions that work with numbers,
                                        including `int()', `sin()'
                                        and `rand()'.
* String Functions::                    Functions for string manipulation,
                                        such as `split()', `match()'
                                        and `sprintf()'.
* Gory Details::                        More than you want to know about
                                        `\' and `&' with
                                        `sub()', `gsub()', and
                                        `gensub()'.
* I/O Functions::                       Functions for files and shell
                                        commands.
* Time Functions::                      Functions for dealing with timestamps.
* Bitwise Functions::                   Functions for bitwise operations.
* Type Functions::                      Functions for type information.
* I18N Functions::                      Functions for string translation.
* User-defined::                        Describes User-defined functions in
                                        detail.
* Definition Syntax::                   How to write definitions and what they
                                        mean.
* Function Example::                    An example function definition and
                                        what it does.
* Function Caveats::                    Things to watch out for.
* Calling A Function::                  Don't use spaces.
* Variable Scope::                      Controlling variable scope.
* Pass By Value/Reference::             Passing parameters.
* Return Statement::                    Specifying the value a function
                                        returns.
* Dynamic Typing::                      How variable types can change at
                                        runtime.
* Indirect Calls::                      Choosing the function to call at
                                        runtime.
* Library Names::                       How to best name private global
                                        variables in library functions.
* General Functions::                   Functions that are of general use.
* Strtonum Function::                   A replacement for the built-in
                                        `strtonum()' function.
* Assert Function::                     A function for assertions in
                                        `awk' programs.
* Round Function::                      A function for rounding if
                                        `sprintf()' does not do it
                                        correctly.
* Cliff Random Function::               The Cliff Random Number Generator.
* Ordinal Functions::                   Functions for using characters as
                                        numbers and vice versa.
* Join Function::                       A function to join an array into a
                                        string.
* Getlocaltime Function::               A function to get formatted times.
* Readfile Function::                   A function to read an entire file at
                                        once.
* Data File Management::                Functions for managing command-line
                                        data files.
* Filetrans Function::                  A function for handling data file
                                        transitions.
* Rewind Function::                     A function for rereading the current
                                        file.
* File Checking::                       Checking that data files are readable.
* Empty Files::                         Checking for zero-length files.
* Ignoring Assigns::                    Treating assignments as file names.
* Getopt Function::                     A function for processing command-line
                                        arguments.
* Passwd Functions::                    Functions for getting user
                                        information.
* Group Functions::                     Functions for getting group
                                        information.
* Walking Arrays::                      A function to walk arrays of arrays.
* Running Examples::                    How to run these examples.
* Clones::                              Clones of common utilities.
* Cut Program::                         The `cut' utility.
* Egrep Program::                       The `egrep' utility.
* Id Program::                          The `id' utility.
* Split Program::                       The `split' utility.
* Tee Program::                         The `tee' utility.
* Uniq Program::                        The `uniq' utility.
* Wc Program::                          The `wc' utility.
* Miscellaneous Programs::              Some interesting `awk'
                                        programs.
* Dupword Program::                     Finding duplicated words in a
                                        document.
* Alarm Program::                       An alarm clock.
* Translate Program::                   A program similar to the `tr'
                                        utility.
* Labels Program::                      Printing mailing labels.
* Word Sorting::                        A program to produce a word usage
                                        count.
* History Sorting::                     Eliminating duplicate entries from a
                                        history file.
* Extract Program::                     Pulling out programs from Texinfo
                                        source files.
* Simple Sed::                          A Simple Stream Editor.
* Igawk Program::                       A wrapper for `awk' that
                                        includes files.
* Anagram Program::                     Finding anagrams from a dictionary.
* Signature Program::                   People do amazing things with too much
                                        time on their hands.
* Nondecimal Data::                     Allowing nondecimal input data.
* Array Sorting::                       Facilities for controlling array
                                        traversal and sorting arrays.
* Controlling Array Traversal::         How to use PROCINFO["sorted_in"].
* Array Sorting Functions::             How to use `asort()' and
                                        `asorti()'.
* Two-way I/O::                         Two-way communications with another
                                        process.
* TCP/IP Networking::                   Using `gawk' for network
                                        programming.
* Profiling::                           Profiling your `awk' programs.
* I18N and L10N::                       Internationalization and Localization.
* Explaining gettext::                  How GNU `gettext' works.
* Programmer i18n::                     Features for the programmer.
* Translator i18n::                     Features for the translator.
* String Extraction::                   Extracting marked strings.
* Printf Ordering::                     Rearranging `printf' arguments.
* I18N Portability::                    `awk'-level portability
                                        issues.
* I18N Example::                        A simple i18n example.
* Gawk I18N::                           `gawk' is also
                                        internationalized.
* Debugging::                           Introduction to `gawk'
                                        debugger.
* Debugging Concepts::                  Debugging in General.
* Debugging Terms::                     Additional Debugging Concepts.
* Awk Debugging::                       Awk Debugging.
* Sample Debugging Session::            Sample debugging session.
* Debugger Invocation::                 How to Start the Debugger.
* Finding The Bug::                     Finding the Bug.
* List of Debugger Commands::           Main debugger commands.
* Breakpoint Control::                  Control of Breakpoints.
* Debugger Execution Control::          Control of Execution.
* Viewing And Changing Data::           Viewing and Changing Data.
* Execution Stack::                     Dealing with the Stack.
* Debugger Info::                       Obtaining Information about the
                                        Program and the Debugger State.
* Miscellaneous Debugger Commands::     Miscellaneous Commands.
* Readline Support::                    Readline support.
* Limitations::                         Limitations and future plans.
* General Arithmetic::                  An introduction to computer
                                        arithmetic.
* Floating Point Issues::               Stuff to know about floating-point
                                        numbers.
* String Conversion Precision::         The String Value Can Lie.
* Unexpected Results::                  Floating Point Numbers Are Not
                                        Abstract Numbers.
* POSIX Floating Point Problems::       Standards Versus Existing Practice.
* Integer Programming::                 Effective integer programming.
* Floating-point Programming::          Effective Floating-point Programming.
* Floating-point Representation::       Binary floating-point representation.
* Floating-point Context::              Floating-point context.
* Rounding Mode::                       Floating-point rounding mode.
* Gawk and MPFR::                       How `gawk' provides
                                        arbitrary-precision arithmetic.
* Arbitrary Precision Floats::          Arbitrary Precision Floating-point
                                        Arithmetic with `gawk'.
* Setting Precision::                   Setting the working precision.
* Setting Rounding Mode::               Setting the rounding mode.
* Floating-point Constants::            Representing floating-point constants.
* Changing Precision::                  Changing the precision of a number.
* Exact Arithmetic::                    Exact arithmetic with floating-point
                                        numbers.
* Arbitrary Precision Integers::        Arbitrary Precision Integer Arithmetic
                                        with `gawk'.
* Extension Intro::                     What is an extension.
* Plugin License::                      A note about licensing.
* Extension Mechanism Outline::         An outline of how it works.
* Extension API Description::           A full description of the API.
* Extension API Functions Introduction:: Introduction to the API functions.
* General Data Types::                  The data types.
* Requesting Values::                   How to get a value.
* Constructor Functions::               Functions for creating values.
* Registration Functions::              Functions to register things with
                                        `gawk'.
* Extension Functions::                 Registering extension functions.
* Exit Callback Functions::             Registering an exit callback.
* Extension Version String::            Registering a version string.
* Input Parsers::                       Registering an input parser.
* Output Wrappers::                     Registering an output wrapper.
* Two-way processors::                  Registering a two-way processor.
* Printing Messages::                   Functions for printing messages.
* Updating `ERRNO'::               Functions for updating `ERRNO'.
* Accessing Parameters::                Functions for accessing parameters.
* Symbol Table Access::                 Functions for accessing global
                                        variables.
* Symbol table by name::                Accessing variables by name.
* Symbol table by cookie::              Accessing variables by ``cookie''.
* Cached values::                       Creating and using cached values.
* Array Manipulation::                  Functions for working with arrays.
* Array Data Types::                    Data types for working with arrays.
* Array Functions::                     Functions for working with arrays.
* Flattening Arrays::                   How to flatten arrays.
* Creating Arrays::                     How to create and populate arrays.
* Extension API Variables::             Variables provided by the API.
* Extension Versioning::                API Version information.
* Extension API Informational Variables:: Variables providing information about
                                        `gawk''s invocation.
* Extension API Boilerplate::           Boilerplate code for using the API.
* Finding Extensions::                  How `gawk' finds compiled
                                        extensions.
* Extension Example::                   Example C code for an extension.
* Internal File Description::           What the new functions will do.
* Internal File Ops::                   The code for internal file operations.
* Using Internal File Ops::             How to use an external extension.
* Extension Samples::                   The sample extensions that ship with
                                        `gawk'.
* Extension Sample File Functions::     The file functions sample.
* Extension Sample Fnmatch::            An interface to `fnmatch()'.
* Extension Sample Fork::               An interface to `fork()' and
                                        other process functions.
* Extension Sample Inplace::            Enabling in-place file editing.
* Extension Sample Ord::                Character to value to character
                                        conversions.
* Extension Sample Readdir::            An interface to `readdir()'.
* Extension Sample Revout::             Reversing output sample output
                                        wrapper.
* Extension Sample Rev2way::            Reversing data sample two-way
                                        processor.
* Extension Sample Read write array::   Serializing an array to a file.
* Extension Sample Readfile::           Reading an entire file into a string.
* Extension Sample API Tests::          Tests for the API.
* Extension Sample Time::               An interface to `gettimeofday()'
                                        and `sleep()'.
* gawkextlib::                          The `gawkextlib' project.
* V7/SVR3.1::                           The major changes between V7 and
                                        System V Release 3.1.
* SVR4::                                Minor changes between System V
                                        Releases 3.1 and 4.
* POSIX::                               New features from the POSIX standard.
* BTL::                                 New features from Brian Kernighan's
                                        version of `awk'.
* POSIX/GNU::                           The extensions in `gawk' not
                                        in POSIX `awk'.
* Common Extensions::                   Common Extensions Summary.
* Ranges and Locales::                  How locales used to affect regexp
                                        ranges.
* Contributors::                        The major contributors to
                                        `gawk'.
* Gawk Distribution::                   What is in the `gawk'
                                        distribution.
* Getting::                             How to get the distribution.
* Extracting::                          How to extract the distribution.
* Distribution contents::               What is in the distribution.
* Unix Installation::                   Installing `gawk' under
                                        various versions of Unix.
* Quick Installation::                  Compiling `gawk' under Unix.
* Additional Configuration Options::    Other compile-time options.
* Configuration Philosophy::            How it's all supposed to work.
* Non-Unix Installation::               Installation on Other Operating
                                        Systems.
* PC Installation::                     Installing and Compiling
                                        `gawk' on MS-DOS and OS/2.
* PC Binary Installation::              Installing a prepared distribution.
* PC Compiling::                        Compiling `gawk' for MS-DOS,
                                        Windows32, and OS/2.
* PC Testing::                          Testing `gawk' on PC systems.
* PC Using::                            Running `gawk' on MS-DOS,
                                        Windows32 and OS/2.
* Cygwin::                              Building and running `gawk'
                                        for Cygwin.
* MSYS::                                Using `gawk' In The MSYS
                                        Environment.
* VMS Installation::                    Installing `gawk' on VMS.
* VMS Compilation::                     How to compile `gawk' under
                                        VMS.
* VMS Installation Details::            How to install `gawk' under
                                        VMS.
* VMS Running::                         How to run `gawk' under VMS.
* VMS Old Gawk::                        An old version comes with some VMS
                                        systems.
* Bugs::                                Reporting Problems and Bugs.
* Other Versions::                      Other freely available `awk'
                                        implementations.
* Compatibility Mode::                  How to disable certain `gawk'
                                        extensions.
* Additions::                           Making Additions To `gawk'.
* Accessing The Source::                Accessing the Git repository.
* Adding Code::                         Adding code to the main body of
                                        `gawk'.
* New Ports::                           Porting `gawk' to a new
                                        operating system.
* Derived Files::                       Why derived files are kept in the
                                        `git' repository.
* Future Extensions::                   New features that may be implemented
                                        one day.
* Implementation Limitations::          Some limitations of the
                                        implementation.
* Extension Design::                    Design notes about the extension API.
* Old Extension Problems::              Problems with the old mechanism.
* Extension New Mechanism Goals::       Goals for the new mechanism.
* Extension Other Design Decisions::    Some other design decisions.
* Extension Future Growth::             Some room for future growth.
* Old Extension Mechanism::             Some compatibility for old extensions.
* Basic High Level::                    The high level view.
* Basic Data Typing::                   A very quick intro to data types.

                  To Miriam, for making me complete.

                  To Chana, for the joy you bring us.

                To Rivka, for the exponential increase.

                  To Nachum, for the added dimension.

                   To Malka, for the new beginning.

File: gawk.info,  Node: Foreword,  Next: Preface,  Prev: Top,  Up: Top

Foreword
********

Arnold Robbins and I are good friends. We were introduced in 1990 by
circumstances--and our favorite programming language, AWK.  The
circumstances started a couple of years earlier. I was working at a new
job and noticed an unplugged Unix computer sitting in the corner.  No
one knew how to use it, and neither did I.  However, a couple of days
later it was running, and I was `root' and the one-and-only user.  That
day, I began the transition from statistician to Unix programmer.

   On one of many trips to the library or bookstore in search of books
on Unix, I found the gray AWK book, a.k.a. Aho, Kernighan and
Weinberger, `The AWK Programming Language', Addison-Wesley, 1988.
AWK's simple programming paradigm--find a pattern in the input and then
perform an action--often reduced complex or tedious data manipulations
to few lines of code.  I was excited to try my hand at programming in
AWK.

   Alas,  the `awk' on my computer was a limited version of the
language described in the AWK book.  I discovered that my computer had
"old `awk'" and the AWK book described "new `awk'."  I learned that
this was typical; the old version refused to step aside or relinquish
its name.  If a system had a new `awk', it was invariably called
`nawk', and few systems had it.  The best way to get a new `awk' was to
`ftp' the source code for `gawk' from `prep.ai.mit.edu'.  `gawk' was a
version of new `awk' written by David Trueman and Arnold, and available
under the GNU General Public License.

   (Incidentally, it's no longer difficult to find a new `awk'. `gawk'
ships with GNU/Linux, and you can download binaries or source code for
almost any system; my wife uses `gawk' on her VMS box.)

   My Unix system started out unplugged from the wall; it certainly was
not plugged into a network.  So, oblivious to the existence of `gawk'
and the Unix community in general, and desiring a new `awk', I wrote my
own, called `mawk'.  Before I was finished I knew about `gawk', but it
was too late to stop, so I eventually posted to a `comp.sources'
newsgroup.

   A few days after my posting, I got a friendly email from Arnold
introducing himself.   He suggested we share design and algorithms and
attached a draft of the POSIX standard so that I could update `mawk' to
support language extensions added after publication of the AWK book.

   Frankly, if our roles had been reversed, I would not have been so
open and we probably would have never met.  I'm glad we did meet.  He
is an AWK expert's AWK expert and a genuinely nice person.  Arnold
contributes significant amounts of his expertise and time to the Free
Software Foundation.

   This book is the `gawk' reference manual, but at its core it is a
book about AWK programming that will appeal to a wide audience.  It is
a definitive reference to the AWK language as defined by the 1987 Bell
Laboratories release and codified in the 1992 POSIX Utilities standard.

   On the other hand, the novice AWK programmer can study a wealth of
practical programs that emphasize the power of AWK's basic idioms: data
driven control-flow, pattern matching with regular expressions, and
associative arrays.  Those looking for something new can try out
`gawk''s interface to network protocols via special `/inet' files.

   The programs in this book make clear that an AWK program is
typically much smaller and faster to develop than a counterpart written
in C.  Consequently, there is often a payoff to prototype an algorithm
or design in AWK to get it running quickly and expose problems early.
Often, the interpreted performance is adequate and the AWK prototype
becomes the product.

   The new `pgawk' (profiling `gawk'), produces program execution
counts.  I recently experimented with an algorithm that for n lines of
input, exhibited ~ C n^2 performance, while theory predicted ~ C n log n
behavior. A few minutes poring over the `awkprof.out' profile
pinpointed the problem to a single line of code.  `pgawk' is a welcome
addition to my programmer's toolbox.

   Arnold has distilled over a decade of experience writing and using
AWK programs, and developing `gawk', into this book.  If you use AWK or
want to learn how, then read this book.

     Michael Brennan
     Author of `mawk'
     March, 2001


File: gawk.info,  Node: Preface,  Next: Getting Started,  Prev: Foreword,  Up: Top

Preface
*******

Several kinds of tasks occur repeatedly when working with text files.
You might want to extract certain lines and discard the rest.  Or you
may need to make changes wherever certain patterns appear, but leave
the rest of the file alone.  Writing single-use programs for these
tasks in languages such as C, C++, or Java is time-consuming and
inconvenient.  Such jobs are often easier with `awk'.  The `awk'
utility interprets a special-purpose programming language that makes it
easy to handle simple data-reformatting jobs.

   The GNU implementation of `awk' is called `gawk'; if you invoke it
with the proper options or environment variables (*note Options::), it
is fully compatible with the POSIX(1) specification of the `awk'
language and with the Unix version of `awk' maintained by Brian
Kernighan.  This means that all properly written `awk' programs should
work with `gawk'.  Thus, we usually don't distinguish between `gawk'
and other `awk' implementations.

   Using `awk' allows you to:

   * Manage small, personal databases

   * Generate reports

   * Validate data

   * Produce indexes and perform other document preparation tasks

   * Experiment with algorithms that you can adapt later to other
     computer languages

   In addition, `gawk' provides facilities that make it easy to:

   * Extract bits and pieces of data for processing

   * Sort data

   * Perform simple network communications

   This Info file teaches you about the `awk' language and how you can
use it effectively.  You should already be familiar with basic system
commands, such as `cat' and `ls',(2) as well as basic shell facilities,
such as input/output (I/O) redirection and pipes.

   Implementations of the `awk' language are available for many
different computing environments.  This Info file, while describing the
`awk' language in general, also describes the particular implementation
of `awk' called `gawk' (which stands for "GNU awk").  `gawk' runs on a
broad range of Unix systems, ranging from Intel(R)-architecture
PC-based computers up through large-scale systems, such as Crays.
`gawk' has also been ported to Mac OS X, Microsoft Windows (all
versions) and OS/2 PCs, and VMS.  (Some other, obsolete systems to
which `gawk' was once ported are no longer supported and the code for
those systems has been removed.)

* Menu:

* History::                     The history of `gawk' and
                                `awk'.
* Names::                       What name to use to find `awk'.
* This Manual::                 Using this Info file. Includes sample
                                input files that you can use.
* Conventions::                 Typographical Conventions.
* Manual History::              Brief history of the GNU project and this
                                Info file.
* How To Contribute::           Helping to save the world.
* Acknowledgments::             Acknowledgments.

   ---------- Footnotes ----------

   (1) The 2008 POSIX standard is online at
`http://www.opengroup.org/onlinepubs/9699919799/'.

   (2) These commands are available on POSIX-compliant systems, as well
as on traditional Unix-based systems. If you are using some other
operating system, you still need to be familiar with the ideas of I/O
redirection and pipes.


File: gawk.info,  Node: History,  Next: Names,  Up: Preface

History of `awk' and `gawk'
===========================

                   Recipe For A Programming Language

          1 part  `egrep'   1 part  `snobol'
          2 parts `ed'      3 parts C

   Blend all parts well using `lex' and `yacc'.  Document minimally and
release.

   After eight years, add another part `egrep' and two more parts C.
Document very well and release.

The name `awk' comes from the initials of its designers: Alfred V.
Aho, Peter J. Weinberger and Brian W. Kernighan.  The original version
of `awk' was written in 1977 at AT&T Bell Laboratories.  In 1985, a new
version made the programming language more powerful, introducing
user-defined functions, multiple input streams, and computed regular
expressions.  This new version became widely available with Unix System
V Release 3.1 (1987).  The version in System V Release 4 (1989) added
some new features and cleaned up the behavior in some of the "dark
corners" of the language.  The specification for `awk' in the POSIX
Command Language and Utilities standard further clarified the language.
Both the `gawk' designers and the original Bell Laboratories `awk'
designers provided feedback for the POSIX specification.

   Paul Rubin wrote the GNU implementation, `gawk', in 1986.  Jay
Fenlason completed it, with advice from Richard Stallman.  John Woods
contributed parts of the code as well.  In 1988 and 1989, David
Trueman, with help from me, thoroughly reworked `gawk' for compatibility
with the newer `awk'.  Circa 1994, I became the primary maintainer.
Current development focuses on bug fixes, performance improvements,
standards compliance, and occasionally, new features.

   In May of 1997, Ju"rgen Kahrs felt the need for network access from
`awk', and with a little help from me, set about adding features to do
this for `gawk'.  At that time, he also wrote the bulk of `TCP/IP
Internetworking with `gawk'' (a separate document, available as part of
the `gawk' distribution).  His code finally became part of the main
`gawk' distribution with `gawk' version 3.1.

   John Haque rewrote the `gawk' internals, in the process providing an
`awk'-level debugger. This version became available as `gawk' version
4.0, in 2011.

   *Note Contributors::, for a complete list of those who made
important contributions to `gawk'.


File: gawk.info,  Node: Names,  Next: This Manual,  Prev: History,  Up: Preface

A Rose by Any Other Name
========================

The `awk' language has evolved over the years. Full details are
provided in *note Language History::.  The language described in this
Info file is often referred to as "new `awk'" (`nawk').

   Because of this, there are systems with multiple versions of `awk'.
Some systems have an `awk' utility that implements the original version
of the `awk' language and a `nawk' utility for the new version.  Others
have an `oawk' version for the "old `awk'" language and plain `awk' for
the new one.  Still others only have one version, which is usually the
new one.(1)

   All in all, this makes it difficult for you to know which version of
`awk' you should run when writing your programs.  The best advice we
can give here is to check your local documentation. Look for `awk',
`oawk', and `nawk', as well as for `gawk'.  It is likely that you
already have some version of new `awk' on your system, which is what
you should use when running your programs.  (Of course, if you're
reading this Info file, chances are good that you have `gawk'!)

   Throughout this Info file, whenever we refer to a language feature
that should be available in any complete implementation of POSIX `awk',
we simply use the term `awk'.  When referring to a feature that is
specific to the GNU implementation, we use the term `gawk'.

   ---------- Footnotes ----------

   (1) Often, these systems use `gawk' for their `awk' implementation!


File: gawk.info,  Node: This Manual,  Next: Conventions,  Prev: Names,  Up: Preface

Using This Book
===============

The term `awk' refers to a particular program as well as to the
language you use to tell this program what to do.  When we need to be
careful, we call the language "the `awk' language," and the program
"the `awk' utility."  This Info file explains both how to write
programs in the `awk' language and how to run the `awk' utility.  The
term "`awk' program" refers to a program written by you in the `awk'
programming language.

   Primarily, this Info file explains the features of `awk' as defined
in the POSIX standard.  It does so in the context of the `gawk'
implementation.  While doing so, it also attempts to describe important
differences between `gawk' and other `awk' implementations.(1) Finally,
any `gawk' features that are not in the POSIX standard for `awk' are
noted.

   There are sidebars scattered throughout the Info file.  They add a
more complete explanation of points that are relevant, but not likely
to be of interest on first reading.  All appear in the index, under the
heading "sidebar."

   Most of the time, the examples use complete `awk' programs.  Some of
the more advanced sections show only the part of the `awk' program that
illustrates the concept currently being described.

   While this Info file is aimed principally at people who have not been
exposed to `awk', there is a lot of information here that even the `awk'
expert should find useful.  In particular, the description of POSIX
`awk' and the example programs in *note Library Functions::, and in
*note Sample Programs::, should be of interest.

   This Info file is split into several parts, as follows:

   Part I describes the `awk' language and `gawk' program in detail.
It starts with the basics, and continues through all of the features of
`awk'.  It contains the following chapters:

   *note Getting Started::, provides the essentials you need to know to
begin using `awk'.

   *note Invoking Gawk::, describes how to run `gawk', the meaning of
its command-line options, and how it finds `awk' program source files.

   *note Regexp::, introduces regular expressions in general, and in
particular the flavors supported by POSIX `awk' and `gawk'.

   *note Reading Files::, describes how `awk' reads your data.  It
introduces the concepts of records and fields, as well as the `getline'
command.  I/O redirection is first described here.  Network I/O is also
briefly introduced here.

   *note Printing::, describes how `awk' programs can produce output
with `print' and `printf'.

   *note Expressions::, describes expressions, which are the basic
building blocks for getting most things done in a program.

   *note Patterns and Actions::, describes how to write patterns for
matching records, actions for doing something when a record is matched,
and the built-in variables `awk' and `gawk' use.

   *note Arrays::, covers `awk''s one-and-only data structure:
associative arrays.  Deleting array elements and whole arrays is also
described, as well as sorting arrays in `gawk'.  It also describes how
`gawk' provides arrays of arrays.

   *note Functions::, describes the built-in functions `awk' and `gawk'
provide, as well as how to define your own functions.

   Part II shows how to use `awk' and `gawk' for problem solving.
There is lots of code here for you to read and learn from.  It contains
the following chapters:

   *note Library Functions::, which provides a number of functions
meant to be used from main `awk' programs.

   *note Sample Programs::, which provides many sample `awk' programs.

   Reading these two chapters allows you to see `awk' solving real
problems.

   Part III focuses on features specific to `gawk'.  It contains the
following chapters:

   *note Advanced Features::, describes a number of `gawk'-specific
advanced features.  Of particular note are the abilities to have
two-way communications with another process, perform TCP/IP networking,
and profile your `awk' programs.

   *note Internationalization::, describes special features in `gawk'
for translating program messages into different languages at runtime.

   *note Debugger::, describes the `awk' debugger.

   *note Arbitrary Precision Arithmetic::, describes advanced
arithmetic facilities provided by `gawk'.

   *note Dynamic Extensions::, describes how to add new variables and
functions to `gawk' by writing extensions in C or C++.

   Part IV provides the appendices, the Glossary, and two licenses that
cover the `gawk' source code and this Info file, respectively.  It
contains the following appendices:

   *note Language History::, describes how the `awk' language has
evolved since its first release to present.  It also describes how
`gawk' has acquired features over time.

   *note Installation::, describes how to get `gawk', how to compile it
on POSIX-compatible systems, and how to compile and use it on different
non-POSIX systems.  It also describes how to report bugs in `gawk' and
where to get other freely available `awk' implementations.

   *note Notes::, describes how to disable `gawk''s extensions, as well
as how to contribute new code to `gawk', and some possible future
directions for `gawk' development.

   *note Basic Concepts::, provides some very cursory background
material for those who are completely unfamiliar with computer
programming.

   The *note Glossary::, defines most, if not all, the significant
terms used throughout the book.  If you find terms that you aren't
familiar with, try looking them up here.

   *note Copying::, and *note GNU Free Documentation License::, present
the licenses that cover the `gawk' source code and this Info file,
respectively.

   ---------- Footnotes ----------

   (1) All such differences appear in the index under the entry
"differences in `awk' and `gawk'."


File: gawk.info,  Node: Conventions,  Next: Manual History,  Prev: This Manual,  Up: Preface

Typographical Conventions
=========================

This Info file is written in Texinfo
(http://www.gnu.org/software/texinfo/), the GNU documentation
formatting language.  A single Texinfo source file is used to produce
both the printed and online versions of the documentation.  This minor
node briefly documents the typographical conventions used in Texinfo.

   Examples you would type at the command-line are preceded by the
common shell primary and secondary prompts, `$' and `>'.  Input that
you type is shown `like this'.  Output from the command is preceded by
the glyph "-|".  This typically represents the command's standard
output.  Error messages, and other output on the command's standard
error, are preceded by the glyph "error-->".  For example:

     $ echo hi on stdout
     -| hi on stdout
     $ echo hello on stderr 1>&2
     error--> hello on stderr

   Characters that you type at the keyboard look `like this'.  In
particular, there are special characters called "control characters."
These are characters that you type by holding down both the `CONTROL'
key and another key, at the same time.  For example, a `Ctrl-d' is typed
by first pressing and holding the `CONTROL' key, next pressing the `d'
key and finally releasing both keys.

Dark Corners
------------

     Dark corners are basically fractal -- no matter how much you
     illuminate, there's always a smaller but darker one.  -- Brian
     Kernighan

   Until the POSIX standard (and `GAWK: Effective AWK Programming'),
many features of `awk' were either poorly documented or not documented
at all.  Descriptions of such features (often called "dark corners")
are noted in this Info file with "(d.c.)".  They also appear in the
index under the heading "dark corner."

   As noted by the opening quote, though, any coverage of dark corners
is, by definition, incomplete.

   Extensions to the standard `awk' language that are supported by more
than one `awk' implementation are marked "(c.e.)," and listed in the
index under "common extensions" and "extensions, common."


File: gawk.info,  Node: Manual History,  Next: How To Contribute,  Prev: Conventions,  Up: Preface

The GNU Project and This Book
=============================

The Free Software Foundation (FSF) is a nonprofit organization dedicated
to the production and distribution of freely distributable software.
It was founded by Richard M. Stallman, the author of the original Emacs
editor.  GNU Emacs is the most widely used version of Emacs today.

   The GNU(1) Project is an ongoing effort on the part of the Free
Software Foundation to create a complete, freely distributable,
POSIX-compliant computing environment.  The FSF uses the "GNU General
Public License" (GPL) to ensure that their software's source code is
always available to the end user. A copy of the GPL is included for
your reference (*note Copying::).  The GPL applies to the C language
source code for `gawk'.  To find out more about the FSF and the GNU
Project online, see the GNU Project's home page (http://www.gnu.org).
This Info file may also be read from their web site
(http://www.gnu.org/software/gawk/manual/).

   A shell, an editor (Emacs), highly portable optimizing C, C++, and
Objective-C compilers, a symbolic debugger and dozens of large and
small utilities (such as `gawk'), have all been completed and are
freely available.  The GNU operating system kernel (the HURD), has been
released but remains in an early stage of development.

   Until the GNU operating system is more fully developed, you should
consider using GNU/Linux, a freely distributable, Unix-like operating
system for Intel(R), Power Architecture, Sun SPARC, IBM S/390, and other
systems.(2) Many GNU/Linux distributions are available for download
from the Internet.

   (There are numerous other freely available, Unix-like operating
systems based on the Berkeley Software Distribution, and some of them
use recent versions of `gawk' for their versions of `awk'.  NetBSD
(http://www.netbsd.org), FreeBSD (http://www.freebsd.org), and OpenBSD
(http://www.openbsd.org) are three of the most popular ones, but there
are others.)

   The Info file itself has gone through a number of previous editions.
Paul Rubin wrote the very first draft of `The GAWK Manual'; it was
around 40 pages in size.  Diane Close and Richard Stallman improved it,
yielding a version that was around 90 pages long and barely described
the original, "old" version of `awk'.

   I started working with that version in the fall of 1988.  As work on
it progressed, the FSF published several preliminary versions (numbered
0.X).  In 1996, Edition 1.0 was released with `gawk' 3.0.0.  The FSF
published the first two editions under the title `The GNU Awk User's
Guide'.

   This edition maintains the basic structure of the previous editions.
For Edition 4.0, the content has been thoroughly reviewed and updated.
All references to `gawk' versions prior to 4.0 have been removed.  Of
significant note for this edition was *note Debugger::.

   For edition 4.1, the content has been reorganized into parts, and
the major new additions are *note Arbitrary Precision Arithmetic::, and
*note Dynamic Extensions::.

   `GAWK: Effective AWK Programming' will undoubtedly continue to
evolve.  An electronic version comes with the `gawk' distribution from
the FSF.  If you find an error in this Info file, please report it!
*Note Bugs::, for information on submitting problem reports
electronically.

   ---------- Footnotes ----------

   (1) GNU stands for "GNU's not Unix."

   (2) The terminology "GNU/Linux" is explained in the *note Glossary::.


File: gawk.info,  Node: How To Contribute,  Next: Acknowledgments,  Prev: Manual History,  Up: Preface

How to Contribute
=================

As the maintainer of GNU `awk', I once thought that I would be able to
manage a collection of publicly available `awk' programs and I even
solicited contributions.  Making things available on the Internet helps
keep the `gawk' distribution down to manageable size.

   The initial collection of material, such as it is, is still available
at `ftp://ftp.freefriends.org/arnold/Awkstuff'.  In the hopes of doing
something more broad, I acquired the `awk.info' domain.

   However, I found that I could not dedicate enough time to managing
contributed code: the archive did not grow and the domain went unused
for several years.

   Fortunately, late in 2008, a volunteer took on the task of setting up
an `awk'-related web site--`http://awk.info'--and did a very nice job.

   If you have written an interesting `awk' program, or have written a
`gawk' extension that you would like to share with the rest of the
world, please see `http://awk.info/?contribute' for how to contribute
it to the web site.


File: gawk.info,  Node: Acknowledgments,  Prev: How To Contribute,  Up: Preface

Acknowledgments
===============

The initial draft of `The GAWK Manual' had the following
acknowledgments:

     Many people need to be thanked for their assistance in producing
     this manual.  Jay Fenlason contributed many ideas and sample
     programs.  Richard Mlynarik and Robert Chassell gave helpful
     comments on drafts of this manual.  The paper `A Supplemental
     Document for `awk'' by John W.  Pierce of the Chemistry Department
     at UC San Diego, pinpointed several issues relevant both to `awk'
     implementation and to this manual, that would otherwise have
     escaped us.

   I would like to acknowledge Richard M. Stallman, for his vision of a
better world and for his courage in founding the FSF and starting the
GNU Project.

   Earlier editions of this Info file had the following
acknowledgements:

     The following people (in alphabetical order) provided helpful
     comments on various versions of this book, Rick Adams, Dr. Nelson
     H.F. Beebe, Karl Berry, Dr. Michael Brennan, Rich Burridge, Claire
     Cloutier, Diane Close, Scott Deifik, Christopher ("Topher") Eliot,
     Jeffrey Friedl, Dr. Darrel Hankerson, Michal Jaegermann, Dr.
     Richard J. LeBlanc, Michael Lijewski, Pat Rankin, Miriam Robbins,
     Mary Sheehan, and Chuck Toporek.

     Robert J. Chassell provided much valuable advice on the use of
     Texinfo.  He also deserves special thanks for convincing me _not_
     to title this Info file `How To Gawk Politely'.  Karl Berry helped
     significantly with the TeX part of Texinfo.

     I would like to thank Marshall and Elaine Hartholz of Seattle and
     Dr. Bert and Rita Schreiber of Detroit for large amounts of quiet
     vacation time in their homes, which allowed me to make significant
     progress on this Info file and on `gawk' itself.

     Phil Hughes of SSC contributed in a very important way by loaning
     me his laptop GNU/Linux system, not once, but twice, which allowed
     me to do a lot of work while away from home.

     David Trueman deserves special credit; he has done a yeoman job of
     evolving `gawk' so that it performs well and without bugs.
     Although he is no longer involved with `gawk', working with him on
     this project was a significant pleasure.

     The intrepid members of the GNITS mailing list, and most notably
     Ulrich Drepper, provided invaluable help and feedback for the
     design of the internationalization features.

     Chuck Toporek, Mary Sheehan, and Claire Cloutier of O'Reilly &
     Associates contributed significant editorial help for this Info
     file for the 3.1 release of `gawk'.

   Dr. Nelson Beebe, Andreas Buening, Dr. Manuel Collado, Antonio
Colombo, Stephen Davies, Scott Deifik, Akim Demaille, Darrel Hankerson,
Michal Jaegermann, Ju"rgen Kahrs, Stepan Kasal, John Malmberg, Dave
Pitts, Chet Ramey, Pat Rankin, Andrew Schorr, Corinna Vinschen, Anders
Wallin, and Eli Zaretskii (in alphabetical order) make up the current
`gawk' "crack portability team."  Without their hard work and help,
`gawk' would not be nearly the fine program it is today.  It has been
and continues to be a pleasure working with this team of fine people.

   Notable code and documentation contributions were made by a number
of people. *Note Contributors::, for the full list.

   I would like to thank Brian Kernighan for invaluable assistance
during the testing and debugging of `gawk', and for ongoing help and
advice in clarifying numerous points about the language.  We could not
have done nearly as good a job on either `gawk' or its documentation
without his help.

   I must thank my wonderful wife, Miriam, for her patience through the
many versions of this project, for her proofreading, and for sharing me
with the computer.  I would like to thank my parents for their love,
and for the grace with which they raised and educated me.  Finally, I
also must acknowledge my gratitude to G-d, for the many opportunities
He has sent my way, as well as for the gifts He has given me with which
to take advantage of those opportunities.


Arnold Robbins
Nof Ayalon
ISRAEL
May, 2013


File: gawk.info,  Node: Getting Started,  Next: Invoking Gawk,  Prev: Preface,  Up: Top

1 Getting Started with `awk'
****************************

The basic function of `awk' is to search files for lines (or other
units of text) that contain certain patterns.  When a line matches one
of the patterns, `awk' performs specified actions on that line.  `awk'
keeps processing input lines in this way until it reaches the end of
the input files.

   Programs in `awk' are different from programs in most other
languages, because `awk' programs are "data-driven"; that is, you
describe the data you want to work with and then what to do when you
find it.  Most other languages are "procedural"; you have to describe,
in great detail, every step the program is to take.  When working with
procedural languages, it is usually much harder to clearly describe the
data your program will process.  For this reason, `awk' programs are
often refreshingly easy to read and write.

   When you run `awk', you specify an `awk' "program" that tells `awk'
what to do.  The program consists of a series of "rules".  (It may also
contain "function definitions", an advanced feature that we will ignore
for now.  *Note User-defined::.)  Each rule specifies one pattern to
search for and one action to perform upon finding the pattern.

   Syntactically, a rule consists of a pattern followed by an action.
The action is enclosed in curly braces to separate it from the pattern.
Newlines usually separate rules.  Therefore, an `awk' program looks
like this:

     PATTERN { ACTION }
     PATTERN { ACTION }
     ...

* Menu:

* Running gawk::                How to run `gawk' programs; includes
                                command-line syntax.
* Sample Data Files::           Sample data files for use in the `awk'
                                programs illustrated in this Info file.
* Very Simple::                 A very simple example.
* Two Rules::                   A less simple one-line example using two
                                rules.
* More Complex::                A more complex example.
* Statements/Lines::            Subdividing or combining statements into
                                lines.
* Other Features::              Other Features of `awk'.
* When::                        When to use `gawk' and when to use
                                other things.


File: gawk.info,  Node: Running gawk,  Next: Sample Data Files,  Up: Getting Started

1.1 How to Run `awk' Programs
=============================

There are several ways to run an `awk' program.  If the program is
short, it is easiest to include it in the command that runs `awk', like
this:

     awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ...

   When the program is long, it is usually more convenient to put it in
a file and run it with a command like this:

     awk -f PROGRAM-FILE INPUT-FILE1 INPUT-FILE2 ...

   This minor node discusses both mechanisms, along with several
variations of each.

* Menu:

* One-shot::                    Running a short throwaway `awk'
                                program.
* Read Terminal::               Using no input files (input from terminal
                                instead).
* Long::                        Putting permanent `awk' programs in
                                files.
* Executable Scripts::          Making self-contained `awk' programs.
* Comments::                    Adding documentation to `gawk'
                                programs.
* Quoting::                     More discussion of shell quoting issues.


File: gawk.info,  Node: One-shot,  Next: Read Terminal,  Up: Running gawk

1.1.1 One-Shot Throwaway `awk' Programs
---------------------------------------

Once you are familiar with `awk', you will often type in simple
programs the moment you want to use them.  Then you can write the
program as the first argument of the `awk' command, like this:

     awk 'PROGRAM' INPUT-FILE1 INPUT-FILE2 ...

where PROGRAM consists of a series of PATTERNS and ACTIONS, as
described earlier.

   This command format instructs the "shell", or command interpreter,
to start `awk' and use the PROGRAM to process records in the input
file(s).  There are single quotes around PROGRAM so the shell won't
interpret any `awk' characters as special shell characters.  The quotes
also cause the shell to treat all of PROGRAM as a single argument for
`awk', and allow PROGRAM to be more than one line long.

   This format is also useful for running short or medium-sized `awk'
programs from shell scripts, because it avoids the need for a separate
file for the `awk' program.  A self-contained shell script is more
reliable because there are no other files to misplace.

   *note Very Simple::, presents several short, self-contained programs.


File: gawk.info,  Node: Read Terminal,  Next: Long,  Prev: One-shot,  Up: Running gawk

1.1.2 Running `awk' Without Input Files
---------------------------------------

You can also run `awk' without any input files.  If you type the
following command line:

     awk 'PROGRAM'

`awk' applies the PROGRAM to the "standard input", which usually means
whatever you type on the terminal.  This continues until you indicate
end-of-file by typing `Ctrl-d'.  (On other operating systems, the
end-of-file character may be different.  For example, on OS/2, it is
`Ctrl-z'.)

   As an example, the following program prints a friendly piece of
advice (from Douglas Adams's `The Hitchhiker's Guide to the Galaxy'),
to keep you from worrying about the complexities of computer
programming(1) (`BEGIN' is a feature we haven't discussed yet):

     $ awk "BEGIN { print \"Don't Panic!\" }"
     -| Don't Panic!

   This program does not read any input.  The `\' before each of the
inner double quotes is necessary because of the shell's quoting
rules--in particular because it mixes both single quotes and double
quotes.(2)

   This next simple `awk' program emulates the `cat' utility; it copies
whatever you type on the keyboard to its standard output (why this
works is explained shortly).

     $ awk '{ print }'
     Now is the time for all good men
     -| Now is the time for all good men
     to come to the aid of their country.
     -| to come to the aid of their country.
     Four score and seven years ago, ...
     -| Four score and seven years ago, ...
     What, me worry?
     -| What, me worry?
     Ctrl-d

   ---------- Footnotes ----------

   (1) If you use Bash as your shell, you should execute the command
`set +H' before running this program interactively, to disable the C
shell-style command history, which treats `!' as a special character.
We recommend putting this command into your personal startup file.

   (2) Although we generally recommend the use of single quotes around
the program text, double quotes are needed here in order to put the
single quote into the message.


File: gawk.info,  Node: Long,  Next: Executable Scripts,  Prev: Read Terminal,  Up: Running gawk

1.1.3 Running Long Programs
---------------------------

Sometimes your `awk' programs can be very long.  In this case, it is
more convenient to put the program into a separate file.  In order to
tell `awk' to use that file for its program, you type:

     awk -f SOURCE-FILE INPUT-FILE1 INPUT-FILE2 ...

   The `-f' instructs the `awk' utility to get the `awk' program from
the file SOURCE-FILE.  Any file name can be used for SOURCE-FILE.  For
example, you could put the program:

     BEGIN { print "Don't Panic!" }

into the file `advice'.  Then this command:

     awk -f advice

does the same thing as this one:

     awk "BEGIN { print \"Don't Panic!\" }"

This was explained earlier (*note Read Terminal::).  Note that you
don't usually need single quotes around the file name that you specify
with `-f', because most file names don't contain any of the shell's
special characters.  Notice that in `advice', the `awk' program did not
have single quotes around it.  The quotes are only needed for programs
that are provided on the `awk' command line.

   If you want to clearly identify your `awk' program files as such,
you can add the extension `.awk' to the file name.  This doesn't affect
the execution of the `awk' program but it does make "housekeeping"
easier.


File: gawk.info,  Node: Executable Scripts,  Next: Comments,  Prev: Long,  Up: Running gawk

1.1.4 Executable `awk' Programs
-------------------------------

Once you have learned `awk', you may want to write self-contained `awk'
scripts, using the `#!' script mechanism.  You can do this on many
systems.(1) For example, you could update the file `advice' to look
like this:

     #! /bin/awk -f

     BEGIN { print "Don't Panic!" }

After making this file executable (with the `chmod' utility), simply
type `advice' at the shell and the system arranges to run `awk'(2) as
if you had typed `awk -f advice':

     $ chmod +x advice
     $ advice
     -| Don't Panic!

(We assume you have the current directory in your shell's search path
variable [typically `$PATH'].  If not, you may need to type `./advice'
at the shell.)

   Self-contained `awk' scripts are useful when you want to write a
program that users can invoke without their having to know that the
program is written in `awk'.

                     Portability Issues with `#!'

   Some systems limit the length of the interpreter name to 32
characters.  Often, this can be dealt with by using a symbolic link.

   You should not put more than one argument on the `#!' line after the
path to `awk'. It does not work. The operating system treats the rest
of the line as a single argument and passes it to `awk'.  Doing this
leads to confusing behavior--most likely a usage diagnostic of some
sort from `awk'.

   Finally, the value of `ARGV[0]' (*note Built-in Variables::) varies
depending upon your operating system.  Some systems put `awk' there,
some put the full pathname of `awk' (such as `/bin/awk'), and some put
the name of your script (`advice').  (d.c.)  Don't rely on the value of
`ARGV[0]' to provide your script name.

   ---------- Footnotes ----------

   (1) The `#!' mechanism works on GNU/Linux systems, BSD-based systems
and commercial Unix systems.

   (2) The line beginning with `#!' lists the full file name of an
interpreter to run and an optional initial command-line argument to
pass to that interpreter.  The operating system then runs the
interpreter with the given argument and the full argument list of the
executed program.  The first argument in the list is the full file name
of the `awk' program.  The rest of the argument list contains either
options to `awk', or data files, or both. Note that on many systems
`awk' may be found in `/usr/bin' instead of in `/bin'. Caveat Emptor.


File: gawk.info,  Node: Comments,  Next: Quoting,  Prev: Executable Scripts,  Up: Running gawk

1.1.5 Comments in `awk' Programs
--------------------------------

A "comment" is some text that is included in a program for the sake of
human readers; it is not really an executable part of the program.
Comments can explain what the program does and how it works.  Nearly all
programming languages have provisions for comments, as programs are
typically hard to understand without them.

   In the `awk' language, a comment starts with the sharp sign
character (`#') and continues to the end of the line.  The `#' does not
have to be the first character on the line. The `awk' language ignores
the rest of a line following a sharp sign.  For example, we could have
put the following into `advice':

     # This program prints a nice friendly message.  It helps
     # keep novice users from being afraid of the computer.
     BEGIN    { print "Don't Panic!" }

   You can put comment lines into keyboard-composed throwaway `awk'
programs, but this usually isn't very useful; the purpose of a comment
is to help you or another person understand the program when reading it
at a later time.

     CAUTION: As mentioned in *note One-shot::, you can enclose small
     to medium programs in single quotes, in order to keep your shell
     scripts self-contained.  When doing so, _don't_ put an apostrophe
     (i.e., a single quote) into a comment (or anywhere else in your
     program). The shell interprets the quote as the closing quote for
     the entire program. As a result, usually the shell prints a
     message about mismatched quotes, and if `awk' actually runs, it
     will probably print strange messages about syntax errors.  For
     example, look at the following:

          $ awk '{ print "hello" } # let's be cute'
          >

     The shell sees that the first two quotes match, and that a new
     quoted object begins at the end of the command line.  It therefore
     prompts with the secondary prompt, waiting for more input.  With
     Unix `awk', closing the quoted string produces this result:

          $ awk '{ print "hello" } # let's be cute'
          > '
          error--> awk: can't open file be
          error-->  source line number 1

     Putting a backslash before the single quote in `let's' wouldn't
     help, since backslashes are not special inside single quotes.  The
     next node describes the shell's quoting rules.


File: gawk.info,  Node: Quoting,  Prev: Comments,  Up: Running gawk

1.1.6 Shell-Quoting Issues
--------------------------

* Menu:

* DOS Quoting::                 Quoting in Windows Batch Files.

   For short to medium length `awk' programs, it is most convenient to
enter the program on the `awk' command line.  This is best done by
enclosing the entire program in single quotes.  This is true whether
you are entering the program interactively at the shell prompt, or
writing it as part of a larger shell script:

     awk 'PROGRAM TEXT' INPUT-FILE1 INPUT-FILE2 ...

   Once you are working with the shell, it is helpful to have a basic
knowledge of shell quoting rules.  The following rules apply only to
POSIX-compliant, Bourne-style shells (such as Bash, the GNU Bourne-Again
Shell).  If you use the C shell, you're on your own.

   * Quoted items can be concatenated with nonquoted items as well as
     with other quoted items.  The shell turns everything into one
     argument for the command.

   * Preceding any single character with a backslash (`\') quotes that
     character.  The shell removes the backslash and passes the quoted
     character on to the command.

   * Single quotes protect everything between the opening and closing
     quotes.  The shell does no interpretation of the quoted text,
     passing it on verbatim to the command.  It is _impossible_ to
     embed a single quote inside single-quoted text.  Refer back to
     *note Comments::, for an example of what happens if you try.

   * Double quotes protect most things between the opening and closing
     quotes.  The shell does at least variable and command substitution
     on the quoted text.  Different shells may do additional kinds of
     processing on double-quoted text.

     Since certain characters within double-quoted text are processed
     by the shell, they must be "escaped" within the text.  Of note are
     the characters `$', ``', `\', and `"', all of which must be
     preceded by a backslash within double-quoted text if they are to
     be passed on literally to the program.  (The leading backslash is
     stripped first.)  Thus, the example seen in *note Read Terminal::,
     is applicable:

          $ awk "BEGIN { print \"Don't Panic!\" }"
          -| Don't Panic!

     Note that the single quote is not special within double quotes.

   * Null strings are removed when they occur as part of a non-null
     command-line argument, while explicit non-null objects are kept.
     For example, to specify that the field separator `FS' should be
     set to the null string, use:

          awk -F "" 'PROGRAM' FILES # correct

     Don't use this:

          awk -F"" 'PROGRAM' FILES  # wrong!

     In the second case, `awk' will attempt to use the text of the
     program as the value of `FS', and the first file name as the text
     of the program!  This results in syntax errors at best, and
     confusing behavior at worst.

   Mixing single and double quotes is difficult.  You have to resort to
shell quoting tricks, like this:

     $ awk 'BEGIN { print "Here is a single quote <'"'"'>" }'
     -| Here is a single quote <'>

This program consists of three concatenated quoted strings.  The first
and the third are single-quoted, the second is double-quoted.

   This can be "simplified" to:

     $ awk 'BEGIN { print "Here is a single quote <'\''>" }'
     -| Here is a single quote <'>

Judge for yourself which of these two is the more readable.

   Another option is to use double quotes, escaping the embedded,
`awk'-level double quotes:

     $ awk "BEGIN { print \"Here is a single quote <'>\" }"
     -| Here is a single quote <'>

This option is also painful, because double quotes, backslashes, and
dollar signs are very common in more advanced `awk' programs.

   A third option is to use the octal escape sequence equivalents
(*note Escape Sequences::) for the single- and double-quote characters,
like so:

     $ awk 'BEGIN { print "Here is a single quote <\47>" }'
     -| Here is a single quote <'>
     $ awk 'BEGIN { print "Here is a double quote <\42>" }'
     -| Here is a double quote <">

This works nicely, except that you should comment clearly what the
escapes mean.

   A fourth option is to use command-line variable assignment, like
this:

     $ awk -v sq="'" 'BEGIN { print "Here is a single quote <" sq ">" }'
     -| Here is a single quote <'>

   If you really need both single and double quotes in your `awk'
program, it is probably best to move it into a separate file, where the
shell won't be part of the picture, and you can say what you mean.


File: gawk.info,  Node: DOS Quoting,  Up: Quoting

1.1.6.1 Quoting in MS-Windows Batch Files
.........................................

Although this Info file generally only worries about POSIX systems and
the POSIX shell, the following issue arises often enough for many users
that it is worth addressing.

   The "shells" on Microsoft Windows systems use the double-quote
character for quoting, and make it difficult or impossible to include an
escaped double-quote character in a command-line script.  The following
example, courtesy of Jeroen Brink, shows how to print all lines in a
file surrounded by double quotes:

     gawk "{ print \"\042\" $0 \"\042\" }" FILE


File: gawk.info,  Node: Sample Data Files,  Next: Very Simple,  Prev: Running gawk,  Up: Getting Started

1.2 Data Files for the Examples
===============================

Many of the examples in this Info file take their input from two sample
data files.  The first, `BBS-list', represents a list of computer
bulletin board systems together with information about those systems.
The second data file, called `inventory-shipped', contains information
about monthly shipments.  In both files, each line is considered to be
one "record".

   In the data file `BBS-list', each record contains the name of a
computer bulletin board, its phone number, the board's baud rate(s),
and a code for the number of hours it is operational.  An `A' in the
last column means the board operates 24 hours a day.  A `B' in the last
column means the board only operates on evening and weekend hours.  A
`C' means the board operates only on weekends:

     aardvark     555-5553     1200/300          B
     alpo-net     555-3412     2400/1200/300     A
     barfly       555-7685     1200/300          A
     bites        555-1675     2400/1200/300     A
     camelot      555-0542     300               C
     core         555-2912     1200/300          C
     fooey        555-1234     2400/1200/300     B
     foot         555-6699     1200/300          B
     macfoo       555-6480     1200/300          A
     sdace        555-3430     2400/1200/300     A
     sabafoo      555-2127     1200/300          C

   The data file `inventory-shipped' represents information about
shipments during the year.  Each record contains the month, the number
of green crates shipped, the number of red boxes shipped, the number of
orange bags shipped, and the number of blue packages shipped,
respectively.  There are 16 entries, covering the 12 months of last year
and the first four months of the current year.

     Jan  13  25  15 115
     Feb  15  32  24 226
     Mar  15  24  34 228
     Apr  31  52  63 420
     May  16  34  29 208
     Jun  31  42  75 492
     Jul  24  34  67 436
     Aug  15  34  47 316
     Sep  13  55  37 277
     Oct  29  54  68 525
     Nov  20  87  82 577
     Dec  17  35  61 401

     Jan  21  36  64 620
     Feb  26  58  80 652
     Mar  24  75  70 495
     Apr  21  70  74 514

   If you are reading this in GNU Emacs using Info, you can copy the
regions of text showing these sample files into your own test files.
This way you can try out the examples shown in the remainder of this
document.  You do this by using the command `M-x write-region' to copy
text from the Info file into a file for use with `awk' (*Note
Miscellaneous File Operations: (emacs)Misc File Ops, for more
information).  Using this information, create your own `BBS-list' and
`inventory-shipped' files and practice what you learn in this Info file.

   If you are using the stand-alone version of Info, see *note Extract
Program::, for an `awk' program that extracts these data files from
`gawk.texi', the (generated) Texinfo source file for this Info file.


File: gawk.info,  Node: Very Simple,  Next: Two Rules,  Prev: Sample Data Files,  Up: Getting Started

1.3 Some Simple Examples
========================

The following command runs a simple `awk' program that searches the
input file `BBS-list' for the character string `foo' (a grouping of
characters is usually called a "string"; the term "string" is based on
similar usage in English, such as "a string of pearls," or "a string of
cars in a train"):

     awk '/foo/ { print $0 }' BBS-list

When lines containing `foo' are found, they are printed because
`print $0' means print the current line.  (Just `print' by itself means
the same thing, so we could have written that instead.)

   You will notice that slashes (`/') surround the string `foo' in the
`awk' program.  The slashes indicate that `foo' is the pattern to
search for.  This type of pattern is called a "regular expression",
which is covered in more detail later (*note Regexp::).  The pattern is
allowed to match parts of words.  There are single quotes around the
`awk' program so that the shell won't interpret any of it as special
shell characters.

   Here is what this program prints:

     $ awk '/foo/ { print $0 }' BBS-list
     -| fooey        555-1234     2400/1200/300     B
     -| foot         555-6699     1200/300          B
     -| macfoo       555-6480     1200/300          A
     -| sabafoo      555-2127     1200/300          C

   In an `awk' rule, either the pattern or the action can be omitted,
but not both.  If the pattern is omitted, then the action is performed
for _every_ input line.  If the action is omitted, the default action
is to print all lines that match the pattern.

   Thus, we could leave out the action (the `print' statement and the
curly braces) in the previous example and the result would be the same:
`awk' prints all lines matching the pattern `foo'.  By comparison,
omitting the `print' statement but retaining the curly braces makes an
empty action that does nothing (i.e., no lines are printed).

   Many practical `awk' programs are just a line or two.  Following is a
collection of useful, short programs to get you started.  Some of these
programs contain constructs that haven't been covered yet. (The
description of the program will give you a good idea of what is going
on, but please read the rest of the Info file to become an `awk'
expert!)  Most of the examples use a data file named `data'.  This is
just a placeholder; if you use these programs yourself, substitute your
own file names for `data'.  For future reference, note that there is
often more than one way to do things in `awk'.  At some point, you may
want to look back at these examples and see if you can come up with
different ways to do the same things shown here:

   * Print the length of the longest input line:

          awk '{ if (length($0) > max) max = length($0) }
               END { print max }' data

   * Print every line that is longer than 80 characters:

          awk 'length($0) > 80' data

     The sole rule has a relational expression as its pattern and it
     has no action--so the default action, printing the record, is used.

   * Print the length of the longest line in `data':

          expand data | awk '{ if (x < length()) x = length() }
                        END { print "maximum line length is " x }'

     The input is processed by the `expand' utility to change TABs into
     spaces, so the widths compared are actually the right-margin
     columns.

   * Print every line that has at least one field:

          awk 'NF > 0' data

     This is an easy way to delete blank lines from a file (or rather,
     to create a new file similar to the old file but from which the
     blank lines have been removed).

   * Print seven random numbers from 0 to 100, inclusive:

          awk 'BEGIN { for (i = 1; i <= 7; i++)
                           print int(101 * rand()) }'

   * Print the total number of bytes used by FILES:

          ls -l FILES | awk '{ x += $5 }
                            END { print "total bytes: " x }'

   * Print the total number of kilobytes used by FILES:

          ls -l FILES | awk '{ x += $5 }
             END { print "total K-bytes:", x / 1024 }'

   * Print a sorted list of the login names of all users:

          awk -F: '{ print $1 }' /etc/passwd | sort

   * Count the lines in a file:

          awk 'END { print NR }' data

   * Print the even-numbered lines in the data file:

          awk 'NR % 2 == 0' data

     If you use the expression `NR % 2 == 1' instead, the program would
     print the odd-numbered lines.


File: gawk.info,  Node: Two Rules,  Next: More Complex,  Prev: Very Simple,  Up: Getting Started

1.4 An Example with Two Rules
=============================

The `awk' utility reads the input files one line at a time.  For each
line, `awk' tries the patterns of each of the rules.  If several
patterns match, then several actions are run in the order in which they
appear in the `awk' program.  If no patterns match, then no actions are
run.

   After processing all the rules that match the line (and perhaps
there are none), `awk' reads the next line.  (However, *note Next
Statement::, and also *note Nextfile Statement::).  This continues
until the program reaches the end of the file.  For example, the
following `awk' program contains two rules:

     /12/  { print $0 }
     /21/  { print $0 }

The first rule has the string `12' as the pattern and `print $0' as the
action.  The second rule has the string `21' as the pattern and also
has `print $0' as the action.  Each rule's action is enclosed in its
own pair of braces.

   This program prints every line that contains the string `12' _or_
the string `21'.  If a line contains both strings, it is printed twice,
once by each rule.

   This is what happens if we run this program on our two sample data
files, `BBS-list' and `inventory-shipped':

     $ awk '/12/ { print $0 }
     >      /21/ { print $0 }' BBS-list inventory-shipped
     -| aardvark     555-5553     1200/300          B
     -| alpo-net     555-3412     2400/1200/300     A
     -| barfly       555-7685     1200/300          A
     -| bites        555-1675     2400/1200/300     A
     -| core         555-2912     1200/300          C
     -| fooey        555-1234     2400/1200/300     B
     -| foot         555-6699     1200/300          B
     -| macfoo       555-6480     1200/300          A
     -| sdace        555-3430     2400/1200/300     A
     -| sabafoo      555-2127     1200/300          C
     -| sabafoo      555-2127     1200/300          C
     -| Jan  21  36  64 620
     -| Apr  21  70  74 514

Note how the line beginning with `sabafoo' in `BBS-list' was printed
twice, once for each rule.


File: gawk.info,  Node: More Complex,  Next: Statements/Lines,  Prev: Two Rules,  Up: Getting Started

1.5 A More Complex Example
==========================

Now that we've mastered some simple tasks, let's look at what typical
`awk' programs do.  This example shows how `awk' can be used to
summarize, select, and rearrange the output of another utility.  It uses
features that haven't been covered yet, so don't worry if you don't
understand all the details:

     LC_ALL=C ls -l | awk '$6 == "Nov" { sum += $5 }
                           END { print sum }'

   This command prints the total number of bytes in all the files in the
current directory that were last modified in November (of any year).
The `ls -l' part of this example is a system command that gives you a
listing of the files in a directory, including each file's size and the
date the file was last modified. Its output looks like this:

     -rw-r--r--  1 arnold   user   1933 Nov  7 13:05 Makefile
     -rw-r--r--  1 arnold   user  10809 Nov  7 13:03 awk.h
     -rw-r--r--  1 arnold   user    983 Apr 13 12:14 awk.tab.h
     -rw-r--r--  1 arnold   user  31869 Jun 15 12:20 awkgram.y
     -rw-r--r--  1 arnold   user  22414 Nov  7 13:03 awk1.c
     -rw-r--r--  1 arnold   user  37455 Nov  7 13:03 awk2.c
     -rw-r--r--  1 arnold   user  27511 Dec  9 13:07 awk3.c
     -rw-r--r--  1 arnold   user   7989 Nov  7 13:03 awk4.c

The first field contains read-write permissions, the second field
contains the number of links to the file, and the third field
identifies the owner of the file. The fourth field identifies the group
of the file.  The fifth field contains the size of the file in bytes.
The sixth, seventh, and eighth fields contain the month, day, and time,
respectively, that the file was last modified.  Finally, the ninth field
contains the file name.(1)

   The `$6 == "Nov"' in our `awk' program is an expression that tests
whether the sixth field of the output from `ls -l' matches the string
`Nov'.  Each time a line has the string `Nov' for its sixth field, the
action `sum += $5' is performed.  This adds the fifth field (the file's
size) to the variable `sum'.  As a result, when `awk' has finished
reading all the input lines, `sum' is the total of the sizes of the
files whose lines matched the pattern.  (This works because `awk'
variables are automatically initialized to zero.)

   After the last line of output from `ls' has been processed, the
`END' rule executes and prints the value of `sum'.  In this example,
the value of `sum' is 80600.

   These more advanced `awk' techniques are covered in later sections
(*note Action Overview::).  Before you can move on to more advanced
`awk' programming, you have to know how `awk' interprets your input and
displays your output.  By manipulating fields and using `print'
statements, you can produce some very useful and impressive-looking
reports.

   ---------- Footnotes ----------

   (1) The `LC_ALL=C' is needed to produce this traditional-style
output from `ls'.


File: gawk.info,  Node: Statements/Lines,  Next: Other Features,  Prev: More Complex,  Up: Getting Started

1.6 `awk' Statements Versus Lines
=================================

Most often, each line in an `awk' program is a separate statement or
separate rule, like this:

     awk '/12/  { print $0 }
          /21/  { print $0 }' BBS-list inventory-shipped

   However, `gawk' ignores newlines after any of the following symbols
and keywords:

     ,    {    ?    :    ||    &&    do    else

A newline at any other point is considered the end of the statement.(1)

   If you would like to split a single statement into two lines at a
point where a newline would terminate it, you can "continue" it by
ending the first line with a backslash character (`\').  The backslash
must be the final character on the line in order to be recognized as a
continuation character.  A backslash is allowed anywhere in the
statement, even in the middle of a string or regular expression.  For
example:

     awk '/This regular expression is too long, so continue it\
      on the next line/ { print $1 }'

We have generally not used backslash continuation in our sample
programs.  `gawk' places no limit on the length of a line, so backslash
continuation is never strictly necessary; it just makes programs more
readable.  For this same reason, as well as for clarity, we have kept
most statements short in the sample programs presented throughout the
Info file.  Backslash continuation is most useful when your `awk'
program is in a separate source file instead of entered from the
command line.  You should also note that many `awk' implementations are
more particular about where you may use backslash continuation. For
example, they may not allow you to split a string constant using
backslash continuation.  Thus, for maximum portability of your `awk'
programs, it is best not to split your lines in the middle of a regular
expression or a string.

     CAUTION: _Backslash continuation does not work as described with
     the C shell._  It works for `awk' programs in files and for
     one-shot programs, _provided_ you are using a POSIX-compliant
     shell, such as the Unix Bourne shell or Bash.  But the C shell
     behaves differently!  There, you must use two backslashes in a
     row, followed by a newline.  Note also that when using the C
     shell, _every_ newline in your `awk' program must be escaped with
     a backslash. To illustrate:

          % awk 'BEGIN { \
          ?   print \\
          ?       "hello, world" \
          ? }'
          -| hello, world

     Here, the `%' and `?' are the C shell's primary and secondary
     prompts, analogous to the standard shell's `$' and `>'.

     Compare the previous example to how it is done with a
     POSIX-compliant shell:

          $ awk 'BEGIN {
          >   print \
          >       "hello, world"
          > }'
          -| hello, world

   `awk' is a line-oriented language.  Each rule's action has to begin
on the same line as the pattern.  To have the pattern and action on
separate lines, you _must_ use backslash continuation; there is no
other option.

   Another thing to keep in mind is that backslash continuation and
comments do not mix. As soon as `awk' sees the `#' that starts a
comment, it ignores _everything_ on the rest of the line. For example:

     $ gawk 'BEGIN { print "dont panic" # a friendly \
     >                                    BEGIN rule
     > }'
     error--> gawk: cmd. line:2:                BEGIN rule
     error--> gawk: cmd. line:2:                ^ parse error

In this case, it looks like the backslash would continue the comment
onto the next line. However, the backslash-newline combination is never
even noticed because it is "hidden" inside the comment. Thus, the
`BEGIN' is noted as a syntax error.

   When `awk' statements within one rule are short, you might want to
put more than one of them on a line.  This is accomplished by
separating the statements with a semicolon (`;').  This also applies to
the rules themselves.  Thus, the program shown at the start of this
minor node could also be written this way:

     /12/ { print $0 } ; /21/ { print $0 }

     NOTE: The requirement that states that rules on the same line must
     be separated with a semicolon was not in the original `awk'
     language; it was added for consistency with the treatment of
     statements within an action.

   ---------- Footnotes ----------

   (1) The `?' and `:' referred to here is the three-operand
conditional expression described in *note Conditional Exp::.  Splitting
lines after `?' and `:' is a minor `gawk' extension; if `--posix' is
specified (*note Options::), then this extension is disabled.


File: gawk.info,  Node: Other Features,  Next: When,  Prev: Statements/Lines,  Up: Getting Started

1.7 Other Features of `awk'
===========================

The `awk' language provides a number of predefined, or "built-in",
variables that your programs can use to get information from `awk'.
There are other variables your program can set as well to control how
`awk' processes your data.

   In addition, `awk' provides a number of built-in functions for doing
common computational and string-related operations.  `gawk' provides
built-in functions for working with timestamps, performing bit
manipulation, for runtime string translation (internationalization),
determining the type of a variable, and array sorting.

   As we develop our presentation of the `awk' language, we introduce
most of the variables and many of the functions. They are described
systematically in *note Built-in Variables::, and *note Built-in::.


File: gawk.info,  Node: When,  Prev: Other Features,  Up: Getting Started

1.8 When to Use `awk'
=====================

Now that you've seen some of what `awk' can do, you might wonder how
`awk' could be useful for you.  By using utility programs, advanced
patterns, field separators, arithmetic statements, and other selection
criteria, you can produce much more complex output.  The `awk' language
is very useful for producing reports from large amounts of raw data,
such as summarizing information from the output of other utility
programs like `ls'.  (*Note More Complex::.)

   Programs written with `awk' are usually much smaller than they would
be in other languages.  This makes `awk' programs easy to compose and
use.  Often, `awk' programs can be quickly composed at your keyboard,
used once, and thrown away.  Because `awk' programs are interpreted, you
can avoid the (usually lengthy) compilation part of the typical
edit-compile-test-debug cycle of software development.

   Complex programs have been written in `awk', including a complete
retargetable assembler for eight-bit microprocessors (*note Glossary::,
for more information), and a microcode assembler for a special-purpose
Prolog computer.  While the original `awk''s capabilities were strained
by tasks of such complexity, modern versions are more capable.  Even
Brian Kernighan's version of `awk' has fewer predefined limits, and
those that it has are much larger than they used to be.

   If you find yourself writing `awk' scripts of more than, say, a few
hundred lines, you might consider using a different programming
language.  Emacs Lisp is a good choice if you need sophisticated string
or pattern matching capabilities.  The shell is also good at string and
pattern matching; in addition, it allows powerful use of the system
utilities.  More conventional languages, such as C, C++, and Java, offer
better facilities for system programming and for managing the complexity
of large programs.  Programs in these languages may require more lines
of source code than the equivalent `awk' programs, but they are easier
to maintain and usually run more efficiently.


File: gawk.info,  Node: Invoking Gawk,  Next: Regexp,  Prev: Getting Started,  Up: Top

2 Running `awk' and `gawk'
**************************

This major node covers how to run awk, both POSIX-standard and
`gawk'-specific command-line options, and what `awk' and `gawk' do with
non-option arguments.  It then proceeds to cover how `gawk' searches
for source files, reading standard input along with other files,
`gawk''s environment variables, `gawk''s exit status, using include
files, and obsolete and undocumented options and/or features.

   Many of the options and features described here are discussed in
more detail later in the Info file; feel free to skip over things in
this major node that don't interest you right now.

* Menu:

* Command Line::                How to run `awk'.
* Options::                     Command-line options and their meanings.
* Other Arguments::             Input file names and variable assignments.
* Naming Standard Input::       How to specify standard input with other
                                files.
* Environment Variables::       The environment variables `gawk' uses.
* Exit Status::                 `gawk''s exit status.
* Include Files::               Including other files into your program.
* Loading Shared Libraries::    Loading shared libraries into your program.
* Obsolete::                    Obsolete Options and/or features.
* Undocumented::                Undocumented Options and Features.


File: gawk.info,  Node: Command Line,  Next: Options,  Up: Invoking Gawk

2.1 Invoking `awk'
==================

There are two ways to run `awk'--with an explicit program or with one
or more program files.  Here are templates for both of them; items
enclosed in [...] in these templates are optional:

     awk [OPTIONS] -f progfile [`--'] FILE ...
     awk [OPTIONS] [`--'] 'PROGRAM' FILE ...

   Besides traditional one-letter POSIX-style options, `gawk' also
supports GNU long options.

   It is possible to invoke `awk' with an empty program:

     awk '' datafile1 datafile2

Doing so makes little sense, though; `awk' exits silently when given an
empty program.  (d.c.)  If `--lint' has been specified on the command
line, `gawk' issues a warning that the program is empty.


File: gawk.info,  Node: Options,  Next: Other Arguments,  Prev: Command Line,  Up: Invoking Gawk

2.2 Command-Line Options
========================

Options begin with a dash and consist of a single character.  GNU-style
long options consist of two dashes and a keyword.  The keyword can be
abbreviated, as long as the abbreviation allows the option to be
uniquely identified.  If the option takes an argument, then the keyword
is either immediately followed by an equals sign (`=') and the
argument's value, or the keyword and the argument's value are separated
by whitespace.  If a particular option with a value is given more than
once, it is the last value that counts.

   Each long option for `gawk' has a corresponding POSIX-style short
option.  The long and short options are interchangeable in all contexts.
The following list describes options mandated by the POSIX standard:

`-F FS'
`--field-separator FS'
     Set the `FS' variable to FS (*note Field Separators::).

`-f SOURCE-FILE'
`--file SOURCE-FILE'
     Read `awk' program source from SOURCE-FILE instead of in the first
     non-option argument.  This option may be given multiple times; the
     `awk' program consists of the concatenation the contents of each
     specified SOURCE-FILE.

`-i SOURCE-FILE'
`--include SOURCE-FILE'
     Read `awk' source library from SOURCE-FILE.  This option is
     completely equivalent to using the `@include' directive inside
     your program.  This option is very similar to the `-f' option, but
     there are two important differences.  First, when `-i' is used,
     the program source will not be loaded if it has been previously
     loaded, whereas the `-f' will always load the file.  Second,
     because this option is intended to be used with code libraries,
     `gawk' does not recognize such files as constituting main program
     input.  Thus, after processing an `-i' argument, `gawk' still
     expects to find the main source code via the `-f' option or on the
     command-line.

`-v VAR=VAL'
`--assign VAR=VAL'
     Set the variable VAR to the value VAL _before_ execution of the
     program begins.  Such variable values are available inside the
     `BEGIN' rule (*note Other Arguments::).

     The `-v' option can only set one variable, but it can be used more
     than once, setting another variable each time, like this: `awk
     -v foo=1 -v bar=2 ...'.

          CAUTION: Using `-v' to set the values of the built-in
          variables may lead to surprising results.  `awk' will reset
          the values of those variables as it needs to, possibly
          ignoring any predefined value you may have given.

`-W GAWK-OPT'
     Provide an implementation-specific option.  This is the POSIX
     convention for providing implementation-specific options.  These
     options also have corresponding GNU-style long options.  Note that
     the long options may be abbreviated, as long as the abbreviations
     remain unique.  The full list of `gawk'-specific options is
     provided next.

`--'
     Signal the end of the command-line options.  The following
     arguments are not treated as options even if they begin with `-'.
     This interpretation of `--' follows the POSIX argument parsing
     conventions.

     This is useful if you have file names that start with `-', or in
     shell scripts, if you have file names that will be specified by
     the user that could start with `-'.  It is also useful for passing
     options on to the `awk' program; see *note Getopt Function::.

   The following list describes `gawk'-specific options:

`-b'
`--characters-as-bytes'
     Cause `gawk' to treat all input data as single-byte characters.
     In addition, all output written with `print' or `printf' are
     treated as single-byte characters.

     Normally, `gawk' follows the POSIX standard and attempts to process
     its input data according to the current locale. This can often
     involve converting multibyte characters into wide characters
     (internally), and can lead to problems or confusion if the input
     data does not contain valid multibyte characters. This option is
     an easy way to tell `gawk': "hands off my data!".

`-c'
`--traditional'
     Specify "compatibility mode", in which the GNU extensions to the
     `awk' language are disabled, so that `gawk' behaves just like
     Brian Kernighan's version `awk'.  *Note POSIX/GNU::, which
     summarizes the extensions.  Also see *note Compatibility Mode::.

`-C'
`--copyright'
     Print the short version of the General Public License and then
     exit.

`-d[FILE]'
`--dump-variables[=FILE]'
     Print a sorted list of global variables, their types, and final
     values to FILE.  If no FILE is provided, print this list to the
     file named `awkvars.out' in the current directory.  No space is
     allowed between the `-d' and FILE, if FILE is supplied.

     Having a list of all global variables is a good way to look for
     typographical errors in your programs.  You would also use this
     option if you have a large program with a lot of functions, and
     you want to be sure that your functions don't inadvertently use
     global variables that you meant to be local.  (This is a
     particularly easy mistake to make with simple variable names like
     `i', `j', etc.)

`-D[FILE]'
`--debug=[FILE]'
     Enable debugging of `awk' programs (*note Debugging::).  By
     default, the debugger reads commands interactively from the
     terminal.  The optional FILE argument allows you to specify a file
     with a list of commands for the debugger to execute
     non-interactively.  No space is allowed between the `-D' and FILE,
     if FILE is supplied.

`-e PROGRAM-TEXT'
`--source PROGRAM-TEXT'
     Provide program source code in the PROGRAM-TEXT.  This option
     allows you to mix source code in files with source code that you
     enter on the command line.  This is particularly useful when you
     have library functions that you want to use from your command-line
     programs (*note AWKPATH Variable::).

`-E FILE'
`--exec FILE'
     Similar to `-f', read `awk' program text from FILE.  There are two
     differences from `-f':

        * This option terminates option processing; anything else on
          the command line is passed on directly to the `awk' program.

        * Command-line variable assignments of the form `VAR=VALUE' are
          disallowed.

     This option is particularly necessary for World Wide Web CGI
     applications that pass arguments through the URL; using this
     option prevents a malicious (or other) user from passing in
     options, assignments, or `awk' source code (via `--source') to the
     CGI application.  This option should be used with `#!' scripts
     (*note Executable Scripts::), like so:

          #! /usr/local/bin/gawk -E

          AWK PROGRAM HERE ...

`-g'
`--gen-pot'
     Analyze the source program and generate a GNU `gettext' Portable
     Object Template file on standard output for all string constants
     that have been marked for translation.  *Note
     Internationalization::, for information about this option.

`-h'
`--help'
     Print a "usage" message summarizing the short and long style
     options that `gawk' accepts and then exit.

`-l LIB'
`--load LIB'
     Load a shared library LIB. This searches for the library using the
     `AWKLIBPATH' environment variable.  The correct library suffix for
     your platform will be supplied by default, so it need not be
     specified in the library name.  The library initialization routine
     should be named `dl_load()'.  An alternative is to use the `@load'
     keyword inside the program to load a shared library.

`-L [value]'
`--lint[=value]'
     Warn about constructs that are dubious or nonportable to other
     `awk' implementations.  Some warnings are issued when `gawk' first
     reads your program.  Others are issued at runtime, as your program
     executes.  With an optional argument of `fatal', lint warnings
     become fatal errors.  This may be drastic, but its use will
     certainly encourage the development of cleaner `awk' programs.
     With an optional argument of `invalid', only warnings about things
     that are actually invalid are issued. (This is not fully
     implemented yet.)

     Some warnings are only printed once, even if the dubious
     constructs they warn about occur multiple times in your `awk'
     program.  Thus, when eliminating problems pointed out by `--lint',
     you should take care to search for all occurrences of each
     inappropriate construct. As `awk' programs are usually short,
     doing so is not burdensome.

`-M'
`--bignum'
     Force arbitrary precision arithmetic on numbers. This option has
     no effect if `gawk' is not compiled to use the GNU MPFR and MP
     libraries (*note Arbitrary Precision Arithmetic::).

`-n'
`--non-decimal-data'
     Enable automatic interpretation of octal and hexadecimal values in
     input data (*note Nondecimal Data::).

          CAUTION: This option can severely break old programs.  Use
          with care.

`-N'
`--use-lc-numeric'
     Force the use of the locale's decimal point character when parsing
     numeric input data (*note Locales::).

`-o[FILE]'
`--pretty-print[=FILE]'
     Enable pretty-printing of `awk' programs.  By default, output
     program is created in a file named `awkprof.out'.  The optional
     FILE argument allows you to specify a different file name for the
     output.  No space is allowed between the `-o' and FILE, if FILE is
     supplied.

`-O'
`--optimize'
     Enable some optimizations on the internal representation of the
     program.  At the moment this includes just simple constant
     folding. The `gawk' maintainer hopes to add more optimizations
     over time.

`-p[FILE]'
`--profile[=FILE]'
     Enable profiling of `awk' programs (*note Profiling::).  By
     default, profiles are created in a file named `awkprof.out'.  The
     optional FILE argument allows you to specify a different file name
     for the profile file.  No space is allowed between the `-p' and
     FILE, if FILE is supplied.

     The profile contains execution counts for each statement in the
     program in the left margin, and function call counts for each
     function.

`-P'
`--posix'
     Operate in strict POSIX mode.  This disables all `gawk' extensions
     (just like `--traditional') and disables all extensions not
     allowed by POSIX.  *Note Common Extensions::, for a summary of the
     extensions in `gawk' that are disabled by this option.  Also, the
     following additional restrictions apply:

        * Newlines do not act as whitespace to separate fields when
          `FS' is equal to a single space (*note Fields::).

        * Newlines are not allowed after `?' or `:' (*note Conditional
          Exp::).

        * Specifying `-Ft' on the command-line does not set the value
          of `FS' to be a single TAB character (*note Field
          Separators::).

        * The locale's decimal point character is used for parsing input
          data (*note Locales::).

     If you supply both `--traditional' and `--posix' on the command
     line, `--posix' takes precedence. `gawk' also issues a warning if
     both options are supplied.

`-r'
`--re-interval'
     Allow interval expressions (*note Regexp Operators::) in regexps.
     This is now `gawk''s default behavior.  Nevertheless, this option
     remains both for backward compatibility, and for use in
     combination with the `--traditional' option.

`-S'
`--sandbox'
     Disable the `system()' function, input redirections with `getline',
     output redirections with `print' and `printf', and dynamic
     extensions.  This is particularly useful when you want to run
     `awk' scripts from questionable sources and need to make sure the
     scripts can't access your system (other than the specified input
     data file).

`-t'
`--lint-old'
     Warn about constructs that are not available in the original
     version of `awk' from Version 7 Unix (*note V7/SVR3.1::).

`-V'
`--version'
     Print version information for this particular copy of `gawk'.
     This allows you to determine if your copy of `gawk' is up to date
     with respect to whatever the Free Software Foundation is currently
     distributing.  It is also useful for bug reports (*note Bugs::).

   As long as program text has been supplied, any other options are
flagged as invalid with a warning message but are otherwise ignored.

   In compatibility mode, as a special case, if the value of FS supplied
to the `-F' option is `t', then `FS' is set to the TAB character
(`"\t"').  This is true only for `--traditional' and not for `--posix'
(*note Field Separators::).

   The `-f' option may be used more than once on the command line.  If
it is, `awk' reads its program source from all of the named files, as
if they had been concatenated together into one big file.  This is
useful for creating libraries of `awk' functions.  These functions can
be written once and then retrieved from a standard place, instead of
having to be included into each individual program.  (As mentioned in
*note Definition Syntax::, function names must be unique.)

   With standard `awk', library functions can still be used, even if
the program is entered at the terminal, by specifying `-f /dev/tty'.
After typing your program, type `Ctrl-d' (the end-of-file character) to
terminate it.  (You may also use `-f -' to read program source from the
standard input but then you will not be able to also use the standard
input as a source of data.)

   Because it is clumsy using the standard `awk' mechanisms to mix
source file and command-line `awk' programs, `gawk' provides the
`--source' option.  This does not require you to pre-empt the standard
input for your source code; it allows you to easily mix command-line
and library source code (*note AWKPATH Variable::).  The `--source'
option may also be used multiple times on the command line.

   If no `-f' or `--source' option is specified, then `gawk' uses the
first non-option command-line argument as the text of the program
source code.

   If the environment variable `POSIXLY_CORRECT' exists, then `gawk'
behaves in strict POSIX mode, exactly as if you had supplied the
`--posix' command-line option.  Many GNU programs look for this
environment variable to suppress extensions that conflict with POSIX,
but `gawk' behaves differently: it suppresses all extensions, even
those that do not conflict with POSIX, and behaves in strict POSIX
mode. If `--lint' is supplied on the command line and `gawk' turns on
POSIX mode because of `POSIXLY_CORRECT', then it issues a warning
message indicating that POSIX mode is in effect.  You would typically
set this variable in your shell's startup file.  For a
Bourne-compatible shell (such as Bash), you would add these lines to
the `.profile' file in your home directory:

     POSIXLY_CORRECT=true
     export POSIXLY_CORRECT

   For a C shell-compatible shell,(1) you would add this line to the
`.login' file in your home directory:

     setenv POSIXLY_CORRECT true

   Having `POSIXLY_CORRECT' set is not recommended for daily use, but
it is good for testing the portability of your programs to other
environments.

   ---------- Footnotes ----------

   (1) Not recommended.


File: gawk.info,  Node: Other Arguments,  Next: Naming Standard Input,  Prev: Options,  Up: Invoking Gawk

2.3 Other Command-Line Arguments
================================

Any additional arguments on the command line are normally treated as
input files to be processed in the order specified.   However, an
argument that has the form `VAR=VALUE', assigns the value VALUE to the
variable VAR--it does not specify a file at all.  (See *note Assignment
Options::.)

   All these arguments are made available to your `awk' program in the
`ARGV' array (*note Built-in Variables::).  Command-line options and
the program text (if present) are omitted from `ARGV'.  All other
arguments, including variable assignments, are included.   As each
element of `ARGV' is processed, `gawk' sets the variable `ARGIND' to
the index in `ARGV' of the current element.

   The distinction between file name arguments and variable-assignment
arguments is made when `awk' is about to open the next input file.  At
that point in execution, it checks the file name to see whether it is
really a variable assignment; if so, `awk' sets the variable instead of
reading a file.

   Therefore, the variables actually receive the given values after all
previously specified files have been read.  In particular, the values of
variables assigned in this fashion are _not_ available inside a `BEGIN'
rule (*note BEGIN/END::), because such rules are run before `awk'
begins scanning the argument list.

   The variable values given on the command line are processed for
escape sequences (*note Escape Sequences::).  (d.c.)

   In some earlier implementations of `awk', when a variable assignment
occurred before any file names, the assignment would happen _before_
the `BEGIN' rule was executed.  `awk''s behavior was thus inconsistent;
some command-line assignments were available inside the `BEGIN' rule,
while others were not.  Unfortunately, some applications came to depend
upon this "feature."  When `awk' was changed to be more consistent, the
`-v' option was added to accommodate applications that depended upon
the old behavior.

   The variable assignment feature is most useful for assigning to
variables such as `RS', `OFS', and `ORS', which control input and
output formats before scanning the data files.  It is also useful for
controlling state if multiple passes are needed over a data file.  For
example:

     awk 'pass == 1  { PASS 1 STUFF }
          pass == 2  { PASS 2 STUFF }' pass=1 mydata pass=2 mydata

   Given the variable assignment feature, the `-F' option for setting
the value of `FS' is not strictly necessary.  It remains for historical
compatibility.


File: gawk.info,  Node: Naming Standard Input,  Next: Environment Variables,  Prev: Other Arguments,  Up: Invoking Gawk

2.4 Naming Standard Input
=========================

Often, you may wish to read standard input together with other files.
For example, you may wish to read one file, read standard input coming
from a pipe, and then read another file.

   The way to name the standard input, with all versions of `awk', is
to use a single, standalone minus sign or dash, `-'.  For example:

     SOME_COMMAND | awk -f myprog.awk file1 - file2

Here, `awk' first reads `file1', then it reads the output of
SOME_COMMAND, and finally it reads `file2'.

   You may also use `"-"' to name standard input when reading files
with `getline' (*note Getline/File::).

   In addition, `gawk' allows you to specify the special file name
`/dev/stdin', both on the command line and with `getline'.  Some other
versions of `awk' also support this, but it is not standard.  (Some
operating systems provide a `/dev/stdin' file in the file system,
however, `gawk' always processes this file name itself.)


File: gawk.info,  Node: Environment Variables,  Next: Exit Status,  Prev: Naming Standard Input,  Up: Invoking Gawk

2.5 The Environment Variables `gawk' Uses
=========================================

A number of environment variables influence how `gawk' behaves.

* Menu:

* AWKPATH Variable::            Searching directories for `awk'
                                programs.
* AWKLIBPATH Variable::         Searching directories for `awk' shared
                                libraries.
* Other Environment Variables:: The environment variables.


File: gawk.info,  Node: AWKPATH Variable,  Next: AWKLIBPATH Variable,  Up: Environment Variables

2.5.1 The `AWKPATH' Environment Variable
----------------------------------------

The previous minor node described how `awk' program files can be named
on the command-line with the `-f' option.  In most `awk'
implementations, you must supply a precise path name for each program
file, unless the file is in the current directory.  But in `gawk', if
the file name supplied to the `-f' or `-i' options does not contain a
`/', then `gawk' searches a list of directories (called the "search
path"), one by one, looking for a file with the specified name.

The search path is a string consisting of directory names separated by
colons.  `gawk' gets its search path from the `AWKPATH' environment
variable.  If that variable does not exist, `gawk' uses a default path,
`.:/usr/local/share/awk'.(1)

   The search path feature is particularly useful for building libraries
of useful `awk' functions.  The library files can be placed in a
standard directory in the default path and then specified on the
command line with a short file name.  Otherwise, the full file name
would have to be typed for each file.

   By using the `-i' option, or the `--source' and `-f' options, your
command-line `awk' programs can use facilities in `awk' library files
(*note Library Functions::).  Path searching is not done if `gawk' is
in compatibility mode.  This is true for both `--traditional' and
`--posix'.  *Note Options::.

   If the source code is not found after the initial search, the path
is searched again after adding the default `.awk' suffix to the
filename.

     NOTE: To include the current directory in the path, either place
     `.' explicitly in the path or write a null entry in the path.  (A
     null entry is indicated by starting or ending the path with a
     colon or by placing two colons next to each other (`::').)  This
     path search mechanism is similar to the shell's.

     However, `gawk' always looks in the current directory _before_
     searching `AWKPATH', so there is no real reason to include the
     current directory in the search path.

   If `AWKPATH' is not defined in the environment, `gawk' places its
default search path into `ENVIRON["AWKPATH"]'. This makes it easy to
determine the actual search path that `gawk' will use from within an
`awk' program.

   While you can change `ENVIRON["AWKPATH"]' within your `awk' program,
this has no effect on the running program's behavior.  This makes
sense: the `AWKPATH' environment variable is used to find the program
source files.  Once your program is running, all the files have been
found, and `gawk' no longer needs to use `AWKPATH'.

   ---------- Footnotes ----------

   (1) Your version of `gawk' may use a different directory; it will
depend upon how `gawk' was built and installed. The actual directory is
the value of `$(datadir)' generated when `gawk' was configured.  You
probably don't need to worry about this, though.


File: gawk.info,  Node: AWKLIBPATH Variable,  Next: Other Environment Variables,  Prev: AWKPATH Variable,  Up: Environment Variables

2.5.2 The `AWKLIBPATH' Environment Variable
-------------------------------------------

The `AWKLIBPATH' environment variable is similar to the `AWKPATH'
variable, but it is used to search for shared libraries specified with
the `-l' option rather than for source files.  If the library is not
found, the path is searched again after adding the appropriate shared
library suffix for the platform.  For example, on GNU/Linux systems,
the suffix `.so' is used.  The search path specified is also used for
libraries loaded via the `@load' keyword (*note Loading Shared
Libraries::).


File: gawk.info,  Node: Other Environment Variables,  Prev: AWKLIBPATH Variable,  Up: Environment Variables

2.5.3 Other Environment Variables
---------------------------------

A number of other environment variables affect `gawk''s behavior, but
they are more specialized. Those in the following list are meant to be
used by regular users.

`POSIXLY_CORRECT'
     Causes `gawk' to switch POSIX compatibility mode, disabling all
     traditional and GNU extensions.  *Note Options::.

`GAWK_SOCK_RETRIES'
     Controls the number of time `gawk' will attempt to retry a two-way
     TCP/IP (socket) connection before giving up.  *Note TCP/IP
     Networking::.

`GAWK_MSEC_SLEEP'
     Specifies the interval between connection retries, in
     milliseconds. On systems that do not support the `usleep()' system
     call, the value is rounded up to an integral number of seconds.

`GAWK_READ_TIMEOUT'
     Specifies the time, in milliseconds, for `gawk' to wait for input
     before returning with an error.  *Note Read Timeout::.

   The environment variables in the following list are meant for use by
the `gawk' developers for testing and tuning.  They are subject to
change. The variables are:

`AWK_HASH'
     If this variable exists with a value of `gst', `gawk' will switch
     to using the hash function from GNU Smalltalk for managing arrays.
     This function may be marginally faster than the standard function.

`AWKREADFUNC'
     If this variable exists, `gawk' switches to reading source files
     one line at a time, instead of reading in blocks. This exists for
     debugging problems on filesystems on non-POSIX operating systems
     where I/O is performed in records, not in blocks.

`GAWK_MSG_SRC'
     If this variable exists, `gawk' includes the source file name and
     line number from which warning and/or fatal messages are
     generated.  Its purpose is to help isolate the source of a
     message, since there can be multiple places which produce the same
     warning or error message.

`GAWK_NO_DFA'
     If this variable exists, `gawk' does not use the DFA regexp matcher
     for "does it match" kinds of tests. This can cause `gawk' to be
     slower. Its purpose is to help isolate differences between the two
     regexp matchers that `gawk' uses internally. (There aren't
     supposed to be differences, but occasionally theory and practice
     don't coordinate with each other.)

`GAWK_STACKSIZE'
     This specifies the amount by which `gawk' should grow its internal
     evaluation stack, when needed.

`INT_CHAIN_MAX'
     The average number of items `gawk' will maintain on a hash chain
     for managing arrays indexed by integers.

`STR_CHAIN_MAX'
     The average number of items `gawk' will maintain on a hash chain
     for managing arrays indexed by strings.

`TIDYMEM'
     If this variable exists, `gawk' uses the `mtrace()' library calls
     from GNU LIBC to help track down possible memory leaks.


File: gawk.info,  Node: Exit Status,  Next: Include Files,  Prev: Environment Variables,  Up: Invoking Gawk

2.6 `gawk''s Exit Status
========================

If the `exit' statement is used with a value (*note Exit Statement::),
then `gawk' exits with the numeric value given to it.

   Otherwise, if there were no problems during execution, `gawk' exits
with the value of the C constant `EXIT_SUCCESS'.  This is usually zero.

   If an error occurs, `gawk' exits with the value of the C constant
`EXIT_FAILURE'.  This is usually one.

   If `gawk' exits because of a fatal error, the exit status is 2.  On
non-POSIX systems, this value may be mapped to `EXIT_FAILURE'.


File: gawk.info,  Node: Include Files,  Next: Loading Shared Libraries,  Prev: Exit Status,  Up: Invoking Gawk

2.7 Including Other Files Into Your Program
===========================================

This minor node describes a feature that is specific to `gawk'.

   The `@include' keyword can be used to read external `awk' source
files.  This gives you the ability to split large `awk' source files
into smaller, more manageable pieces, and also lets you reuse common
`awk' code from various `awk' scripts.  In other words, you can group
together `awk' functions, used to carry out specific tasks, into
external files. These files can be used just like function libraries,
using the `@include' keyword in conjunction with the `AWKPATH'
environment variable.  Note that source files may also be included
using the `-i' option.

   Let's see an example.  We'll start with two (trivial) `awk' scripts,
namely `test1' and `test2'. Here is the `test1' script:

     BEGIN {
         print "This is script test1."
     }

and here is `test2':

     @include "test1"
     BEGIN {
         print "This is script test2."
     }

   Running `gawk' with `test2' produces the following result:

     $ gawk -f test2
     -| This is file test1.
     -| This is file test2.

   `gawk' runs the `test2' script which includes `test1' using the
`@include' keyword.  So, to include external `awk' source files you just
use `@include' followed by the name of the file to be included,
enclosed in double quotes.

     NOTE: Keep in mind that this is a language construct and the file
     name cannot be a string variable, but rather just a literal string
     in double quotes.

   The files to be included may be nested; e.g., given a third script,
namely `test3':

     @include "test2"
     BEGIN {
         print "This is script test3."
     }

Running `gawk' with the `test3' script produces the following results:

     $ gawk -f test3
     -| This is file test1.
     -| This is file test2.
     -| This is file test3.

   The file name can, of course, be a pathname. For example:

     @include "../io_funcs"

or:

     @include "/usr/awklib/network"

are valid. The `AWKPATH' environment variable can be of great value
when using `@include'. The same rules for the use of the `AWKPATH'
variable in command-line file searches (*note AWKPATH Variable::) apply
to `@include' also.

   This is very helpful in constructing `gawk' function libraries.  If
you have a large script with useful, general purpose `awk' functions,
you can break it down into library files and put those files in a
special directory.  You can then include those "libraries," using
either the full pathnames of the files, or by setting the `AWKPATH'
environment variable accordingly and then using `@include' with just
the file part of the full pathname. Of course you can have more than
one directory to keep library files; the more complex the working
environment is, the more directories you may need to organize the files
to be included.

   Given the ability to specify multiple `-f' options, the `@include'
mechanism is not strictly necessary.  However, the `@include' keyword
can help you in constructing self-contained `gawk' programs, thus
reducing the need for writing complex and tedious command lines.  In
particular, `@include' is very useful for writing CGI scripts to be run
from web pages.

   As mentioned in *note AWKPATH Variable::, the current directory is
always searched first for source files, before searching in `AWKPATH',
and this also applies to files named with `@include'.


File: gawk.info,  Node: Loading Shared Libraries,  Next: Obsolete,  Prev: Include Files,  Up: Invoking Gawk

2.8 Loading Shared Libraries Into Your Program
==============================================

This minor node describes a feature that is specific to `gawk'.

   The `@load' keyword can be used to read external `awk' shared
libraries.  This allows you to link in compiled code that may offer
superior performance and/or give you access to extended capabilities
not supported by the `awk' language.  The `AWKLIBPATH' variable is used
to search for the shared library.  Using `@load' is completely
equivalent to using the `-l' command-line option.

   If the shared library is not initially found in `AWKLIBPATH', another
search is conducted after appending the platform's default shared
library suffix to the filename.  For example, on GNU/Linux systems, the
suffix `.so' is used.

     $ gawk '@load "ordchr"; BEGIN {print chr(65)}'
     -| A

This is equivalent to the following example:

     $ gawk -lordchr 'BEGIN {print chr(65)}'
     -| A

For command-line usage, the `-l' option is more convenient, but `@load'
is useful for embedding inside an `awk' source file that requires
access to a shared library.

   *note Dynamic Extensions::, describes how to write extensions (in C
or C++) that can be loaded with either `@load' or the `-l' option.


File: gawk.info,  Node: Obsolete,  Next: Undocumented,  Prev: Loading Shared Libraries,  Up: Invoking Gawk

2.9 Obsolete Options and/or Features
====================================

This minor node describes features and/or command-line options from
previous releases of `gawk' that are either not available in the
current version or that are still supported but deprecated (meaning that
they will _not_ be in the next release).

   The process-related special files `/dev/pid', `/dev/ppid',
`/dev/pgrpid', and `/dev/user' were deprecated in `gawk' 3.1, but still
worked.  As of version 4.0, they are no longer interpreted specially by
`gawk'.  (Use `PROCINFO' instead; see *note Auto-set::.)


File: gawk.info,  Node: Undocumented,  Prev: Obsolete,  Up: Invoking Gawk

2.10 Undocumented Options and Features
======================================

     Use the Source, Luke!  -- Obi-Wan

   This minor node intentionally left blank.


File: gawk.info,  Node: Regexp,  Next: Reading Files,  Prev: Invoking Gawk,  Up: Top

3 Regular Expressions
*********************

A "regular expression", or "regexp", is a way of describing a set of
strings.  Because regular expressions are such a fundamental part of
`awk' programming, their format and use deserve a separate major node.

   A regular expression enclosed in slashes (`/') is an `awk' pattern
that matches every input record whose text belongs to that set.  The
simplest regular expression is a sequence of letters, numbers, or both.
Such a regexp matches any string that contains that sequence.  Thus,
the regexp `foo' matches any string containing `foo'.  Therefore, the
pattern `/foo/' matches any input record containing the three
characters `foo' _anywhere_ in the record.  Other kinds of regexps let
you specify more complicated classes of strings.

* Menu:

* Regexp Usage::                How to Use Regular Expressions.
* Escape Sequences::            How to write nonprinting characters.
* Regexp Operators::            Regular Expression Operators.
* Bracket Expressions::         What can go between `[...]'.
* GNU Regexp Operators::        Operators specific to GNU software.
* Case-sensitivity::            How to do case-insensitive matching.
* Leftmost Longest::            How much text matches.
* Computed Regexps::            Using Dynamic Regexps.


File: gawk.info,  Node: Regexp Usage,  Next: Escape Sequences,  Up: Regexp

3.1 How to Use Regular Expressions
==================================

A regular expression can be used as a pattern by enclosing it in
slashes.  Then the regular expression is tested against the entire text
of each record.  (Normally, it only needs to match some part of the
text in order to succeed.)  For example, the following prints the
second field of each record that contains the string `foo' anywhere in
it:

     $ awk '/foo/ { print $2 }' BBS-list
     -| 555-1234
     -| 555-6699
     -| 555-6480
     -| 555-2127

   Regular expressions can also be used in matching expressions.  These
expressions allow you to specify the string to match against; it need
not be the entire current input record.  The two operators `~' and `!~'
perform regular expression comparisons.  Expressions using these
operators can be used as patterns, or in `if', `while', `for', and `do'
statements.  (*Note Statements::.)  For example:

     EXP ~ /REGEXP/

is true if the expression EXP (taken as a string) matches REGEXP.  The
following example matches, or selects, all input records with the
uppercase letter `J' somewhere in the first field:

     $ awk '$1 ~ /J/' inventory-shipped
     -| Jan  13  25  15 115
     -| Jun  31  42  75 492
     -| Jul  24  34  67 436
     -| Jan  21  36  64 620

   So does this:

     awk '{ if ($1 ~ /J/) print }' inventory-shipped

   This next example is true if the expression EXP (taken as a
character string) does _not_ match REGEXP:

     EXP !~ /REGEXP/

   The following example matches, or selects, all input records whose
first field _does not_ contain the uppercase letter `J':

     $ awk '$1 !~ /J/' inventory-shipped
     -| Feb  15  32  24 226
     -| Mar  15  24  34 228
     -| Apr  31  52  63 420
     -| May  16  34  29 208
     ...

   When a regexp is enclosed in slashes, such as `/foo/', we call it a
"regexp constant", much like `5.27' is a numeric constant and `"foo"'
is a string constant.


File: gawk.info,  Node: Escape Sequences,  Next: Regexp Operators,  Prev: Regexp Usage,  Up: Regexp

3.2 Escape Sequences
====================

Some characters cannot be included literally in string constants
(`"foo"') or regexp constants (`/foo/').  Instead, they should be
represented with "escape sequences", which are character sequences
beginning with a backslash (`\').  One use of an escape sequence is to
include a double-quote character in a string constant.  Because a plain
double quote ends the string, you must use `\"' to represent an actual
double-quote character as a part of the string.  For example:

     $ awk 'BEGIN { print "He said \"hi!\" to her." }'
     -| He said "hi!" to her.

   The  backslash character itself is another character that cannot be
included normally; you must write `\\' to put one backslash in the
string or regexp.  Thus, the string whose contents are the two
characters `"' and `\' must be written `"\"\\"'.

   Other escape sequences represent unprintable characters such as TAB
or newline.  While there is nothing to stop you from entering most
unprintable characters directly in a string constant or regexp constant,
they may look ugly.

   The following table lists all the escape sequences used in `awk' and
what they represent. Unless noted otherwise, all these escape sequences
apply to both string constants and regexp constants:

`\\'
     A literal backslash, `\'.

`\a'
     The "alert" character, `Ctrl-g', ASCII code 7 (BEL).  (This
     usually makes some sort of audible noise.)

`\b'
     Backspace, `Ctrl-h', ASCII code 8 (BS).

`\f'
     Formfeed, `Ctrl-l', ASCII code 12 (FF).

`\n'
     Newline, `Ctrl-j', ASCII code 10 (LF).

`\r'
     Carriage return, `Ctrl-m', ASCII code 13 (CR).

`\t'
     Horizontal TAB, `Ctrl-i', ASCII code 9 (HT).

`\v'
     Vertical tab, `Ctrl-k', ASCII code 11 (VT).

`\NNN'
     The octal value NNN, where NNN stands for 1 to 3 digits between
     `0' and `7'.  For example, the code for the ASCII ESC (escape)
     character is `\033'.

`\xHH...'
     The hexadecimal value HH, where HH stands for a sequence of
     hexadecimal digits (`0'-`9', and either `A'-`F' or `a'-`f').  Like
     the same construct in ISO C, the escape sequence continues until
     the first nonhexadecimal digit is seen. (c.e.)  However, using
     more than two hexadecimal digits produces undefined results. (The
     `\x' escape sequence is not allowed in POSIX `awk'.)

`\/'
     A literal slash (necessary for regexp constants only).  This
     sequence is used when you want to write a regexp constant that
     contains a slash. Because the regexp is delimited by slashes, you
     need to escape the slash that is part of the pattern, in order to
     tell `awk' to keep processing the rest of the regexp.

`\"'
     A literal double quote (necessary for string constants only).
     This sequence is used when you want to write a string constant
     that contains a double quote. Because the string is delimited by
     double quotes, you need to escape the quote that is part of the
     string, in order to tell `awk' to keep processing the rest of the
     string.

   In `gawk', a number of additional two-character sequences that begin
with a backslash have special meaning in regexps.  *Note GNU Regexp
Operators::.

   In a regexp, a backslash before any character that is not in the
previous list and not listed in *note GNU Regexp Operators::, means
that the next character should be taken literally, even if it would
normally be a regexp operator.  For example, `/a\+b/' matches the three
characters `a+b'.

   For complete portability, do not use a backslash before any
character not shown in the previous list.

   To summarize:

   * The escape sequences in the table above are always processed first,
     for both string constants and regexp constants. This happens very
     early, as soon as `awk' reads your program.

   * `gawk' processes both regexp constants and dynamic regexps (*note
     Computed Regexps::), for the special operators listed in *note GNU
     Regexp Operators::.

   * A backslash before any other character means to treat that
     character literally.

                  Backslash Before Regular Characters

   If you place a backslash in a string constant before something that
is not one of the characters previously listed, POSIX `awk' purposely
leaves what happens as undefined.  There are two choices:

Strip the backslash out
     This is what Brian Kernighan's `awk' and `gawk' both do.  For
     example, `"a\qc"' is the same as `"aqc"'.  (Because this is such
     an easy bug both to introduce and to miss, `gawk' warns you about
     it.)  Consider `FS = "[ \t]+\|[ \t]+"' to use vertical bars
     surrounded by whitespace as the field separator. There should be
     two backslashes in the string: `FS = "[ \t]+\\|[ \t]+"'.)

Leave the backslash alone
     Some other `awk' implementations do this.  In such
     implementations, typing `"a\qc"' is the same as typing `"a\\qc"'.

                  Escape Sequences for Metacharacters

   Suppose you use an octal or hexadecimal escape to represent a regexp
metacharacter.  (See *note Regexp Operators::.)  Does `awk' treat the
character as a literal character or as a regexp operator?

   Historically, such characters were taken literally.  (d.c.)
However, the POSIX standard indicates that they should be treated as
real metacharacters, which is what `gawk' does.  In compatibility mode
(*note Options::), `gawk' treats the characters represented by octal
and hexadecimal escape sequences literally when used in regexp
constants. Thus, `/a\52b/' is equivalent to `/a\*b/'.


File: gawk.info,  Node: Regexp Operators,  Next: Bracket Expressions,  Prev: Escape Sequences,  Up: Regexp

3.3 Regular Expression Operators
================================

You can combine regular expressions with special characters, called
"regular expression operators" or "metacharacters", to increase the
power and versatility of regular expressions.

   The escape sequences described in *note Escape Sequences::, are
valid inside a regexp.  They are introduced by a `\' and are recognized
and converted into corresponding real characters as the very first step
in processing regexps.

   Here is a list of metacharacters.  All characters that are not escape
sequences and that are not listed in the table stand for themselves:

`\'
     This is used to suppress the special meaning of a character when
     matching.  For example, `\$' matches the character `$'.

`^'
     This matches the beginning of a string.  For example, `^@chapter'
     matches `@chapter' at the beginning of a string and can be used to
     identify chapter beginnings in Texinfo source files.  The `^' is
     known as an "anchor", because it anchors the pattern to match only
     at the beginning of the string.

     It is important to realize that `^' does not match the beginning of
     a line embedded in a string.  The condition is not true in the
     following example:

          if ("line1\nLINE 2" ~ /^L/) ...

`$'
     This is similar to `^', but it matches only at the end of a string.
     For example, `p$' matches a record that ends with a `p'.  The `$'
     is an anchor and does not match the end of a line embedded in a
     string.  The condition in the following example is not true:

          if ("line1\nLINE 2" ~ /1$/) ...

`. (period)'
     This matches any single character, _including_ the newline
     character.  For example, `.P' matches any single character
     followed by a `P' in a string.  Using concatenation, we can make a
     regular expression such as `U.A', which matches any
     three-character sequence that begins with `U' and ends with `A'.

     In strict POSIX mode (*note Options::), `.' does not match the NUL
     character, which is a character with all bits equal to zero.
     Otherwise, NUL is just another character. Other versions of `awk'
     may not be able to match the NUL character.

`[...]'
     This is called a "bracket expression".(1) It matches any _one_ of
     the characters that are enclosed in the square brackets.  For
     example, `[MVX]' matches any one of the characters `M', `V', or
     `X' in a string.  A full discussion of what can be inside the
     square brackets of a bracket expression is given in *note Bracket
     Expressions::.

`[^ ...]'
     This is a "complemented bracket expression".  The first character
     after the `[' _must_ be a `^'.  It matches any characters _except_
     those in the square brackets.  For example, `[^awk]' matches any
     character that is not an `a', `w', or `k'.

`|'
     This is the "alternation operator" and it is used to specify
     alternatives.  The `|' has the lowest precedence of all the regular
     expression operators.  For example, `^P|[[:digit:]]' matches any
     string that matches either `^P' or `[[:digit:]]'.  This means it
     matches any string that starts with `P' or contains a digit.

     The alternation applies to the largest possible regexps on either
     side.

`(...)'
     Parentheses are used for grouping in regular expressions, as in
     arithmetic.  They can be used to concatenate regular expressions
     containing the alternation operator, `|'.  For example,
     `@(samp|code)\{[^}]+\}' matches both `@code{foo}' and `@samp{bar}'.
     (These are Texinfo formatting control sequences. The `+' is
     explained further on in this list.)

`*'
     This symbol means that the preceding regular expression should be
     repeated as many times as necessary to find a match.  For example,
     `ph*' applies the `*' symbol to the preceding `h' and looks for
     matches of one `p' followed by any number of `h's.  This also
     matches just `p' if no `h's are present.

     The `*' repeats the _smallest_ possible preceding expression.
     (Use parentheses if you want to repeat a larger expression.)  It
     finds as many repetitions as possible.  For example, `awk
     '/\(c[ad][ad]*r x\)/ { print }' sample' prints every record in
     `sample' containing a string of the form `(car x)', `(cdr x)',
     `(cadr x)', and so on.  Notice the escaping of the parentheses by
     preceding them with backslashes.

`+'
     This symbol is similar to `*', except that the preceding
     expression must be matched at least once.  This means that `wh+y'
     would match `why' and `whhy', but not `wy', whereas `wh*y' would
     match all three of these strings.  The following is a simpler way
     of writing the last `*' example:

          awk '/\(c[ad]+r x\)/ { print }' sample

`?'
     This symbol is similar to `*', except that the preceding
     expression can be matched either once or not at all.  For example,
     `fe?d' matches `fed' and `fd', but nothing else.

`{N}'
`{N,}'
`{N,M}'
     One or two numbers inside braces denote an "interval expression".
     If there is one number in the braces, the preceding regexp is
     repeated N times.  If there are two numbers separated by a comma,
     the preceding regexp is repeated N to M times.  If there is one
     number followed by a comma, then the preceding regexp is repeated
     at least N times:

    `wh{3}y'
          Matches `whhhy', but not `why' or `whhhhy'.

    `wh{3,5}y'
          Matches `whhhy', `whhhhy', or `whhhhhy', only.

    `wh{2,}y'
          Matches `whhy' or `whhhy', and so on.

     Interval expressions were not traditionally available in `awk'.
     They were added as part of the POSIX standard to make `awk' and
     `egrep' consistent with each other.

     Initially, because old programs may use `{' and `}' in regexp
     constants, `gawk' did _not_ match interval expressions in regexps.

     However, beginning with version 4.0, `gawk' does match interval
     expressions by default.  This is because compatibility with POSIX
     has become more important to most `gawk' users than compatibility
     with old programs.

     For programs that use `{' and `}' in regexp constants, it is good
     practice to always escape them with a backslash.  Then the regexp
     constants are valid and work the way you want them to, using any
     version of `awk'.(2)

     Finally, when `{' and `}' appear in regexp constants in a way that
     cannot be interpreted as an interval expression (such as
     `/q{a}/'), then they stand for themselves.

   In regular expressions, the `*', `+', and `?' operators, as well as
the braces `{' and `}', have the highest precedence, followed by
concatenation, and finally by `|'.  As in arithmetic, parentheses can
change how operators are grouped.

   In POSIX `awk' and `gawk', the `*', `+', and `?' operators stand for
themselves when there is nothing in the regexp that precedes them.  For
example, `/+/' matches a literal plus sign.  However, many other
versions of `awk' treat such a usage as a syntax error.

   If `gawk' is in compatibility mode (*note Options::), interval
expressions are not available in regular expressions.

   ---------- Footnotes ----------

   (1) In other literature, you may see a bracket expression referred
to as either a "character set", a "character class", or a "character
list".

   (2) Use two backslashes if you're using a string constant with a
regexp operator or function.


File: gawk.info,  Node: Bracket Expressions,  Next: GNU Regexp Operators,  Prev: Regexp Operators,  Up: Regexp

3.4 Using Bracket Expressions
=============================

As mentioned earlier, a bracket expression matches any character amongst
those listed between the opening and closing square brackets.

   Within a bracket expression, a "range expression" consists of two
characters separated by a hyphen.  It matches any single character that
sorts between the two characters, based upon the system's native
character set.  For example, `[0-9]' is equivalent to `[0123456789]'.
(See *note Ranges and Locales::, for an explanation of how the POSIX
standard and `gawk' have changed over time.  This is mainly of
historical interest.)

   To include one of the characters `\', `]', `-', or `^' in a bracket
expression, put a `\' in front of it.  For example:

     [d\]]

matches either `d' or `]'.

   This treatment of `\' in bracket expressions is compatible with
other `awk' implementations and is also mandated by POSIX.  The regular
expressions in `awk' are a superset of the POSIX specification for
Extended Regular Expressions (EREs).  POSIX EREs are based on the
regular expressions accepted by the traditional `egrep' utility.

   "Character classes" are a feature introduced in the POSIX standard.
A character class is a special notation for describing lists of
characters that have a specific attribute, but the actual characters
can vary from country to country and/or from character set to character
set.  For example, the notion of what is an alphabetic character
differs between the United States and France.

   A character class is only valid in a regexp _inside_ the brackets of
a bracket expression.  Character classes consist of `[:', a keyword
denoting the class, and `:]'.  *note table-char-classes:: lists the
character classes defined by the POSIX standard.

Class       Meaning
-------------------------------------------------------------------------- 
`[:alnum:]' Alphanumeric characters.
`[:alpha:]' Alphabetic characters.
`[:blank:]' Space and TAB characters.
`[:cntrl:]' Control characters.
`[:digit:]' Numeric characters.
`[:graph:]' Characters that are both printable and visible.  (A space is
            printable but not visible, whereas an `a' is both.)
`[:lower:]' Lowercase alphabetic characters.
`[:print:]' Printable characters (characters that are not control
            characters).
`[:punct:]' Punctuation characters (characters that are not letters,
            digits, control characters, or space characters).
`[:space:]' Space characters (such as space, TAB, and formfeed, to name
            a few).
`[:upper:]' Uppercase alphabetic characters.
`[:xdigit:]'Characters that are hexadecimal digits.

Table 3.1: POSIX Character Classes

   For example, before the POSIX standard, you had to write
`/[A-Za-z0-9]/' to match alphanumeric characters.  If your character
set had other alphabetic characters in it, this would not match them.
With the POSIX character classes, you can write `/[[:alnum:]]/' to
match the alphabetic and numeric characters in your character set.

   Two additional special sequences can appear in bracket expressions.
These apply to non-ASCII character sets, which can have single symbols
(called "collating elements") that are represented with more than one
character. They can also have several characters that are equivalent for
"collating", or sorting, purposes.  (For example, in French, a plain "e"
and a grave-accented "e`" are equivalent.)  These sequences are:

Collating symbols
     Multicharacter collating elements enclosed between `[.' and `.]'.
     For example, if `ch' is a collating element, then `[[.ch.]]' is a
     regexp that matches this collating element, whereas `[ch]' is a
     regexp that matches either `c' or `h'.

Equivalence classes
     Locale-specific names for a list of characters that are equal. The
     name is enclosed between `[=' and `=]'.  For example, the name `e'
     might be used to represent all of "e," "e`," and "e'." In this
     case, `[[=e=]]' is a regexp that matches any of `e', `e'', or `e`'.

   These features are very valuable in non-English-speaking locales.

     CAUTION: The library functions that `gawk' uses for regular
     expression matching currently recognize only POSIX character
     classes; they do not recognize collating symbols or equivalence
     classes.


File: gawk.info,  Node: GNU Regexp Operators,  Next: Case-sensitivity,  Prev: Bracket Expressions,  Up: Regexp

3.5 `gawk'-Specific Regexp Operators
====================================

GNU software that deals with regular expressions provides a number of
additional regexp operators.  These operators are described in this
minor node and are specific to `gawk'; they are not available in other
`awk' implementations.  Most of the additional operators deal with word
matching.  For our purposes, a "word" is a sequence of one or more
letters, digits, or underscores (`_'):

`\s'
     Matches any whitespace character.  Think of it as shorthand for
     `[[:space:]]'.

`\S'
     Matches any character that is not whitespace.  Think of it as
     shorthand for `[^[:space:]]'.

`\w'
     Matches any word-constituent character--that is, it matches any
     letter, digit, or underscore. Think of it as shorthand for
     `[[:alnum:]_]'.

`\W'
     Matches any character that is not word-constituent.  Think of it
     as shorthand for `[^[:alnum:]_]'.

`\<'
     Matches the empty string at the beginning of a word.  For example,
     `/\<away/' matches `away' but not `stowaway'.

`\>'
     Matches the empty string at the end of a word.  For example,
     `/stow\>/' matches `stow' but not `stowaway'.

`\y'
     Matches the empty string at either the beginning or the end of a
     word (i.e., the word boundar*y*).  For example, `\yballs?\y'
     matches either `ball' or `balls', as a separate word.

`\B'
     Matches the empty string that occurs between two word-constituent
     characters. For example, `/\Brat\B/' matches `crate' but it does
     not match `dirty rat'.  `\B' is essentially the opposite of `\y'.

   There are two other operators that work on buffers.  In Emacs, a
"buffer" is, naturally, an Emacs buffer.  For other programs, `gawk''s
regexp library routines consider the entire string to match as the
buffer.  The operators are:

`\`'
     Matches the empty string at the beginning of a buffer (string).

`\''
     Matches the empty string at the end of a buffer (string).

   Because `^' and `$' always work in terms of the beginning and end of
strings, these operators don't add any new capabilities for `awk'.
They are provided for compatibility with other GNU software.

   In other GNU software, the word-boundary operator is `\b'. However,
that conflicts with the `awk' language's definition of `\b' as
backspace, so `gawk' uses a different letter.  An alternative method
would have been to require two backslashes in the GNU operators, but
this was deemed too confusing. The current method of using `\y' for the
GNU `\b' appears to be the lesser of two evils.

   The various command-line options (*note Options::) control how
`gawk' interprets characters in regexps:

No options
     In the default case, `gawk' provides all the facilities of POSIX
     regexps and the GNU regexp operators described in *note Regexp
     Operators::.

`--posix'
     Only POSIX regexps are supported; the GNU operators are not special
     (e.g., `\w' matches a literal `w').  Interval expressions are
     allowed.

`--traditional'
     Traditional Unix `awk' regexps are matched. The GNU operators are
     not special, and interval expressions are not available.  The
     POSIX character classes (`[[:alnum:]]', etc.) are supported, as
     Brian Kernighan's `awk' does support them.  Characters described
     by octal and hexadecimal escape sequences are treated literally,
     even if they represent regexp metacharacters.

`--re-interval'
     Allow interval expressions in regexps, if `--traditional' has been
     provided.  Otherwise, interval expressions are available by
     default.


File: gawk.info,  Node: Case-sensitivity,  Next: Leftmost Longest,  Prev: GNU Regexp Operators,  Up: Regexp

3.6 Case Sensitivity in Matching
================================

Case is normally significant in regular expressions, both when matching
ordinary characters (i.e., not metacharacters) and inside bracket
expressions.  Thus, a `w' in a regular expression matches only a
lowercase `w' and not an uppercase `W'.

   The simplest way to do a case-independent match is to use a bracket
expression--for example, `[Ww]'.  However, this can be cumbersome if
you need to use it often, and it can make the regular expressions harder
to read.  There are two alternatives that you might prefer.

   One way to perform a case-insensitive match at a particular point in
the program is to convert the data to a single case, using the
`tolower()' or `toupper()' built-in string functions (which we haven't
discussed yet; *note String Functions::).  For example:

     tolower($1) ~ /foo/  { ... }

converts the first field to lowercase before matching against it.  This
works in any POSIX-compliant `awk'.

   Another method, specific to `gawk', is to set the variable
`IGNORECASE' to a nonzero value (*note Built-in Variables::).  When
`IGNORECASE' is not zero, _all_ regexp and string operations ignore
case.  Changing the value of `IGNORECASE' dynamically controls the
case-sensitivity of the program as it runs.  Case is significant by
default because `IGNORECASE' (like most variables) is initialized to
zero:

     x = "aB"
     if (x ~ /ab/) ...   # this test will fail

     IGNORECASE = 1
     if (x ~ /ab/) ...   # now it will succeed

   In general, you cannot use `IGNORECASE' to make certain rules
case-insensitive and other rules case-sensitive, because there is no
straightforward way to set `IGNORECASE' just for the pattern of a
particular rule.(1) To do this, use either bracket expressions or
`tolower()'.  However, one thing you can do with `IGNORECASE' only is
dynamically turn case-sensitivity on or off for all the rules at once.

   `IGNORECASE' can be set on the command line or in a `BEGIN' rule
(*note Other Arguments::; also *note Using BEGIN/END::).  Setting
`IGNORECASE' from the command line is a way to make a program
case-insensitive without having to edit it.

   Both regexp and string comparison operations are affected by
`IGNORECASE'.

   In multibyte locales, the equivalences between upper- and lowercase
characters are tested based on the wide-character values of the
locale's character set.  Otherwise, the characters are tested based on
the ISO-8859-1 (ISO Latin-1) character set. This character set is a
superset of the traditional 128 ASCII characters, which also provides a
number of characters suitable for use with European languages.(2)

   The value of `IGNORECASE' has no effect if `gawk' is in
compatibility mode (*note Options::).  Case is always significant in
compatibility mode.

   ---------- Footnotes ----------

   (1) Experienced C and C++ programmers will note that it is possible,
using something like `IGNORECASE = 1 && /foObAr/ { ... }' and
`IGNORECASE = 0 || /foobar/ { ... }'.  However, this is somewhat
obscure and we don't recommend it.

   (2) If you don't understand this, don't worry about it; it just
means that `gawk' does the right thing.


File: gawk.info,  Node: Leftmost Longest,  Next: Computed Regexps,  Prev: Case-sensitivity,  Up: Regexp

3.7 How Much Text Matches?
==========================

Consider the following:

     echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }'

   This example uses the `sub()' function (which we haven't discussed
yet; *note String Functions::) to make a change to the input record.
Here, the regexp `/a+/' indicates "one or more `a' characters," and the
replacement text is `<A>'.

   The input contains four `a' characters.  `awk' (and POSIX) regular
expressions always match the leftmost, _longest_ sequence of input
characters that can match.  Thus, all four `a' characters are replaced
with `<A>' in this example:

     $ echo aaaabcd | awk '{ sub(/a+/, "<A>"); print }'
     -| <A>bcd

   For simple match/no-match tests, this is not so important. But when
doing text matching and substitutions with the `match()', `sub()',
`gsub()', and `gensub()' functions, it is very important.  *Note String
Functions::, for more information on these functions.  Understanding
this principle is also important for regexp-based record and field
splitting (*note Records::, and also *note Field Separators::).


File: gawk.info,  Node: Computed Regexps,  Prev: Leftmost Longest,  Up: Regexp

3.8 Using Dynamic Regexps
=========================

The righthand side of a `~' or `!~' operator need not be a regexp
constant (i.e., a string of characters between slashes).  It may be any
expression.  The expression is evaluated and converted to a string if
necessary; the contents of the string are then used as the regexp.  A
regexp computed in this way is called a "dynamic regexp":

     BEGIN { digits_regexp = "[[:digit:]]+" }
     $0 ~ digits_regexp    { print }

This sets `digits_regexp' to a regexp that describes one or more digits,
and tests whether the input record matches this regexp.

     NOTE: When using the `~' and `!~' operators, there is a difference
     between a regexp constant enclosed in slashes and a string
     constant enclosed in double quotes.  If you are going to use a
     string constant, you have to understand that the string is, in
     essence, scanned _twice_: the first time when `awk' reads your
     program, and the second time when it goes to match the string on
     the lefthand side of the operator with the pattern on the right.
     This is true of any string-valued expression (such as
     `digits_regexp', shown previously), not just string constants.

   What difference does it make if the string is scanned twice? The
answer has to do with escape sequences, and particularly with
backslashes.  To get a backslash into a regular expression inside a
string, you have to type two backslashes.

   For example, `/\*/' is a regexp constant for a literal `*'.  Only
one backslash is needed.  To do the same thing with a string, you have
to type `"\\*"'.  The first backslash escapes the second one so that
the string actually contains the two characters `\' and `*'.

   Given that you can use both regexp and string constants to describe
regular expressions, which should you use?  The answer is "regexp
constants," for several reasons:

   * String constants are more complicated to write and more difficult
     to read. Using regexp constants makes your programs less
     error-prone.  Not understanding the difference between the two
     kinds of constants is a common source of errors.

   * It is more efficient to use regexp constants. `awk' can note that
     you have supplied a regexp and store it internally in a form that
     makes pattern matching more efficient.  When using a string
     constant, `awk' must first convert the string into this internal
     form and then perform the pattern matching.

   * Using regexp constants is better form; it shows clearly that you
     intend a regexp match.

         Using `\n' in Bracket Expressions of Dynamic Regexps

   Some commercial versions of `awk' do not allow the newline character
to be used inside a bracket expression for a dynamic regexp:

     $ awk '$0 ~ "[ \t\n]"'
     error--> awk: newline in character class [
     error--> ]...
     error-->  source line number 1
     error-->  context is
     error-->          >>>  <<<

   But a newline in a regexp constant works with no problem:

     $ awk '$0 ~ /[ \t\n]/'
     here is a sample line
     -| here is a sample line
     Ctrl-d

   `gawk' does not have this problem, and it isn't likely to occur
often in practice, but it's worth noting for future reference.


File: gawk.info,  Node: Reading Files,  Next: Printing,  Prev: Regexp,  Up: Top

4 Reading Input Files
*********************

In the typical `awk' program, `awk' reads all input either from the
standard input (by default, this is the keyboard, but often it is a
pipe from another command) or from files whose names you specify on the
`awk' command line.  If you specify input files, `awk' reads them in
order, processing all the data from one before going on to the next.
The name of the current input file can be found in the built-in variable
`FILENAME' (*note Built-in Variables::).

   The input is read in units called "records", and is processed by the
rules of your program one record at a time.  By default, each record is
one line.  Each record is automatically split into chunks called
"fields".  This makes it more convenient for programs to work on the
parts of a record.

   On rare occasions, you may need to use the `getline' command.  The
`getline' command is valuable, both because it can do explicit input
from any number of files, and because the files used with it do not
have to be named on the `awk' command line (*note Getline::).

* Menu:

* Records::                     Controlling how data is split into records.
* Fields::                      An introduction to fields.
* Nonconstant Fields::          Nonconstant Field Numbers.
* Changing Fields::             Changing the Contents of a Field.
* Field Separators::            The field separator and how to change it.
* Constant Size::               Reading constant width data.
* Splitting By Content::        Defining Fields By Content
* Multiple Line::               Reading multiline records.
* Getline::                     Reading files under explicit program control
                                using the `getline' function.
* Read Timeout::                Reading input with a timeout.
* Command line directories::    What happens if you put a directory on the
                                command line.


File: gawk.info,  Node: Records,  Next: Fields,  Up: Reading Files

4.1 How Input Is Split into Records
===================================

The `awk' utility divides the input for your `awk' program into records
and fields.  `awk' keeps track of the number of records that have been
read so far from the current input file.  This value is stored in a
built-in variable called `FNR'.  It is reset to zero when a new file is
started.  Another built-in variable, `NR', records the total number of
input records read so far from all data files.  It starts at zero, but
is never automatically reset to zero.

   Records are separated by a character called the "record separator".
By default, the record separator is the newline character.  This is why
records are, by default, single lines.  A different character can be
used for the record separator by assigning the character to the
built-in variable `RS'.

   Like any other variable, the value of `RS' can be changed in the
`awk' program with the assignment operator, `=' (*note Assignment
Ops::).  The new record-separator character should be enclosed in
quotation marks, which indicate a string constant.  Often the right
time to do this is at the beginning of execution, before any input is
processed, so that the very first record is read with the proper
separator.  To do this, use the special `BEGIN' pattern (*note
BEGIN/END::).  For example:

     awk 'BEGIN { RS = "/" }
          { print $0 }' BBS-list

changes the value of `RS' to `"/"', before reading any input.  This is
a string whose first character is a slash; as a result, records are
separated by slashes.  Then the input file is read, and the second rule
in the `awk' program (the action with no pattern) prints each record.
Because each `print' statement adds a newline at the end of its output,
this `awk' program copies the input with each slash changed to a
newline.  Here are the results of running the program on `BBS-list':

     $ awk 'BEGIN { RS = "/" }
     >      { print $0 }' BBS-list
     -| aardvark     555-5553     1200
     -| 300          B
     -| alpo-net     555-3412     2400
     -| 1200
     -| 300     A
     -| barfly       555-7685     1200
     -| 300          A
     -| bites        555-1675     2400
     -| 1200
     -| 300     A
     -| camelot      555-0542     300               C
     -| core         555-2912     1200
     -| 300          C
     -| fooey        555-1234     2400
     -| 1200
     -| 300     B
     -| foot         555-6699     1200
     -| 300          B
     -| macfoo       555-6480     1200
     -| 300          A
     -| sdace        555-3430     2400
     -| 1200
     -| 300     A
     -| sabafoo      555-2127     1200
     -| 300          C
     -|

Note that the entry for the `camelot' BBS is not split.  In the
original data file (*note Sample Data Files::), the line looks like
this:

     camelot      555-0542     300               C

It has one baud rate only, so there are no slashes in the record,
unlike the others which have two or more baud rates.  In fact, this
record is treated as part of the record for the `core' BBS; the newline
separating them in the output is the original newline in the data file,
not the one added by `awk' when it printed the record!

   Another way to change the record separator is on the command line,
using the variable-assignment feature (*note Other Arguments::):

     awk '{ print $0 }' RS="/" BBS-list

This sets `RS' to `/' before processing `BBS-list'.

   Using an unusual character such as `/' for the record separator
produces correct behavior in the vast majority of cases.

   There is one unusual case, that occurs when `gawk' is being fully
POSIX-compliant (*note Options::).  Then, the following (extreme)
pipeline prints a surprising `1':

     $ echo | gawk --posix 'BEGIN { RS = "a" } ; { print NF }'
     -| 1

   There is one field, consisting of a newline.  The value of the
built-in variable `NF' is the number of fields in the current record.
(In the normal case, `gawk' treats the newline as whitespace, printing
`0' as the result. Most other versions of `awk' also act this way.)

   Reaching the end of an input file terminates the current input
record, even if the last character in the file is not the character in
`RS'.  (d.c.)

   The empty string `""' (a string without any characters) has a
special meaning as the value of `RS'. It means that records are
separated by one or more blank lines and nothing else.  *Note Multiple
Line::, for more details.

   If you change the value of `RS' in the middle of an `awk' run, the
new value is used to delimit subsequent records, but the record
currently being processed, as well as records already processed, are not
affected.

   After the end of the record has been determined, `gawk' sets the
variable `RT' to the text in the input that matched `RS'.

   When using `gawk', the value of `RS' is not limited to a
one-character string.  It can be any regular expression (*note
Regexp::). (c.e.)  In general, each record ends at the next string that
matches the regular expression; the next record starts at the end of
the matching string.  This general rule is actually at work in the
usual case, where `RS' contains just a newline: a record ends at the
beginning of the next matching string (the next newline in the input),
and the following record starts just after the end of this string (at
the first character of the following line).  The newline, because it
matches `RS', is not part of either record.

   When `RS' is a single character, `RT' contains the same single
character. However, when `RS' is a regular expression, `RT' contains
the actual input text that matched the regular expression.

   If the input file ended without any text that matches `RS', `gawk'
sets `RT' to the null string.

   The following example illustrates both of these features.  It sets
`RS' equal to a regular expression that matches either a newline or a
series of one or more uppercase letters with optional leading and/or
trailing whitespace:

     $ echo record 1 AAAA record 2 BBBB record 3 |
     > gawk 'BEGIN { RS = "\n|( *[[:upper:]]+ *)" }
     >             { print "Record =", $0, "and RT =", RT }'
     -| Record = record 1 and RT =  AAAA
     -| Record = record 2 and RT =  BBBB
     -| Record = record 3 and RT =
     -|

The final line of output has an extra blank line. This is because the
value of `RT' is a newline, and the `print' statement supplies its own
terminating newline.  *Note Simple Sed::, for a more useful example of
`RS' as a regexp and `RT'.

   If you set `RS' to a regular expression that allows optional
trailing text, such as `RS = "abc(XYZ)?"' it is possible, due to
implementation constraints, that `gawk' may match the leading part of
the regular expression, but not the trailing part, particularly if the
input text that could match the trailing part is fairly long.  `gawk'
attempts to avoid this problem, but currently, there's no guarantee
that this will never happen.

     NOTE: Remember that in `awk', the `^' and `$' anchor
     metacharacters match the beginning and end of a _string_, and not
     the beginning and end of a _line_.  As a result, something like
     `RS = "^[[:upper:]]"' can only match at the beginning of a file.
     This is because `gawk' views the input file as one long string
     that happens to contain newline characters in it.  It is thus best
     to avoid anchor characters in the value of `RS'.

   The use of `RS' as a regular expression and the `RT' variable are
`gawk' extensions; they are not available in compatibility mode (*note
Options::).  In compatibility mode, only the first character of the
value of `RS' is used to determine the end of the record.

                      `RS = "\0"' Is Not Portable

   There are times when you might want to treat an entire data file as a
single record.  The only way to make this happen is to give `RS' a
value that you know doesn't occur in the input file.  This is hard to
do in a general way, such that a program always works for arbitrary
input files.

   You might think that for text files, the NUL character, which
consists of a character with all bits equal to zero, is a good value to
use for `RS' in this case:

     BEGIN { RS = "\0" }  # whole file becomes one record?

   `gawk' in fact accepts this, and uses the NUL character for the
record separator.  However, this usage is _not_ portable to other `awk'
implementations.

   All other `awk' implementations(1) store strings internally as
C-style strings.  C strings use the NUL character as the string
terminator.  In effect, this means that `RS = "\0"' is the same as `RS
= ""'.  (d.c.)

   The best way to treat a whole file as a single record is to simply
read the file in, one record at a time, concatenating each record onto
the end of the previous ones.

   ---------- Footnotes ----------

   (1) At least that we know about.


File: gawk.info,  Node: Fields,  Next: Nonconstant Fields,  Prev: Records,  Up: Reading Files

4.2 Examining Fields
====================

When `awk' reads an input record, the record is automatically "parsed"
or separated by the `awk' utility into chunks called "fields".  By
default, fields are separated by "whitespace", like words in a line.
Whitespace in `awk' means any string of one or more spaces, TABs, or
newlines;(1) other characters, such as formfeed, vertical tab, etc.,
that are considered whitespace by other languages, are _not_ considered
whitespace by `awk'.

   The purpose of fields is to make it more convenient for you to refer
to these pieces of the record.  You don't have to use them--you can
operate on the whole record if you want--but fields are what make
simple `awk' programs so powerful.

   A dollar-sign (`$') is used to refer to a field in an `awk' program,
followed by the number of the field you want.  Thus, `$1' refers to the
first field, `$2' to the second, and so on.  (Unlike the Unix shells,
the field numbers are not limited to single digits.  `$127' is the one
hundred twenty-seventh field in the record.)  For example, suppose the
following is a line of input:

     This seems like a pretty nice example.

Here the first field, or `$1', is `This', the second field, or `$2', is
`seems', and so on.  Note that the last field, `$7', is `example.'.
Because there is no space between the `e' and the `.', the period is
considered part of the seventh field.

   `NF' is a built-in variable whose value is the number of fields in
the current record.  `awk' automatically updates the value of `NF' each
time it reads a record.  No matter how many fields there are, the last
field in a record can be represented by `$NF'.  So, `$NF' is the same
as `$7', which is `example.'.  If you try to reference a field beyond
the last one (such as `$8' when the record has only seven fields), you
get the empty string.  (If used in a numeric operation, you get zero.)

   The use of `$0', which looks like a reference to the "zero-th"
field, is a special case: it represents the whole input record when you
are not interested in specific fields.  Here are some more examples:

     $ awk '$1 ~ /foo/ { print $0 }' BBS-list
     -| fooey        555-1234     2400/1200/300     B
     -| foot         555-6699     1200/300          B
     -| macfoo       555-6480     1200/300          A
     -| sabafoo      555-2127     1200/300          C

This example prints each record in the file `BBS-list' whose first
field contains the string `foo'.  The operator `~' is called a
"matching operator" (*note Regexp Usage::); it tests whether a string
(here, the field `$1') matches a given regular expression.

   By contrast, the following example looks for `foo' in _the entire
record_ and prints the first field and the last field for each matching
input record:

     $ awk '/foo/ { print $1, $NF }' BBS-list
     -| fooey B
     -| foot B
     -| macfoo A
     -| sabafoo C

   ---------- Footnotes ----------

   (1) In POSIX `awk', newlines are not considered whitespace for
separating fields.


File: gawk.info,  Node: Nonconstant Fields,  Next: Changing Fields,  Prev: Fields,  Up: Reading Files

4.3 Nonconstant Field Numbers
=============================

The number of a field does not need to be a constant.  Any expression in
the `awk' language can be used after a `$' to refer to a field.  The
value of the expression specifies the field number.  If the value is a
string, rather than a number, it is converted to a number.  Consider
this example:

     awk '{ print $NR }'

Recall that `NR' is the number of records read so far: one in the first
record, two in the second, etc.  So this example prints the first field
of the first record, the second field of the second record, and so on.
For the twentieth record, field number 20 is printed; most likely, the
record has fewer than 20 fields, so this prints a blank line.  Here is
another example of using expressions as field numbers:

     awk '{ print $(2*2) }' BBS-list

   `awk' evaluates the expression `(2*2)' and uses its value as the
number of the field to print.  The `*' sign represents multiplication,
so the expression `2*2' evaluates to four.  The parentheses are used so
that the multiplication is done before the `$' operation; they are
necessary whenever there is a binary operator in the field-number
expression.  This example, then, prints the hours of operation (the
fourth field) for every line of the file `BBS-list'.  (All of the `awk'
operators are listed, in order of decreasing precedence, in *note
Precedence::.)

   If the field number you compute is zero, you get the entire record.
Thus, `$(2-2)' has the same value as `$0'.  Negative field numbers are
not allowed; trying to reference one usually terminates the program.
(The POSIX standard does not define what happens when you reference a
negative field number.  `gawk' notices this and terminates your
program.  Other `awk' implementations may behave differently.)

   As mentioned in *note Fields::, `awk' stores the current record's
number of fields in the built-in variable `NF' (also *note Built-in
Variables::).  The expression `$NF' is not a special feature--it is the
direct consequence of evaluating `NF' and using its value as a field
number.


File: gawk.info,  Node: Changing Fields,  Next: Field Separators,  Prev: Nonconstant Fields,  Up: Reading Files

4.4 Changing the Contents of a Field
====================================

The contents of a field, as seen by `awk', can be changed within an
`awk' program; this changes what `awk' perceives as the current input
record.  (The actual input is untouched; `awk' _never_ modifies the
input file.)  Consider the following example and its output:

     $ awk '{ nboxes = $3 ; $3 = $3 - 10
     >        print nboxes, $3 }' inventory-shipped
     -| 25 15
     -| 32 22
     -| 24 14
     ...

The program first saves the original value of field three in the
variable `nboxes'.  The `-' sign represents subtraction, so this
program reassigns field three, `$3', as the original value of field
three minus ten: `$3 - 10'.  (*Note Arithmetic Ops::.)  Then it prints
the original and new values for field three.  (Someone in the warehouse
made a consistent mistake while inventorying the red boxes.)

   For this to work, the text in field `$3' must make sense as a
number; the string of characters must be converted to a number for the
computer to do arithmetic on it.  The number resulting from the
subtraction is converted back to a string of characters that then
becomes field three.  *Note Conversion::.

   When the value of a field is changed (as perceived by `awk'), the
text of the input record is recalculated to contain the new field where
the old one was.  In other words, `$0' changes to reflect the altered
field.  Thus, this program prints a copy of the input file, with 10
subtracted from the second field of each line:

     $ awk '{ $2 = $2 - 10; print $0 }' inventory-shipped
     -| Jan 3 25 15 115
     -| Feb 5 32 24 226
     -| Mar 5 24 34 228
     ...

   It is also possible to also assign contents to fields that are out
of range.  For example:

     $ awk '{ $6 = ($5 + $4 + $3 + $2)
     >        print $6 }' inventory-shipped
     -| 168
     -| 297
     -| 301
     ...

We've just created `$6', whose value is the sum of fields `$2', `$3',
`$4', and `$5'.  The `+' sign represents addition.  For the file
`inventory-shipped', `$6' represents the total number of parcels
shipped for a particular month.

   Creating a new field changes `awk''s internal copy of the current
input record, which is the value of `$0'.  Thus, if you do `print $0'
after adding a field, the record printed includes the new field, with
the appropriate number of field separators between it and the previously
existing fields.

   This recomputation affects and is affected by `NF' (the number of
fields; *note Fields::).  For example, the value of `NF' is set to the
number of the highest field you create.  The exact format of `$0' is
also affected by a feature that has not been discussed yet: the "output
field separator", `OFS', used to separate the fields (*note Output
Separators::).

   Note, however, that merely _referencing_ an out-of-range field does
_not_ change the value of either `$0' or `NF'.  Referencing an
out-of-range field only produces an empty string.  For example:

     if ($(NF+1) != "")
         print "can't happen"
     else
         print "everything is normal"

should print `everything is normal', because `NF+1' is certain to be
out of range.  (*Note If Statement::, for more information about
`awk''s `if-else' statements.  *Note Typing and Comparison::, for more
information about the `!=' operator.)

   It is important to note that making an assignment to an existing
field changes the value of `$0' but does not change the value of `NF',
even when you assign the empty string to a field.  For example:

     $ echo a b c d | awk '{ OFS = ":"; $2 = ""
     >                       print $0; print NF }'
     -| a::c:d
     -| 4

The field is still there; it just has an empty value, denoted by the
two colons between `a' and `c'.  This example shows what happens if you
create a new field:

     $ echo a b c d | awk '{ OFS = ":"; $2 = ""; $6 = "new"
     >                       print $0; print NF }'
     -| a::c:d::new
     -| 6

The intervening field, `$5', is created with an empty value (indicated
by the second pair of adjacent colons), and `NF' is updated with the
value six.

   Decrementing `NF' throws away the values of the fields after the new
value of `NF' and recomputes `$0'.  (d.c.)  Here is an example:

     $ echo a b c d e f | awk '{ print "NF =", NF;
     >                            NF = 3; print $0 }'
     -| NF = 6
     -| a b c

     CAUTION: Some versions of `awk' don't rebuild `$0' when `NF' is
     decremented. Caveat emptor.

   Finally, there are times when it is convenient to force `awk' to
rebuild the entire record, using the current value of the fields and
`OFS'.  To do this, use the seemingly innocuous assignment:

     $1 = $1   # force record to be reconstituted
     print $0  # or whatever else with $0

This forces `awk' to rebuild the record.  It does help to add a
comment, as we've shown here.

   There is a flip side to the relationship between `$0' and the
fields.  Any assignment to `$0' causes the record to be reparsed into
fields using the _current_ value of `FS'.  This also applies to any
built-in function that updates `$0', such as `sub()' and `gsub()'
(*note String Functions::).

                          Understanding `$0'

   It is important to remember that `$0' is the _full_ record, exactly
as it was read from the input.  This includes any leading or trailing
whitespace, and the exact whitespace (or other characters) that
separate the fields.

   It is a not-uncommon error to try to change the field separators in
a record simply by setting `FS' and `OFS', and then expecting a plain
`print' or `print $0' to print the modified record.

   But this does not work, since nothing was done to change the record
itself.  Instead, you must force the record to be rebuilt, typically
with a statement such as `$1 = $1', as described earlier.


File: gawk.info,  Node: Field Separators,  Next: Constant Size,  Prev: Changing Fields,  Up: Reading Files

4.5 Specifying How Fields Are Separated
=======================================

* Menu:

* Default Field Splitting::      How fields are normally separated.
* Regexp Field Splitting::       Using regexps as the field separator.
* Single Character Fields::      Making each character a separate field.
* Command Line Field Separator:: Setting `FS' from the command-line.
* Field Splitting Summary::      Some final points and a summary table.

   The "field separator", which is either a single character or a
regular expression, controls the way `awk' splits an input record into
fields.  `awk' scans the input record for character sequences that
match the separator; the fields themselves are the text between the
matches.

   In the examples that follow, we use the bullet symbol (*) to
represent spaces in the output.  If the field separator is `oo', then
the following line:

     moo goo gai pan

is split into three fields: `m', `*g', and `*gai*pan'.  Note the
leading spaces in the values of the second and third fields.

   The field separator is represented by the built-in variable `FS'.
Shell programmers take note:  `awk' does _not_ use the name `IFS' that
is used by the POSIX-compliant shells (such as the Unix Bourne shell,
`sh', or Bash).

   The value of `FS' can be changed in the `awk' program with the
assignment operator, `=' (*note Assignment Ops::).  Often the right
time to do this is at the beginning of execution before any input has
been processed, so that the very first record is read with the proper
separator.  To do this, use the special `BEGIN' pattern (*note
BEGIN/END::).  For example, here we set the value of `FS' to the string
`","':

     awk 'BEGIN { FS = "," } ; { print $2 }'

Given the input line:

     John Q. Smith, 29 Oak St., Walamazoo, MI 42139

this `awk' program extracts and prints the string `*29*Oak*St.'.

   Sometimes the input data contains separator characters that don't
separate fields the way you thought they would.  For instance, the
person's name in the example we just used might have a title or suffix
attached, such as:

     John Q. Smith, LXIX, 29 Oak St., Walamazoo, MI 42139

The same program would extract `*LXIX', instead of `*29*Oak*St.'.  If
you were expecting the program to print the address, you would be
surprised.  The moral is to choose your data layout and separator
characters carefully to prevent such problems.  (If the data is not in
a form that is easy to process, perhaps you can massage it first with a
separate `awk' program.)


File: gawk.info,  Node: Default Field Splitting,  Next: Regexp Field Splitting,  Up: Field Separators

4.5.1 Whitespace Normally Separates Fields
------------------------------------------

Fields are normally separated by whitespace sequences (spaces, TABs,
and newlines), not by single spaces.  Two spaces in a row do not
delimit an empty field.  The default value of the field separator `FS'
is a string containing a single space, `" "'.  If `awk' interpreted
this value in the usual way, each space character would separate
fields, so two spaces in a row would make an empty field between them.
The reason this does not happen is that a single space as the value of
`FS' is a special case--it is taken to specify the default manner of
delimiting fields.

   If `FS' is any other single character, such as `","', then each
occurrence of that character separates two fields.  Two consecutive
occurrences delimit an empty field.  If the character occurs at the
beginning or the end of the line, that too delimits an empty field.  The
space character is the only single character that does not follow these
rules.


File: gawk.info,  Node: Regexp Field Splitting,  Next: Single Character Fields,  Prev: Default Field Splitting,  Up: Field Separators

4.5.2 Using Regular Expressions to Separate Fields
--------------------------------------------------

The previous node discussed the use of single characters or simple
strings as the value of `FS'.  More generally, the value of `FS' may be
a string containing any regular expression.  In this case, each match
in the record for the regular expression separates fields.  For
example, the assignment:

     FS = ", \t"

makes every area of an input line that consists of a comma followed by a
space and a TAB into a field separator.  (`\t' is an "escape sequence"
that stands for a TAB; *note Escape Sequences::, for the complete list
of similar escape sequences.)

   For a less trivial example of a regular expression, try using single
spaces to separate fields the way single commas are used.  `FS' can be
set to `"[ ]"' (left bracket, space, right bracket).  This regular
expression matches a single space and nothing else (*note Regexp::).

   There is an important difference between the two cases of `FS = " "'
(a single space) and `FS = "[ \t\n]+"' (a regular expression matching
one or more spaces, TABs, or newlines).  For both values of `FS',
fields are separated by "runs" (multiple adjacent occurrences) of
spaces, TABs, and/or newlines.  However, when the value of `FS' is
`" "', `awk' first strips leading and trailing whitespace from the
record and then decides where the fields are.  For example, the
following pipeline prints `b':

     $ echo ' a b c d ' | awk '{ print $2 }'
     -| b

However, this pipeline prints `a' (note the extra spaces around each
letter):

     $ echo ' a  b  c  d ' | awk 'BEGIN { FS = "[ \t\n]+" }
     >                                  { print $2 }'
     -| a

In this case, the first field is "null" or empty.

   The stripping of leading and trailing whitespace also comes into
play whenever `$0' is recomputed.  For instance, study this pipeline:

     $ echo '   a b c d' | awk '{ print; $2 = $2; print }'
     -|    a b c d
     -| a b c d

The first `print' statement prints the record as it was read, with
leading whitespace intact.  The assignment to `$2' rebuilds `$0' by
concatenating `$1' through `$NF' together, separated by the value of
`OFS'.  Because the leading whitespace was ignored when finding `$1',
it is not part of the new `$0'.  Finally, the last `print' statement
prints the new `$0'.

   There is an additional subtlety to be aware of when using regular
expressions for field splitting.  It is not well-specified in the POSIX
standard, or anywhere else, what `^' means when splitting fields.  Does
the `^'  match only at the beginning of the entire record? Or is each
field separator a new string?  It turns out that different `awk'
versions answer this question differently, and you should not rely on
any specific behavior in your programs.  (d.c.)

   As a point of information, Brian Kernighan's `awk' allows `^' to
match only at the beginning of the record. `gawk' also works this way.
For example:

     $ echo 'xxAA  xxBxx  C' |
     > gawk -F '(^x+)|( +)' '{ for (i = 1; i <= NF; i++)
     >                                   printf "-->%s<--\n", $i }'
     -| --><--
     -| -->AA<--
     -| -->xxBxx<--
     -| -->C<--


File: gawk.info,  Node: Single Character Fields,  Next: Command Line Field Separator,  Prev: Regexp Field Splitting,  Up: Field Separators

4.5.3 Making Each Character a Separate Field
--------------------------------------------

There are times when you may want to examine each character of a record
separately.  This can be done in `gawk' by simply assigning the null
string (`""') to `FS'. (c.e.)  In this case, each individual character
in the record becomes a separate field.  For example:

     $ echo a b | gawk 'BEGIN { FS = "" }
     >                  {
     >                      for (i = 1; i <= NF; i = i + 1)
     >                          print "Field", i, "is", $i
     >                  }'
     -| Field 1 is a
     -| Field 2 is
     -| Field 3 is b

   Traditionally, the behavior of `FS' equal to `""' was not defined.
In this case, most versions of Unix `awk' simply treat the entire record
as only having one field.  (d.c.)  In compatibility mode (*note
Options::), if `FS' is the null string, then `gawk' also behaves this
way.


File: gawk.info,  Node: Command Line Field Separator,  Next: Field Splitting Summary,  Prev: Single Character Fields,  Up: Field Separators

4.5.4 Setting `FS' from the Command Line
----------------------------------------

`FS' can be set on the command line.  Use the `-F' option to do so.
For example:

     awk -F, 'PROGRAM' INPUT-FILES

sets `FS' to the `,' character.  Notice that the option uses an
uppercase `F' instead of a lowercase `f'. The latter option (`-f')
specifies a file containing an `awk' program.  Case is significant in
command-line options: the `-F' and `-f' options have nothing to do with
each other.  You can use both options at the same time to set the `FS'
variable _and_ get an `awk' program from a file.

   The value used for the argument to `-F' is processed in exactly the
same way as assignments to the built-in variable `FS'.  Any special
characters in the field separator must be escaped appropriately.  For
example, to use a `\' as the field separator on the command line, you
would have to type:

     # same as FS = "\\"
     awk -F\\\\ '...' files ...

Because `\' is used for quoting in the shell, `awk' sees `-F\\'.  Then
`awk' processes the `\\' for escape characters (*note Escape
Sequences::), finally yielding a single `\' to use for the field
separator.

   As a special case, in compatibility mode (*note Options::), if the
argument to `-F' is `t', then `FS' is set to the TAB character.  If you
type `-F\t' at the shell, without any quotes, the `\' gets deleted, so
`awk' figures that you really want your fields to be separated with
TABs and not `t's.  Use `-v FS="t"' or `-F"[t]"' on the command line if
you really do want to separate your fields with `t's.

   As an example, let's use an `awk' program file called `baud.awk'
that contains the pattern `/300/' and the action `print $1':

     /300/   { print $1 }

   Let's also set `FS' to be the `-' character and run the program on
the file `BBS-list'.  The following command prints a list of the names
of the bulletin boards that operate at 300 baud and the first three
digits of their phone numbers:

     $ awk -F- -f baud.awk BBS-list
     -| aardvark     555
     -| alpo
     -| barfly       555
     -| bites        555
     -| camelot      555
     -| core         555
     -| fooey        555
     -| foot         555
     -| macfoo       555
     -| sdace        555
     -| sabafoo      555

Note the second line of output.  The second line in the original file
looked like this:

     alpo-net     555-3412     2400/1200/300     A

   The `-' as part of the system's name was used as the field
separator, instead of the `-' in the phone number that was originally
intended.  This demonstrates why you have to be careful in choosing
your field and record separators.

   Perhaps the most common use of a single character as the field
separator occurs when processing the Unix system password file.  On
many Unix systems, each user has a separate entry in the system password
file, one line per user.  The information in these lines is separated
by colons.  The first field is the user's login name and the second is
the user's (encrypted or shadow) password.  A password file entry might
look like this:

     arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/bash

   The following program searches the system password file and prints
the entries for users who have no password:

     awk -F: '$2 == ""' /etc/passwd


File: gawk.info,  Node: Field Splitting Summary,  Prev: Command Line Field Separator,  Up: Field Separators

4.5.5 Field-Splitting Summary
-----------------------------

It is important to remember that when you assign a string constant as
the value of `FS', it undergoes normal `awk' string processing.  For
example, with Unix `awk' and `gawk', the assignment `FS = "\.."'
assigns the character string `".."' to `FS' (the backslash is
stripped).  This creates a regexp meaning "fields are separated by
occurrences of any two characters."  If instead you want fields to be
separated by a literal period followed by any single character, use `FS
= "\\.."'.

   The following table summarizes how fields are split, based on the
value of `FS' (`==' means "is equal to"):

`FS == " "'
     Fields are separated by runs of whitespace.  Leading and trailing
     whitespace are ignored.  This is the default.

`FS == ANY OTHER SINGLE CHARACTER'
     Fields are separated by each occurrence of the character.  Multiple
     successive occurrences delimit empty fields, as do leading and
     trailing occurrences.  The character can even be a regexp
     metacharacter; it does not need to be escaped.

`FS == REGEXP'
     Fields are separated by occurrences of characters that match
     REGEXP.  Leading and trailing matches of REGEXP delimit empty
     fields.

`FS == ""'
     Each individual character in the record becomes a separate field.
     (This is a `gawk' extension; it is not specified by the POSIX
     standard.)

               Changing `FS' Does Not Affect the Fields

   According to the POSIX standard, `awk' is supposed to behave as if
each record is split into fields at the time it is read.  In
particular, this means that if you change the value of `FS' after a
record is read, the value of the fields (i.e., how they were split)
should reflect the old value of `FS', not the new one.

   However, many older implementations of `awk' do not work this way.
Instead, they defer splitting the fields until a field is actually
referenced.  The fields are split using the _current_ value of `FS'!
(d.c.)  This behavior can be difficult to diagnose. The following
example illustrates the difference between the two methods.  (The
`sed'(1) command prints just the first line of `/etc/passwd'.)

     sed 1q /etc/passwd | awk '{ FS = ":" ; print $1 }'

which usually prints:

     root

on an incorrect implementation of `awk', while `gawk' prints something
like:

     root:nSijPlPhZZwgE:0:0:Root:/:

                         `FS' and `IGNORECASE'

   The `IGNORECASE' variable (*note User-modified::) affects field
splitting _only_ when the value of `FS' is a regexp.  It has no effect
when `FS' is a single character, even if that character is a letter.
Thus, in the following code:

     FS = "c"
     IGNORECASE = 1
     $0 = "aCa"
     print $1

The output is `aCa'.  If you really want to split fields on an
alphabetic character while ignoring case, use a regexp that will do it
for you.  E.g., `FS = "[c]"'.  In this case, `IGNORECASE' will take
effect.

   ---------- Footnotes ----------

   (1) The `sed' utility is a "stream editor."  Its behavior is also
defined by the POSIX standard.


File: gawk.info,  Node: Constant Size,  Next: Splitting By Content,  Prev: Field Separators,  Up: Reading Files

4.6 Reading Fixed-Width Data
============================

(This minor node discusses an advanced feature of `awk'.  If you are a
novice `awk' user, you might want to skip it on the first reading.)

`gawk' provides a facility for dealing with fixed-width fields with no
distinctive field separator.  For example, data of this nature arises
in the input for old Fortran programs where numbers are run together,
or in the output of programs that did not anticipate the use of their
output as input for other programs.

   An example of the latter is a table where all the columns are lined
up by the use of a variable number of spaces and _empty fields are just
spaces_.  Clearly, `awk''s normal field splitting based on `FS' does
not work well in this case.  Although a portable `awk' program can use
a series of `substr()' calls on `$0' (*note String Functions::), this
is awkward and inefficient for a large number of fields.

   The splitting of an input record into fixed-width fields is
specified by assigning a string containing space-separated numbers to
the built-in variable `FIELDWIDTHS'.  Each number specifies the width
of the field, _including_ columns between fields.  If you want to
ignore the columns between fields, you can specify the width as a
separate field that is subsequently ignored.  It is a fatal error to
supply a field width that is not a positive number.  The following data
is the output of the Unix `w' utility.  It is useful to illustrate the
use of `FIELDWIDTHS':

      10:06pm  up 21 days, 14:04,  23 users
     User     tty       login  idle   JCPU   PCPU  what
     hzuo     ttyV0     8:58pm            9      5  vi p24.tex
     hzang    ttyV3     6:37pm    50                -csh
     eklye    ttyV5     9:53pm            7      1  em thes.tex
     dportein ttyV6     8:17pm  1:47                -csh
     gierd    ttyD3    10:00pm     1                elm
     dave     ttyD4     9:47pm            4      4  w
     brent    ttyp0    26Jun91  4:46  26:46   4:41  bash
     dave     ttyq4    26Jun9115days     46     46  wnewmail

   The following program takes the above input, converts the idle time
to number of seconds, and prints out the first two fields and the
calculated idle time:

     NOTE: This program uses a number of `awk' features that haven't
     been introduced yet.

     BEGIN  { FIELDWIDTHS = "9 6 10 6 7 7 35" }
     NR > 2 {
         idle = $4
         sub(/^  */, "", idle)   # strip leading spaces
         if (idle == "")
             idle = 0
         if (idle ~ /:/) {
             split(idle, t, ":")
             idle = t[1] * 60 + t[2]
         }
         if (idle ~ /days/)
             idle *= 24 * 60 * 60

         print $1, $2, idle
     }

   Running the program on the data produces the following results:

     hzuo      ttyV0  0
     hzang     ttyV3  50
     eklye     ttyV5  0
     dportein  ttyV6  107
     gierd     ttyD3  1
     dave      ttyD4  0
     brent     ttyp0  286
     dave      ttyq4  1296000

   Another (possibly more practical) example of fixed-width input data
is the input from a deck of balloting cards.  In some parts of the
United States, voters mark their choices by punching holes in computer
cards.  These cards are then processed to count the votes for any
particular candidate or on any particular issue.  Because a voter may
choose not to vote on some issue, any column on the card may be empty.
An `awk' program for processing such data could use the `FIELDWIDTHS'
feature to simplify reading the data.  (Of course, getting `gawk' to
run on a system with card readers is another story!)

   Assigning a value to `FS' causes `gawk' to use `FS' for field
splitting again.  Use `FS = FS' to make this happen, without having to
know the current value of `FS'.  In order to tell which kind of field
splitting is in effect, use `PROCINFO["FS"]' (*note Auto-set::).  The
value is `"FS"' if regular field splitting is being used, or it is
`"FIELDWIDTHS"' if fixed-width field splitting is being used:

     if (PROCINFO["FS"] == "FS")
         REGULAR FIELD SPLITTING ...
     else if  (PROCINFO["FS"] == "FIELDWIDTHS")
         FIXED-WIDTH FIELD SPLITTING ...
     else
         CONTENT-BASED FIELD SPLITTING ... (see next minor node)

   This information is useful when writing a function that needs to
temporarily change `FS' or `FIELDWIDTHS', read some records, and then
restore the original settings (*note Passwd Functions::, for an example
of such a function).


File: gawk.info,  Node: Splitting By Content,  Next: Multiple Line,  Prev: Constant Size,  Up: Reading Files

4.7 Defining Fields By Content
==============================

(This minor node discusses an advanced feature of `awk'.  If you are a
novice `awk' user, you might want to skip it on the first reading.)

Normally, when using `FS', `gawk' defines the fields as the parts of
the record that occur in between each field separator. In other words,
`FS' defines what a field _is not_, instead of what a field _is_.
However, there are times when you really want to define the fields by
what they are, and not by what they are not.

   The most notorious such case is so-called "comma separated value"
(CSV) data. Many spreadsheet programs, for example, can export their
data into text files, where each record is terminated with a newline,
and fields are separated by commas. If only commas separated the data,
there wouldn't be an issue. The problem comes when one of the fields
contains an _embedded_ comma. While there is no formal standard
specification for CSV data(1), in such cases, most programs embed the
field in double quotes. So we might have data like this:

     Robbins,Arnold,"1234 A Pretty Street, NE",MyTown,MyState,12345-6789,USA

   The `FPAT' variable offers a solution for cases like this.  The
value of `FPAT' should be a string that provides a regular expression.
This regular expression describes the contents of each field.

   In the case of CSV data as presented above, each field is either
"anything that is not a comma," or "a double quote, anything that is
not a double quote, and a closing double quote."  If written as a
regular expression constant (*note Regexp::), we would have
`/([^,]+)|("[^"]+")/'.  Writing this as a string requires us to escape
the double quotes, leading to:

     FPAT = "([^,]+)|(\"[^\"]+\")"

   Putting this to use, here is a simple program to parse the data:

     BEGIN {
         FPAT = "([^,]+)|(\"[^\"]+\")"
     }

     {
         print "NF = ", NF
         for (i = 1; i <= NF; i++) {
             printf("$%d = <%s>\n", i, $i)
         }
     }

   When run, we get the following:

     $ gawk -f simple-csv.awk addresses.csv
     NF =  7
     $1 = <Robbins>
     $2 = <Arnold>
     $3 = <"1234 A Pretty Street, NE">
     $4 = <MyTown>
     $5 = <MyState>
     $6 = <12345-6789>
     $7 = <USA>

   Note the embedded comma in the value of `$3'.

   A straightforward improvement when processing CSV data of this sort
would be to remove the quotes when they occur, with something like this:

     if (substr($i, 1, 1) == "\"") {
         len = length($i)
         $i = substr($i, 2, len - 2)    # Get text within the two quotes
     }

   As with `FS', the `IGNORECASE' variable (*note User-modified::)
affects field splitting with `FPAT'.

   Similar to `FIELDWIDTHS', the value of `PROCINFO["FS"]' will be
`"FPAT"' if content-based field splitting is being used.

     NOTE: Some programs export CSV data that contains embedded
     newlines between the double quotes.  `gawk' provides no way to
     deal with this.  Since there is no formal specification for CSV
     data, there isn't much more to be done; the `FPAT' mechanism
     provides an elegant solution for the majority of cases, and the
     `gawk' maintainer is satisfied with that.

   As written, the regexp used for `FPAT' requires that each field have
a least one character.  A straightforward modification (changing
changed the first `+' to `*') allows fields to be empty:

     FPAT = "([^,]*)|(\"[^\"]+\")"

   Finally, the `patsplit()' function makes the same functionality
available for splitting regular strings (*note String Functions::).

   ---------- Footnotes ----------

   (1) At least, we don't know of one.


File: gawk.info,  Node: Multiple Line,  Next: Getline,  Prev: Splitting By Content,  Up: Reading Files

4.8 Multiple-Line Records
=========================

In some databases, a single line cannot conveniently hold all the
information in one entry.  In such cases, you can use multiline
records.  The first step in doing this is to choose your data format.

   One technique is to use an unusual character or string to separate
records.  For example, you could use the formfeed character (written
`\f' in `awk', as in C) to separate them, making each record a page of
the file.  To do this, just set the variable `RS' to `"\f"' (a string
containing the formfeed character).  Any other character could equally
well be used, as long as it won't be part of the data in a record.

   Another technique is to have blank lines separate records.  By a
special dispensation, an empty string as the value of `RS' indicates
that records are separated by one or more blank lines.  When `RS' is set
to the empty string, each record always ends at the first blank line
encountered.  The next record doesn't start until the first nonblank
line that follows.  No matter how many blank lines appear in a row, they
all act as one record separator.  (Blank lines must be completely
empty; lines that contain only whitespace do not count.)

   You can achieve the same effect as `RS = ""' by assigning the string
`"\n\n+"' to `RS'. This regexp matches the newline at the end of the
record and one or more blank lines after the record.  In addition, a
regular expression always matches the longest possible sequence when
there is a choice (*note Leftmost Longest::).  So the next record
doesn't start until the first nonblank line that follows--no matter how
many blank lines appear in a row, they are considered one record
separator.

   There is an important difference between `RS = ""' and `RS =
"\n\n+"'. In the first case, leading newlines in the input data file
are ignored, and if a file ends without extra blank lines after the
last record, the final newline is removed from the record.  In the
second case, this special processing is not done.  (d.c.)

   Now that the input is separated into records, the second step is to
separate the fields in the record.  One way to do this is to divide each
of the lines into fields in the normal manner.  This happens by default
as the result of a special feature.  When `RS' is set to the empty
string, _and_ `FS' is set to a single character, the newline character
_always_ acts as a field separator.  This is in addition to whatever
field separations result from `FS'.(1)

   The original motivation for this special exception was probably to
provide useful behavior in the default case (i.e., `FS' is equal to
`" "').  This feature can be a problem if you really don't want the
newline character to separate fields, because there is no way to
prevent it.  However, you can work around this by using the `split()'
function to break up the record manually (*note String Functions::).
If you have a single character field separator, you can work around the
special feature in a different way, by making `FS' into a regexp for
that single character.  For example, if the field separator is a
percent character, instead of `FS = "%"', use `FS = "[%]"'.

   Another way to separate fields is to put each field on a separate
line: to do this, just set the variable `FS' to the string `"\n"'.
(This single character separator matches a single newline.)  A
practical example of a data file organized this way might be a mailing
list, where each entry is separated by blank lines.  Consider a mailing
list in a file named `addresses', which looks like this:

     Jane Doe
     123 Main Street
     Anywhere, SE 12345-6789

     John Smith
     456 Tree-lined Avenue
     Smallville, MW 98765-4321
     ...

A simple program to process this file is as follows:

     # addrs.awk --- simple mailing list program

     # Records are separated by blank lines.
     # Each line is one field.
     BEGIN { RS = "" ; FS = "\n" }

     {
           print "Name is:", $1
           print "Address is:", $2
           print "City and State are:", $3
           print ""
     }

   Running the program produces the following output:

     $ awk -f addrs.awk addresses
     -| Name is: Jane Doe
     -| Address is: 123 Main Street
     -| City and State are: Anywhere, SE 12345-6789
     -|
     -| Name is: John Smith
     -| Address is: 456 Tree-lined Avenue
     -| City and State are: Smallville, MW 98765-4321
     -|
     ...

   *Note Labels Program::, for a more realistic program that deals with
address lists.  The following table summarizes how records are split,
based on the value of `RS'.  (`==' means "is equal to.")

`RS == "\n"'
     Records are separated by the newline character (`\n').  In effect,
     every line in the data file is a separate record, including blank
     lines.  This is the default.

`RS == ANY SINGLE CHARACTER'
     Records are separated by each occurrence of the character.
     Multiple successive occurrences delimit empty records.

`RS == ""'
     Records are separated by runs of blank lines.  When `FS' is a
     single character, then the newline character always serves as a
     field separator, in addition to whatever value `FS' may have.
     Leading and trailing newlines in a file are ignored.

`RS == REGEXP'
     Records are separated by occurrences of characters that match
     REGEXP.  Leading and trailing matches of REGEXP delimit empty
     records.  (This is a `gawk' extension; it is not specified by the
     POSIX standard.)

   In all cases, `gawk' sets `RT' to the input text that matched the
value specified by `RS'.  But if the input file ended without any text
that matches `RS', then `gawk' sets `RT' to the null string.

   ---------- Footnotes ----------

   (1) When `FS' is the null string (`""') or a regexp, this special
feature of `RS' does not apply.  It does apply to the default field
separator of a single space: `FS = " "'.


File: gawk.info,  Node: Getline,  Next: Read Timeout,  Prev: Multiple Line,  Up: Reading Files

4.9 Explicit Input with `getline'
=================================

So far we have been getting our input data from `awk''s main input
stream--either the standard input (usually your terminal, sometimes the
output from another program) or from the files specified on the command
line.  The `awk' language has a special built-in command called
`getline' that can be used to read input under your explicit control.

   The `getline' command is used in several different ways and should
_not_ be used by beginners.  The examples that follow the explanation
of the `getline' command include material that has not been covered
yet.  Therefore, come back and study the `getline' command _after_ you
have reviewed the rest of this Info file and have a good knowledge of
how `awk' works.

   The `getline' command returns one if it finds a record and zero if
it encounters the end of the file.  If there is some error in getting a
record, such as a file that cannot be opened, then `getline' returns
-1.  In this case, `gawk' sets the variable `ERRNO' to a string
describing the error that occurred.

   In the following examples, COMMAND stands for a string value that
represents a shell command.

     NOTE: When `--sandbox' is specified (*note Options::), reading
     lines from files, pipes and coprocesses is disabled.

* Menu:

* Plain Getline::               Using `getline' with no arguments.
* Getline/Variable::            Using `getline' into a variable.
* Getline/File::                Using `getline' from a file.
* Getline/Variable/File::       Using `getline' into a variable from a
                                file.
* Getline/Pipe::                Using `getline' from a pipe.
* Getline/Variable/Pipe::       Using `getline' into a variable from a
                                pipe.
* Getline/Coprocess::           Using `getline' from a coprocess.
* Getline/Variable/Coprocess::  Using `getline' into a variable from a
                                coprocess.
* Getline Notes::               Important things to know about `getline'.
* Getline Summary::             Summary of `getline' Variants.


File: gawk.info,  Node: Plain Getline,  Next: Getline/Variable,  Up: Getline

4.9.1 Using `getline' with No Arguments
---------------------------------------

The `getline' command can be used without arguments to read input from
the current input file.  All it does in this case is read the next
input record and split it up into fields.  This is useful if you've
finished processing the current record, but want to do some special
processing on the next record _right now_.  For example:

     {
          if ((t = index($0, "/*")) != 0) {
               # value of `tmp' will be "" if t is 1
               tmp = substr($0, 1, t - 1)
               u = index(substr($0, t + 2), "*/")
               offset = t + 2
               while (u == 0) {
                    if (getline <= 0) {
                         m = "unexpected EOF or error"
                         m = (m ": " ERRNO)
                         print m > "/dev/stderr"
                         exit
                    }
                    u = index($0, "*/")
                    offset = 0
               }
               # substr() expression will be "" if */
               # occurred at end of line
               $0 = tmp substr($0, offset + u + 2)
          }
          print $0
     }

   This `awk' program deletes C-style comments (`/* ...  */') from the
input.  By replacing the `print $0' with other statements, you could
perform more complicated processing on the decommented input, such as
searching for matches of a regular expression.  (This program has a
subtle problem--it does not work if one comment ends and another begins
on the same line.)

   This form of the `getline' command sets `NF', `NR', `FNR', `RT', and
the value of `$0'.

     NOTE: The new value of `$0' is used to test the patterns of any
     subsequent rules.  The original value of `$0' that triggered the
     rule that executed `getline' is lost.  By contrast, the `next'
     statement reads a new record but immediately begins processing it
     normally, starting with the first rule in the program.  *Note Next
     Statement::.


File: gawk.info,  Node: Getline/Variable,  Next: Getline/File,  Prev: Plain Getline,  Up: Getline

4.9.2 Using `getline' into a Variable
-------------------------------------

You can use `getline VAR' to read the next record from `awk''s input
into the variable VAR.  No other processing is done.  For example,
suppose the next line is a comment or a special string, and you want to
read it without triggering any rules.  This form of `getline' allows
you to read that line and store it in a variable so that the main
read-a-line-and-check-each-rule loop of `awk' never sees it.  The
following example swaps every two lines of input:

     {
          if ((getline tmp) > 0) {
               print tmp
               print $0
          } else
               print $0
     }

It takes the following list:

     wan
     tew
     free
     phore

and produces these results:

     tew
     wan
     phore
     free

   The `getline' command used in this way sets only the variables `NR',
`FNR' and `RT' (and of course, VAR).  The record is not split into
fields, so the values of the fields (including `$0') and the value of
`NF' do not change.


File: gawk.info,  Node: Getline/File,  Next: Getline/Variable/File,  Prev: Getline/Variable,  Up: Getline

4.9.3 Using `getline' from a File
---------------------------------

Use `getline < FILE' to read the next record from FILE.  Here FILE is a
string-valued expression that specifies the file name.  `< FILE' is
called a "redirection" because it directs input to come from a
different place.  For example, the following program reads its input
record from the file `secondary.input' when it encounters a first field
with a value equal to 10 in the current input file:

     {
         if ($1 == 10) {
              getline < "secondary.input"
              print
         } else
              print
     }

   Because the main input stream is not used, the values of `NR' and
`FNR' are not changed. However, the record it reads is split into
fields in the normal manner, so the values of `$0' and the other fields
are changed, resulting in a new value of `NF'.  `RT' is also set.

   According to POSIX, `getline < EXPRESSION' is ambiguous if
EXPRESSION contains unparenthesized operators other than `$'; for
example, `getline < dir "/" file' is ambiguous because the
concatenation operator is not parenthesized.  You should write it as
`getline < (dir "/" file)' if you want your program to be portable to
all `awk' implementations.


File: gawk.info,  Node: Getline/Variable/File,  Next: Getline/Pipe,  Prev: Getline/File,  Up: Getline

4.9.4 Using `getline' into a Variable from a File
-------------------------------------------------

Use `getline VAR < FILE' to read input from the file FILE, and put it
in the variable VAR.  As above, FILE is a string-valued expression that
specifies the file from which to read.

   In this version of `getline', none of the built-in variables are
changed and the record is not split into fields.  The only variable
changed is VAR.(1) For example, the following program copies all the
input files to the output, except for records that say
`@include FILENAME'.  Such a record is replaced by the contents of the
file FILENAME:

     {
          if (NF == 2 && $1 == "@include") {
               while ((getline line < $2) > 0)
                    print line
               close($2)
          } else
               print
     }

   Note here how the name of the extra input file is not built into the
program; it is taken directly from the data, specifically from the
second field on the `@include' line.

   The `close()' function is called to ensure that if two identical
`@include' lines appear in the input, the entire specified file is
included twice.  *Note Close Files And Pipes::.

   One deficiency of this program is that it does not process nested
`@include' statements (i.e., `@include' statements in included files)
the way a true macro preprocessor would.  *Note Igawk Program::, for a
program that does handle nested `@include' statements.

   ---------- Footnotes ----------

   (1) This is not quite true. `RT' could be changed if `RS' is a
regular expression.


File: gawk.info,  Node: Getline/Pipe,  Next: Getline/Variable/Pipe,  Prev: Getline/Variable/File,  Up: Getline

4.9.5 Using `getline' from a Pipe
---------------------------------

     Omniscience has much to recommend it.  Failing that, attention to
     details would be useful.  -- Brian Kernighan

   The output of a command can also be piped into `getline', using
`COMMAND | getline'.  In this case, the string COMMAND is run as a
shell command and its output is piped into `awk' to be used as input.
This form of `getline' reads one record at a time from the pipe.  For
example, the following program copies its input to its output, except
for lines that begin with `@execute', which are replaced by the output
produced by running the rest of the line as a shell command:

     {
          if ($1 == "@execute") {
               tmp = substr($0, 10)        # Remove "@execute"
               while ((tmp | getline) > 0)
                    print
               close(tmp)
          } else
               print
     }

The `close()' function is called to ensure that if two identical
`@execute' lines appear in the input, the command is run for each one.
*Note Close Files And Pipes::.  Given the input:

     foo
     bar
     baz
     @execute who
     bletch

the program might produce:

     foo
     bar
     baz
     arnold     ttyv0   Jul 13 14:22
     miriam     ttyp0   Jul 13 14:23     (murphy:0)
     bill       ttyp1   Jul 13 14:23     (murphy:0)
     bletch

Notice that this program ran the command `who' and printed the previous
result.  (If you try this program yourself, you will of course get
different results, depending upon who is logged in on your system.)

   This variation of `getline' splits the record into fields, sets the
value of `NF', and recomputes the value of `$0'.  The values of `NR'
and `FNR' are not changed.  `RT' is set.

   According to POSIX, `EXPRESSION | getline' is ambiguous if
EXPRESSION contains unparenthesized operators other than `$'--for
example, `"echo " "date" | getline' is ambiguous because the
concatenation operator is not parenthesized.  You should write it as
`("echo " "date") | getline' if you want your program to be portable to
all `awk' implementations.

     NOTE: Unfortunately, `gawk' has not been consistent in its
     treatment of a construct like `"echo " "date" | getline'.  Most
     versions, including the current version, treat it at as `("echo "
     "date") | getline'.  (This how Brian Kernighan's `awk' behaves.)
     Some versions changed and treated it as `"echo " ("date" |
     getline)'.  (This is how `mawk' behaves.)  In short, _always_ use
     explicit parentheses, and then you won't have to worry.


File: gawk.info,  Node: Getline/Variable/Pipe,  Next: Getline/Coprocess,  Prev: Getline/Pipe,  Up: Getline

4.9.6 Using `getline' into a Variable from a Pipe
-------------------------------------------------

When you use `COMMAND | getline VAR', the output of COMMAND is sent
through a pipe to `getline' and into the variable VAR.  For example, the
following program reads the current date and time into the variable
`current_time', using the `date' utility, and then prints it:

     BEGIN {
          "date" | getline current_time
          close("date")
          print "Report printed on " current_time
     }

   In this version of `getline', none of the built-in variables are
changed and the record is not split into fields.

   According to POSIX, `EXPRESSION | getline VAR' is ambiguous if
EXPRESSION contains unparenthesized operators other than `$'; for
example, `"echo " "date" | getline VAR' is ambiguous because the
concatenation operator is not parenthesized. You should write it as
`("echo " "date") | getline VAR' if you want your program to be
portable to other `awk' implementations.


File: gawk.info,  Node: Getline/Coprocess,  Next: Getline/Variable/Coprocess,  Prev: Getline/Variable/Pipe,  Up: Getline

4.9.7 Using `getline' from a Coprocess
--------------------------------------

Input into `getline' from a pipe is a one-way operation.  The command
that is started with `COMMAND | getline' only sends data _to_ your
`awk' program.

   On occasion, you might want to send data to another program for
processing and then read the results back.  `gawk' allows you to start
a "coprocess", with which two-way communications are possible.  This is
done with the `|&' operator.  Typically, you write data to the
coprocess first and then read results back, as shown in the following:

     print "SOME QUERY" |& "db_server"
     "db_server" |& getline

which sends a query to `db_server' and then reads the results.

   The values of `NR' and `FNR' are not changed, because the main input
stream is not used.  However, the record is split into fields in the
normal manner, thus changing the values of `$0', of the other fields,
and of `NF' and `RT'.

   Coprocesses are an advanced feature. They are discussed here only
because this is the minor node on `getline'.  *Note Two-way I/O::,
where coprocesses are discussed in more detail.


File: gawk.info,  Node: Getline/Variable/Coprocess,  Next: Getline Notes,  Prev: Getline/Coprocess,  Up: Getline

4.9.8 Using `getline' into a Variable from a Coprocess
------------------------------------------------------

When you use `COMMAND |& getline VAR', the output from the coprocess
COMMAND is sent through a two-way pipe to `getline' and into the
variable VAR.

   In this version of `getline', none of the built-in variables are
changed and the record is not split into fields.  The only variable
changed is VAR.  However, `RT' is set.

   Coprocesses are an advanced feature. They are discussed here only
because this is the minor node on `getline'.  *Note Two-way I/O::,
where coprocesses are discussed in more detail.


File: gawk.info,  Node: Getline Notes,  Next: Getline Summary,  Prev: Getline/Variable/Coprocess,  Up: Getline

4.9.9 Points to Remember About `getline'
----------------------------------------

Here are some miscellaneous points about `getline' that you should bear
in mind:

   * When `getline' changes the value of `$0' and `NF', `awk' does
     _not_ automatically jump to the start of the program and start
     testing the new record against every pattern.  However, the new
     record is tested against any subsequent rules.

   * Many `awk' implementations limit the number of pipelines that an
     `awk' program may have open to just one.  In `gawk', there is no
     such limit.  You can open as many pipelines (and coprocesses) as
     the underlying operating system permits.

   * An interesting side effect occurs if you use `getline' without a
     redirection inside a `BEGIN' rule. Because an unredirected
     `getline' reads from the command-line data files, the first
     `getline' command causes `awk' to set the value of `FILENAME'.
     Normally, `FILENAME' does not have a value inside `BEGIN' rules,
     because you have not yet started to process the command-line data
     files.  (d.c.)  (*Note BEGIN/END::, also *note Auto-set::.)

   * Using `FILENAME' with `getline' (`getline < FILENAME') is likely
     to be a source for confusion.  `awk' opens a separate input stream
     from the current input file.  However, by not using a variable,
     `$0' and `NR' are still updated.  If you're doing this, it's
     probably by accident, and you should reconsider what it is you're
     trying to accomplish.

   * *note Getline Summary::, presents a table summarizing the
     `getline' variants and which variables they can affect.  It is
     worth noting that those variants which do not use redirection can
     cause `FILENAME' to be updated if they cause `awk' to start
     reading a new input file.

   * If the variable being assigned is an expression with side effects,
     different versions of `awk' behave differently upon encountering
     end-of-file.  Some versions don't evaluate the expression; many
     versions (including `gawk') do.  Here is an example, due to Duncan
     Moore:

          BEGIN {
              system("echo 1 > f")
              while ((getline a[++c] < "f") > 0) { }
              print c
          }

     Here, the side effect is the `++c'.  Is `c' incremented if end of
     file is encountered, before the element in `a' is assigned?

     `gawk' treats `getline' like a function call, and evaluates the
     expression `a[++c]' before attempting to read from `f'.  Other
     versions of `awk' only evaluate the expression once they know that
     there is a string value to be assigned.  Caveat Emptor.


File: gawk.info,  Node: Getline Summary,  Prev: Getline Notes,  Up: Getline

4.9.10 Summary of `getline' Variants
------------------------------------

*note table-getline-variants:: summarizes the eight variants of
`getline', listing which built-in variables are set by each one, and
whether the variant is standard or a `gawk' extension.  Note: for each
variant, `gawk' sets the `RT' built-in variable.

Variant                  Effect                      Standard /
                                                     Extension
------------------------------------------------------------------------- 
`getline'                Sets `$0', `NF', `FNR',     Standard
                         `NR', and `RT'              
`getline' VAR            Sets VAR, `FNR', `NR', and  Standard
                         `RT'                        
`getline <' FILE         Sets `$0', `NF', and `RT'   Standard
`getline VAR < FILE'     Sets VAR and `RT'           Standard
COMMAND `| getline'      Sets `$0', `NF', and `RT'   Standard
COMMAND `| getline' VAR  Sets VAR and `RT'           Standard
COMMAND `|& getline'     Sets `$0', `NF', and `RT'   Extension
COMMAND `|& getline'     Sets VAR and `RT'           Extension
VAR                                                  

Table 4.1: `getline' Variants and What They Set


File: gawk.info,  Node: Read Timeout,  Next: Command line directories,  Prev: Getline,  Up: Reading Files

4.10 Reading Input With A Timeout
=================================

You may specify a timeout in milliseconds for reading input from a
terminal, pipe or two-way communication including, TCP/IP sockets. This
can be done on a per input, command or connection basis, by setting a
special element in the `PROCINFO' array:

     PROCINFO["input_name", "READ_TIMEOUT"] = TIMEOUT IN MILLISECONDS

   When set, this causes `gawk' to time out and return failure if no
data is available to read within the specified timeout period.  For
example, a TCP client can decide to give up on receiving any response
from the server after a certain amount of time:

     Service = "/inet/tcp/0/localhost/daytime"
     PROCINFO[Service, "READ_TIMEOUT"] = 100
     if ((Service |& getline) > 0)
         print $0
     else if (ERRNO != "")
         print ERRNO

   Here is how to read interactively from the terminal(1) without
waiting for more than five seconds:

     PROCINFO["/dev/stdin", "READ_TIMEOUT"] = 5000
     while ((getline < "/dev/stdin") > 0)
         print $0

   `gawk' will terminate the read operation if input does not arrive
after waiting for the timeout period, return failure and set the
`ERRNO' variable to an appropriate string value.  A negative or zero
value for the timeout is the same as specifying no timeout at all.

   A timeout can also be set for reading from the terminal in the
implicit loop that reads input records and matches them against
patterns, like so:

     $  gawk 'BEGIN { PROCINFO["-", "READ_TIMEOUT"] = 5000 }
     > { print "You entered: " $0 }'
     gawk
     -| You entered: gawk

   In this case, failure to respond within five seconds results in the
following error message:

     error--> gawk: cmd. line:2: (FILENAME=- FNR=1) fatal: error reading input file `-': Connection timed out

   The timeout can be set or changed at any time, and will take effect
on the next attempt to read from the input device. In the following
example, we start with a timeout value of one second, and progressively
reduce it by one-tenth of a second until we wait indefinitely for the
input to arrive:

     PROCINFO[Service, "READ_TIMEOUT"] = 1000
     while ((Service |& getline) > 0) {
         print $0
         PROCINFO[S, "READ_TIMEOUT"] -= 100
     }

     NOTE: You should not assume that the read operation will block
     exactly after the tenth record has been printed. It is possible
     that `gawk' will read and buffer more than one record's worth of
     data the first time. Because of this, changing the value of
     timeout like in the above example is not very useful.

   If the `PROCINFO' element is not present and the environment
variable `GAWK_READ_TIMEOUT' exists, `gawk' uses its value to
initialize the timeout value.  The exclusive use of the environment
variable to specify timeout has the disadvantage of not being able to
control it on a per command or connection basis.

   `gawk' considers a timeout event to be an error even though the
attempt to read from the underlying device may succeed in a later
attempt. This is a limitation, and it also means that you cannot use
this to multiplex input from two or more sources.

   Assigning a timeout value prevents read operations from blocking
indefinitely. But bear in mind that there are other ways `gawk' can
stall waiting for an input device to be ready.  A network client can
sometimes take a long time to establish a connection before it can
start reading any data, or the attempt to open a FIFO special file for
reading can block indefinitely until some other process opens it for
writing.

   ---------- Footnotes ----------

   (1) This assumes that standard input is the keyboard


File: gawk.info,  Node: Command line directories,  Prev: Read Timeout,  Up: Reading Files

4.11 Directories On The Command Line
====================================

According to the POSIX standard, files named on the `awk' command line
must be text files.  It is a fatal error if they are not.  Most
versions of `awk' treat a directory on the command line as a fatal
error.

   By default, `gawk' produces a warning for a directory on the command
line, but otherwise ignores it.  If either of the `--posix' or
`--traditional' options is given, then `gawk' reverts to treating a
directory on the command line as a fatal error.


File: gawk.info,  Node: Printing,  Next: Expressions,  Prev: Reading Files,  Up: Top

5 Printing Output
*****************

One of the most common programming actions is to "print", or output,
some or all of the input.  Use the `print' statement for simple output,
and the `printf' statement for fancier formatting.  The `print'
statement is not limited when computing _which_ values to print.
However, with two exceptions, you cannot specify _how_ to print
them--how many columns, whether to use exponential notation or not, and
so on.  (For the exceptions, *note Output Separators::, and *note
OFMT::.)  For printing with specifications, you need the `printf'
statement (*note Printf::).

   Besides basic and formatted printing, this major node also covers
I/O redirections to files and pipes, introduces the special file names
that `gawk' processes internally, and discusses the `close()' built-in
function.

* Menu:

* Print::                       The `print' statement.
* Print Examples::              Simple examples of `print' statements.
* Output Separators::           The output separators and how to change them.
* OFMT::                        Controlling Numeric Output With `print'.
* Printf::                      The `printf' statement.
* Redirection::                 How to redirect output to multiple files and
                                pipes.
* Special Files::               File name interpretation in `gawk'.
                                `gawk' allows access to inherited file
                                descriptors.
* Close Files And Pipes::       Closing Input and Output Files and Pipes.


File: gawk.info,  Node: Print,  Next: Print Examples,  Up: Printing

5.1 The `print' Statement
=========================

The `print' statement is used for producing output with simple,
standardized formatting.  Specify only the strings or numbers to print,
in a list separated by commas.  They are output, separated by single
spaces, followed by a newline.  The statement looks like this:

     print ITEM1, ITEM2, ...

The entire list of items may be optionally enclosed in parentheses.  The
parentheses are necessary if any of the item expressions uses the `>'
relational operator; otherwise it could be confused with an output
redirection (*note Redirection::).

   The items to print can be constant strings or numbers, fields of the
current record (such as `$1'), variables, or any `awk' expression.
Numeric values are converted to strings and then printed.

   The simple statement `print' with no items is equivalent to `print
$0': it prints the entire current record.  To print a blank line, use
`print ""', where `""' is the empty string.  To print a fixed piece of
text, use a string constant, such as `"Don't Panic"', as one item.  If
you forget to use the double-quote characters, your text is taken as an
`awk' expression, and you will probably get an error.  Keep in mind
that a space is printed between any two items.


File: gawk.info,  Node: Print Examples,  Next: Output Separators,  Prev: Print,  Up: Printing

5.2 `print' Statement Examples
==============================

Each `print' statement makes at least one line of output.  However, it
isn't limited to only one line.  If an item value is a string
containing a newline, the newline is output along with the rest of the
string.  A single `print' statement can make any number of lines this
way.

   The following is an example of printing a string that contains
embedded newlines (the `\n' is an escape sequence, used to represent
the newline character; *note Escape Sequences::):

     $ awk 'BEGIN { print "line one\nline two\nline three" }'
     -| line one
     -| line two
     -| line three

   The next example, which is run on the `inventory-shipped' file,
prints the first two fields of each input record, with a space between
them:

     $ awk '{ print $1, $2 }' inventory-shipped
     -| Jan 13
     -| Feb 15
     -| Mar 15
     ...

   A common mistake in using the `print' statement is to omit the comma
between two items.  This often has the effect of making the items run
together in the output, with no space.  The reason for this is that
juxtaposing two string expressions in `awk' means to concatenate them.
Here is the same program, without the comma:

     $ awk '{ print $1 $2 }' inventory-shipped
     -| Jan13
     -| Feb15
     -| Mar15
     ...

   To someone unfamiliar with the `inventory-shipped' file, neither
example's output makes much sense.  A heading line at the beginning
would make it clearer.  Let's add some headings to our table of months
(`$1') and green crates shipped (`$2').  We do this using the `BEGIN'
pattern (*note BEGIN/END::) so that the headings are only printed once:

     awk 'BEGIN {  print "Month Crates"
                   print "----- ------" }
                {  print $1, $2 }' inventory-shipped

When run, the program prints the following:

     Month Crates
     ----- ------
     Jan 13
     Feb 15
     Mar 15
     ...

The only problem, however, is that the headings and the table data
don't line up!  We can fix this by printing some spaces between the two
fields:

     awk 'BEGIN { print "Month Crates"
                  print "----- ------" }
                { print $1, "     ", $2 }' inventory-shipped

   Lining up columns this way can get pretty complicated when there are
many columns to fix.  Counting spaces for two or three columns is
simple, but any more than this can take up a lot of time. This is why
the `printf' statement was created (*note Printf::); one of its
specialties is lining up columns of data.

     NOTE: You can continue either a `print' or `printf' statement
     simply by putting a newline after any comma (*note
     Statements/Lines::).


File: gawk.info,  Node: Output Separators,  Next: OFMT,  Prev: Print Examples,  Up: Printing

5.3 Output Separators
=====================

As mentioned previously, a `print' statement contains a list of items
separated by commas.  In the output, the items are normally separated
by single spaces.  However, this doesn't need to be the case; a single
space is simply the default.  Any string of characters may be used as
the "output field separator" by setting the built-in variable `OFS'.
The initial value of this variable is the string `" "'--that is, a
single space.

   The output from an entire `print' statement is called an "output
record".  Each `print' statement outputs one output record, and then
outputs a string called the "output record separator" (or `ORS').  The
initial value of `ORS' is the string `"\n"'; i.e., a newline character.
Thus, each `print' statement normally makes a separate line.

   In order to change how output fields and records are separated,
assign new values to the variables `OFS' and `ORS'.  The usual place to
do this is in the `BEGIN' rule (*note BEGIN/END::), so that it happens
before any input is processed.  It can also be done with assignments on
the command line, before the names of the input files, or using the
`-v' command-line option (*note Options::).  The following example
prints the first and second fields of each input record, separated by a
semicolon, with a blank line added after each newline:

     $ awk 'BEGIN { OFS = ";"; ORS = "\n\n" }
     >            { print $1, $2 }' BBS-list
     -| aardvark;555-5553
     -|
     -| alpo-net;555-3412
     -|
     -| barfly;555-7685
     ...

   If the value of `ORS' does not contain a newline, the program's
output runs together on a single line.


File: gawk.info,  Node: OFMT,  Next: Printf,  Prev: Output Separators,  Up: Printing

5.4 Controlling Numeric Output with `print'
===========================================

When printing numeric values with the `print' statement, `awk'
internally converts the number to a string of characters and prints
that string.  `awk' uses the `sprintf()' function to do this conversion
(*note String Functions::).  For now, it suffices to say that the
`sprintf()' function accepts a "format specification" that tells it how
to format numbers (or strings), and that there are a number of
different ways in which numbers can be formatted.  The different format
specifications are discussed more fully in *note Control Letters::.

   The built-in variable `OFMT' contains the default format
specification that `print' uses with `sprintf()' when it wants to
convert a number to a string for printing.  The default value of `OFMT'
is `"%.6g"'.  The way `print' prints numbers can be changed by
supplying different format specifications as the value of `OFMT', as
shown in the following example:

     $ awk 'BEGIN {
     >   OFMT = "%.0f"  # print numbers as integers (rounds)
     >   print 17.23, 17.54 }'
     -| 17 18

According to the POSIX standard, `awk''s behavior is undefined if
`OFMT' contains anything but a floating-point conversion specification.
(d.c.)


File: gawk.info,  Node: Printf,  Next: Redirection,  Prev: OFMT,  Up: Printing

5.5 Using `printf' Statements for Fancier Printing
==================================================

For more precise control over the output format than what is provided
by `print', use `printf'.  With `printf' you can specify the width to
use for each item, as well as various formatting choices for numbers
(such as what output base to use, whether to print an exponent, whether
to print a sign, and how many digits to print after the decimal point).
You do this by supplying a string, called the "format string", that
controls how and where to print the other arguments.

* Menu:

* Basic Printf::                Syntax of the `printf' statement.
* Control Letters::             Format-control letters.
* Format Modifiers::            Format-specification modifiers.
* Printf Examples::             Several examples.


File: gawk.info,  Node: Basic Printf,  Next: Control Letters,  Up: Printf

5.5.1 Introduction to the `printf' Statement
--------------------------------------------

A simple `printf' statement looks like this:

     printf FORMAT, ITEM1, ITEM2, ...

The entire list of arguments may optionally be enclosed in parentheses.
The parentheses are necessary if any of the item expressions use the `>'
relational operator; otherwise, it can be confused with an output
redirection (*note Redirection::).

   The difference between `printf' and `print' is the FORMAT argument.
This is an expression whose value is taken as a string; it specifies
how to output each of the other arguments.  It is called the "format
string".

   The format string is very similar to that in the ISO C library
function `printf()'.  Most of FORMAT is text to output verbatim.
Scattered among this text are "format specifiers"--one per item.  Each
format specifier says to output the next item in the argument list at
that place in the format.

   The `printf' statement does not automatically append a newline to
its output.  It outputs only what the format string specifies.  So if a
newline is needed, you must include one in the format string.  The
output separator variables `OFS' and `ORS' have no effect on `printf'
statements. For example:

     $ awk 'BEGIN {
     >    ORS = "\nOUCH!\n"; OFS = "+"
     >    msg = "Dont Panic!"
     >    printf "%s\n", msg
     > }'
     -| Dont Panic!

Here, neither the `+' nor the `OUCH' appear in the output message.


File: gawk.info,  Node: Control Letters,  Next: Format Modifiers,  Prev: Basic Printf,  Up: Printf

5.5.2 Format-Control Letters
----------------------------

A format specifier starts with the character `%' and ends with a
"format-control letter"--it tells the `printf' statement how to output
one item.  The format-control letter specifies what _kind_ of value to
print.  The rest of the format specifier is made up of optional
"modifiers" that control _how_ to print the value, such as the field
width.  Here is a list of the format-control letters:

`%c'
     Print a number as an ASCII character; thus, `printf "%c", 65'
     outputs the letter `A'. The output for a string value is the first
     character of the string.

          NOTE: The POSIX standard says the first character of a string
          is printed.  In locales with multibyte characters, `gawk'
          attempts to convert the leading bytes of the string into a
          valid wide character and then to print the multibyte encoding
          of that character.  Similarly, when printing a numeric value,
          `gawk' allows the value to be within the numeric range of
          values that can be held in a wide character.

          Other `awk' versions generally restrict themselves to printing
          the first byte of a string or to numeric values within the
          range of a single byte (0-255).

`%d, %i'
     Print a decimal integer.  The two control letters are equivalent.
     (The `%i' specification is for compatibility with ISO C.)

`%e, %E'
     Print a number in scientific (exponential) notation; for example:

          printf "%4.3e\n", 1950

     prints `1.950e+03', with a total of four significant figures,
     three of which follow the decimal point.  (The `4.3' represents
     two modifiers, discussed in the next node.)  `%E' uses `E' instead
     of `e' in the output.

`%f'
     Print a number in floating-point notation.  For example:

          printf "%4.3f", 1950

     prints `1950.000', with a total of four significant figures, three
     of which follow the decimal point.  (The `4.3' represents two
     modifiers, discussed in the next node.)

     On systems supporting IEEE 754 floating point format, values
     representing negative infinity are formatted as `-inf' or
     `-infinity', and positive infinity as `inf' and `infinity'.  The
     special "not a number" value formats as `-nan' or `nan'.

`%F'
     Like `%f' but the infinity and "not a number" values are spelled
     using uppercase letters.

     The `%F' format is a POSIX extension to ISO C; not all systems
     support it.  On those that don't, `gawk' uses `%f' instead.

`%g, %G'
     Print a number in either scientific notation or in floating-point
     notation, whichever uses fewer characters; if the result is
     printed in scientific notation, `%G' uses `E' instead of `e'.

`%o'
     Print an unsigned octal integer (*note Nondecimal-numbers::).

`%s'
     Print a string.

`%u'
     Print an unsigned decimal integer.  (This format is of marginal
     use, because all numbers in `awk' are floating-point; it is
     provided primarily for compatibility with C.)

`%x, %X'
     Print an unsigned hexadecimal integer; `%X' uses the letters `A'
     through `F' instead of `a' through `f' (*note
     Nondecimal-numbers::).

`%%'
     Print a single `%'.  This does not consume an argument and it
     ignores any modifiers.

     NOTE: When using the integer format-control letters for values
     that are outside the range of the widest C integer type, `gawk'
     switches to the `%g' format specifier. If `--lint' is provided on
     the command line (*note Options::), `gawk' warns about this.
     Other versions of `awk' may print invalid values or do something
     else entirely.  (d.c.)


File: gawk.info,  Node: Format Modifiers,  Next: Printf Examples,  Prev: Control Letters,  Up: Printf

5.5.3 Modifiers for `printf' Formats
------------------------------------

A format specification can also include "modifiers" that can control
how much of the item's value is printed, as well as how much space it
gets.  The modifiers come between the `%' and the format-control letter.
We will use the bullet symbol "*" in the following examples to represent
spaces in the output. Here are the possible modifiers, in the order in
which they may appear:

`N$'
     An integer constant followed by a `$' is a "positional specifier".
     Normally, format specifications are applied to arguments in the
     order given in the format string.  With a positional specifier,
     the format specification is applied to a specific argument,
     instead of what would be the next argument in the list.
     Positional specifiers begin counting with one. Thus:

          printf "%s %s\n", "don't", "panic"
          printf "%2$s %1$s\n", "panic", "don't"

     prints the famous friendly message twice.

     At first glance, this feature doesn't seem to be of much use.  It
     is in fact a `gawk' extension, intended for use in translating
     messages at runtime.  *Note Printf Ordering::, which describes how
     and why to use positional specifiers.  For now, we will not use
     them.

`-'
     The minus sign, used before the width modifier (see later on in
     this list), says to left-justify the argument within its specified
     width.  Normally, the argument is printed right-justified in the
     specified width.  Thus:

          printf "%-4s", "foo"

     prints `foo*'.

`SPACE'
     For numeric conversions, prefix positive values with a space and
     negative values with a minus sign.

`+'
     The plus sign, used before the width modifier (see later on in
     this list), says to always supply a sign for numeric conversions,
     even if the data to format is positive. The `+' overrides the
     space modifier.

`#'
     Use an "alternate form" for certain control letters.  For `%o',
     supply a leading zero.  For `%x' and `%X', supply a leading `0x'
     or `0X' for a nonzero result.  For `%e', `%E', `%f', and `%F', the
     result always contains a decimal point.  For `%g' and `%G',
     trailing zeros are not removed from the result.

`0'
     A leading `0' (zero) acts as a flag that indicates that output
     should be padded with zeros instead of spaces.  This applies only
     to the numeric output formats.  This flag only has an effect when
     the field width is wider than the value to print.

`''
     A single quote or apostrophe character is a POSIX extension to ISO
     C.  It indicates that the integer part of a floating point value,
     or the entire part of an integer decimal value, should have a
     thousands-separator character in it.  This only works in locales
     that support such characters.  For example:

          $ cat thousands.awk          Show source program
          -| BEGIN { printf "%'d\n", 1234567 }
          $ LC_ALL=C gawk -f thousands.awk
          -| 1234567                   Results in "C" locale
          $ LC_ALL=en_US.UTF-8 gawk -f thousands.awk
          -| 1,234,567                 Results in US English UTF locale

     For more information about locales and internationalization issues,
     see *note Locales::.

          NOTE: The `'' flag is a nice feature, but its use complicates
          things: it becomes difficult to use it in command-line
          programs.  For information on appropriate quoting tricks, see
          *note Quoting::.

`WIDTH'
     This is a number specifying the desired minimum width of a field.
     Inserting any number between the `%' sign and the format-control
     character forces the field to expand to this width.  The default
     way to do this is to pad with spaces on the left.  For example:

          printf "%4s", "foo"

     prints `*foo'.

     The value of WIDTH is a minimum width, not a maximum.  If the item
     value requires more than WIDTH characters, it can be as wide as
     necessary.  Thus, the following:

          printf "%4s", "foobar"

     prints `foobar'.

     Preceding the WIDTH with a minus sign causes the output to be
     padded with spaces on the right, instead of on the left.

`.PREC'
     A period followed by an integer constant specifies the precision
     to use when printing.  The meaning of the precision varies by
     control letter:

    `%d', `%i', `%o', `%u', `%x', `%X'
          Minimum number of digits to print.

    `%e', `%E', `%f', `%F'
          Number of digits to the right of the decimal point.

    `%g', `%G'
          Maximum number of significant digits.

    `%s'
          Maximum number of characters from the string that should
          print.

     Thus, the following:

          printf "%.4s", "foobar"

     prints `foob'.

   The C library `printf''s dynamic WIDTH and PREC capability (for
example, `"%*.*s"') is supported.  Instead of supplying explicit WIDTH
and/or PREC values in the format string, they are passed in the
argument list.  For example:

     w = 5
     p = 3
     s = "abcdefg"
     printf "%*.*s\n", w, p, s

is exactly equivalent to:

     s = "abcdefg"
     printf "%5.3s\n", s

Both programs output `**abc'.  Earlier versions of `awk' did not
support this capability.  If you must use such a version, you may
simulate this feature by using concatenation to build up the format
string, like so:

     w = 5
     p = 3
     s = "abcdefg"
     printf "%" w "." p "s\n", s

This is not particularly easy to read but it does work.

   C programmers may be used to supplying additional `l', `L', and `h'
modifiers in `printf' format strings. These are not valid in `awk'.
Most `awk' implementations silently ignore them.  If `--lint' is
provided on the command line (*note Options::), `gawk' warns about
their use. If `--posix' is supplied, their use is a fatal error.


File: gawk.info,  Node: Printf Examples,  Prev: Format Modifiers,  Up: Printf

5.5.4 Examples Using `printf'
-----------------------------

The following simple example shows how to use `printf' to make an
aligned table:

     awk '{ printf "%-10s %s\n", $1, $2 }' BBS-list

This command prints the names of the bulletin boards (`$1') in the file
`BBS-list' as a string of 10 characters that are left-justified.  It
also prints the phone numbers (`$2') next on the line.  This produces
an aligned two-column table of names and phone numbers, as shown here:

     $ awk '{ printf "%-10s %s\n", $1, $2 }' BBS-list
     -| aardvark   555-5553
     -| alpo-net   555-3412
     -| barfly     555-7685
     -| bites      555-1675
     -| camelot    555-0542
     -| core       555-2912
     -| fooey      555-1234
     -| foot       555-6699
     -| macfoo     555-6480
     -| sdace      555-3430
     -| sabafoo    555-2127

   In this case, the phone numbers had to be printed as strings because
the numbers are separated by a dash.  Printing the phone numbers as
numbers would have produced just the first three digits: `555'.  This
would have been pretty confusing.

   It wasn't necessary to specify a width for the phone numbers because
they are last on their lines.  They don't need to have spaces after
them.

   The table could be made to look even nicer by adding headings to the
tops of the columns.  This is done using the `BEGIN' pattern (*note
BEGIN/END::) so that the headers are only printed once, at the
beginning of the `awk' program:

     awk 'BEGIN { print "Name      Number"
                  print "----      ------" }
          { printf "%-10s %s\n", $1, $2 }' BBS-list

   The above example mixes `print' and `printf' statements in the same
program.  Using just `printf' statements can produce the same results:

     awk 'BEGIN { printf "%-10s %s\n", "Name", "Number"
                  printf "%-10s %s\n", "----", "------" }
          { printf "%-10s %s\n", $1, $2 }' BBS-list

Printing each column heading with the same format specification used
for the column elements ensures that the headings are aligned just like
the columns.

   The fact that the same format specification is used three times can
be emphasized by storing it in a variable, like this:

     awk 'BEGIN { format = "%-10s %s\n"
                  printf format, "Name", "Number"
                  printf format, "----", "------" }
          { printf format, $1, $2 }' BBS-list

   At this point, it would be a worthwhile exercise to use the `printf'
statement to line up the headings and table data for the
`inventory-shipped' example that was covered earlier in the minor node
on the `print' statement (*note Print::).


File: gawk.info,  Node: Redirection,  Next: Special Files,  Prev: Printf,  Up: Printing

5.6 Redirecting Output of `print' and `printf'
==============================================

So far, the output from `print' and `printf' has gone to the standard
output, usually the screen.  Both `print' and `printf' can also send
their output to other places.  This is called "redirection".

     NOTE: When `--sandbox' is specified (*note Options::), redirecting
     output to files and pipes is disabled.

   A redirection appears after the `print' or `printf' statement.
Redirections in `awk' are written just like redirections in shell
commands, except that they are written inside the `awk' program.

   There are four forms of output redirection: output to a file, output
appended to a file, output through a pipe to another command, and output
to a coprocess.  They are all shown for the `print' statement, but they
work identically for `printf':

`print ITEMS > OUTPUT-FILE'
     This redirection prints the items into the output file named
     OUTPUT-FILE.  The file name OUTPUT-FILE can be any expression.
     Its value is changed to a string and then used as a file name
     (*note Expressions::).

     When this type of redirection is used, the OUTPUT-FILE is erased
     before the first output is written to it.  Subsequent writes to
     the same OUTPUT-FILE do not erase OUTPUT-FILE, but append to it.
     (This is different from how you use redirections in shell scripts.)
     If OUTPUT-FILE does not exist, it is created.  For example, here
     is how an `awk' program can write a list of BBS names to one file
     named `name-list', and a list of phone numbers to another file
     named `phone-list':

          $ awk '{ print $2 > "phone-list"
          >        print $1 > "name-list" }' BBS-list
          $ cat phone-list
          -| 555-5553
          -| 555-3412
          ...
          $ cat name-list
          -| aardvark
          -| alpo-net
          ...

     Each output file contains one name or number per line.

`print ITEMS >> OUTPUT-FILE'
     This redirection prints the items into the pre-existing output file
     named OUTPUT-FILE.  The difference between this and the single-`>'
     redirection is that the old contents (if any) of OUTPUT-FILE are
     not erased.  Instead, the `awk' output is appended to the file.
     If OUTPUT-FILE does not exist, then it is created.

`print ITEMS | COMMAND'
     It is possible to send output to another program through a pipe
     instead of into a file.   This redirection opens a pipe to
     COMMAND, and writes the values of ITEMS through this pipe to
     another process created to execute COMMAND.

     The redirection argument COMMAND is actually an `awk' expression.
     Its value is converted to a string whose contents give the shell
     command to be run.  For example, the following produces two files,
     one unsorted list of BBS names, and one list sorted in reverse
     alphabetical order:

          awk '{ print $1 > "names.unsorted"
                 command = "sort -r > names.sorted"
                 print $1 | command }' BBS-list

     The unsorted list is written with an ordinary redirection, while
     the sorted list is written by piping through the `sort' utility.

     The next example uses redirection to mail a message to the mailing
     list `bug-system'.  This might be useful when trouble is
     encountered in an `awk' script run periodically for system
     maintenance:

          report = "mail bug-system"
          print "Awk script failed:", $0 | report
          m = ("at record number " FNR " of " FILENAME)
          print m | report
          close(report)

     The message is built using string concatenation and saved in the
     variable `m'.  It's then sent down the pipeline to the `mail'
     program.  (The parentheses group the items to concatenate--see
     *note Concatenation::.)

     The `close()' function is called here because it's a good idea to
     close the pipe as soon as all the intended output has been sent to
     it.  *Note Close Files And Pipes::, for more information.

     This example also illustrates the use of a variable to represent a
     FILE or COMMAND--it is not necessary to always use a string
     constant.  Using a variable is generally a good idea, because (if
     you mean to refer to that same file or command) `awk' requires
     that the string value be spelled identically every time.

`print ITEMS |& COMMAND'
     This redirection prints the items to the input of COMMAND.  The
     difference between this and the single-`|' redirection is that the
     output from COMMAND can be read with `getline'.  Thus COMMAND is a
     "coprocess", which works together with, but subsidiary to, the
     `awk' program.

     This feature is a `gawk' extension, and is not available in POSIX
     `awk'.  *Note Getline/Coprocess::, for a brief discussion.  *Note
     Two-way I/O::, for a more complete discussion.

   Redirecting output using `>', `>>', `|', or `|&' asks the system to
open a file, pipe, or coprocess only if the particular FILE or COMMAND
you specify has not already been written to by your program or if it
has been closed since it was last written to.

   It is a common error to use `>' redirection for the first `print' to
a file, and then to use `>>' for subsequent output:

     # clear the file
     print "Don't panic" > "guide.txt"
     ...
     # append
     print "Avoid improbability generators" >> "guide.txt"

This is indeed how redirections must be used from the shell.  But in
`awk', it isn't necessary.  In this kind of case, a program should use
`>' for all the `print' statements, since the output file is only
opened once. (It happens that if you mix `>' and `>>' that output is
produced in the expected order. However, mixing the operators for the
same file is definitely poor style, and is confusing to readers of your
program.)

   Many older `awk' implementations limit the number of pipelines that
an `awk' program may have open to just one!  In `gawk', there is no
such limit.  `gawk' allows a program to open as many pipelines as the
underlying operating system permits.

                           Piping into `sh'

   A particularly powerful way to use redirection is to build command
lines and pipe them into the shell, `sh'.  For example, suppose you
have a list of files brought over from a system where all the file names
are stored in uppercase, and you wish to rename them to have names in
all lowercase.  The following program is both simple and efficient:

     { printf("mv %s %s\n", $0, tolower($0)) | "sh" }

     END { close("sh") }

   The `tolower()' function returns its argument string with all
uppercase characters converted to lowercase (*note String Functions::).
The program builds up a list of command lines, using the `mv' utility
to rename the files.  It then sends the list to the shell for execution.


File: gawk.info,  Node: Special Files,  Next: Close Files And Pipes,  Prev: Redirection,  Up: Printing

5.7 Special File Names in `gawk'
================================

`gawk' provides a number of special file names that it interprets
internally.  These file names provide access to standard file
descriptors and TCP/IP networking.

* Menu:

* Special FD::                  Special files for I/O.
* Special Network::             Special files for network communications.
* Special Caveats::             Things to watch out for.


File: gawk.info,  Node: Special FD,  Next: Special Network,  Up: Special Files

5.7.1 Special Files for Standard Descriptors
--------------------------------------------

Running programs conventionally have three input and output streams
already available to them for reading and writing.  These are known as
the "standard input", "standard output", and "standard error output".
These streams are, by default, connected to your keyboard and screen,
but they are often redirected with the shell, via the `<', `<<', `>',
`>>', `>&', and `|' operators.  Standard error is typically used for
writing error messages; the reason there are two separate streams,
standard output and standard error, is so that they can be redirected
separately.

   In other implementations of `awk', the only way to write an error
message to standard error in an `awk' program is as follows:

     print "Serious error detected!" | "cat 1>&2"

This works by opening a pipeline to a shell command that can access the
standard error stream that it inherits from the `awk' process.  This is
far from elegant, and it is also inefficient, because it requires a
separate process.  So people writing `awk' programs often don't do
this.  Instead, they send the error messages to the screen, like this:

     print "Serious error detected!" > "/dev/tty"

(`/dev/tty' is a special file supplied by the operating system that is
connected to your keyboard and screen. It represents the "terminal,"(1)
which on modern systems is a keyboard and screen, not a serial console.)
This usually has the same effect but not always: although the standard
error stream is usually the screen, it can be redirected; when that
happens, writing to the screen is not correct.  In fact, if `awk' is
run from a background job, it may not have a terminal at all.  Then
opening `/dev/tty' fails.

   `gawk' provides special file names for accessing the three standard
streams. (c.e.). It also provides syntax for accessing any other
inherited open files.  If the file name matches one of these special
names when `gawk' redirects input or output, then it directly uses the
stream that the file name stands for.  These special file names work
for all operating systems that `gawk' has been ported to, not just
those that are POSIX-compliant:

`/dev/stdin'
     The standard input (file descriptor 0).

`/dev/stdout'
     The standard output (file descriptor 1).

`/dev/stderr'
     The standard error output (file descriptor 2).

`/dev/fd/N'
     The file associated with file descriptor N.  Such a file must be
     opened by the program initiating the `awk' execution (typically
     the shell).  Unless special pains are taken in the shell from which
     `gawk' is invoked, only descriptors 0, 1, and 2 are available.

   The file names `/dev/stdin', `/dev/stdout', and `/dev/stderr' are
aliases for `/dev/fd/0', `/dev/fd/1', and `/dev/fd/2', respectively.
However, they are more self-explanatory.  The proper way to write an
error message in a `gawk' program is to use `/dev/stderr', like this:

     print "Serious error detected!" > "/dev/stderr"

   Note the use of quotes around the file name.  Like any other
redirection, the value must be a string.  It is a common error to omit
the quotes, which leads to confusing results.

   Finally, using the `close()' function on a file name of the form
`"/dev/fd/N"', for file descriptor numbers above two, does actually
close the given file descriptor.

   The `/dev/stdin', `/dev/stdout', and `/dev/stderr' special files are
also recognized internally by several other versions of `awk'.

   ---------- Footnotes ----------

   (1) The "tty" in `/dev/tty' stands for "Teletype," a serial terminal.


File: gawk.info,  Node: Special Network,  Next: Special Caveats,  Prev: Special FD,  Up: Special Files

5.7.2 Special Files for Network Communications
----------------------------------------------

`gawk' programs can open a two-way TCP/IP connection, acting as either
a client or a server.  This is done using a special file name of the
form:

     `/NET-TYPE/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'

   The NET-TYPE is one of `inet', `inet4' or `inet6'.  The PROTOCOL is
one of `tcp' or `udp', and the other fields represent the other
essential pieces of information for making a networking connection.
These file names are used with the `|&' operator for communicating with
a coprocess (*note Two-way I/O::).  This is an advanced feature,
mentioned here only for completeness.  Full discussion is delayed until
*note TCP/IP Networking::.


File: gawk.info,  Node: Special Caveats,  Prev: Special Network,  Up: Special Files

5.7.3 Special File Name Caveats
-------------------------------

Here is a list of things to bear in mind when using the special file
names that `gawk' provides:

   * Recognition of these special file names is disabled if `gawk' is in
     compatibility mode (*note Options::).

   * `gawk' _always_ interprets these special file names.  For example,
     using `/dev/fd/4' for output actually writes on file descriptor 4,
     and not on a new file descriptor that is `dup()''ed from file
     descriptor 4.  Most of the time this does not matter; however, it
     is important to _not_ close any of the files related to file
     descriptors 0, 1, and 2.  Doing so results in unpredictable
     behavior.


File: gawk.info,  Node: Close Files And Pipes,  Prev: Special Files,  Up: Printing

5.8 Closing Input and Output Redirections
=========================================

If the same file name or the same shell command is used with `getline'
more than once during the execution of an `awk' program (*note
Getline::), the file is opened (or the command is executed) the first
time only.  At that time, the first record of input is read from that
file or command.  The next time the same file or command is used with
`getline', another record is read from it, and so on.

   Similarly, when a file or pipe is opened for output, `awk' remembers
the file name or command associated with it, and subsequent writes to
the same file or command are appended to the previous writes.  The file
or pipe stays open until `awk' exits.

   This implies that special steps are necessary in order to read the
same file again from the beginning, or to rerun a shell command (rather
than reading more output from the same command).  The `close()' function
makes these things possible:

     close(FILENAME)

or:

     close(COMMAND)

   The argument FILENAME or COMMAND can be any expression.  Its value
must _exactly_ match the string that was used to open the file or start
the command (spaces and other "irrelevant" characters included). For
example, if you open a pipe with this:

     "sort -r names" | getline foo

then you must close it with this:

     close("sort -r names")

   Once this function call is executed, the next `getline' from that
file or command, or the next `print' or `printf' to that file or
command, reopens the file or reruns the command.  Because the
expression that you use to close a file or pipeline must exactly match
the expression used to open the file or run the command, it is good
practice to use a variable to store the file name or command.  The
previous example becomes the following:

     sortcom = "sort -r names"
     sortcom | getline foo
     ...
     close(sortcom)

This helps avoid hard-to-find typographical errors in your `awk'
programs.  Here are some of the reasons for closing an output file:

   * To write a file and read it back later on in the same `awk'
     program.  Close the file after writing it, then begin reading it
     with `getline'.

   * To write numerous files, successively, in the same `awk' program.
     If the files aren't closed, eventually `awk' may exceed a system
     limit on the number of open files in one process.  It is best to
     close each one when the program has finished writing it.

   * To make a command finish.  When output is redirected through a
     pipe, the command reading the pipe normally continues to try to
     read input as long as the pipe is open.  Often this means the
     command cannot really do its work until the pipe is closed.  For
     example, if output is redirected to the `mail' program, the
     message is not actually sent until the pipe is closed.

   * To run the same program a second time, with the same arguments.
     This is not the same thing as giving more input to the first run!

     For example, suppose a program pipes output to the `mail' program.
     If it outputs several lines redirected to this pipe without closing
     it, they make a single message of several lines.  By contrast, if
     the program closes the pipe after each line of output, then each
     line makes a separate message.

   If you use more files than the system allows you to have open,
`gawk' attempts to multiplex the available open files among your data
files.  `gawk''s ability to do this depends upon the facilities of your
operating system, so it may not always work.  It is therefore both good
practice and good portability advice to always use `close()' on your
files when you are done with them.  In fact, if you are using a lot of
pipes, it is essential that you close commands when done. For example,
consider something like this:

     {
         ...
         command = ("grep " $1 " /some/file | my_prog -q " $3)
         while ((command | getline) > 0) {
             PROCESS OUTPUT OF command
         }
         # need close(command) here
     }

   This example creates a new pipeline based on data in _each_ record.
Without the call to `close()' indicated in the comment, `awk' creates
child processes to run the commands, until it eventually runs out of
file descriptors for more pipelines.

   Even though each command has finished (as indicated by the
end-of-file return status from `getline'), the child process is not
terminated;(1) more importantly, the file descriptor for the pipe is
not closed and released until `close()' is called or `awk' exits.

   `close()' will silently do nothing if given an argument that does
not represent a file, pipe or coprocess that was opened with a
redirection.

   Note also that `close(FILENAME)' has no "magic" effects on the
implicit loop that reads through the files named on the command line.
It is, more likely, a close of a file that was never opened, so `awk'
silently does nothing.

   When using the `|&' operator to communicate with a coprocess, it is
occasionally useful to be able to close one end of the two-way pipe
without closing the other.  This is done by supplying a second argument
to `close()'.  As in any other call to `close()', the first argument is
the name of the command or special file used to start the coprocess.
The second argument should be a string, with either of the values
`"to"' or `"from"'.  Case does not matter.  As this is an advanced
feature, a more complete discussion is delayed until *note Two-way
I/O::, which discusses it in more detail and gives an example.

                    Using `close()''s Return Value

   In many versions of Unix `awk', the `close()' function is actually a
statement.  It is a syntax error to try and use the return value from
`close()': (d.c.)

     command = "..."
     command | getline info
     retval = close(command)  # syntax error in many Unix awks

   `gawk' treats `close()' as a function.  The return value is -1 if
the argument names something that was never opened with a redirection,
or if there is a system problem closing the file or process.  In these
cases, `gawk' sets the built-in variable `ERRNO' to a string describing
the problem.

   In `gawk', when closing a pipe or coprocess (input or output), the
return value is the exit status of the command.(2) Otherwise, it is the
return value from the system's `close()' or `fclose()' C functions when
closing input or output files, respectively.  This value is zero if the
close succeeds, or -1 if it fails.

   The POSIX standard is very vague; it says that `close()' returns
zero on success and nonzero otherwise.  In general, different
implementations vary in what they report when closing pipes; thus the
return value cannot be used portably.  (d.c.)  In POSIX mode (*note
Options::), `gawk' just returns zero when closing a pipe.

   ---------- Footnotes ----------

   (1) The technical terminology is rather morbid.  The finished child
is called a "zombie," and cleaning up after it is referred to as
"reaping."

   (2) This is a full 16-bit value as returned by the `wait()' system
call. See the system manual pages for information on how to decode this
value.


File: gawk.info,  Node: Expressions,  Next: Patterns and Actions,  Prev: Printing,  Up: Top

6 Expressions
*************

Expressions are the basic building blocks of `awk' patterns and
actions.  An expression evaluates to a value that you can print, test,
or pass to a function.  Additionally, an expression can assign a new
value to a variable or a field by using an assignment operator.

   An expression can serve as a pattern or action statement on its own.
Most other kinds of statements contain one or more expressions that
specify the data on which to operate.  As in other languages,
expressions in `awk' include variables, array references, constants,
and function calls, as well as combinations of these with various
operators.

* Menu:

* Values::                      Constants, Variables, and Regular Expressions.
* All Operators::               `gawk''s operators.
* Truth Values and Conditions:: Testing for true and false.
* Function Calls::              A function call is an expression.
* Precedence::                  How various operators nest.
* Locales::                     How the locale affects things.


File: gawk.info,  Node: Values,  Next: All Operators,  Up: Expressions

6.1 Constants, Variables and Conversions
========================================

Expressions are built up from values and the operations performed upon
them. This minor node describes the elementary objects which provide
the values used in expressions.

* Menu:

* Constants::                   String, numeric and regexp constants.
* Using Constant Regexps::      When and how to use a regexp constant.
* Variables::                   Variables give names to values for later use.
* Conversion::                  The conversion of strings to numbers and vice
                                versa.


File: gawk.info,  Node: Constants,  Next: Using Constant Regexps,  Up: Values

6.1.1 Constant Expressions
--------------------------

The simplest type of expression is the "constant", which always has the
same value.  There are three types of constants: numeric, string, and
regular expression.

   Each is used in the appropriate context when you need a data value
that isn't going to change.  Numeric constants can have different
forms, but are stored identically internally.

* Menu:

* Scalar Constants::            Numeric and string constants.
* Nondecimal-numbers::          What are octal and hex numbers.
* Regexp Constants::            Regular Expression constants.


File: gawk.info,  Node: Scalar Constants,  Next: Nondecimal-numbers,  Up: Constants

6.1.1.1 Numeric and String Constants
....................................

A "numeric constant" stands for a number.  This number can be an
integer, a decimal fraction, or a number in scientific (exponential)
notation.(1) Here are some examples of numeric constants that all have
the same value:

     105
     1.05e+2
     1050e-1

   A string constant consists of a sequence of characters enclosed in
double-quotation marks.  For example:

     "parrot"

represents the string whose contents are `parrot'.  Strings in `gawk'
can be of any length, and they can contain any of the possible
eight-bit ASCII characters including ASCII NUL (character code zero).
Other `awk' implementations may have difficulty with some character
codes.

   ---------- Footnotes ----------

   (1) The internal representation of all numbers, including integers,
uses double precision floating-point numbers.  On most modern systems,
these are in IEEE 754 standard format.


File: gawk.info,  Node: Nondecimal-numbers,  Next: Regexp Constants,  Prev: Scalar Constants,  Up: Constants

6.1.1.2 Octal and Hexadecimal Numbers
.....................................

In `awk', all numbers are in decimal; i.e., base 10.  Many other
programming languages allow you to specify numbers in other bases, often
octal (base 8) and hexadecimal (base 16).  In octal, the numbers go 0,
1, 2, 3, 4, 5, 6, 7, 10, 11, 12, etc.  Just as `11', in decimal, is 1
times 10 plus 1, so `11', in octal, is 1 times 8, plus 1. This equals 9
in decimal.  In hexadecimal, there are 16 digits. Since the everyday
decimal number system only has ten digits (`0'-`9'), the letters `a'
through `f' are used to represent the rest.  (Case in the letters is
usually irrelevant; hexadecimal `a' and `A' have the same value.)
Thus, `11', in hexadecimal, is 1 times 16 plus 1, which equals 17 in
decimal.

   Just by looking at plain `11', you can't tell what base it's in.
So, in C, C++, and other languages derived from C, there is a special
notation to signify the base.  Octal numbers start with a leading `0',
and hexadecimal numbers start with a leading `0x' or `0X':

`11'
     Decimal value 11.

`011'
     Octal 11, decimal value 9.

`0x11'
     Hexadecimal 11, decimal value 17.

   This example shows the difference:

     $ gawk 'BEGIN { printf "%d, %d, %d\n", 011, 11, 0x11 }'
     -| 9, 11, 17

   Being able to use octal and hexadecimal constants in your programs
is most useful when working with data that cannot be represented
conveniently as characters or as regular numbers, such as binary data
of various sorts.

   `gawk' allows the use of octal and hexadecimal constants in your
program text.  However, such numbers in the input data are not treated
differently; doing so by default would break old programs.  (If you
really need to do this, use the `--non-decimal-data' command-line
option; *note Nondecimal Data::.)  If you have octal or hexadecimal
data, you can use the `strtonum()' function (*note String Functions::)
to convert the data into a number.  Most of the time, you will want to
use octal or hexadecimal constants when working with the built-in bit
manipulation functions; see *note Bitwise Functions::, for more
information.

   Unlike some early C implementations, `8' and `9' are not valid in
octal constants; e.g., `gawk' treats `018' as decimal 18:

     $ gawk 'BEGIN { print "021 is", 021 ; print 018 }'
     -| 021 is 17
     -| 18

   Octal and hexadecimal source code constants are a `gawk' extension.
If `gawk' is in compatibility mode (*note Options::), they are not
available.

              A Constant's Base Does Not Affect Its Value

   Once a numeric constant has been converted internally into a number,
`gawk' no longer remembers what the original form of the constant was;
the internal value is always used.  This has particular consequences
for conversion of numbers to strings:

     $ gawk 'BEGIN { printf "0x11 is <%s>\n", 0x11 }'
     -| 0x11 is <17>


File: gawk.info,  Node: Regexp Constants,  Prev: Nondecimal-numbers,  Up: Constants

6.1.1.3 Regular Expression Constants
....................................

A regexp constant is a regular expression description enclosed in
slashes, such as `/^beginning and end$/'.  Most regexps used in `awk'
programs are constant, but the `~' and `!~' matching operators can also
match computed or dynamic regexps (which are just ordinary strings or
variables that contain a regexp).


File: gawk.info,  Node: Using Constant Regexps,  Next: Variables,  Prev: Constants,  Up: Values

6.1.2 Using Regular Expression Constants
----------------------------------------

When used on the righthand side of the `~' or `!~' operators, a regexp
constant merely stands for the regexp that is to be matched.  However,
regexp constants (such as `/foo/') may be used like simple expressions.
When a regexp constant appears by itself, it has the same meaning as if
it appeared in a pattern, i.e., `($0 ~ /foo/)' (d.c.)  *Note Expression
Patterns::.  This means that the following two code segments:

     if ($0 ~ /barfly/ || $0 ~ /camelot/)
         print "found"

and:

     if (/barfly/ || /camelot/)
         print "found"

are exactly equivalent.  One rather bizarre consequence of this rule is
that the following Boolean expression is valid, but does not do what
the user probably intended:

     # Note that /foo/ is on the left of the ~
     if (/foo/ ~ $1) print "found foo"

This code is "obviously" testing `$1' for a match against the regexp
`/foo/'.  But in fact, the expression `/foo/ ~ $1' really means `($0 ~
/foo/) ~ $1'.  In other words, first match the input record against the
regexp `/foo/'.  The result is either zero or one, depending upon the
success or failure of the match.  That result is then matched against
the first field in the record.  Because it is unlikely that you would
ever really want to make this kind of test, `gawk' issues a warning
when it sees this construct in a program.  Another consequence of this
rule is that the assignment statement:

     matches = /foo/

assigns either zero or one to the variable `matches', depending upon
the contents of the current input record.

   Constant regular expressions are also used as the first argument for
the `gensub()', `sub()', and `gsub()' functions, as the second argument
of the `match()' function, and as the third argument of the
`patsplit()' function (*note String Functions::).  Modern
implementations of `awk', including `gawk', allow the third argument of
`split()' to be a regexp constant, but some older implementations do
not.  (d.c.)  This can lead to confusion when attempting to use regexp
constants as arguments to user-defined functions (*note User-defined::).
For example:

     function mysub(pat, repl, str, global)
     {
         if (global)
             gsub(pat, repl, str)
         else
             sub(pat, repl, str)
         return str
     }

     {
         ...
         text = "hi! hi yourself!"
         mysub(/hi/, "howdy", text, 1)
         ...
     }

   In this example, the programmer wants to pass a regexp constant to
the user-defined function `mysub', which in turn passes it on to either
`sub()' or `gsub()'.  However, what really happens is that the `pat'
parameter is either one or zero, depending upon whether or not `$0'
matches `/hi/'.  `gawk' issues a warning when it sees a regexp constant
used as a parameter to a user-defined function, since passing a truth
value in this way is probably not what was intended.


File: gawk.info,  Node: Variables,  Next: Conversion,  Prev: Using Constant Regexps,  Up: Values

6.1.3 Variables
---------------

Variables are ways of storing values at one point in your program for
use later in another part of your program.  They can be manipulated
entirely within the program text, and they can also be assigned values
on the `awk' command line.

* Menu:

* Using Variables::             Using variables in your programs.
* Assignment Options::          Setting variables on the command-line and a
                                summary of command-line syntax. This is an
                                advanced method of input.


File: gawk.info,  Node: Using Variables,  Next: Assignment Options,  Up: Variables

6.1.3.1 Using Variables in a Program
....................................

Variables let you give names to values and refer to them later.
Variables have already been used in many of the examples.  The name of
a variable must be a sequence of letters, digits, or underscores, and
it may not begin with a digit.  Case is significant in variable names;
`a' and `A' are distinct variables.

   A variable name is a valid expression by itself; it represents the
variable's current value.  Variables are given new values with
"assignment operators", "increment operators", and "decrement
operators".  *Note Assignment Ops::.  In addition, the `sub()' and
`gsub()' functions can change a variable's value, and the `match()',
`patsplit()' and `split()' functions can change the contents of their
array parameters. *Note String Functions::.

   A few variables have special built-in meanings, such as `FS' (the
field separator), and `NF' (the number of fields in the current input
record).  *Note Built-in Variables::, for a list of the built-in
variables.  These built-in variables can be used and assigned just like
all other variables, but their values are also used or changed
automatically by `awk'.  All built-in variables' names are entirely
uppercase.

   Variables in `awk' can be assigned either numeric or string values.
The kind of value a variable holds can change over the life of a
program.  By default, variables are initialized to the empty string,
which is zero if converted to a number.  There is no need to explicitly
"initialize" a variable in `awk', which is what you would do in C and
in most other traditional languages.


File: gawk.info,  Node: Assignment Options,  Prev: Using Variables,  Up: Variables

6.1.3.2 Assigning Variables on the Command Line
...............................................

Any `awk' variable can be set by including a "variable assignment"
among the arguments on the command line when `awk' is invoked (*note
Other Arguments::).  Such an assignment has the following form:

     VARIABLE=TEXT

With it, a variable is set either at the beginning of the `awk' run or
in between input files.  When the assignment is preceded with the `-v'
option, as in the following:

     -v VARIABLE=TEXT

the variable is set at the very beginning, even before the `BEGIN'
rules execute.  The `-v' option and its assignment must precede all the
file name arguments, as well as the program text.  (*Note Options::,
for more information about the `-v' option.)  Otherwise, the variable
assignment is performed at a time determined by its position among the
input file arguments--after the processing of the preceding input file
argument.  For example:

     awk '{ print $n }' n=4 inventory-shipped n=2 BBS-list

prints the value of field number `n' for all input records.  Before the
first file is read, the command line sets the variable `n' equal to
four.  This causes the fourth field to be printed in lines from
`inventory-shipped'.  After the first file has finished, but before the
second file is started, `n' is set to two, so that the second field is
printed in lines from `BBS-list':

     $ awk '{ print $n }' n=4 inventory-shipped n=2 BBS-list
     -| 15
     -| 24
     ...
     -| 555-5553
     -| 555-3412
     ...

   Command-line arguments are made available for explicit examination by
the `awk' program in the `ARGV' array (*note ARGC and ARGV::).  `awk'
processes the values of command-line assignments for escape sequences
(*note Escape Sequences::).  (d.c.)


File: gawk.info,  Node: Conversion,  Prev: Variables,  Up: Values

6.1.4 Conversion of Strings and Numbers
---------------------------------------

Strings are converted to numbers and numbers are converted to strings,
if the context of the `awk' program demands it.  For example, if the
value of either `foo' or `bar' in the expression `foo + bar' happens to
be a string, it is converted to a number before the addition is
performed.  If numeric values appear in string concatenation, they are
converted to strings.  Consider the following:

     two = 2; three = 3
     print (two three) + 4

This prints the (numeric) value 27.  The numeric values of the
variables `two' and `three' are converted to strings and concatenated
together.  The resulting string is converted back to the number 23, to
which 4 is then added.

   If, for some reason, you need to force a number to be converted to a
string, concatenate that number with the empty string, `""'.  To force
a string to be converted to a number, add zero to that string.  A
string is converted to a number by interpreting any numeric prefix of
the string as numerals: `"2.5"' converts to 2.5, `"1e3"' converts to
1000, and `"25fix"' has a numeric value of 25.  Strings that can't be
interpreted as valid numbers convert to zero.

   The exact manner in which numbers are converted into strings is
controlled by the `awk' built-in variable `CONVFMT' (*note Built-in
Variables::).  Numbers are converted using the `sprintf()' function
with `CONVFMT' as the format specifier (*note String Functions::).

   `CONVFMT''s default value is `"%.6g"', which creates a value with at
most six significant digits.  For some applications, you might want to
change it to specify more precision.  On most modern machines, 17
digits is usually enough to capture a floating-point number's value
exactly.(1)

   Strange results can occur if you set `CONVFMT' to a string that
doesn't tell `sprintf()' how to format floating-point numbers in a
useful way.  For example, if you forget the `%' in the format, `awk'
converts all numbers to the same constant string.

   As a special case, if a number is an integer, then the result of
converting it to a string is _always_ an integer, no matter what the
value of `CONVFMT' may be.  Given the following code fragment:

     CONVFMT = "%2.2f"
     a = 12
     b = a ""

`b' has the value `"12"', not `"12.00"'.  (d.c.)

   Prior to the POSIX standard, `awk' used the value of `OFMT' for
converting numbers to strings.  `OFMT' specifies the output format to
use when printing numbers with `print'.  `CONVFMT' was introduced in
order to separate the semantics of conversion from the semantics of
printing.  Both `CONVFMT' and `OFMT' have the same default value:
`"%.6g"'.  In the vast majority of cases, old `awk' programs do not
change their behavior.  However, these semantics for `OFMT' are
something to keep in mind if you must port your new-style program to
older implementations of `awk'.  We recommend that instead of changing
your programs, just port `gawk' itself.  *Note Print::, for more
information on the `print' statement.

   And, once again, where you are can matter when it comes to converting
between numbers and strings.  In *note Locales::, we mentioned that the
local character set and language (the locale) can affect how `gawk'
matches characters.  The locale also affects numeric formats.  In
particular, for `awk' programs, it affects the decimal point character.
The `"C"' locale, and most English-language locales, use the period
character (`.') as the decimal point.  However, many (if not most)
European and non-English locales use the comma (`,') as the decimal
point character.

   The POSIX standard says that `awk' always uses the period as the
decimal point when reading the `awk' program source code, and for
command-line variable assignments (*note Other Arguments::).  However,
when interpreting input data, for `print' and `printf' output, and for
number to string conversion, the local decimal point character is used.
(d.c.).  Here are some examples indicating the difference in behavior,
on a GNU/Linux system:

     $ export POSIXLY_CORRECT=1                        Force POSIX behavior
     $ gawk 'BEGIN { printf "%g\n", 3.1415927 }'
     -| 3.14159
     $ LC_ALL=en_DK.utf-8 gawk 'BEGIN { printf "%g\n", 3.1415927 }'
     -| 3,14159
     $ echo 4,321 | gawk '{ print $1 + 1 }'
     -| 5
     $ echo 4,321 | LC_ALL=en_DK.utf-8 gawk '{ print $1 + 1 }'
     -| 5,321

The `en_DK.utf-8' locale is for English in Denmark, where the comma
acts as the decimal point separator.  In the normal `"C"' locale, `gawk'
treats `4,321' as `4', while in the Danish locale, it's treated as the
full number, 4.321.

   Some earlier versions of `gawk' fully complied with this aspect of
the standard.  However, many users in non-English locales complained
about this behavior, since their data used a period as the decimal
point, so the default behavior was restored to use a period as the
decimal point character.  You can use the `--use-lc-numeric' option
(*note Options::) to force `gawk' to use the locale's decimal point
character.  (`gawk' also uses the locale's decimal point character when
in POSIX mode, either via `--posix', or the `POSIXLY_CORRECT'
environment variable, as shown previously.)

   *note table-locale-affects:: describes the cases in which the
locale's decimal point character is used and when a period is used.
Some of these features have not been described yet.

Feature     Default        `--posix' or `--use-lc-numeric'
------------------------------------------------------------ 
`%'g'       Use locale     Use locale
`%g'        Use period     Use locale
Input       Use period     Use locale
`strtonum()'Use period     Use locale

Table 6.1: Locale Decimal Point versus A Period

   Finally, modern day formal standards and IEEE standard floating point
representation can have an unusual but important effect on the way
`gawk' converts some special string values to numbers.  The details are
presented in *note POSIX Floating Point Problems::.

   ---------- Footnotes ----------

   (1) Pathological cases can require up to 752 digits (!), but we
doubt that you need to worry about this.


File: gawk.info,  Node: All Operators,  Next: Truth Values and Conditions,  Prev: Values,  Up: Expressions

6.2 Operators: Doing Something With Values
==========================================

This minor node introduces the "operators" which make use of the values
provided by constants and variables.

* Menu:

* Arithmetic Ops::              Arithmetic operations (`+', `-',
                                etc.)
* Concatenation::               Concatenating strings.
* Assignment Ops::              Changing the value of a variable or a field.
* Increment Ops::               Incrementing the numeric value of a variable.


File: gawk.info,  Node: Arithmetic Ops,  Next: Concatenation,  Up: All Operators

6.2.1 Arithmetic Operators
--------------------------

The `awk' language uses the common arithmetic operators when evaluating
expressions.  All of these arithmetic operators follow normal
precedence rules and work as you would expect them to.

   The following example uses a file named `grades', which contains a
list of student names as well as three test scores per student (it's a
small class):

     Pat   100 97 58
     Sandy  84 72 93
     Chris  72 92 89

This program takes the file `grades' and prints the average of the
scores:

     $ awk '{ sum = $2 + $3 + $4 ; avg = sum / 3
     >        print $1, avg }' grades
     -| Pat 85
     -| Sandy 83
     -| Chris 84.3333

   The following list provides the arithmetic operators in `awk', in
order from the highest precedence to the lowest:

`X ^ Y'
`X ** Y'
     Exponentiation; X raised to the Y power.  `2 ^ 3' has the value
     eight; the character sequence `**' is equivalent to `^'. (c.e.)

`- X'
     Negation.

`+ X'
     Unary plus; the expression is converted to a number.

`X * Y'
     Multiplication.

`X / Y'
     Division;  because all numbers in `awk' are floating-point
     numbers, the result is _not_ rounded to an integer--`3 / 4' has
     the value 0.75.  (It is a common mistake, especially for C
     programmers, to forget that _all_ numbers in `awk' are
     floating-point, and that division of integer-looking constants
     produces a real number, not an integer.)

`X % Y'
     Remainder; further discussion is provided in the text, just after
     this list.

`X + Y'
     Addition.

`X - Y'
     Subtraction.

   Unary plus and minus have the same precedence, the multiplication
operators all have the same precedence, and addition and subtraction
have the same precedence.

   When computing the remainder of `X % Y', the quotient is rounded
toward zero to an integer and multiplied by Y. This result is
subtracted from X; this operation is sometimes known as "trunc-mod."
The following relation always holds:

     b * int(a / b) + (a % b) == a

   One possibly undesirable effect of this definition of remainder is
that `X % Y' is negative if X is negative.  Thus:

     -17 % 8 = -1

   In other `awk' implementations, the signedness of the remainder may
be machine-dependent.

     NOTE: The POSIX standard only specifies the use of `^' for
     exponentiation.  For maximum portability, do not use the `**'
     operator.


File: gawk.info,  Node: Concatenation,  Next: Assignment Ops,  Prev: Arithmetic Ops,  Up: All Operators

6.2.2 String Concatenation
--------------------------

     It seemed like a good idea at the time.  -- Brian Kernighan

   There is only one string operation: concatenation.  It does not have
a specific operator to represent it.  Instead, concatenation is
performed by writing expressions next to one another, with no operator.
For example:

     $ awk '{ print "Field number one: " $1 }' BBS-list
     -| Field number one: aardvark
     -| Field number one: alpo-net
     ...

   Without the space in the string constant after the `:', the line
runs together.  For example:

     $ awk '{ print "Field number one:" $1 }' BBS-list
     -| Field number one:aardvark
     -| Field number one:alpo-net
     ...

   Because string concatenation does not have an explicit operator, it
is often necessary to insure that it happens at the right time by using
parentheses to enclose the items to concatenate.  For example, you
might expect that the following code fragment concatenates `file' and
`name':

     file = "file"
     name = "name"
     print "something meaningful" > file name

This produces a syntax error with some versions of Unix `awk'.(1) It is
necessary to use the following:

     print "something meaningful" > (file name)

   Parentheses should be used around concatenation in all but the most
common contexts, such as on the righthand side of `='.  Be careful
about the kinds of expressions used in string concatenation.  In
particular, the order of evaluation of expressions used for
concatenation is undefined in the `awk' language.  Consider this
example:

     BEGIN {
         a = "don't"
         print (a " " (a = "panic"))
     }

It is not defined whether the assignment to `a' happens before or after
the value of `a' is retrieved for producing the concatenated value.
The result could be either `don't panic', or `panic panic'.

   The precedence of concatenation, when mixed with other operators, is
often counter-intuitive.  Consider this example:

     $ awk 'BEGIN { print -12 " " -24 }'
     -| -12-24

   This "obviously" is concatenating -12, a space, and -24.  But where
did the space disappear to?  The answer lies in the combination of
operator precedences and `awk''s automatic conversion rules.  To get
the desired result, write the program this way:

     $ awk 'BEGIN { print -12 " " (-24) }'
     -| -12 -24

   This forces `awk' to treat the `-' on the `-24' as unary.
Otherwise, it's parsed as follows:

         -12 (`" "' - 24)
     => -12 (0 - 24)
     => -12 (-24)
     => -12-24

   As mentioned earlier, when doing concatenation, _parenthesize_.
Otherwise, you're never quite sure what you'll get.

   ---------- Footnotes ----------

   (1) It happens that Brian Kernighan's `awk', `gawk' and `mawk' all
"get it right," but you should not rely on this.


File: gawk.info,  Node: Assignment Ops,  Next: Increment Ops,  Prev: Concatenation,  Up: All Operators

6.2.3 Assignment Expressions
----------------------------

An "assignment" is an expression that stores a (usually different)
value into a variable.  For example, let's assign the value one to the
variable `z':

     z = 1

   After this expression is executed, the variable `z' has the value
one.  Whatever old value `z' had before the assignment is forgotten.

   Assignments can also store string values.  For example, the
following stores the value `"this food is good"' in the variable
`message':

     thing = "food"
     predicate = "good"
     message = "this " thing " is " predicate

This also illustrates string concatenation.  The `=' sign is called an
"assignment operator".  It is the simplest assignment operator because
the value of the righthand operand is stored unchanged.  Most operators
(addition, concatenation, and so on) have no effect except to compute a
value.  If the value isn't used, there's no reason to use the operator.
An assignment operator is different; it does produce a value, but even
if you ignore it, the assignment still makes itself felt through the
alteration of the variable.  We call this a "side effect".

   The lefthand operand of an assignment need not be a variable (*note
Variables::); it can also be a field (*note Changing Fields::) or an
array element (*note Arrays::).  These are all called "lvalues", which
means they can appear on the lefthand side of an assignment operator.
The righthand operand may be any expression; it produces the new value
that the assignment stores in the specified variable, field, or array
element. (Such values are called "rvalues".)

   It is important to note that variables do _not_ have permanent types.
A variable's type is simply the type of whatever value it happens to
hold at the moment.  In the following program fragment, the variable
`foo' has a numeric value at first, and a string value later on:

     foo = 1
     print foo
     foo = "bar"
     print foo

When the second assignment gives `foo' a string value, the fact that it
previously had a numeric value is forgotten.

   String values that do not begin with a digit have a numeric value of
zero. After executing the following code, the value of `foo' is five:

     foo = "a string"
     foo = foo + 5

     NOTE: Using a variable as a number and then later as a string can
     be confusing and is poor programming style.  The previous two
     examples illustrate how `awk' works, _not_ how you should write
     your programs!

   An assignment is an expression, so it has a value--the same value
that is assigned.  Thus, `z = 1' is an expression with the value one.
One consequence of this is that you can write multiple assignments
together, such as:

     x = y = z = 5

This example stores the value five in all three variables (`x', `y',
and `z').  It does so because the value of `z = 5', which is five, is
stored into `y' and then the value of `y = z = 5', which is five, is
stored into `x'.

   Assignments may be used anywhere an expression is called for.  For
example, it is valid to write `x != (y = 1)' to set `y' to one, and
then test whether `x' equals one.  But this style tends to make
programs hard to read; such nesting of assignments should be avoided,
except perhaps in a one-shot program.

   Aside from `=', there are several other assignment operators that do
arithmetic with the old value of the variable.  For example, the
operator `+=' computes a new value by adding the righthand value to the
old value of the variable.  Thus, the following assignment adds five to
the value of `foo':

     foo += 5

This is equivalent to the following:

     foo = foo + 5

Use whichever makes the meaning of your program clearer.

   There are situations where using `+=' (or any assignment operator)
is _not_ the same as simply repeating the lefthand operand in the
righthand expression.  For example:

     # Thanks to Pat Rankin for this example
     BEGIN  {
         foo[rand()] += 5
         for (x in foo)
            print x, foo[x]

         bar[rand()] = bar[rand()] + 5
         for (x in bar)
            print x, bar[x]
     }

The indices of `bar' are practically guaranteed to be different, because
`rand()' returns different values each time it is called.  (Arrays and
the `rand()' function haven't been covered yet.  *Note Arrays::, and
see *note Numeric Functions::, for more information).  This example
illustrates an important fact about assignment operators: the lefthand
expression is only evaluated _once_.  It is up to the implementation as
to which expression is evaluated first, the lefthand or the righthand.
Consider this example:

     i = 1
     a[i += 2] = i + 1

The value of `a[3]' could be either two or four.

   *note table-assign-ops:: lists the arithmetic assignment operators.
In each case, the righthand operand is an expression whose value is
converted to a number.

Operator               Effect
-------------------------------------------------------------------------- 
LVALUE `+=' INCREMENT  Adds INCREMENT to the value of LVALUE.
LVALUE `-=' DECREMENT  Subtracts DECREMENT from the value of LVALUE.
LVALUE `*='            Multiplies the value of LVALUE by COEFFICIENT.
COEFFICIENT            
LVALUE `/=' DIVISOR    Divides the value of LVALUE by DIVISOR.
LVALUE `%=' MODULUS    Sets LVALUE to its remainder by MODULUS.
LVALUE `^=' POWER      
LVALUE `**=' POWER     Raises LVALUE to the power POWER. (c.e.)

Table 6.2: Arithmetic Assignment Operators

     NOTE: Only the `^=' operator is specified by POSIX.  For maximum
     portability, do not use the `**=' operator.

      Syntactic Ambiguities Between `/=' and Regular Expressions

   There is a syntactic ambiguity between the `/=' assignment operator
and regexp constants whose first character is an `='.  (d.c.)  This is
most notable in some commercial `awk' versions.  For example:

     $ awk /==/ /dev/null
     error--> awk: syntax error at source line 1
     error-->  context is
     error-->         >>> /= <<<
     error--> awk: bailing out at source line 1

A workaround is:

     awk '/[=]=/' /dev/null

   `gawk' does not have this problem, nor do the other freely available
versions described in *note Other Versions::.


File: gawk.info,  Node: Increment Ops,  Prev: Assignment Ops,  Up: All Operators

6.2.4 Increment and Decrement Operators
---------------------------------------

"Increment" and "decrement operators" increase or decrease the value of
a variable by one.  An assignment operator can do the same thing, so
the increment operators add no power to the `awk' language; however,
they are convenient abbreviations for very common operations.

   The operator used for adding one is written `++'.  It can be used to
increment a variable either before or after taking its value.  To
pre-increment a variable `v', write `++v'.  This adds one to the value
of `v'--that new value is also the value of the expression. (The
assignment expression `v += 1' is completely equivalent.)  Writing the
`++' after the variable specifies post-increment.  This increments the
variable value just the same; the difference is that the value of the
increment expression itself is the variable's _old_ value.  Thus, if
`foo' has the value four, then the expression `foo++' has the value
four, but it changes the value of `foo' to five.  In other words, the
operator returns the old value of the variable, but with the side
effect of incrementing it.

   The post-increment `foo++' is nearly the same as writing `(foo += 1)
- 1'.  It is not perfectly equivalent because all numbers in `awk' are
floating-point--in floating-point, `foo + 1 - 1' does not necessarily
equal `foo'.  But the difference is minute as long as you stick to
numbers that are fairly small (less than 10e12).

   Fields and array elements are incremented just like variables.  (Use
`$(i++)' when you want to do a field reference and a variable increment
at the same time.  The parentheses are necessary because of the
precedence of the field reference operator `$'.)

   The decrement operator `--' works just like `++', except that it
subtracts one instead of adding it.  As with `++', it can be used before
the lvalue to pre-decrement or after it to post-decrement.  Following
is a summary of increment and decrement expressions:

`++LVALUE'
     Increment LVALUE, returning the new value as the value of the
     expression.

`LVALUE++'
     Increment LVALUE, returning the _old_ value of LVALUE as the value
     of the expression.

`--LVALUE'
     Decrement LVALUE, returning the new value as the value of the
     expression.  (This expression is like `++LVALUE', but instead of
     adding, it subtracts.)

`LVALUE--'
     Decrement LVALUE, returning the _old_ value of LVALUE as the value
     of the expression.  (This expression is like `LVALUE++', but
     instead of adding, it subtracts.)

                       Operator Evaluation Order

     Doctor, doctor!  It hurts when I do this!
     So don't do that!  -- Groucho Marx

What happens for something like the following?

     b = 6
     print b += b++

Or something even stranger?

     b = 6
     b += ++b + b++
     print b

   In other words, when do the various side effects prescribed by the
postfix operators (`b++') take effect?  When side effects happen is
"implementation defined".  In other words, it is up to the particular
version of `awk'.  The result for the first example may be 12 or 13,
and for the second, it may be 22 or 23.

   In short, doing things like this is not recommended and definitely
not anything that you can rely upon for portability.  You should avoid
such things in your own programs.


File: gawk.info,  Node: Truth Values and Conditions,  Next: Function Calls,  Prev: All Operators,  Up: Expressions

6.3 Truth Values and Conditions
===============================

In certain contexts, expression values also serve as "truth values;"
i.e., they determine what should happen next as the program runs. This
minor node describes how `awk' defines "true" and "false" and how
values are compared.

* Menu:

* Truth Values::                What is ``true'' and what is ``false''.
* Typing and Comparison::       How variables acquire types and how this
                                affects comparison of numbers and strings with
                                `<', etc.
* Boolean Ops::                 Combining comparison expressions using boolean
                                operators `||' (``or''), `&&'
                                (``and'') and `!' (``not'').
* Conditional Exp::             Conditional expressions select between two
                                subexpressions under control of a third
                                subexpression.


File: gawk.info,  Node: Truth Values,  Next: Typing and Comparison,  Up: Truth Values and Conditions

6.3.1 True and False in `awk'
-----------------------------

Many programming languages have a special representation for the
concepts of "true" and "false."  Such languages usually use the special
constants `true' and `false', or perhaps their uppercase equivalents.
However, `awk' is different.  It borrows a very simple concept of true
and false from C.  In `awk', any nonzero numeric value _or_ any
nonempty string value is true.  Any other value (zero or the null
string, `""') is false.  The following program prints `A strange truth
value' three times:

     BEGIN {
        if (3.1415927)
            print "A strange truth value"
        if ("Four Score And Seven Years Ago")
            print "A strange truth value"
        if (j = 57)
            print "A strange truth value"
     }

   There is a surprising consequence of the "nonzero or non-null" rule:
the string constant `"0"' is actually true, because it is non-null.
(d.c.)


File: gawk.info,  Node: Typing and Comparison,  Next: Boolean Ops,  Prev: Truth Values,  Up: Truth Values and Conditions

6.3.2 Variable Typing and Comparison Expressions
------------------------------------------------

     The Guide is definitive. Reality is frequently inaccurate.  -- The
     Hitchhiker's Guide to the Galaxy

   Unlike other programming languages, `awk' variables do not have a
fixed type. Instead, they can be either a number or a string, depending
upon the value that is assigned to them.  We look now at how variables
are typed, and how `awk' compares variables.

* Menu:

* Variable Typing::             String type versus numeric type.
* Comparison Operators::        The comparison operators.
* POSIX String Comparison::     String comparison with POSIX rules.


File: gawk.info,  Node: Variable Typing,  Next: Comparison Operators,  Up: Typing and Comparison

6.3.2.1 String Type Versus Numeric Type
.......................................

The 1992 POSIX standard introduced the concept of a "numeric string",
which is simply a string that looks like a number--for example,
`" +2"'.  This concept is used for determining the type of a variable.
The type of the variable is important because the types of two variables
determine how they are compared.  The various versions of the POSIX
standard did not get the rules quite right for several editions.
Fortunately, as of at least the 2008 standard (and possibly earlier),
the standard has been fixed, and variable typing follows these rules:(1)

   * A numeric constant or the result of a numeric operation has the
     NUMERIC attribute.

   * A string constant or the result of a string operation has the
     STRING attribute.

   * Fields, `getline' input, `FILENAME', `ARGV' elements, `ENVIRON'
     elements, and the elements of an array created by `patsplit()',
     `split()' and `match()' that are numeric strings have the STRNUM
     attribute.  Otherwise, they have the STRING attribute.
     Uninitialized variables also have the STRNUM attribute.

   * Attributes propagate across assignments but are not changed by any
     use.

   The last rule is particularly important. In the following program,
`a' has numeric type, even though it is later used in a string
operation:

     BEGIN {
          a = 12.345
          b = a " is a cute number"
          print b
     }

   When two operands are compared, either string comparison or numeric
comparison may be used. This depends upon the attributes of the
operands, according to the following symmetric matrix:

             +---------------------------------------------
             |       STRING          NUMERIC         STRNUM
     -------+---------------------------------------------
             |
     STRING  |       string          string          string
             |
     NUMERIC |       string          numeric         numeric
             |
     STRNUM  |       string          numeric         numeric
     -------+---------------------------------------------

   The basic idea is that user input that looks numeric--and _only_
user input--should be treated as numeric, even though it is actually
made of characters and is therefore also a string.  Thus, for example,
the string constant `" +3.14"', when it appears in program source code,
is a string--even though it looks numeric--and is _never_ treated as
number for comparison purposes.

   In short, when one operand is a "pure" string, such as a string
constant, then a string comparison is performed.  Otherwise, a numeric
comparison is performed.

   This point bears additional emphasis: All user input is made of
characters, and so is first and foremost of STRING type; input strings
that look numeric are additionally given the STRNUM attribute.  Thus,
the six-character input string ` +3.14' receives the STRNUM attribute.
In contrast, the eight-character literal `" +3.14"' appearing in
program text is a string constant.  The following examples print `1'
when the comparison between the two different constants is true, `0'
otherwise:

     $ echo ' +3.14' | gawk '{ print $0 == " +3.14" }'    True
     -| 1
     $ echo ' +3.14' | gawk '{ print $0 == "+3.14" }'     False
     -| 0
     $ echo ' +3.14' | gawk '{ print $0 == "3.14" }'      False
     -| 0
     $ echo ' +3.14' | gawk '{ print $0 == 3.14 }'        True
     -| 1
     $ echo ' +3.14' | gawk '{ print $1 == " +3.14" }'    False
     -| 0
     $ echo ' +3.14' | gawk '{ print $1 == "+3.14" }'     True
     -| 1
     $ echo ' +3.14' | gawk '{ print $1 == "3.14" }'      False
     -| 0
     $ echo ' +3.14' | gawk '{ print $1 == 3.14 }'        True
     -| 1

   ---------- Footnotes ----------

   (1) `gawk' has followed these rules for many years, and it is
gratifying that the POSIX standard is also now correct.


File: gawk.info,  Node: Comparison Operators,  Next: POSIX String Comparison,  Prev: Variable Typing,  Up: Typing and Comparison

6.3.2.2 Comparison Operators
............................

"Comparison expressions" compare strings or numbers for relationships
such as equality.  They are written using "relational operators", which
are a superset of those in C.  *note table-relational-ops:: describes
them.

Expression         Result
-------------------------------------------------------------------------- 
X `<' Y            True if X is less than Y.
X `<=' Y           True if X is less than or equal to Y.
X `>' Y            True if X is greater than Y.
X `>=' Y           True if X is greater than or equal to Y.
X `==' Y           True if X is equal to Y.
X `!=' Y           True if X is not equal to Y.
X `~' Y            True if the string X matches the regexp denoted by Y.
X `!~' Y           True if the string X does not match the regexp
                   denoted by Y.
SUBSCRIPT `in'     True if the array ARRAY has an element with the
ARRAY              subscript SUBSCRIPT.

Table 6.3: Relational Operators

   Comparison expressions have the value one if true and zero if false.
When comparing operands of mixed types, numeric operands are converted
to strings using the value of `CONVFMT' (*note Conversion::).

   Strings are compared by comparing the first character of each, then
the second character of each, and so on.  Thus, `"10"' is less than
`"9"'.  If there are two strings where one is a prefix of the other,
the shorter string is less than the longer one.  Thus, `"abc"' is less
than `"abcd"'.

   It is very easy to accidentally mistype the `==' operator and leave
off one of the `=' characters.  The result is still valid `awk' code,
but the program does not do what is intended:

     if (a = b)   # oops! should be a == b
        ...
     else
        ...

Unless `b' happens to be zero or the null string, the `if' part of the
test always succeeds.  Because the operators are so similar, this kind
of error is very difficult to spot when scanning the source code.

   The following table of expressions illustrates the kind of comparison
`gawk' performs, as well as what the result of the comparison is:

`1.5 <= 2.0'
     numeric comparison (true)

`"abc" >= "xyz"'
     string comparison (false)

`1.5 != " +2"'
     string comparison (true)

`"1e2" < "3"'
     string comparison (true)

`a = 2; b = "2"'
`a == b'
     string comparison (true)

`a = 2; b = " +2"'

`a == b'
     string comparison (false)

   In this example:

     $ echo 1e2 3 | awk '{ print ($1 < $2) ? "true" : "false" }'
     -| false

the result is `false' because both `$1' and `$2' are user input.  They
are numeric strings--therefore both have the STRNUM attribute,
dictating a numeric comparison.  The purpose of the comparison rules
and the use of numeric strings is to attempt to produce the behavior
that is "least surprising," while still "doing the right thing."

   String comparisons and regular expression comparisons are very
different.  For example:

     x == "foo"

has the value one, or is true if the variable `x' is precisely `foo'.
By contrast:

     x ~ /foo/

has the value one if `x' contains `foo', such as `"Oh, what a fool am
I!"'.

   The righthand operand of the `~' and `!~' operators may be either a
regexp constant (`/.../') or an ordinary expression. In the latter
case, the value of the expression as a string is used as a dynamic
regexp (*note Regexp Usage::; also *note Computed Regexps::).

   In modern implementations of `awk', a constant regular expression in
slashes by itself is also an expression.  The regexp `/REGEXP/' is an
abbreviation for the following comparison expression:

     $0 ~ /REGEXP/

   One special place where `/foo/' is _not_ an abbreviation for `$0 ~
/foo/' is when it is the righthand operand of `~' or `!~'.  *Note Using
Constant Regexps::, where this is discussed in more detail.


File: gawk.info,  Node: POSIX String Comparison,  Prev: Comparison Operators,  Up: Typing and Comparison

6.3.2.3 String Comparison With POSIX Rules
..........................................

The POSIX standard says that string comparison is performed based on
the locale's collating order.  This is usually very different from the
results obtained when doing straight character-by-character
comparison.(1)

   Because this behavior differs considerably from existing practice,
`gawk' only implements it when in POSIX mode (*note Options::).  Here
is an example to illustrate the difference, in an `en_US.UTF-8' locale:

     $ gawk 'BEGIN { printf("ABC < abc = %s\n",
     >                     ("ABC" < "abc" ? "TRUE" : "FALSE")) }'
     -| ABC < abc = TRUE
     $ gawk --posix 'BEGIN { printf("ABC < abc = %s\n",
     >                             ("ABC" < "abc" ? "TRUE" : "FALSE")) }'
     -| ABC < abc = FALSE

   ---------- Footnotes ----------

   (1) Technically, string comparison is supposed to behave the same
way as if the strings are compared with the C `strcoll()' function.


File: gawk.info,  Node: Boolean Ops,  Next: Conditional Exp,  Prev: Typing and Comparison,  Up: Truth Values and Conditions

6.3.3 Boolean Expressions
-------------------------

A "Boolean expression" is a combination of comparison expressions or
matching expressions, using the Boolean operators "or" (`||'), "and"
(`&&'), and "not" (`!'), along with parentheses to control nesting.
The truth value of the Boolean expression is computed by combining the
truth values of the component expressions.  Boolean expressions are
also referred to as "logical expressions".  The terms are equivalent.

   Boolean expressions can be used wherever comparison and matching
expressions can be used.  They can be used in `if', `while', `do', and
`for' statements (*note Statements::).  They have numeric values (one
if true, zero if false) that come into play if the result of the
Boolean expression is stored in a variable or used in arithmetic.

   In addition, every Boolean expression is also a valid pattern, so
you can use one as a pattern to control the execution of rules.  The
Boolean operators are:

`BOOLEAN1 && BOOLEAN2'
     True if both BOOLEAN1 and BOOLEAN2 are true.  For example, the
     following statement prints the current input record if it contains
     both `2400' and `foo':

          if ($0 ~ /2400/ && $0 ~ /foo/) print

     The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is true.
     This can make a difference when BOOLEAN2 contains expressions that
     have side effects. In the case of `$0 ~ /foo/ && ($2 == bar++)',
     the variable `bar' is not incremented if there is no substring
     `foo' in the record.

`BOOLEAN1 || BOOLEAN2'
     True if at least one of BOOLEAN1 or BOOLEAN2 is true.  For
     example, the following statement prints all records in the input
     that contain _either_ `2400' or `foo' or both:

          if ($0 ~ /2400/ || $0 ~ /foo/) print

     The subexpression BOOLEAN2 is evaluated only if BOOLEAN1 is false.
     This can make a difference when BOOLEAN2 contains expressions that
     have side effects.

`! BOOLEAN'
     True if BOOLEAN is false.  For example, the following program
     prints `no home!' in the unusual event that the `HOME' environment
     variable is not defined:

          BEGIN { if (! ("HOME" in ENVIRON))
                         print "no home!" }

     (The `in' operator is described in *note Reference to Elements::.)

   The `&&' and `||' operators are called "short-circuit" operators
because of the way they work.  Evaluation of the full expression is
"short-circuited" if the result can be determined part way through its
evaluation.

   Statements that use `&&' or `||' can be continued simply by putting
a newline after them.  But you cannot put a newline in front of either
of these operators without using backslash continuation (*note
Statements/Lines::).

   The actual value of an expression using the `!' operator is either
one or zero, depending upon the truth value of the expression it is
applied to.  The `!' operator is often useful for changing the sense of
a flag variable from false to true and back again. For example, the
following program is one way to print lines in between special
bracketing lines:

     $1 == "START"   { interested = ! interested; next }
     interested == 1 { print }
     $1 == "END"     { interested = ! interested; next }

The variable `interested', as with all `awk' variables, starts out
initialized to zero, which is also false.  When a line is seen whose
first field is `START', the value of `interested' is toggled to true,
using `!'. The next rule prints lines as long as `interested' is true.
When a line is seen whose first field is `END', `interested' is toggled
back to false.(1)

     NOTE: The `next' statement is discussed in *note Next Statement::.
     `next' tells `awk' to skip the rest of the rules, get the next
     record, and start processing the rules over again at the top.  The
     reason it's there is to avoid printing the bracketing `START' and
     `END' lines.

   ---------- Footnotes ----------

   (1) This program has a bug; it prints lines starting with `END'. How
would you fix it?


File: gawk.info,  Node: Conditional Exp,  Prev: Boolean Ops,  Up: Truth Values and Conditions

6.3.4 Conditional Expressions
-----------------------------

A "conditional expression" is a special kind of expression that has
three operands.  It allows you to use one expression's value to select
one of two other expressions.  The conditional expression is the same
as in the C language, as shown here:

     SELECTOR ? IF-TRUE-EXP : IF-FALSE-EXP

There are three subexpressions.  The first, SELECTOR, is always
computed first.  If it is "true" (not zero or not null), then
IF-TRUE-EXP is computed next and its value becomes the value of the
whole expression.  Otherwise, IF-FALSE-EXP is computed next and its
value becomes the value of the whole expression.  For example, the
following expression produces the absolute value of `x':

     x >= 0 ? x : -x

   Each time the conditional expression is computed, only one of
IF-TRUE-EXP and IF-FALSE-EXP is used; the other is ignored.  This is
important when the expressions have side effects.  For example, this
conditional expression examines element `i' of either array `a' or
array `b', and increments `i':

     x == y ? a[i++] : b[i++]

This is guaranteed to increment `i' exactly once, because each time
only one of the two increment expressions is executed and the other is
not.  *Note Arrays::, for more information about arrays.

   As a minor `gawk' extension, a statement that uses `?:' can be
continued simply by putting a newline after either character.  However,
putting a newline in front of either character does not work without
using backslash continuation (*note Statements/Lines::).  If `--posix'
is specified (*note Options::), then this extension is disabled.


File: gawk.info,  Node: Function Calls,  Next: Precedence,  Prev: Truth Values and Conditions,  Up: Expressions

6.4 Function Calls
==================

A "function" is a name for a particular calculation.  This enables you
to ask for it by name at any point in the program.  For example, the
function `sqrt()' computes the square root of a number.

   A fixed set of functions are "built-in", which means they are
available in every `awk' program.  The `sqrt()' function is one of
these.  *Note Built-in::, for a list of built-in functions and their
descriptions.  In addition, you can define functions for use in your
program.  *Note User-defined::, for instructions on how to do this.

   The way to use a function is with a "function call" expression,
which consists of the function name followed immediately by a list of
"arguments" in parentheses.  The arguments are expressions that provide
the raw materials for the function's calculations.  When there is more
than one argument, they are separated by commas.  If there are no
arguments, just write `()' after the function name.  The following
examples show function calls with and without arguments:

     sqrt(x^2 + y^2)        one argument
     atan2(y, x)            two arguments
     rand()                 no arguments

     CAUTION: Do not put any space between the function name and the
     open-parenthesis!  A user-defined function name looks just like
     the name of a variable--a space would make the expression look
     like concatenation of a variable with an expression inside
     parentheses.  With built-in functions, space before the
     parenthesis is harmless, but it is best not to get into the habit
     of using space to avoid mistakes with user-defined functions.

   Each function expects a particular number of arguments.  For
example, the `sqrt()' function must be called with a single argument,
the number of which to take the square root:

     sqrt(ARGUMENT)

   Some of the built-in functions have one or more optional arguments.
If those arguments are not supplied, the functions use a reasonable
default value.  *Note Built-in::, for full details.  If arguments are
omitted in calls to user-defined functions, then those arguments are
treated as local variables and initialized to the empty string (*note
User-defined::).

   As an advanced feature, `gawk' provides indirect function calls,
which is a way to choose the function to call at runtime, instead of
when you write the source code to your program. We defer discussion of
this feature until later; see *note Indirect Calls::.

   Like every other expression, the function call has a value, which is
computed by the function based on the arguments you give it.  In this
example, the value of `sqrt(ARGUMENT)' is the square root of ARGUMENT.
The following program reads numbers, one number per line, and prints the
square root of each one:

     $ awk '{ print "The square root of", $1, "is", sqrt($1) }'
     1
     -| The square root of 1 is 1
     3
     -| The square root of 3 is 1.73205
     5
     -| The square root of 5 is 2.23607
     Ctrl-d

   A function can also have side effects, such as assigning values to
certain variables or doing I/O.  This program shows how the `match()'
function (*note String Functions::) changes the variables `RSTART' and
`RLENGTH':

     {
         if (match($1, $2))
             print RSTART, RLENGTH
         else
             print "no match"
     }

Here is a sample run:

     $ awk -f matchit.awk
     aaccdd  c+
     -| 3 2
     foo     bar
     -| no match
     abcdefg e
     -| 5 1


File: gawk.info,  Node: Precedence,  Next: Locales,  Prev: Function Calls,  Up: Expressions

6.5 Operator Precedence (How Operators Nest)
============================================

"Operator precedence" determines how operators are grouped when
different operators appear close by in one expression.  For example,
`*' has higher precedence than `+'; thus, `a + b * c' means to multiply
`b' and `c', and then add `a' to the product (i.e., `a + (b * c)').

   The normal precedence of the operators can be overruled by using
parentheses.  Think of the precedence rules as saying where the
parentheses are assumed to be.  In fact, it is wise to always use
parentheses whenever there is an unusual combination of operators,
because other people who read the program may not remember what the
precedence is in this case.  Even experienced programmers occasionally
forget the exact rules, which leads to mistakes.  Explicit parentheses
help prevent any such mistakes.

   When operators of equal precedence are used together, the leftmost
operator groups first, except for the assignment, conditional, and
exponentiation operators, which group in the opposite order.  Thus, `a
- b + c' groups as `(a - b) + c' and `a = b = c' groups as `a = (b =
c)'.

   Normally the precedence of prefix unary operators does not matter,
because there is only one way to interpret them: innermost first.
Thus, `$++i' means `$(++i)' and `++$x' means `++($x)'.  However, when
another operator follows the operand, then the precedence of the unary
operators can matter.  `$x^2' means `($x)^2', but `-x^2' means
`-(x^2)', because `-' has lower precedence than `^', whereas `$' has
higher precedence.  Also, operators cannot be combined in a way that
violates the precedence rules; for example, `$$0++--' is not a valid
expression because the first `$' has higher precedence than the `++';
to avoid the problem the expression can be rewritten as `$($0++)--'.

   This table presents `awk''s operators, in order of highest to lowest
precedence:

`(...)'
     Grouping.

`$'
     Field reference.

`++ --'
     Increment, decrement.

`^ **'
     Exponentiation.  These operators group right-to-left.

`+ - !'
     Unary plus, minus, logical "not."

`* / %'
     Multiplication, division, remainder.

`+ -'
     Addition, subtraction.

`String Concatenation'
     There is no special symbol for concatenation.  The operands are
     simply written side by side (*note Concatenation::).

`< <= == != > >= >> | |&'
     Relational and redirection.  The relational operators and the
     redirections have the same precedence level.  Characters such as
     `>' serve both as relationals and as redirections; the context
     distinguishes between the two meanings.

     Note that the I/O redirection operators in `print' and `printf'
     statements belong to the statement level, not to expressions.  The
     redirection does not produce an expression that could be the
     operand of another operator.  As a result, it does not make sense
     to use a redirection operator near another operator of lower
     precedence without parentheses.  Such combinations (for example,
     `print foo > a ? b : c'), result in syntax errors.  The correct
     way to write this statement is `print foo > (a ? b : c)'.

`~ !~'
     Matching, nonmatching.

`in'
     Array membership.

`&&'
     Logical "and".

`||'
     Logical "or".

`?:'
     Conditional.  This operator groups right-to-left.

`= += -= *= /= %= ^= **='
     Assignment.  These operators group right-to-left.

     NOTE: The `|&', `**', and `**=' operators are not specified by
     POSIX.  For maximum portability, do not use them.


File: gawk.info,  Node: Locales,  Prev: Precedence,  Up: Expressions

6.6 Where You Are Makes A Difference
====================================

Modern systems support the notion of "locales": a way to tell the
system about the local character set and language.

   Once upon a time, the locale setting used to affect regexp matching
(*note Ranges and Locales::), but this is no longer true.

   Locales can affect record splitting.  For the normal case of `RS =
"\n"', the locale is largely irrelevant.  For other single-character
record separators, setting `LC_ALL=C' in the environment will give you
much better performance when reading records.  Otherwise, `gawk' has to
make several function calls, _per input character_, to find the record
terminator.

   According to POSIX, string comparison is also affected by locales
(similar to regular expressions).  The details are presented in *note
POSIX String Comparison::.

   Finally, the locale affects the value of the decimal point character
used when `gawk' parses input data.  This is discussed in detail in
*note Conversion::.


File: gawk.info,  Node: Patterns and Actions,  Next: Arrays,  Prev: Expressions,  Up: Top

7 Patterns, Actions, and Variables
**********************************

As you have already seen, each `awk' statement consists of a pattern
with an associated action.  This major node describes how you build
patterns and actions, what kinds of things you can do within actions,
and `awk''s built-in variables.

   The pattern-action rules and the statements available for use within
actions form the core of `awk' programming.  In a sense, everything
covered up to here has been the foundation that programs are built on
top of.  Now it's time to start building something useful.

* Menu:

* Pattern Overview::            What goes into a pattern.
* Using Shell Variables::       How to use shell variables with `awk'.
* Action Overview::             What goes into an action.
* Statements::                  Describes the various control statements in
                                detail.
* Built-in Variables::          Summarizes the built-in variables.


File: gawk.info,  Node: Pattern Overview,  Next: Using Shell Variables,  Up: Patterns and Actions

7.1 Pattern Elements
====================

* Menu:

* Regexp Patterns::             Using regexps as patterns.
* Expression Patterns::         Any expression can be used as a pattern.
* Ranges::                      Pairs of patterns specify record ranges.
* BEGIN/END::                   Specifying initialization and cleanup rules.
* BEGINFILE/ENDFILE::           Two special patterns for advanced control.
* Empty::                       The empty pattern, which matches every record.

   Patterns in `awk' control the execution of rules--a rule is executed
when its pattern matches the current input record.  The following is a
summary of the types of `awk' patterns:

`/REGULAR EXPRESSION/'
     A regular expression. It matches when the text of the input record
     fits the regular expression.  (*Note Regexp::.)

`EXPRESSION'
     A single expression.  It matches when its value is nonzero (if a
     number) or non-null (if a string).  (*Note Expression Patterns::.)

`PAT1, PAT2'
     A pair of patterns separated by a comma, specifying a range of
     records.  The range includes both the initial record that matches
     PAT1 and the final record that matches PAT2.  (*Note Ranges::.)

`BEGIN'
`END'
     Special patterns for you to supply startup or cleanup actions for
     your `awk' program.  (*Note BEGIN/END::.)

`BEGINFILE'
`ENDFILE'
     Special patterns for you to supply startup or cleanup actions to be
     done on a per file basis.  (*Note BEGINFILE/ENDFILE::.)

`EMPTY'
     The empty pattern matches every input record.  (*Note Empty::.)


File: gawk.info,  Node: Regexp Patterns,  Next: Expression Patterns,  Up: Pattern Overview

7.1.1 Regular Expressions as Patterns
-------------------------------------

Regular expressions are one of the first kinds of patterns presented in
this book.  This kind of pattern is simply a regexp constant in the
pattern part of a rule.  Its  meaning is `$0 ~ /PATTERN/'.  The pattern
matches when the input record matches the regexp.  For example:

     /foo|bar|baz/  { buzzwords++ }
     END            { print buzzwords, "buzzwords seen" }


File: gawk.info,  Node: Expression Patterns,  Next: Ranges,  Prev: Regexp Patterns,  Up: Pattern Overview

7.1.2 Expressions as Patterns
-----------------------------

Any `awk' expression is valid as an `awk' pattern.  The pattern matches
if the expression's value is nonzero (if a number) or non-null (if a
string).  The expression is reevaluated each time the rule is tested
against a new input record.  If the expression uses fields such as
`$1', the value depends directly on the new input record's text;
otherwise, it depends on only what has happened so far in the execution
of the `awk' program.

   Comparison expressions, using the comparison operators described in
*note Typing and Comparison::, are a very common kind of pattern.
Regexp matching and nonmatching are also very common expressions.  The
left operand of the `~' and `!~' operators is a string.  The right
operand is either a constant regular expression enclosed in slashes
(`/REGEXP/'), or any expression whose string value is used as a dynamic
regular expression (*note Computed Regexps::).  The following example
prints the second field of each input record whose first field is
precisely `foo':

     $ awk '$1 == "foo" { print $2 }' BBS-list

(There is no output, because there is no BBS site with the exact name
`foo'.)  Contrast this with the following regular expression match,
which accepts any record with a first field that contains `foo':

     $ awk '$1 ~ /foo/ { print $2 }' BBS-list
     -| 555-1234
     -| 555-6699
     -| 555-6480
     -| 555-2127

   A regexp constant as a pattern is also a special case of an
expression pattern.  The expression `/foo/' has the value one if `foo'
appears in the current input record. Thus, as a pattern, `/foo/'
matches any record containing `foo'.

   Boolean expressions are also commonly used as patterns.  Whether the
pattern matches an input record depends on whether its subexpressions
match.  For example, the following command prints all the records in
`BBS-list' that contain both `2400' and `foo':

     $ awk '/2400/ && /foo/' BBS-list
     -| fooey        555-1234     2400/1200/300     B

   The following command prints all records in `BBS-list' that contain
_either_ `2400' or `foo' (or both, of course):

     $ awk '/2400/ || /foo/' BBS-list
     -| alpo-net     555-3412     2400/1200/300     A
     -| bites        555-1675     2400/1200/300     A
     -| fooey        555-1234     2400/1200/300     B
     -| foot         555-6699     1200/300          B
     -| macfoo       555-6480     1200/300          A
     -| sdace        555-3430     2400/1200/300     A
     -| sabafoo      555-2127     1200/300          C

   The following command prints all records in `BBS-list' that do _not_
contain the string `foo':

     $ awk '! /foo/' BBS-list
     -| aardvark     555-5553     1200/300          B
     -| alpo-net     555-3412     2400/1200/300     A
     -| barfly       555-7685     1200/300          A
     -| bites        555-1675     2400/1200/300     A
     -| camelot      555-0542     300               C
     -| core         555-2912     1200/300          C
     -| sdace        555-3430     2400/1200/300     A

   The subexpressions of a Boolean operator in a pattern can be
constant regular expressions, comparisons, or any other `awk'
expressions.  Range patterns are not expressions, so they cannot appear
inside Boolean patterns.  Likewise, the special patterns `BEGIN', `END',
`BEGINFILE' and `ENDFILE', which never match any input record, are not
expressions and cannot appear inside Boolean patterns.

   The precedence of the different operators which can appear in
patterns is described in *note Precedence::.


File: gawk.info,  Node: Ranges,  Next: BEGIN/END,  Prev: Expression Patterns,  Up: Pattern Overview

7.1.3 Specifying Record Ranges with Patterns
--------------------------------------------

A "range pattern" is made of two patterns separated by a comma, in the
form `BEGPAT, ENDPAT'.  It is used to match ranges of consecutive input
records.  The first pattern, BEGPAT, controls where the range begins,
while ENDPAT controls where the pattern ends.  For example, the
following:

     awk '$1 == "on", $1 == "off"' myfile

prints every record in `myfile' between `on'/`off' pairs, inclusive.

   A range pattern starts out by matching BEGPAT against every input
record.  When a record matches BEGPAT, the range pattern is "turned on"
and the range pattern matches this record as well.  As long as the
range pattern stays turned on, it automatically matches every input
record read.  The range pattern also matches ENDPAT against every input
record; when this succeeds, the range pattern is turned off again for
the following record.  Then the range pattern goes back to checking
BEGPAT against each record.

   The record that turns on the range pattern and the one that turns it
off both match the range pattern.  If you don't want to operate on
these records, you can write `if' statements in the rule's action to
distinguish them from the records you are interested in.

   It is possible for a pattern to be turned on and off by the same
record. If the record satisfies both conditions, then the action is
executed for just that record.  For example, suppose there is text
between two identical markers (e.g., the `%' symbol), each on its own
line, that should be ignored.  A first attempt would be to combine a
range pattern that describes the delimited text with the `next'
statement (not discussed yet, *note Next Statement::).  This causes
`awk' to skip any further processing of the current record and start
over again with the next input record. Such a program looks like this:

     /^%$/,/^%$/    { next }
                    { print }

This program fails because the range pattern is both turned on and
turned off by the first line, which just has a `%' on it.  To
accomplish this task, write the program in the following manner, using
a flag:

     /^%$/     { skip = ! skip; next }
     skip == 1 { next } # skip lines with `skip' set

   In a range pattern, the comma (`,') has the lowest precedence of all
the operators (i.e., it is evaluated last).  Thus, the following
program attempts to combine a range pattern with another, simpler test:

     echo Yes | awk '/1/,/2/ || /Yes/'

   The intent of this program is `(/1/,/2/) || /Yes/'.  However, `awk'
interprets this as `/1/, (/2/ || /Yes/)'.  This cannot be changed or
worked around; range patterns do not combine with other patterns:

     $ echo Yes | gawk '(/1/,/2/) || /Yes/'
     error--> gawk: cmd. line:1: (/1/,/2/) || /Yes/
     error--> gawk: cmd. line:1:           ^ syntax error


File: gawk.info,  Node: BEGIN/END,  Next: BEGINFILE/ENDFILE,  Prev: Ranges,  Up: Pattern Overview

7.1.4 The `BEGIN' and `END' Special Patterns
--------------------------------------------

All the patterns described so far are for matching input records.  The
`BEGIN' and `END' special patterns are different.  They supply startup
and cleanup actions for `awk' programs.  `BEGIN' and `END' rules must
have actions; there is no default action for these rules because there
is no current record when they run.  `BEGIN' and `END' rules are often
referred to as "`BEGIN' and `END' blocks" by long-time `awk'
programmers.

* Menu:

* Using BEGIN/END::             How and why to use BEGIN/END rules.
* I/O And BEGIN/END::           I/O issues in BEGIN/END rules.


File: gawk.info,  Node: Using BEGIN/END,  Next: I/O And BEGIN/END,  Up: BEGIN/END

7.1.4.1 Startup and Cleanup Actions
...................................

A `BEGIN' rule is executed once only, before the first input record is
read. Likewise, an `END' rule is executed once only, after all the
input is read.  For example:

     $ awk '
     > BEGIN { print "Analysis of \"foo\"" }
     > /foo/ { ++n }
     > END   { print "\"foo\" appears", n, "times." }' BBS-list
     -| Analysis of "foo"
     -| "foo" appears 4 times.

   This program finds the number of records in the input file `BBS-list'
that contain the string `foo'.  The `BEGIN' rule prints a title for the
report.  There is no need to use the `BEGIN' rule to initialize the
counter `n' to zero, since `awk' does this automatically (*note
Variables::).  The second rule increments the variable `n' every time a
record containing the pattern `foo' is read.  The `END' rule prints the
value of `n' at the end of the run.

   The special patterns `BEGIN' and `END' cannot be used in ranges or
with Boolean operators (indeed, they cannot be used with any operators).
An `awk' program may have multiple `BEGIN' and/or `END' rules.  They
are executed in the order in which they appear: all the `BEGIN' rules
at startup and all the `END' rules at termination.  `BEGIN' and `END'
rules may be intermixed with other rules.  This feature was added in
the 1987 version of `awk' and is included in the POSIX standard.  The
original (1978) version of `awk' required the `BEGIN' rule to be placed
at the beginning of the program, the `END' rule to be placed at the
end, and only allowed one of each.  This is no longer required, but it
is a good idea to follow this template in terms of program organization
and readability.

   Multiple `BEGIN' and `END' rules are useful for writing library
functions, because each library file can have its own `BEGIN' and/or
`END' rule to do its own initialization and/or cleanup.  The order in
which library functions are named on the command line controls the
order in which their `BEGIN' and `END' rules are executed.  Therefore,
you have to be careful when writing such rules in library files so that
the order in which they are executed doesn't matter.  *Note Options::,
for more information on using library functions.  *Note Library
Functions::, for a number of useful library functions.

   If an `awk' program has only `BEGIN' rules and no other rules, then
the program exits after the `BEGIN' rule is run.(1)  However, if an
`END' rule exists, then the input is read, even if there are no other
rules in the program.  This is necessary in case the `END' rule checks
the `FNR' and `NR' variables.

   ---------- Footnotes ----------

   (1) The original version of `awk' kept reading and ignoring input
until the end of the file was seen.


File: gawk.info,  Node: I/O And BEGIN/END,  Prev: Using BEGIN/END,  Up: BEGIN/END

7.1.4.2 Input/Output from `BEGIN' and `END' Rules
.................................................

There are several (sometimes subtle) points to remember when doing I/O
from a `BEGIN' or `END' rule.  The first has to do with the value of
`$0' in a `BEGIN' rule.  Because `BEGIN' rules are executed before any
input is read, there simply is no input record, and therefore no
fields, when executing `BEGIN' rules.  References to `$0' and the fields
yield a null string or zero, depending upon the context.  One way to
give `$0' a real value is to execute a `getline' command without a
variable (*note Getline::).  Another way is simply to assign a value to
`$0'.

   The second point is similar to the first but from the other
direction.  Traditionally, due largely to implementation issues, `$0'
and `NF' were _undefined_ inside an `END' rule.  The POSIX standard
specifies that `NF' is available in an `END' rule. It contains the
number of fields from the last input record.  Most probably due to an
oversight, the standard does not say that `$0' is also preserved,
although logically one would think that it should be.  In fact, `gawk'
does preserve the value of `$0' for use in `END' rules.  Be aware,
however, that Brian Kernighan's `awk', and possibly other
implementations, do not.

   The third point follows from the first two.  The meaning of `print'
inside a `BEGIN' or `END' rule is the same as always: `print $0'.  If
`$0' is the null string, then this prints an empty record.  Many long
time `awk' programmers use an unadorned `print' in `BEGIN' and `END'
rules, to mean `print ""', relying on `$0' being null.  Although one
might generally get away with this in `BEGIN' rules, it is a very bad
idea in `END' rules, at least in `gawk'.  It is also poor style, since
if an empty line is needed in the output, the program should print one
explicitly.

   Finally, the `next' and `nextfile' statements are not allowed in a
`BEGIN' rule, because the implicit
read-a-record-and-match-against-the-rules loop has not started yet.
Similarly, those statements are not valid in an `END' rule, since all
the input has been read.  (*Note Next Statement::, and see *note
Nextfile Statement::.)


File: gawk.info,  Node: BEGINFILE/ENDFILE,  Next: Empty,  Prev: BEGIN/END,  Up: Pattern Overview

7.1.5 The `BEGINFILE' and `ENDFILE' Special Patterns
----------------------------------------------------

This minor node describes a `gawk'-specific feature.

   Two special kinds of rule, `BEGINFILE' and `ENDFILE', give you
"hooks" into `gawk''s command-line file processing loop.  As with the
`BEGIN' and `END' rules (*note BEGIN/END::), all `BEGINFILE' rules in a
program are merged, in the order they are read by `gawk', and all
`ENDFILE' rules are merged as well.

   The body of the `BEGINFILE' rules is executed just before `gawk'
reads the first record from a file.  `FILENAME' is set to the name of
the current file, and `FNR' is set to zero.

   The `BEGINFILE' rule provides you the opportunity to accomplish two
tasks that would otherwise be difficult or impossible to perform:

   * You can test if the file is readable.  Normally, it is a fatal
     error if a file named on the command line cannot be opened for
     reading.  However, you can bypass the fatal error and move on to
     the next file on the command line.

     You do this by checking if the `ERRNO' variable is not the empty
     string; if so, then `gawk' was not able to open the file. In this
     case, your program can execute the `nextfile' statement (*note
     Nextfile Statement::).  This causes `gawk' to skip the file
     entirely.  Otherwise, `gawk' exits with the usual fatal error.

   * If you have written extensions that modify the record handling (by
     inserting an "input parser"), you can invoke them at this point,
     before `gawk' has started processing the file.  (This is a _very_
     advanced feature, currently used only by the `gawkextlib' project
     (http://gawkextlib.sourceforge.net).)

   The `ENDFILE' rule is called when `gawk' has finished processing the
last record in an input file.  For the last input file, it will be
called before any `END' rules.  The `ENDFILE' rule is executed even for
empty input files.

   Normally, when an error occurs when reading input in the normal input
processing loop, the error is fatal.  However, if an `ENDFILE' rule is
present, the error becomes non-fatal, and instead `ERRNO' is set.  This
makes it possible to catch and process I/O errors at the level of the
`awk' program.

   The `next' statement (*note Next Statement::) is not allowed inside
either a `BEGINFILE' or and `ENDFILE' rule.  The `nextfile' statement
(*note Nextfile Statement::) is allowed only inside a `BEGINFILE' rule,
but not inside an `ENDFILE' rule.

   The `getline' statement (*note Getline::) is restricted inside both
`BEGINFILE' and `ENDFILE'.  Only the `getline VARIABLE < FILE' form is
allowed.

   `BEGINFILE' and `ENDFILE' are `gawk' extensions.  In most other
`awk' implementations, or if `gawk' is in compatibility mode (*note
Options::), they are not special.


File: gawk.info,  Node: Empty,  Prev: BEGINFILE/ENDFILE,  Up: Pattern Overview

7.1.6 The Empty Pattern
-----------------------

An empty (i.e., nonexistent) pattern is considered to match _every_
input record.  For example, the program:

     awk '{ print $1 }' BBS-list

prints the first field of every record.


File: gawk.info,  Node: Using Shell Variables,  Next: Action Overview,  Prev: Pattern Overview,  Up: Patterns and Actions

7.2 Using Shell Variables in Programs
=====================================

`awk' programs are often used as components in larger programs written
in shell.  For example, it is very common to use a shell variable to
hold a pattern that the `awk' program searches for.  There are two ways
to get the value of the shell variable into the body of the `awk'
program.

   The most common method is to use shell quoting to substitute the
variable's value into the program inside the script.  For example, in
the following program:

     printf "Enter search pattern: "
     read pattern
     awk "/$pattern/ "'{ nmatches++ }
          END { print nmatches, "found" }' /path/to/data

the `awk' program consists of two pieces of quoted text that are
concatenated together to form the program.  The first part is
double-quoted, which allows substitution of the `pattern' shell
variable inside the quotes.  The second part is single-quoted.

   Variable substitution via quoting works, but can be potentially
messy.  It requires a good understanding of the shell's quoting rules
(*note Quoting::), and it's often difficult to correctly match up the
quotes when reading the program.

   A better method is to use `awk''s variable assignment feature (*note
Assignment Options::) to assign the shell variable's value to an `awk'
variable's value.  Then use dynamic regexps to match the pattern (*note
Computed Regexps::).  The following shows how to redo the previous
example using this technique:

     printf "Enter search pattern: "
     read pattern
     awk -v pat="$pattern" '$0 ~ pat { nmatches++ }
            END { print nmatches, "found" }' /path/to/data

Now, the `awk' program is just one single-quoted string.  The
assignment `-v pat="$pattern"' still requires double quotes, in case
there is whitespace in the value of `$pattern'.  The `awk' variable
`pat' could be named `pattern' too, but that would be more confusing.
Using a variable also provides more flexibility, since the variable can
be used anywhere inside the program--for printing, as an array
subscript, or for any other use--without requiring the quoting tricks
at every point in the program.


File: gawk.info,  Node: Action Overview,  Next: Statements,  Prev: Using Shell Variables,  Up: Patterns and Actions

7.3 Actions
===========

An `awk' program or script consists of a series of rules and function
definitions interspersed.  (Functions are described later.  *Note
User-defined::.)  A rule contains a pattern and an action, either of
which (but not both) may be omitted.  The purpose of the "action" is to
tell `awk' what to do once a match for the pattern is found.  Thus, in
outline, an `awk' program generally looks like this:

     [PATTERN]  { ACTION }
      PATTERN  [{ ACTION }]
     ...
     function NAME(ARGS) { ... }
     ...

   An action consists of one or more `awk' "statements", enclosed in
curly braces (`{...}').  Each statement specifies one thing to do.  The
statements are separated by newlines or semicolons.  The curly braces
around an action must be used even if the action contains only one
statement, or if it contains no statements at all.  However, if you
omit the action entirely, omit the curly braces as well.  An omitted
action is equivalent to `{ print $0 }':

     /foo/  { }     match `foo', do nothing -- empty action
     /foo/          match `foo', print the record -- omitted action

   The following types of statements are supported in `awk':

Expressions
     Call functions or assign values to variables (*note
     Expressions::).  Executing this kind of statement simply computes
     the value of the expression.  This is useful when the expression
     has side effects (*note Assignment Ops::).

Control statements
     Specify the control flow of `awk' programs.  The `awk' language
     gives you C-like constructs (`if', `for', `while', and `do') as
     well as a few special ones (*note Statements::).

Compound statements
     Consist of one or more statements enclosed in curly braces.  A
     compound statement is used in order to put several statements
     together in the body of an `if', `while', `do', or `for' statement.

Input statements
     Use the `getline' command (*note Getline::).  Also supplied in
     `awk' are the `next' statement (*note Next Statement::), and the
     `nextfile' statement (*note Nextfile Statement::).

Output statements
     Such as `print' and `printf'.  *Note Printing::.

Deletion statements
     For deleting array elements.  *Note Delete::.


File: gawk.info,  Node: Statements,  Next: Built-in Variables,  Prev: Action Overview,  Up: Patterns and Actions

7.4 Control Statements in Actions
=================================

"Control statements", such as `if', `while', and so on, control the
flow of execution in `awk' programs.  Most of `awk''s control
statements are patterned after similar statements in C.

   All the control statements start with special keywords, such as `if'
and `while', to distinguish them from simple expressions.  Many control
statements contain other statements.  For example, the `if' statement
contains another statement that may or may not be executed.  The
contained statement is called the "body".  To include more than one
statement in the body, group them into a single "compound statement"
with curly braces, separating them with newlines or semicolons.

* Menu:

* If Statement::                Conditionally execute some `awk'
                                statements.
* While Statement::             Loop until some condition is satisfied.
* Do Statement::                Do specified action while looping until some
                                condition is satisfied.
* For Statement::               Another looping statement, that provides
                                initialization and increment clauses.
* Switch Statement::            Switch/case evaluation for conditional
                                execution of statements based on a value.
* Break Statement::             Immediately exit the innermost enclosing loop.
* Continue Statement::          Skip to the end of the innermost enclosing
                                loop.
* Next Statement::              Stop processing the current input record.
* Nextfile Statement::          Stop processing the current file.
* Exit Statement::              Stop execution of `awk'.


File: gawk.info,  Node: If Statement,  Next: While Statement,  Up: Statements

7.4.1 The `if'-`else' Statement
-------------------------------

The `if'-`else' statement is `awk''s decision-making statement.  It
looks like this:

     if (CONDITION) THEN-BODY [else ELSE-BODY]

The CONDITION is an expression that controls what the rest of the
statement does.  If the CONDITION is true, THEN-BODY is executed;
otherwise, ELSE-BODY is executed.  The `else' part of the statement is
optional.  The condition is considered false if its value is zero or
the null string; otherwise, the condition is true.  Refer to the
following:

     if (x % 2 == 0)
         print "x is even"
     else
         print "x is odd"

   In this example, if the expression `x % 2 == 0' is true (that is, if
the value of `x' is evenly divisible by two), then the first `print'
statement is executed; otherwise, the second `print' statement is
executed.  If the `else' keyword appears on the same line as THEN-BODY
and THEN-BODY is not a compound statement (i.e., not surrounded by
curly braces), then a semicolon must separate THEN-BODY from the `else'.
To illustrate this, the previous example can be rewritten as:

     if (x % 2 == 0) print "x is even"; else
             print "x is odd"

If the `;' is left out, `awk' can't interpret the statement and it
produces a syntax error.  Don't actually write programs this way,
because a human reader might fail to see the `else' if it is not the
first thing on its line.


File: gawk.info,  Node: While Statement,  Next: Do Statement,  Prev: If Statement,  Up: Statements

7.4.2 The `while' Statement
---------------------------

In programming, a "loop" is a part of a program that can be executed
two or more times in succession.  The `while' statement is the simplest
looping statement in `awk'.  It repeatedly executes a statement as long
as a condition is true.  For example:

     while (CONDITION)
       BODY

BODY is a statement called the "body" of the loop, and CONDITION is an
expression that controls how long the loop keeps running.  The first
thing the `while' statement does is test the CONDITION.  If the
CONDITION is true, it executes the statement BODY.  (The CONDITION is
true when the value is not zero and not a null string.)  After BODY has
been executed, CONDITION is tested again, and if it is still true, BODY
is executed again.  This process repeats until the CONDITION is no
longer true.  If the CONDITION is initially false, the body of the loop
is never executed and `awk' continues with the statement following the
loop.  This example prints the first three fields of each record, one
per line:

     awk '{
            i = 1
            while (i <= 3) {
                print $i
                i++
            }
     }' inventory-shipped

The body of this loop is a compound statement enclosed in braces,
containing two statements.  The loop works in the following manner:
first, the value of `i' is set to one.  Then, the `while' statement
tests whether `i' is less than or equal to three.  This is true when
`i' equals one, so the `i'-th field is printed.  Then the `i++'
increments the value of `i' and the loop repeats.  The loop terminates
when `i' reaches four.

   A newline is not required between the condition and the body;
however using one makes the program clearer unless the body is a
compound statement or else is very simple.  The newline after the
open-brace that begins the compound statement is not required either,
but the program is harder to read without it.


File: gawk.info,  Node: Do Statement,  Next: For Statement,  Prev: While Statement,  Up: Statements

7.4.3 The `do'-`while' Statement
--------------------------------

The `do' loop is a variation of the `while' looping statement.  The
`do' loop executes the BODY once and then repeats the BODY as long as
the CONDITION is true.  It looks like this:

     do
       BODY
     while (CONDITION)

   Even if the CONDITION is false at the start, the BODY is executed at
least once (and only once, unless executing BODY makes CONDITION true).
Contrast this with the corresponding `while' statement:

     while (CONDITION)
       BODY

This statement does not execute BODY even once if the CONDITION is
false to begin with.  The following is an example of a `do' statement:

     {
            i = 1
            do {
               print $0
               i++
            } while (i <= 10)
     }

This program prints each input record 10 times.  However, it isn't a
very realistic example, since in this case an ordinary `while' would do
just as well.  This situation reflects actual experience; only
occasionally is there a real use for a `do' statement.


File: gawk.info,  Node: For Statement,  Next: Switch Statement,  Prev: Do Statement,  Up: Statements

7.4.4 The `for' Statement
-------------------------

The `for' statement makes it more convenient to count iterations of a
loop.  The general form of the `for' statement looks like this:

     for (INITIALIZATION; CONDITION; INCREMENT)
       BODY

The INITIALIZATION, CONDITION, and INCREMENT parts are arbitrary `awk'
expressions, and BODY stands for any `awk' statement.

   The `for' statement starts by executing INITIALIZATION.  Then, as
long as the CONDITION is true, it repeatedly executes BODY and then
INCREMENT.  Typically, INITIALIZATION sets a variable to either zero or
one, INCREMENT adds one to it, and CONDITION compares it against the
desired number of iterations.  For example:

     awk '{
            for (i = 1; i <= 3; i++)
               print $i
     }' inventory-shipped

This prints the first three fields of each input record, with one field
per line.

   It isn't possible to set more than one variable in the
INITIALIZATION part without using a multiple assignment statement such
as `x = y = 0'. This makes sense only if all the initial values are
equal.  (But it is possible to initialize additional variables by
writing their assignments as separate statements preceding the `for'
loop.)

   The same is true of the INCREMENT part. Incrementing additional
variables requires separate statements at the end of the loop.  The C
compound expression, using C's comma operator, is useful in this
context but it is not supported in `awk'.

   Most often, INCREMENT is an increment expression, as in the previous
example.  But this is not required; it can be any expression
whatsoever.  For example, the following statement prints all the powers
of two between 1 and 100:

     for (i = 1; i <= 100; i *= 2)
       print i

   If there is nothing to be done, any of the three expressions in the
parentheses following the `for' keyword may be omitted.  Thus,
`for (; x > 0;)' is equivalent to `while (x > 0)'.  If the CONDITION is
omitted, it is treated as true, effectively yielding an "infinite loop"
(i.e., a loop that never terminates).

   In most cases, a `for' loop is an abbreviation for a `while' loop,
as shown here:

     INITIALIZATION
     while (CONDITION) {
       BODY
       INCREMENT
     }

The only exception is when the `continue' statement (*note Continue
Statement::) is used inside the loop. Changing a `for' statement to a
`while' statement in this way can change the effect of the `continue'
statement inside the loop.

   The `awk' language has a `for' statement in addition to a `while'
statement because a `for' loop is often both less work to type and more
natural to think of.  Counting the number of iterations is very common
in loops.  It can be easier to think of this counting as part of
looping rather than as something to do inside the loop.

   There is an alternate version of the `for' loop, for iterating over
all the indices of an array:

     for (i in array)
         DO SOMETHING WITH array[i]

*Note Scanning an Array::, for more information on this version of the
`for' loop.


File: gawk.info,  Node: Switch Statement,  Next: Break Statement,  Prev: For Statement,  Up: Statements

7.4.5 The `switch' Statement
----------------------------

The `switch' statement allows the evaluation of an expression and the
execution of statements based on a `case' match. Case statements are
checked for a match in the order they are defined.  If no suitable
`case' is found, the `default' section is executed, if supplied.

   Each `case' contains a single constant, be it numeric, string, or
regexp.  The `switch' expression is evaluated, and then each `case''s
constant is compared against the result in turn. The type of constant
determines the comparison: numeric or string do the usual comparisons.
A regexp constant does a regular expression match against the string
value of the original expression.  The general form of the `switch'
statement looks like this:

     switch (EXPRESSION) {
     case VALUE OR REGULAR EXPRESSION:
         CASE-BODY
     default:
         DEFAULT-BODY
     }

   Control flow in the `switch' statement works as it does in C. Once a
match to a given case is made, the case statement bodies execute until
a `break', `continue', `next', `nextfile'  or `exit' is encountered, or
the end of the `switch' statement itself. For example:

     switch (NR * 2 + 1) {
     case 3:
     case "11":
         print NR - 1
         break

     case /2[[:digit:]]+/:
         print NR

     default:
         print NR + 1

     case -1:
         print NR * -1
     }

   Note that if none of the statements specified above halt execution
of a matched `case' statement, execution falls through to the next
`case' until execution halts. In the above example, for any case value
starting with `2' followed by one or more digits, the `print' statement
is executed and then falls through into the `default' section,
executing its `print' statement. In turn, the -1 case will also be
executed since the `default' does not halt execution.

   This `switch' statement is a `gawk' extension.  If `gawk' is in
compatibility mode (*note Options::), it is not available.


File: gawk.info,  Node: Break Statement,  Next: Continue Statement,  Prev: Switch Statement,  Up: Statements

7.4.6 The `break' Statement
---------------------------

The `break' statement jumps out of the innermost `for', `while', or
`do' loop that encloses it.  The following example finds the smallest
divisor of any integer, and also identifies prime numbers:

     # find smallest divisor of num
     {
        num = $1
        for (div = 2; div * div <= num; div++) {
          if (num % div == 0)
            break
        }
        if (num % div == 0)
          printf "Smallest divisor of %d is %d\n", num, div
        else
          printf "%d is prime\n", num
     }

   When the remainder is zero in the first `if' statement, `awk'
immediately "breaks out" of the containing `for' loop.  This means that
`awk' proceeds immediately to the statement following the loop and
continues processing.  (This is very different from the `exit'
statement, which stops the entire `awk' program.  *Note Exit
Statement::.)

   The following program illustrates how the CONDITION of a `for' or
`while' statement could be replaced with a `break' inside an `if':

     # find smallest divisor of num
     {
       num = $1
       for (div = 2; ; div++) {
         if (num % div == 0) {
           printf "Smallest divisor of %d is %d\n", num, div
           break
         }
         if (div * div > num) {
           printf "%d is prime\n", num
           break
         }
       }
     }

   The `break' statement is also used to break out of the `switch'
statement.  This is discussed in *note Switch Statement::.

   The `break' statement has no meaning when used outside the body of a
loop or `switch'.  However, although it was never documented,
historical implementations of `awk' treated the `break' statement
outside of a loop as if it were a `next' statement (*note Next
Statement::).  (d.c.)  Recent versions of Brian Kernighan's `awk' no
longer allow this usage, nor does `gawk'.


File: gawk.info,  Node: Continue Statement,  Next: Next Statement,  Prev: Break Statement,  Up: Statements

7.4.7 The `continue' Statement
------------------------------

Similar to `break', the `continue' statement is used only inside `for',
`while', and `do' loops.  It skips over the rest of the loop body,
causing the next cycle around the loop to begin immediately.  Contrast
this with `break', which jumps out of the loop altogether.

   The `continue' statement in a `for' loop directs `awk' to skip the
rest of the body of the loop and resume execution with the
increment-expression of the `for' statement.  The following program
illustrates this fact:

     BEGIN {
          for (x = 0; x <= 20; x++) {
              if (x == 5)
                  continue
              printf "%d ", x
          }
          print ""
     }

This program prints all the numbers from 0 to 20--except for 5, for
which the `printf' is skipped.  Because the increment `x++' is not
skipped, `x' does not remain stuck at 5.  Contrast the `for' loop from
the previous example with the following `while' loop:

     BEGIN {
          x = 0
          while (x <= 20) {
              if (x == 5)
                  continue
              printf "%d ", x
              x++
          }
          print ""
     }

This program loops forever once `x' reaches 5.

   The `continue' statement has no special meaning with respect to the
`switch' statement, nor does it have any meaning when used outside the
body of a loop.  Historical versions of `awk' treated a `continue'
statement outside a loop the same way they treated a `break' statement
outside a loop: as if it were a `next' statement (*note Next
Statement::).  (d.c.)  Recent versions of Brian Kernighan's `awk' no
longer work this way, nor does `gawk'.


File: gawk.info,  Node: Next Statement,  Next: Nextfile Statement,  Prev: Continue Statement,  Up: Statements

7.4.8 The `next' Statement
--------------------------

The `next' statement forces `awk' to immediately stop processing the
current record and go on to the next record.  This means that no
further rules are executed for the current record, and the rest of the
current rule's action isn't executed.

   Contrast this with the effect of the `getline' function (*note
Getline::).  That also causes `awk' to read the next record
immediately, but it does not alter the flow of control in any way
(i.e., the rest of the current action executes with a new input record).

   At the highest level, `awk' program execution is a loop that reads
an input record and then tests each rule's pattern against it.  If you
think of this loop as a `for' statement whose body contains the rules,
then the `next' statement is analogous to a `continue' statement. It
skips to the end of the body of this implicit loop and executes the
increment (which reads another record).

   For example, suppose an `awk' program works only on records with
four fields, and it shouldn't fail when given bad input.  To avoid
complicating the rest of the program, write a "weed out" rule near the
beginning, in the following manner:

     NF != 4 {
       err = sprintf("%s:%d: skipped: NF != 4\n", FILENAME, FNR)
       print err > "/dev/stderr"
       next
     }

Because of the `next' statement, the program's subsequent rules won't
see the bad record.  The error message is redirected to the standard
error output stream, as error messages should be.  For more detail see
*note Special Files::.

   If the `next' statement causes the end of the input to be reached,
then the code in any `END' rules is executed.  *Note BEGIN/END::.

   The `next' statement is not allowed inside `BEGINFILE' and `ENDFILE'
rules. *Note BEGINFILE/ENDFILE::.

   According to the POSIX standard, the behavior is undefined if the
`next' statement is used in a `BEGIN' or `END' rule.  `gawk' treats it
as a syntax error.  Although POSIX permits it, some other `awk'
implementations don't allow the `next' statement inside function bodies
(*note User-defined::).  Just as with any other `next' statement, a
`next' statement inside a function body reads the next record and
starts processing it with the first rule in the program.


File: gawk.info,  Node: Nextfile Statement,  Next: Exit Statement,  Prev: Next Statement,  Up: Statements

7.4.9 The `nextfile' Statement
------------------------------

The `nextfile' statement is similar to the `next' statement.  However,
instead of abandoning processing of the current record, the `nextfile'
statement instructs `awk' to stop processing the current data file.

   Upon execution of the `nextfile' statement, `FILENAME' is updated to
the name of the next data file listed on the command line, `FNR' is
reset to one, and processing starts over with the first rule in the
program.  If the `nextfile' statement causes the end of the input to be
reached, then the code in any `END' rules is executed. An exception to
this is when `nextfile' is invoked during execution of any statement in
an `END' rule; In this case, it causes the program to stop immediately.
*Note BEGIN/END::.

   The `nextfile' statement is useful when there are many data files to
process but it isn't necessary to process every record in every file.
Without `nextfile', in order to move on to the next data file, a program
would have to continue scanning the unwanted records.  The `nextfile'
statement accomplishes this much more efficiently.

   In `gawk', execution of `nextfile' causes additional things to
happen: any `ENDFILE' rules are executed except in the case as
mentioned below, `ARGIND' is incremented, and any `BEGINFILE' rules are
executed.  (`ARGIND' hasn't been introduced yet. *Note Built-in
Variables::.)

   With `gawk', `nextfile' is useful inside a `BEGINFILE' rule to skip
over a file that would otherwise cause `gawk' to exit with a fatal
error. In this case, `ENDFILE' rules are not executed. *Note
BEGINFILE/ENDFILE::.

   While one might think that `close(FILENAME)' would accomplish the
same as `nextfile', this isn't true.  `close()' is reserved for closing
files, pipes, and coprocesses that are opened with redirections.  It is
not related to the main processing that `awk' does with the files
listed in `ARGV'.

     NOTE: For many years, `nextfile' was a `gawk' extension. As of
     September, 2012, it was accepted for inclusion into the POSIX
     standard.  See the Austin Group website
     (http://austingroupbugs.net/view.php?id=607).

   The current version of the Brian Kernighan's `awk' (*note Other
Versions::) also supports `nextfile'.  However, it doesn't allow the
`nextfile' statement inside function bodies (*note User-defined::).
`gawk' does; a `nextfile' inside a function body reads the next record
and starts processing it with the first rule in the program, just as
any other `nextfile' statement.


File: gawk.info,  Node: Exit Statement,  Prev: Nextfile Statement,  Up: Statements

7.4.10 The `exit' Statement
---------------------------

The `exit' statement causes `awk' to immediately stop executing the
current rule and to stop processing input; any remaining input is
ignored.  The `exit' statement is written as follows:

     exit [RETURN CODE]

   When an `exit' statement is executed from a `BEGIN' rule, the
program stops processing everything immediately.  No input records are
read.  However, if an `END' rule is present, as part of executing the
`exit' statement, the `END' rule is executed (*note BEGIN/END::).  If
`exit' is used in the body of an `END' rule, it causes the program to
stop immediately.

   An `exit' statement that is not part of a `BEGIN' or `END' rule
stops the execution of any further automatic rules for the current
record, skips reading any remaining input records, and executes the
`END' rule if there is one.  Any `ENDFILE' rules are also skipped; they
are not executed.

   In such a case, if you don't want the `END' rule to do its job, set
a variable to nonzero before the `exit' statement and check that
variable in the `END' rule.  *Note Assert Function::, for an example
that does this.

   If an argument is supplied to `exit', its value is used as the exit
status code for the `awk' process.  If no argument is supplied, `exit'
causes `awk' to return a "success" status.  In the case where an
argument is supplied to a first `exit' statement, and then `exit' is
called a second time from an `END' rule with no argument, `awk' uses
the previously supplied exit value.  (d.c.)  *Note Exit Status::, for
more information.

   For example, suppose an error condition occurs that is difficult or
impossible to handle.  Conventionally, programs report this by exiting
with a nonzero status.  An `awk' program can do this using an `exit'
statement with a nonzero argument, as shown in the following example:

     BEGIN {
            if (("date" | getline date_now) <= 0) {
              print "Can't get system date" > "/dev/stderr"
              exit 1
            }
            print "current date is", date_now
            close("date")
     }

     NOTE: For full portability, exit values should be between zero and
     126, inclusive.  Negative values, and values of 127 or greater,
     may not produce consistent results across different operating
     systems.


File: gawk.info,  Node: Built-in Variables,  Prev: Statements,  Up: Patterns and Actions

7.5 Built-in Variables
======================

Most `awk' variables are available to use for your own purposes; they
never change unless your program assigns values to them, and they never
affect anything unless your program examines them.  However, a few
variables in `awk' have special built-in meanings.  `awk' examines some
of these automatically, so that they enable you to tell `awk' how to do
certain things.  Others are set automatically by `awk', so that they
carry information from the internal workings of `awk' to your program.

   This minor node documents all the built-in variables of `gawk', most
of which are also documented in the chapters describing their areas of
activity.

* Menu:

* User-modified::               Built-in variables that you change to control
                                `awk'.
* Auto-set::                    Built-in variables where `awk' gives
                                you information.
* ARGC and ARGV::               Ways to use `ARGC' and `ARGV'.


File: gawk.info,  Node: User-modified,  Next: Auto-set,  Up: Built-in Variables

7.5.1 Built-in Variables That Control `awk'
-------------------------------------------

The following is an alphabetical list of variables that you can change
to control how `awk' does certain things. The variables that are
specific to `gawk' are marked with a pound sign (`#').

`BINMODE #'
     On non-POSIX systems, this variable specifies use of binary mode
     for all I/O.  Numeric values of one, two, or three specify that
     input files, output files, or all files, respectively, should use
     binary I/O.  A numeric value less than zero is treated as zero,
     and a numeric value greater than three is treated as three.
     Alternatively, string values of `"r"' or `"w"' specify that input
     files and output files, respectively, should use binary I/O.  A
     string value of `"rw"' or `"wr"' indicates that all files should
     use binary I/O.  Any other string value is treated the same as
     `"rw"', but causes `gawk' to generate a warning message.
     `BINMODE' is described in more detail in *note PC Using::.

     This variable is a `gawk' extension.  In other `awk'
     implementations (except `mawk', *note Other Versions::), or if
     `gawk' is in compatibility mode (*note Options::), it is not
     special.

`CONVFMT'
     This string controls conversion of numbers to strings (*note
     Conversion::).  It works by being passed, in effect, as the first
     argument to the `sprintf()' function (*note String Functions::).
     Its default value is `"%.6g"'.  `CONVFMT' was introduced by the
     POSIX standard.

`FIELDWIDTHS #'
     This is a space-separated list of columns that tells `gawk' how to
     split input with fixed columnar boundaries.  Assigning a value to
     `FIELDWIDTHS' overrides the use of `FS' and `FPAT' for field
     splitting.  *Note Constant Size::, for more information.

     If `gawk' is in compatibility mode (*note Options::), then
     `FIELDWIDTHS' has no special meaning, and field-splitting
     operations occur based exclusively on the value of `FS'.

`FPAT #'
     This is a regular expression (as a string) that tells `gawk' to
     create the fields based on text that matches the regular
     expression.  Assigning a value to `FPAT' overrides the use of `FS'
     and `FIELDWIDTHS' for field splitting.  *Note Splitting By
     Content::, for more information.

     If `gawk' is in compatibility mode (*note Options::), then `FPAT'
     has no special meaning, and field-splitting operations occur based
     exclusively on the value of `FS'.

`FS'
     This is the input field separator (*note Field Separators::).  The
     value is a single-character string or a multicharacter regular
     expression that matches the separations between fields in an input
     record.  If the value is the null string (`""'), then each
     character in the record becomes a separate field.  (This behavior
     is a `gawk' extension. POSIX `awk' does not specify the behavior
     when `FS' is the null string.  Nonetheless, some other versions of
     `awk' also treat `""' specially.)

     The default value is `" "', a string consisting of a single space.
     As a special exception, this value means that any sequence of
     spaces, TABs, and/or newlines is a single separator.(1)  It also
     causes spaces, TABs, and newlines at the beginning and end of a
     record to be ignored.

     You can set the value of `FS' on the command line using the `-F'
     option:

          awk -F, 'PROGRAM' INPUT-FILES

     If `gawk' is using `FIELDWIDTHS' or `FPAT' for field splitting,
     assigning a value to `FS' causes `gawk' to return to the normal,
     `FS'-based field splitting. An easy way to do this is to simply
     say `FS = FS', perhaps with an explanatory comment.

`IGNORECASE #'
     If `IGNORECASE' is nonzero or non-null, then all string comparisons
     and all regular expression matching are case independent.  Thus,
     regexp matching with `~' and `!~', as well as the `gensub()',
     `gsub()', `index()', `match()', `patsplit()', `split()', and
     `sub()' functions, record termination with `RS', and field
     splitting with `FS' and `FPAT', all ignore case when doing their
     particular regexp operations.  However, the value of `IGNORECASE'
     does _not_ affect array subscripting and it does not affect field
     splitting when using a single-character field separator.  *Note
     Case-sensitivity::.

     If `gawk' is in compatibility mode (*note Options::), then
     `IGNORECASE' has no special meaning.  Thus, string and regexp
     operations are always case-sensitive.

`LINT #'
     When this variable is true (nonzero or non-null), `gawk' behaves
     as if the `--lint' command-line option is in effect.  (*note
     Options::).  With a value of `"fatal"', lint warnings become fatal
     errors.  With a value of `"invalid"', only warnings about things
     that are actually invalid are issued. (This is not fully
     implemented yet.)  Any other true value prints nonfatal warnings.
     Assigning a false value to `LINT' turns off the lint warnings.

     This variable is a `gawk' extension.  It is not special in other
     `awk' implementations.  Unlike the other special variables,
     changing `LINT' does affect the production of lint warnings, even
     if `gawk' is in compatibility mode.  Much as the `--lint' and
     `--traditional' options independently control different aspects of
     `gawk''s behavior, the control of lint warnings during program
     execution is independent of the flavor of `awk' being executed.

`OFMT'
     This string controls conversion of numbers to strings (*note
     Conversion::) for printing with the `print' statement.  It works
     by being passed as the first argument to the `sprintf()' function
     (*note String Functions::).  Its default value is `"%.6g"'.
     Earlier versions of `awk' also used `OFMT' to specify the format
     for converting numbers to strings in general expressions; this is
     now done by `CONVFMT'.

`OFS'
     This is the output field separator (*note Output Separators::).
     It is output between the fields printed by a `print' statement.
     Its default value is `" "', a string consisting of a single space.

`ORS'
     This is the output record separator.  It is output at the end of
     every `print' statement.  Its default value is `"\n"', the newline
     character.  (*Note Output Separators::.)

`PREC #'
     The working precision of arbitrary precision floating-point
     numbers, 53 bits by default (*note Setting Precision::).

`ROUNDMODE #'
     The rounding mode to use for arbitrary precision arithmetic on
     numbers, by default `"N"' (`roundTiesToEven' in the IEEE-754
     standard) (*note Setting Rounding Mode::).

`RS'
     This is `awk''s input record separator.  Its default value is a
     string containing a single newline character, which means that an
     input record consists of a single line of text.  It can also be
     the null string, in which case records are separated by runs of
     blank lines.  If it is a regexp, records are separated by matches
     of the regexp in the input text.  (*Note Records::.)

     The ability for `RS' to be a regular expression is a `gawk'
     extension.  In most other `awk' implementations, or if `gawk' is
     in compatibility mode (*note Options::), just the first character
     of `RS''s value is used.

`SUBSEP'
     This is the subscript separator.  It has the default value of
     `"\034"' and is used to separate the parts of the indices of a
     multidimensional array.  Thus, the expression `foo["A", "B"]'
     really accesses `foo["A\034B"]' (*note Multidimensional::).

`TEXTDOMAIN #'
     This variable is used for internationalization of programs at the
     `awk' level.  It sets the default text domain for specially marked
     string constants in the source text, as well as for the
     `dcgettext()', `dcngettext()' and `bindtextdomain()' functions
     (*note Internationalization::).  The default value of `TEXTDOMAIN'
     is `"messages"'.

     This variable is a `gawk' extension.  In other `awk'
     implementations, or if `gawk' is in compatibility mode (*note
     Options::), it is not special.

   ---------- Footnotes ----------

   (1) In POSIX `awk', newline does not count as whitespace.


File: gawk.info,  Node: Auto-set,  Next: ARGC and ARGV,  Prev: User-modified,  Up: Built-in Variables

7.5.2 Built-in Variables That Convey Information
------------------------------------------------

The following is an alphabetical list of variables that `awk' sets
automatically on certain occasions in order to provide information to
your program.  The variables that are specific to `gawk' are marked
with a pound sign (`#').

`ARGC, ARGV'
     The command-line arguments available to `awk' programs are stored
     in an array called `ARGV'.  `ARGC' is the number of command-line
     arguments present.  *Note Other Arguments::.  Unlike most `awk'
     arrays, `ARGV' is indexed from 0 to `ARGC' - 1.  In the following
     example:

          $ awk 'BEGIN {
          >         for (i = 0; i < ARGC; i++)
          >             print ARGV[i]
          >      }' inventory-shipped BBS-list
          -| awk
          -| inventory-shipped
          -| BBS-list

     `ARGV[0]' contains `awk', `ARGV[1]' contains `inventory-shipped',
     and `ARGV[2]' contains `BBS-list'.  The value of `ARGC' is three,
     one more than the index of the last element in `ARGV', because the
     elements are numbered from zero.

     The names `ARGC' and `ARGV', as well as the convention of indexing
     the array from 0 to `ARGC' - 1, are derived from the C language's
     method of accessing command-line arguments.

     The value of `ARGV[0]' can vary from system to system.  Also, you
     should note that the program text is _not_ included in `ARGV', nor
     are any of `awk''s command-line options.  *Note ARGC and ARGV::,
     for information about how `awk' uses these variables.  (d.c.)

`ARGIND #'
     The index in `ARGV' of the current file being processed.  Every
     time `gawk' opens a new data file for processing, it sets `ARGIND'
     to the index in `ARGV' of the file name.  When `gawk' is
     processing the input files, `FILENAME == ARGV[ARGIND]' is always
     true.

     This variable is useful in file processing; it allows you to tell
     how far along you are in the list of data files as well as to
     distinguish between successive instances of the same file name on
     the command line.

     While you can change the value of `ARGIND' within your `awk'
     program, `gawk' automatically sets it to a new value when the next
     file is opened.

     This variable is a `gawk' extension.  In other `awk'
     implementations, or if `gawk' is in compatibility mode (*note
     Options::), it is not special.

`ENVIRON'
     An associative array containing the values of the environment.
     The array indices are the environment variable names; the elements
     are the values of the particular environment variables.  For
     example, `ENVIRON["HOME"]' might be `/home/arnold'.  Changing this
     array does not affect the environment passed on to any programs
     that `awk' may spawn via redirection or the `system()' function.

     Some operating systems may not have environment variables.  On
     such systems, the `ENVIRON' array is empty (except for
     `ENVIRON["AWKPATH"]', *note AWKPATH Variable:: and
     `ENVIRON["AWKLIBPATH"]', *note AWKLIBPATH Variable::).

`ERRNO #'
     If a system error occurs during a redirection for `getline',
     during a read for `getline', or during a `close()' operation, then
     `ERRNO' contains a string describing the error.

     In addition, `gawk' clears `ERRNO' before opening each
     command-line input file. This enables checking if the file is
     readable inside a `BEGINFILE' pattern (*note BEGINFILE/ENDFILE::).

     Otherwise, `ERRNO' works similarly to the C variable `errno'.
     Except for the case just mentioned, `gawk' _never_ clears it (sets
     it to zero or `""').  Thus, you should only expect its value to be
     meaningful when an I/O operation returns a failure value, such as
     `getline' returning -1.  You are, of course, free to clear it
     yourself before doing an I/O operation.

     This variable is a `gawk' extension.  In other `awk'
     implementations, or if `gawk' is in compatibility mode (*note
     Options::), it is not special.

`FILENAME'
     The name of the file that `awk' is currently reading.  When no
     data files are listed on the command line, `awk' reads from the
     standard input and `FILENAME' is set to `"-"'.  `FILENAME' is
     changed each time a new file is read (*note Reading Files::).
     Inside a `BEGIN' rule, the value of `FILENAME' is `""', since
     there are no input files being processed yet.(1) (d.c.)  Note,
     though, that using `getline' (*note Getline::) inside a `BEGIN'
     rule can give `FILENAME' a value.

`FNR'
     The current record number in the current file.  `FNR' is
     incremented each time a new record is read (*note Records::).  It
     is reinitialized to zero each time a new input file is started.

`NF'
     The number of fields in the current input record.  `NF' is set
     each time a new record is read, when a new field is created or
     when `$0' changes (*note Fields::).

     Unlike most of the variables described in this node, assigning a
     value to `NF' has the potential to affect `awk''s internal
     workings.  In particular, assignments to `NF' can be used to
     create or remove fields from the current record. *Note Changing
     Fields::.

`FUNCTAB #'
     An array whose indices and corresponding values are the names of
     all the user-defined or extension functions in the program.

          NOTE: Attempting to use the `delete' statement with the
          `FUNCTAB' array will cause a fatal error.  Any attempt to
          assign to an element of the `FUNCTAB' array will also cause a
          fatal error.

`NR'
     The number of input records `awk' has processed since the
     beginning of the program's execution (*note Records::).  `NR' is
     incremented each time a new record is read.

`PROCINFO #'
     The elements of this array provide access to information about the
     running `awk' program.  The following elements (listed
     alphabetically) are guaranteed to be available:

    `PROCINFO["egid"]'
          The value of the `getegid()' system call.

    `PROCINFO["euid"]'
          The value of the `geteuid()' system call.

    `PROCINFO["FS"]'
          This is `"FS"' if field splitting with `FS' is in effect,
          `"FIELDWIDTHS"' if field splitting with `FIELDWIDTHS' is in
          effect, or `"FPAT"' if field matching with `FPAT' is in
          effect.

    `PROCINFO["identifiers"]'
          A subarray, indexed by the names of all identifiers used in
          the text of the AWK program.  For each identifier, the value
          of the element is one of the following:

         `"array"'
               The identifier is an array.

         `"extension"'
               The identifier is an extension function loaded via
               `@load'.

         `"scalar"'
               The identifier is a scalar.

         `"untyped"'
               The identifier is untyped (could be used as a scalar or
               array, `gawk' doesn't know yet).

         `"user"'
               The identifier is a user-defined function.

          The values indicate what `gawk' knows about the identifiers
          after it has finished parsing the program; they are _not_
          updated while the program runs.

    `PROCINFO["gid"]'
          The value of the `getgid()' system call.

    `PROCINFO["pgrpid"]'
          The process group ID of the current process.

    `PROCINFO["pid"]'
          The process ID of the current process.

    `PROCINFO["ppid"]'
          The parent process ID of the current process.

    `PROCINFO["sorted_in"]'
          If this element exists in `PROCINFO', its value controls the
          order in which array indices will be processed by `for (index
          in array) ...' loops.  Since this is an advanced feature, we
          defer the full description until later; see *note Scanning an
          Array::.

    `PROCINFO["strftime"]'
          The default time format string for `strftime()'.  Assigning a
          new value to this element changes the default.  *Note Time
          Functions::.

    `PROCINFO["uid"]'
          The value of the `getuid()' system call.

    `PROCINFO["version"]'
          The version of `gawk'.

     The following additional elements in the array are available to
     provide information about the MPFR and GMP libraries if your
     version of `gawk' supports arbitrary precision numbers (*note
     Arbitrary Precision Arithmetic::):

    `PROCINFO["mpfr_version"]'
          The version of the GNU MPFR library.

    `PROCINFO["gmp_version"]'
          The version of the GNU MP library.

    `PROCINFO["prec_max"]'
          The maximum precision supported by MPFR.

    `PROCINFO["prec_min"]'
          The minimum precision required by MPFR.

     The following additional elements in the array are available to
     provide information about the version of the extension API, if
     your version of `gawk' supports dynamic loading of extension
     functions (*note Dynamic Extensions::):

    `PROCINFO["api_major"]'
          The major version of the extension API.

    `PROCINFO["api_minor"]'
          The minor version of the extension API.

     On some systems, there may be elements in the array, `"group1"'
     through `"groupN"' for some N. N is the number of supplementary
     groups that the process has.  Use the `in' operator to test for
     these elements (*note Reference to Elements::).

     The `PROCINFO' array has the following additional uses:

        * It may be used to cause coprocesses to communicate over
          pseudo-ttys instead of through two-way pipes; this is
          discussed further in *note Two-way I/O::.

        * It may be used to provide a timeout when reading from any
          open input file, pipe, or coprocess.  *Note Read Timeout::,
          for more information.

     This array is a `gawk' extension.  In other `awk' implementations,
     or if `gawk' is in compatibility mode (*note Options::), it is not
     special.

`RLENGTH'
     The length of the substring matched by the `match()' function
     (*note String Functions::).  `RLENGTH' is set by invoking the
     `match()' function.  Its value is the length of the matched
     string, or -1 if no match is found.

`RSTART'
     The start-index in characters of the substring that is matched by
     the `match()' function (*note String Functions::).  `RSTART' is
     set by invoking the `match()' function.  Its value is the position
     of the string where the matched substring starts, or zero if no
     match was found.

`RT #'
     This is set each time a record is read. It contains the input text
     that matched the text denoted by `RS', the record separator.

     This variable is a `gawk' extension.  In other `awk'
     implementations, or if `gawk' is in compatibility mode (*note
     Options::), it is not special.

`SYMTAB #'
     An array whose indices are the names of all currently defined
     global variables and arrays in the program.  The array may be used
     for indirect access to read or write the value of a variable:

          foo = 5
          SYMTAB["foo"] = 4
          print foo    # prints 4

     The `isarray()' function (*note Type Functions::) may be used to
     test if an element in `SYMTAB' is an array.  Also, you may not use
     the `delete' statement with the `SYMTAB' array.

     You may use an index for `SYMTAB' that is not a predefined
     identifer:

          SYMTAB["xxx"] = 5
          print SYMTAB["xxx"]

     This works as expected: in this case `SYMTAB' acts just like a
     regular array.  The only difference is that you can't then delete
     `SYMTAB["xxx"]'.

     The `SYMTAB' array is more interesting than it looks. Andrew Schorr
     points out that it effectively gives `awk' data pointers. Consider
     his example:

          # Indirect multiply of any variable by amount, return result

          function multiply(variable, amount)
          {
              return SYMTAB[variable] *= amount
          }

          NOTE: In order to avoid severe time-travel paradoxes(2),
          neither `FUNCTAB' nor `SYMTAB' are available as elements
          within the `SYMTAB' array.

                        Changing `NR' and `FNR'

   `awk' increments `NR' and `FNR' each time it reads a record, instead
of setting them to the absolute value of the number of records read.
This means that a program can change these variables and their new
values are incremented for each record.  (d.c.)  The following example
shows this:

     $ echo '1
     > 2
     > 3
     > 4' | awk 'NR == 2 { NR = 17 }
     > { print NR }'
     -| 1
     -| 17
     -| 18
     -| 19

Before `FNR' was added to the `awk' language (*note V7/SVR3.1::), many
`awk' programs used this feature to track the number of records in a
file by resetting `NR' to zero when `FILENAME' changed.

   ---------- Footnotes ----------

   (1) Some early implementations of Unix `awk' initialized `FILENAME'
to `"-"', even if there were data files to be processed. This behavior
was incorrect and should not be relied upon in your programs.

   (2) Not to mention difficult implementation issues.


File: gawk.info,  Node: ARGC and ARGV,  Prev: Auto-set,  Up: Built-in Variables

7.5.3 Using `ARGC' and `ARGV'
-----------------------------

*note Auto-set::, presented the following program describing the
information contained in `ARGC' and `ARGV':

     $ awk 'BEGIN {
     >        for (i = 0; i < ARGC; i++)
     >            print ARGV[i]
     >      }' inventory-shipped BBS-list
     -| awk
     -| inventory-shipped
     -| BBS-list

In this example, `ARGV[0]' contains `awk', `ARGV[1]' contains
`inventory-shipped', and `ARGV[2]' contains `BBS-list'.  Notice that
the `awk' program is not entered in `ARGV'.  The other command-line
options, with their arguments, are also not entered.  This includes
variable assignments done with the `-v' option (*note Options::).
Normal variable assignments on the command line _are_ treated as
arguments and do show up in the `ARGV' array.  Given the following
program in a file named `showargs.awk':

     BEGIN {
         printf "A=%d, B=%d\n", A, B
         for (i = 0; i < ARGC; i++)
             printf "\tARGV[%d] = %s\n", i, ARGV[i]
     }
     END   { printf "A=%d, B=%d\n", A, B }

Running it produces the following:

     $ awk -v A=1 -f showargs.awk B=2 /dev/null
     -| A=1, B=0
     -|        ARGV[0] = awk
     -|        ARGV[1] = B=2
     -|        ARGV[2] = /dev/null
     -| A=1, B=2

   A program can alter `ARGC' and the elements of `ARGV'.  Each time
`awk' reaches the end of an input file, it uses the next element of
`ARGV' as the name of the next input file.  By storing a different
string there, a program can change which files are read.  Use `"-"' to
represent the standard input.  Storing additional elements and
incrementing `ARGC' causes additional files to be read.

   If the value of `ARGC' is decreased, that eliminates input files
from the end of the list.  By recording the old value of `ARGC'
elsewhere, a program can treat the eliminated arguments as something
other than file names.

   To eliminate a file from the middle of the list, store the null
string (`""') into `ARGV' in place of the file's name.  As a special
feature, `awk' ignores file names that have been replaced with the null
string.  Another option is to use the `delete' statement to remove
elements from `ARGV' (*note Delete::).

   All of these actions are typically done in the `BEGIN' rule, before
actual processing of the input begins.  *Note Split Program::, and see
*note Tee Program::, for examples of each way of removing elements from
`ARGV'.  The following fragment processes `ARGV' in order to examine,
and then remove, command-line options:

     BEGIN {
         for (i = 1; i < ARGC; i++) {
             if (ARGV[i] == "-v")
                 verbose = 1
             else if (ARGV[i] == "-q")
                 debug = 1
             else if (ARGV[i] ~ /^-./) {
                 e = sprintf("%s: unrecognized option -- %c",
                         ARGV[0], substr(ARGV[i], 2, 1))
                 print e > "/dev/stderr"
             } else
                 break
             delete ARGV[i]
         }
     }

   To actually get the options into the `awk' program, end the `awk'
options with `--' and then supply the `awk' program's options, in the
following manner:

     awk -f myprog -- -v -q file1 file2 ...

   This is not necessary in `gawk'. Unless `--posix' has been
specified, `gawk' silently puts any unrecognized options into `ARGV'
for the `awk' program to deal with.  As soon as it sees an unknown
option, `gawk' stops looking for other options that it might otherwise
recognize.  The previous example with `gawk' would be:

     gawk -f myprog -q -v file1 file2 ...

Because `-q' is not a valid `gawk' option, it and the following `-v'
are passed on to the `awk' program.  (*Note Getopt Function::, for an
`awk' library function that parses command-line options.)


File: gawk.info,  Node: Arrays,  Next: Functions,  Prev: Patterns and Actions,  Up: Top

8 Arrays in `awk'
*****************

An "array" is a table of values called "elements".  The elements of an
array are distinguished by their "indices".  Indices may be either
numbers or strings.

   This major node describes how arrays work in `awk', how to use array
elements, how to scan through every element in an array, and how to
remove array elements.  It also describes how `awk' simulates
multidimensional arrays, as well as some of the less obvious points
about array usage.  The major node moves on to discuss `gawk''s facility
for sorting arrays, and ends with a brief description of `gawk''s
ability to support true multidimensional arrays.

   `awk' maintains a single set of names that may be used for naming
variables, arrays, and functions (*note User-defined::).  Thus, you
cannot have a variable and an array with the same name in the same
`awk' program.

* Menu:

* Array Basics::                The basics of arrays.
* Delete::                      The `delete' statement removes an element
                                from an array.
* Numeric Array Subscripts::    How to use numbers as subscripts in
                                `awk'.
* Uninitialized Subscripts::    Using Uninitialized variables as subscripts.
* Multidimensional::            Emulating multidimensional arrays in
                                `awk'.
* Arrays of Arrays::            True multidimensional arrays.


File: gawk.info,  Node: Array Basics,  Next: Delete,  Up: Arrays

8.1 The Basics of Arrays
========================

This minor node presents the basics: working with elements in arrays
one at a time, and traversing all of the elements in an array.

* Menu:

* Array Intro::                 Introduction to Arrays
* Reference to Elements::       How to examine one element of an array.
* Assigning Elements::          How to change an element of an array.
* Array Example::               Basic Example of an Array
* Scanning an Array::           A variation of the `for' statement. It
                                loops through the indices of an array's
                                existing elements.
* Controlling Scanning::        Controlling the order in which arrays are
                                scanned.


File: gawk.info,  Node: Array Intro,  Next: Reference to Elements,  Up: Array Basics

8.1.1 Introduction to Arrays
----------------------------

     Doing linear scans over an associative array is like trying to
     club someone to death with a loaded Uzi.  -- Larry Wall

   The `awk' language provides one-dimensional arrays for storing
groups of related strings or numbers.  Every `awk' array must have a
name.  Array names have the same syntax as variable names; any valid
variable name would also be a valid array name.  But one name cannot be
used in both ways (as an array and as a variable) in the same `awk'
program.

   Arrays in `awk' superficially resemble arrays in other programming
languages, but there are fundamental differences.  In `awk', it isn't
necessary to specify the size of an array before starting to use it.
Additionally, any number or string in `awk', not just consecutive
integers, may be used as an array index.

   In most other languages, arrays must be "declared" before use,
including a specification of how many elements or components they
contain.  In such languages, the declaration causes a contiguous block
of memory to be allocated for that many elements.  Usually, an index in
the array must be a positive integer.  For example, the index zero
specifies the first element in the array, which is actually stored at
the beginning of the block of memory.  Index one specifies the second
element, which is stored in memory right after the first element, and
so on.  It is impossible to add more elements to the array, because it
has room only for as many elements as given in the declaration.  (Some
languages allow arbitrary starting and ending indices--e.g., `15 ..
27'--but the size of the array is still fixed when the array is
declared.)

   A contiguous array of four elements might look like the following
example, conceptually, if the element values are 8, `"foo"', `""', and
30:

     +---------+---------+--------+---------+
     |    8    |  "foo"  |   ""   |    30   |    Value
     +---------+---------+--------+---------+
          0         1         2         3        Index

Only the values are stored; the indices are implicit from the order of
the values. Here, 8 is the value at index zero, because 8 appears in the
position with zero elements before it.

   Arrays in `awk' are different--they are "associative".  This means
that each array is a collection of pairs: an index and its corresponding
array element value:

     Index 3     Value 30
     Index 1     Value "foo"
     Index 0     Value 8
     Index 2     Value ""

The pairs are shown in jumbled order because their order is irrelevant.

   One advantage of associative arrays is that new pairs can be added
at any time.  For example, suppose a tenth element is added to the array
whose value is `"number ten"'.  The result is:

     Index 10    Value "number ten"
     Index 3     Value 30
     Index 1     Value "foo"
     Index 0     Value 8
     Index 2     Value ""

Now the array is "sparse", which just means some indices are missing.
It has elements 0-3 and 10, but doesn't have elements 4, 5, 6, 7, 8, or
9.

   Another consequence of associative arrays is that the indices don't
have to be positive integers.  Any number, or even a string, can be an
index.  For example, the following is an array that translates words
from English to French:

     Index "dog" Value "chien"
     Index "cat" Value "chat"
     Index "one" Value "un"
     Index 1     Value "un"

Here we decided to translate the number one in both spelled-out and
numeric form--thus illustrating that a single array can have both
numbers and strings as indices.  In fact, array subscripts are always
strings; this is discussed in more detail in *note Numeric Array
Subscripts::.  Here, the number `1' isn't double-quoted, since `awk'
automatically converts it to a string.

   The value of `IGNORECASE' has no effect upon array subscripting.
The identical string value used to store an array element must be used
to retrieve it.  When `awk' creates an array (e.g., with the `split()'
built-in function), that array's indices are consecutive integers
starting at one.  (*Note String Functions::.)

   `awk''s arrays are efficient--the time to access an element is
independent of the number of elements in the array.


File: gawk.info,  Node: Reference to Elements,  Next: Assigning Elements,  Prev: Array Intro,  Up: Array Basics

8.1.2 Referring to an Array Element
-----------------------------------

The principal way to use an array is to refer to one of its elements.
An array reference is an expression as follows:

     ARRAY[INDEX-EXPRESSION]

Here, ARRAY is the name of an array.  The expression INDEX-EXPRESSION is
the index of the desired element of the array.

   The value of the array reference is the current value of that array
element.  For example, `foo[4.3]' is an expression for the element of
array `foo' at index `4.3'.

   A reference to an array element that has no recorded value yields a
value of `""', the null string.  This includes elements that have not
been assigned any value as well as elements that have been deleted
(*note Delete::).

     NOTE: A reference to an element that does not exist
     _automatically_ creates that array element, with the null string
     as its value.  (In some cases, this is unfortunate, because it
     might waste memory inside `awk'.)

     Novice `awk' programmers often make the mistake of checking if an
     element exists by checking if the value is empty:

          # Check if "foo" exists in a:         Incorrect!
          if (a["foo"] != "") ...

     This is incorrect, since this will _create_ `a["foo"]' if it
     didn't exist before!

   To determine whether an element exists in an array at a certain
index, use the following expression:

     IND in ARRAY

This expression tests whether the particular index IND exists, without
the side effect of creating that element if it is not present.  The
expression has the value one (true) if `ARRAY[IND]' exists and zero
(false) if it does not exist.  For example, this statement tests
whether the array `frequencies' contains the index `2':

     if (2 in frequencies)
         print "Subscript 2 is present."

   Note that this is _not_ a test of whether the array `frequencies'
contains an element whose _value_ is two.  There is no way to do that
except to scan all the elements.  Also, this _does not_ create
`frequencies[2]', while the following (incorrect) alternative does:

     if (frequencies[2] != "")
         print "Subscript 2 is present."


File: gawk.info,  Node: Assigning Elements,  Next: Array Example,  Prev: Reference to Elements,  Up: Array Basics

8.1.3 Assigning Array Elements
------------------------------

Array elements can be assigned values just like `awk' variables:

     ARRAY[INDEX-EXPRESSION] = VALUE

ARRAY is the name of an array.  The expression INDEX-EXPRESSION is the
index of the element of the array that is assigned a value.  The
expression VALUE is the value to assign to that element of the array.


File: gawk.info,  Node: Array Example,  Next: Scanning an Array,  Prev: Assigning Elements,  Up: Array Basics

8.1.4 Basic Array Example
-------------------------

The following program takes a list of lines, each beginning with a line
number, and prints them out in order of line number.  The line numbers
are not in order when they are first read--instead they are scrambled.
This program sorts the lines by making an array using the line numbers
as subscripts.  The program then prints out the lines in sorted order
of their numbers.  It is a very simple program and gets confused upon
encountering repeated numbers, gaps, or lines that don't begin with a
number:

     {
       if ($1 > max)
         max = $1
       arr[$1] = $0
     }

     END {
       for (x = 1; x <= max; x++)
         print arr[x]
     }

   The first rule keeps track of the largest line number seen so far;
it also stores each line into the array `arr', at an index that is the
line's number.  The second rule runs after all the input has been read,
to print out all the lines.  When this program is run with the
following input:

     5  I am the Five man
     2  Who are you?  The new number two!
     4  . . . And four on the floor
     1  Who is number one?
     3  I three you.

Its output is:

     1  Who is number one?
     2  Who are you?  The new number two!
     3  I three you.
     4  . . . And four on the floor
     5  I am the Five man

   If a line number is repeated, the last line with a given number
overrides the others.  Gaps in the line numbers can be handled with an
easy improvement to the program's `END' rule, as follows:

     END {
       for (x = 1; x <= max; x++)
         if (x in arr)
           print arr[x]
     }


File: gawk.info,  Node: Scanning an Array,  Next: Controlling Scanning,  Prev: Array Example,  Up: Array Basics

8.1.5 Scanning All Elements of an Array
---------------------------------------

In programs that use arrays, it is often necessary to use a loop that
executes once for each element of an array.  In other languages, where
arrays are contiguous and indices are limited to positive integers,
this is easy: all the valid indices can be found by counting from the
lowest index up to the highest.  This technique won't do the job in
`awk', because any number or string can be an array index.  So `awk'
has a special kind of `for' statement for scanning an array:

     for (VAR in ARRAY)
       BODY

This loop executes BODY once for each index in ARRAY that the program
has previously used, with the variable VAR set to that index.

   The following program uses this form of the `for' statement.  The
first rule scans the input records and notes which words appear (at
least once) in the input, by storing a one into the array `used' with
the word as index.  The second rule scans the elements of `used' to
find all the distinct words that appear in the input.  It prints each
word that is more than 10 characters long and also prints the number of
such words.  *Note String Functions::, for more information on the
built-in function `length()'.

     # Record a 1 for each word that is used at least once
     {
         for (i = 1; i <= NF; i++)
             used[$i] = 1
     }

     # Find number of distinct words more than 10 characters long
     END {
         for (x in used) {
             if (length(x) > 10) {
                 ++num_long_words
                 print x
             }
         }
         print num_long_words, "words longer than 10 characters"
     }

*Note Word Sorting::, for a more detailed example of this type.

   The order in which elements of the array are accessed by this
statement is determined by the internal arrangement of the array
elements within `awk' and normally cannot be controlled or changed.
This can lead to problems if new elements are added to ARRAY by
statements in the loop body; it is not predictable whether the `for'
loop will reach them.  Similarly, changing VAR inside the loop may
produce strange results.  It is best to avoid such things.


File: gawk.info,  Node: Controlling Scanning,  Prev: Scanning an Array,  Up: Array Basics

8.1.6 Using Predefined Array Scanning Orders
--------------------------------------------

By default, when a `for' loop traverses an array, the order is
undefined, meaning that the `awk' implementation determines the order
in which the array is traversed.  This order is usually based on the
internal implementation of arrays and will vary from one version of
`awk' to the next.

   Often, though, you may wish to do something simple, such as
"traverse the array by comparing the indices in ascending order," or
"traverse the array by comparing the values in descending order."
`gawk' provides two mechanisms which give you this control.

   * Set `PROCINFO["sorted_in"]' to one of a set of predefined values.
     We describe this now.

   * Set `PROCINFO["sorted_in"]' to the name of a user-defined function
     to use for comparison of array elements. This advanced feature is
     described later, in *note Array Sorting::.

   The following special values for `PROCINFO["sorted_in"]' are
available:

`"@unsorted"'
     Array elements are processed in arbitrary order, which is the
     default `awk' behavior.

`"@ind_str_asc"'
     Order by indices in ascending order compared as strings; this is
     the most basic sort.  (Internally, array indices are always
     strings, so with `a[2*5] = 1' the index is `"10"' rather than
     numeric 10.)

`"@ind_num_asc"'
     Order by indices in ascending order but force them to be treated
     as numbers in the process.  Any index with a non-numeric value
     will end up positioned as if it were zero.

`"@val_type_asc"'
     Order by element values in ascending order (rather than by
     indices).  Ordering is by the type assigned to the element (*note
     Typing and Comparison::).  All numeric values come before all
     string values, which in turn come before all subarrays.
     (Subarrays have not been described yet; *note Arrays of Arrays::.)

`"@val_str_asc"'
     Order by element values in ascending order (rather than by
     indices).  Scalar values are compared as strings.  Subarrays, if
     present, come out last.

`"@val_num_asc"'
     Order by element values in ascending order (rather than by
     indices).  Scalar values are compared as numbers.  Subarrays, if
     present, come out last.  When numeric values are equal, the string
     values are used to provide an ordering: this guarantees consistent
     results across different versions of the C `qsort()' function,(1)
     which `gawk' uses internally to perform the sorting.

`"@ind_str_desc"'
     String indices ordered from high to low.

`"@ind_num_desc"'
     Numeric indices ordered from high to low.

`"@val_type_desc"'
     Element values, based on type, ordered from high to low.
     Subarrays, if present, come out first.

`"@val_str_desc"'
     Element values, treated as strings, ordered from high to low.
     Subarrays, if present, come out first.

`"@val_num_desc"'
     Element values, treated as numbers, ordered from high to low.
     Subarrays, if present, come out first.

   The array traversal order is determined before the `for' loop starts
to run. Changing `PROCINFO["sorted_in"]' in the loop body does not
affect the loop.  For example:

     $ gawk 'BEGIN {
     >    a[4] = 4
     >    a[3] = 3
     >    for (i in a)
     >        print i, a[i]
     > }'
     -| 4 4
     -| 3 3
     $ gawk 'BEGIN {
     >    PROCINFO["sorted_in"] = "@ind_str_asc"
     >    a[4] = 4
     >    a[3] = 3
     >    for (i in a)
     >        print i, a[i]
     > }'
     -| 3 3
     -| 4 4

   When sorting an array by element values, if a value happens to be a
subarray then it is considered to be greater than any string or numeric
value, regardless of what the subarray itself contains, and all
subarrays are treated as being equal to each other.  Their order
relative to each other is determined by their index strings.

   Here are some additional things to bear in mind about sorted array
traversal.

   * The value of `PROCINFO["sorted_in"]' is global. That is, it affects
     all array traversal `for' loops.  If you need to change it within
     your own code, you should see if it's defined and save and restore
     the value:

          ...
          if ("sorted_in" in PROCINFO) {
              save_sorted = PROCINFO["sorted_in"]
              PROCINFO["sorted_in"] = "@val_str_desc" # or whatever
          }
          ...
          if (save_sorted)
              PROCINFO["sorted_in"] = save_sorted

   * As mentioned, the default array traversal order is represented by
     `"@unsorted"'.  You can also get the default behavior by assigning
     the null string to `PROCINFO["sorted_in"]' or by just deleting the
     `"sorted_in"' element from the `PROCINFO' array with the `delete'
     statement.  (The `delete' statement hasn't been described yet;
     *note Delete::.)

   In addition, `gawk' provides built-in functions for sorting arrays;
see *note Array Sorting Functions::.

   ---------- Footnotes ----------

   (1) When two elements compare as equal, the C `qsort()' function
does not guarantee that they will maintain their original relative
order after sorting.  Using the string value to provide a unique
ordering when the numeric values are equal ensures that `gawk' behaves
consistently across different environments.


File: gawk.info,  Node: Delete,  Next: Numeric Array Subscripts,  Prev: Array Basics,  Up: Arrays

8.2 The `delete' Statement
==========================

To remove an individual element of an array, use the `delete' statement:

     delete ARRAY[INDEX-EXPRESSION]

   Once an array element has been deleted, any value the element once
had is no longer available. It is as if the element had never been
referred to or been given a value.  The following is an example of
deleting elements in an array:

     for (i in frequencies)
       delete frequencies[i]

This example removes all the elements from the array `frequencies'.
Once an element is deleted, a subsequent `for' statement to scan the
array does not report that element and the `in' operator to check for
the presence of that element returns zero (i.e., false):

     delete foo[4]
     if (4 in foo)
         print "This will never be printed"

   It is important to note that deleting an element is _not_ the same
as assigning it a null value (the empty string, `""').  For example:

     foo[4] = ""
     if (4 in foo)
       print "This is printed, even though foo[4] is empty"

   It is not an error to delete an element that does not exist.
However, if `--lint' is provided on the command line (*note Options::),
`gawk' issues a warning message when an element that is not in the
array is deleted.

   All the elements of an array may be deleted with a single statement
by leaving off the subscript in the `delete' statement, as follows:

     delete ARRAY

   Using this version of the `delete' statement is about three times
more efficient than the equivalent loop that deletes each element one
at a time.

     NOTE: For many years, using `delete' without a subscript was a
     `gawk' extension.  As of September, 2012, it was accepted for
     inclusion into the POSIX standard. See the Austin Group website
     (http://austingroupbugs.net/view.php?id=544).  This form of the
     `delete' statement is also supported by Brian Kernighan's `awk'
     and `mawk', as well as by a number of other implementations (*note
     Other Versions::).

   The following statement provides a portable but nonobvious way to
clear out an array:(1)

     split("", array)

   The `split()' function (*note String Functions::) clears out the
target array first. This call asks it to split apart the null string.
Because there is no data to split out, the function simply clears the
array and then returns.

     CAUTION: Deleting an array does not change its type; you cannot
     delete an array and then use the array's name as a scalar (i.e., a
     regular variable). For example, the following does not work:

          a[1] = 3
          delete a
          a = 3

   ---------- Footnotes ----------

   (1) Thanks to Michael Brennan for pointing this out.


File: gawk.info,  Node: Numeric Array Subscripts,  Next: Uninitialized Subscripts,  Prev: Delete,  Up: Arrays

8.3 Using Numbers to Subscript Arrays
=====================================

An important aspect to remember about arrays is that _array subscripts
are always strings_.  When a numeric value is used as a subscript, it
is converted to a string value before being used for subscripting
(*note Conversion::).  This means that the value of the built-in
variable `CONVFMT' can affect how your program accesses elements of an
array.  For example:

     xyz = 12.153
     data[xyz] = 1
     CONVFMT = "%2.2f"
     if (xyz in data)
         printf "%s is in data\n", xyz
     else
         printf "%s is not in data\n", xyz

This prints `12.15 is not in data'.  The first statement gives `xyz' a
numeric value.  Assigning to `data[xyz]' subscripts `data' with the
string value `"12.153"' (using the default conversion value of
`CONVFMT', `"%.6g"').  Thus, the array element `data["12.153"]' is
assigned the value one.  The program then changes the value of
`CONVFMT'.  The test `(xyz in data)' generates a new string value from
`xyz'--this time `"12.15"'--because the value of `CONVFMT' only allows
two significant digits.  This test fails, since `"12.15"' is different
from `"12.153"'.

   According to the rules for conversions (*note Conversion::), integer
values are always converted to strings as integers, no matter what the
value of `CONVFMT' may happen to be.  So the usual case of the
following works:

     for (i = 1; i <= maxsub; i++)
         do something with array[i]

   The "integer values always convert to strings as integers" rule has
an additional consequence for array indexing.  Octal and hexadecimal
constants (*note Nondecimal-numbers::) are converted internally into
numbers, and their original form is forgotten.  This means, for
example, that `array[17]', `array[021]', and `array[0x11]' all refer to
the same element!

   As with many things in `awk', the majority of the time things work
as one would expect them to.  But it is useful to have a precise
knowledge of the actual rules since they can sometimes have a subtle
effect on your programs.


File: gawk.info,  Node: Uninitialized Subscripts,  Next: Multidimensional,  Prev: Numeric Array Subscripts,  Up: Arrays

8.4 Using Uninitialized Variables as Subscripts
===============================================

Suppose it's necessary to write a program to print the input data in
reverse order.  A reasonable attempt to do so (with some test data)
might look like this:

     $ echo 'line 1
     > line 2
     > line 3' | awk '{ l[lines] = $0; ++lines }
     > END {
     >     for (i = lines-1; i >= 0; --i)
     >        print l[i]
     > }'
     -| line 3
     -| line 2

   Unfortunately, the very first line of input data did not come out in
the output!

   Upon first glance, we would think that this program should have
worked.  The variable `lines' is uninitialized, and uninitialized
variables have the numeric value zero.  So, `awk' should have printed
the value of `l[0]'.

   The issue here is that subscripts for `awk' arrays are _always_
strings. Uninitialized variables, when used as strings, have the value
`""', not zero.  Thus, `line 1' ends up stored in `l[""]'.  The
following version of the program works correctly:

     { l[lines++] = $0 }
     END {
         for (i = lines - 1; i >= 0; --i)
            print l[i]
     }

   Here, the `++' forces `lines' to be numeric, thus making the "old
value" numeric zero. This is then converted to `"0"' as the array
subscript.

   Even though it is somewhat unusual, the null string (`""') is a
valid array subscript.  (d.c.)  `gawk' warns about the use of the null
string as a subscript if `--lint' is provided on the command line
(*note Options::).


File: gawk.info,  Node: Multidimensional,  Next: Arrays of Arrays,  Prev: Uninitialized Subscripts,  Up: Arrays

8.5 Multidimensional Arrays
===========================

* Menu:

* Multiscanning::              Scanning multidimensional arrays.

   A multidimensional array is an array in which an element is
identified by a sequence of indices instead of a single index.  For
example, a two-dimensional array requires two indices.  The usual way
(in most languages, including `awk') to refer to an element of a
two-dimensional array named `grid' is with `grid[X,Y]'.

   Multidimensional arrays are supported in `awk' through concatenation
of indices into one string.  `awk' converts the indices into strings
(*note Conversion::) and concatenates them together, with a separator
between them.  This creates a single string that describes the values
of the separate indices.  The combined string is used as a single index
into an ordinary, one-dimensional array.  The separator used is the
value of the built-in variable `SUBSEP'.

   For example, suppose we evaluate the expression `foo[5,12] = "value"'
when the value of `SUBSEP' is `"@"'.  The numbers 5 and 12 are
converted to strings and concatenated with an `@' between them,
yielding `"5@12"'; thus, the array element `foo["5@12"]' is set to
`"value"'.

   Once the element's value is stored, `awk' has no record of whether
it was stored with a single index or a sequence of indices.  The two
expressions `foo[5,12]' and `foo[5 SUBSEP 12]' are always equivalent.

   The default value of `SUBSEP' is the string `"\034"', which contains
a nonprinting character that is unlikely to appear in an `awk' program
or in most input data.  The usefulness of choosing an unlikely
character comes from the fact that index values that contain a string
matching `SUBSEP' can lead to combined strings that are ambiguous.
Suppose that `SUBSEP' is `"@"'; then `foo["a@b", "c"]' and
`foo["a", "b@c"]' are indistinguishable because both are actually
stored as `foo["a@b@c"]'.

   To test whether a particular index sequence exists in a
multidimensional array, use the same operator (`in') that is used for
single dimensional arrays.  Write the whole sequence of indices in
parentheses, separated by commas, as the left operand:

     (SUBSCRIPT1, SUBSCRIPT2, ...) in ARRAY

   The following example treats its input as a two-dimensional array of
fields; it rotates this array 90 degrees clockwise and prints the
result.  It assumes that all lines have the same number of elements:

     {
          if (max_nf < NF)
               max_nf = NF
          max_nr = NR
          for (x = 1; x <= NF; x++)
               vector[x, NR] = $x
     }

     END {
          for (x = 1; x <= max_nf; x++) {
               for (y = max_nr; y >= 1; --y)
                    printf("%s ", vector[x, y])
               printf("\n")
          }
     }

When given the input:

     1 2 3 4 5 6
     2 3 4 5 6 1
     3 4 5 6 1 2
     4 5 6 1 2 3

the program produces the following output:

     4 3 2 1
     5 4 3 2
     6 5 4 3
     1 6 5 4
     2 1 6 5
     3 2 1 6


File: gawk.info,  Node: Multiscanning,  Up: Multidimensional

8.5.1 Scanning Multidimensional Arrays
--------------------------------------

There is no special `for' statement for scanning a "multidimensional"
array. There cannot be one, because, in truth, `awk' does not have
multidimensional arrays or elements--there is only a multidimensional
_way of accessing_ an array.

   However, if your program has an array that is always accessed as
multidimensional, you can get the effect of scanning it by combining
the scanning `for' statement (*note Scanning an Array::) with the
built-in `split()' function (*note String Functions::).  It works in
the following manner:

     for (combined in array) {
         split(combined, separate, SUBSEP)
         ...
     }

This sets the variable `combined' to each concatenated combined index
in the array, and splits it into the individual indices by breaking it
apart where the value of `SUBSEP' appears.  The individual indices then
become the elements of the array `separate'.

   Thus, if a value is previously stored in `array[1, "foo"]', then an
element with index `"1\034foo"' exists in `array'.  (Recall that the
default value of `SUBSEP' is the character with code 034.)  Sooner or
later, the `for' statement finds that index and does an iteration with
the variable `combined' set to `"1\034foo"'.  Then the `split()'
function is called as follows:

     split("1\034foo", separate, "\034")

The result is to set `separate[1]' to `"1"' and `separate[2]' to
`"foo"'.  Presto! The original sequence of separate indices is
recovered.


File: gawk.info,  Node: Arrays of Arrays,  Prev: Multidimensional,  Up: Arrays

8.6 Arrays of Arrays
====================

`gawk' goes beyond standard `awk''s multidimensional array access and
provides true arrays of arrays. Elements of a subarray are referred to
by their own indices enclosed in square brackets, just like the
elements of the main array.  For example, the following creates a
two-element subarray at index `1' of the main array `a':

     a[1][1] = 1
     a[1][2] = 2

   This simulates a true two-dimensional array. Each subarray element
can contain another subarray as a value, which in turn can hold other
arrays as well. In this way, you can create arrays of three or more
dimensions.  The indices can be any `awk' expression, including scalars
separated by commas (that is, a regular `awk' simulated
multidimensional subscript). So the following is valid in `gawk':

     a[1][3][1, "name"] = "barney"

   Each subarray and the main array can be of different length. In
fact, the elements of an array or its subarray do not all have to have
the same type. This means that the main array and any of its subarrays
can be non-rectangular, or jagged in structure. One can assign a scalar
value to the index `4' of the main array `a':

     a[4] = "An element in a jagged array"

   The terms "dimension", "row" and "column" are meaningless when
applied to such an array, but we will use "dimension" henceforth to
imply the maximum number of indices needed to refer to an existing
element. The type of any element that has already been assigned cannot
be changed by assigning a value of a different type. You have to first
delete the current element, which effectively makes `gawk' forget about
the element at that index:

     delete a[4]
     a[4][5][6][7] = "An element in a four-dimensional array"

This removes the scalar value from index `4' and then inserts a
subarray of subarray of subarray containing a scalar. You can also
delete an entire subarray or subarray of subarrays:

     delete a[4][5]
     a[4][5] = "An element in subarray a[4]"

   But recall that you can not delete the main array `a' and then use it
as a scalar.

   The built-in functions which take array arguments can also be used
with subarrays. For example, the following code fragment uses `length()'
(*note String Functions::) to determine the number of elements in the
main array `a' and its subarrays:

     print length(a), length(a[1]), length(a[1][3])

This results in the following output for our main array `a':

     2, 3, 1

The `SUBSCRIPT in ARRAY' expression (*note Reference to Elements::)
works similarly for both regular `awk'-style arrays and arrays of
arrays. For example, the tests `1 in a', `3 in a[1]', and `(1, "name")
in a[1][3]' all evaluate to one (true) for our array `a'.

   The `for (item in array)' statement (*note Scanning an Array::) can
be nested to scan all the elements of an array of arrays if it is
rectangular in structure. In order to print the contents (scalar
values) of a two-dimensional array of arrays (i.e., in which each
first-level element is itself an array, not necessarily of the same
length) you could use the following code:

     for (i in array)
         for (j in array[i])
             print array[i][j]

   The `isarray()' function (*note Type Functions::) lets you test if
an array element is itself an array:

     for (i in array) {
         if (isarray(array[i]) {
             for (j in array[i]) {
                 print array[i][j]
             }
         }
     }

   If the structure of a jagged array of arrays is known in advance,
you can often devise workarounds using control statements. For example,
the following code prints the elements of our main array `a':

     for (i in a) {
         for (j in a[i]) {
             if (j == 3) {
                 for (k in a[i][j])
                     print a[i][j][k]
             } else
                 print a[i][j]
         }
     }

*Note Walking Arrays::, for a user-defined function that "walks" an
arbitrarily-dimensioned array of arrays.

   Recall that a reference to an uninitialized array element yields a
value of `""', the null string. This has one important implication when
you intend to use a subarray as an argument to a function, as
illustrated by the following example:

     $ gawk 'BEGIN { split("a b c d", b[1]); print b[1][1] }'
     error--> gawk: cmd. line:1: fatal: split: second argument is not an array

   The way to work around this is to first force `b[1]' to be an array
by creating an arbitrary index:

     $ gawk 'BEGIN { b[1][1] = ""; split("a b c d", b[1]); print b[1][1] }'
     -| a


File: gawk.info,  Node: Functions,  Next: Library Functions,  Prev: Arrays,  Up: Top

9 Functions
***********

This major node describes `awk''s built-in functions, which fall into
three categories: numeric, string, and I/O.  `gawk' provides additional
groups of functions to work with values that represent time, do bit
manipulation, sort arrays, and internationalize and localize programs.

   Besides the built-in functions, `awk' has provisions for writing new
functions that the rest of a program can use.  The second half of this
major node describes these "user-defined" functions.

* Menu:

* Built-in::                    Summarizes the built-in functions.
* User-defined::                Describes User-defined functions in detail.
* Indirect Calls::              Choosing the function to call at runtime.


File: gawk.info,  Node: Built-in,  Next: User-defined,  Up: Functions

9.1 Built-in Functions
======================

"Built-in" functions are always available for your `awk' program to
call.  This minor node defines all the built-in functions in `awk';
some of these are mentioned in other sections but are summarized here
for your convenience.

* Menu:

* Calling Built-in::            How to call built-in functions.
* Numeric Functions::           Functions that work with numbers, including
                                `int()', `sin()' and `rand()'.
* String Functions::            Functions for string manipulation, such as
                                `split()', `match()' and
                                `sprintf()'.
* I/O Functions::               Functions for files and shell commands.
* Time Functions::              Functions for dealing with timestamps.
* Bitwise Functions::           Functions for bitwise operations.
* Type Functions::              Functions for type information.
* I18N Functions::              Functions for string translation.


File: gawk.info,  Node: Calling Built-in,  Next: Numeric Functions,  Up: Built-in

9.1.1 Calling Built-in Functions
--------------------------------

To call one of `awk''s built-in functions, write the name of the
function followed by arguments in parentheses.  For example, `atan2(y +
z, 1)' is a call to the function `atan2()' and has two arguments.

   Whitespace is ignored between the built-in function name and the
open parenthesis, but nonetheless it is good practice to avoid using
whitespace there.  User-defined functions do not permit whitespace in
this way, and it is easier to avoid mistakes by following a simple
convention that always works--no whitespace after a function name.

   Each built-in function accepts a certain number of arguments.  In
some cases, arguments can be omitted. The defaults for omitted
arguments vary from function to function and are described under the
individual functions.  In some `awk' implementations, extra arguments
given to built-in functions are ignored.  However, in `gawk', it is a
fatal error to give extra arguments to a built-in function.

   When a function is called, expressions that create the function's
actual parameters are evaluated completely before the call is performed.
For example, in the following code fragment:

     i = 4
     j = sqrt(i++)

the variable `i' is incremented to the value five before `sqrt()' is
called with a value of four for its actual parameter.  The order of
evaluation of the expressions used for the function's parameters is
undefined.  Thus, avoid writing programs that assume that parameters
are evaluated from left to right or from right to left.  For example:

     i = 5
     j = atan2(i++, i *= 2)

   If the order of evaluation is left to right, then `i' first becomes
6, and then 12, and `atan2()' is called with the two arguments 6 and
12.  But if the order of evaluation is right to left, `i' first becomes
10, then 11, and `atan2()' is called with the two arguments 11 and 10.


File: gawk.info,  Node: Numeric Functions,  Next: String Functions,  Prev: Calling Built-in,  Up: Built-in

9.1.2 Numeric Functions
-----------------------

The following list describes all of the built-in functions that work
with numbers.  Optional parameters are enclosed in square
brackets ([ ]):

`atan2(Y, X)'
     Return the arctangent of `Y / X' in radians.  You can use `pi =
     atan2(0, -1)' to retrieve the value of pi.

`cos(X)'
     Return the cosine of X, with X in radians.

`exp(X)'
     Return the exponential of X (`e ^ X') or report an error if X is
     out of range.  The range of values X can have depends on your
     machine's floating-point representation.

`int(X)'
     Return the nearest integer to X, located between X and zero and
     truncated toward zero.

     For example, `int(3)' is 3, `int(3.9)' is 3, `int(-3.9)' is -3,
     and `int(-3)' is -3 as well.

`log(X)'
     Return the natural logarithm of X, if X is positive; otherwise,
     report an error.

`rand()'
     Return a random number.  The values of `rand()' are uniformly
     distributed between zero and one.  The value could be zero but is
     never one.(1)

     Often random integers are needed instead.  Following is a
     user-defined function that can be used to obtain a random
     non-negative integer less than N:

          function randint(n) {
               return int(n * rand())
          }

     The multiplication produces a random number greater than zero and
     less than `n'.  Using `int()', this result is made into an integer
     between zero and `n' - 1, inclusive.

     The following example uses a similar function to produce random
     integers between one and N.  This program prints a new random
     number for each input record:

          # Function to roll a simulated die.
          function roll(n) { return 1 + int(rand() * n) }

          # Roll 3 six-sided dice and
          # print total number of points.
          {
                printf("%d points\n",
                       roll(6)+roll(6)+roll(6))
          }

          CAUTION: In most `awk' implementations, including `gawk',
          `rand()' starts generating numbers from the same starting
          number, or "seed", each time you run `awk'.(2)  Thus, a
          program generates the same results each time you run it.  The
          numbers are random within one `awk' run but predictable from
          run to run.  This is convenient for debugging, but if you want
          a program to do different things each time it is used, you
          must change the seed to a value that is different in each
          run.  To do this, use `srand()'.

`sin(X)'
     Return the sine of X, with X in radians.

`sqrt(X)'
     Return the positive square root of X.  `gawk' prints a warning
     message if X is negative.  Thus, `sqrt(4)' is 2.

`srand([X])'
     Set the starting point, or seed, for generating random numbers to
     the value X.

     Each seed value leads to a particular sequence of random
     numbers.(3) Thus, if the seed is set to the same value a second
     time, the same sequence of random numbers is produced again.

          CAUTION: Different `awk' implementations use different
          random-number generators internally.  Don't expect the same
          `awk' program to produce the same series of random numbers
          when executed by different versions of `awk'.

     If the argument X is omitted, as in `srand()', then the current
     date and time of day are used for a seed.  This is the way to get
     random numbers that are truly unpredictable.

     The return value of `srand()' is the previous seed.  This makes it
     easy to keep track of the seeds in case you need to consistently
     reproduce sequences of random numbers.

   ---------- Footnotes ----------

   (1) The C version of `rand()' on many Unix systems is known to
produce fairly poor sequences of random numbers.  However, nothing
requires that an `awk' implementation use the C `rand()' to implement
the `awk' version of `rand()'.  In fact, `gawk' uses the BSD `random()'
function, which is considerably better than `rand()', to produce random
numbers.

   (2) `mawk' uses a different seed each time.

   (3) Computer-generated random numbers really are not truly random.
They are technically known as "pseudorandom."  This means that while
the numbers in a sequence appear to be random, you can in fact generate
the same sequence of random numbers over and over again.


File: gawk.info,  Node: String Functions,  Next: I/O Functions,  Prev: Numeric Functions,  Up: Built-in

9.1.3 String-Manipulation Functions
-----------------------------------

The functions in this minor node look at or change the text of one or
more strings.

   `gawk' understands locales (*note Locales::), and does all string
processing in terms of _characters_, not _bytes_.  This distinction is
particularly important to understand for locales where one character
may be represented by multiple bytes.  Thus, for example, `length()'
returns the number of characters in a string, and not the number of
bytes used to represent those characters. Similarly, `index()' works
with character indices, and not byte indices.

   In the following list, optional parameters are enclosed in square
brackets ([ ]).  Several functions perform string substitution; the
full discussion is provided in the description of the `sub()' function,
which comes towards the end since the list is presented in alphabetic
order.  Those functions that are specific to `gawk' are marked with a
pound sign (`#'):

* Menu:

* Gory Details::                More than you want to know about `\' and
                                `&' with `sub()', `gsub()', and
                                `gensub()'.

`asort(SOURCE [, DEST [, HOW  ] ]) #'
`asorti(SOURCE [, DEST [, HOW  ] ]) #'
     These two functions are similar in behavior, so they are described
     together.

          NOTE: The following description ignores the third argument,
          HOW, since it requires understanding features that we have
          not discussed yet.  Thus, the discussion here is a deliberate
          simplification.  (We do provide all the details later on:
          *Note Array Sorting Functions::, for the full story.)

     Both functions return the number of elements in the array SOURCE.
     For `asort()', `gawk' sorts the values of SOURCE and replaces the
     indices of the sorted values of SOURCE with sequential integers
     starting with one.  If the optional array DEST is specified, then
     SOURCE is duplicated into DEST.  DEST is then sorted, leaving the
     indices of SOURCE unchanged.

     When comparing strings, `IGNORECASE' affects the sorting.  If the
     SOURCE array contains subarrays as values (*note Arrays of
     Arrays::), they will come last, after all scalar values.

     For example, if the contents of `a' are as follows:

          a["last"] = "de"
          a["first"] = "sac"
          a["middle"] = "cul"

     A call to `asort()':

          asort(a)

     results in the following contents of `a':

          a[1] = "cul"
          a[2] = "de"
          a[3] = "sac"

     The `asorti()' function works similarly to `asort()', however, the
     _indices_ are sorted, instead of the values. Thus, in the previous
     example, starting with the same initial set of indices and values
     in `a', calling `asorti(a)' would yield:

          a[1] = "first"
          a[2] = "last"
          a[3] = "middle"

     `asort()' and `asorti()' are `gawk' extensions; they are not
     available in compatibility mode (*note Options::).

`gensub(REGEXP, REPLACEMENT, HOW [, TARGET]) #'
     Search the target string TARGET for matches of the regular
     expression REGEXP.  If HOW is a string beginning with `g' or `G'
     (short for "global"), then replace all matches of REGEXP with
     REPLACEMENT.  Otherwise, HOW is treated as a number indicating
     which match of REGEXP to replace. If no TARGET is supplied, use
     `$0'.  It returns the modified string as the result of the
     function and the original target string is _not_ changed.

     `gensub()' is a general substitution function.  It's purpose is to
     provide more features than the standard `sub()' and `gsub()'
     functions.

     `gensub()' provides an additional feature that is not available in
     `sub()' or `gsub()': the ability to specify components of a regexp
     in the replacement text.  This is done by using parentheses in the
     regexp to mark the components and then specifying `\N' in the
     replacement text, where N is a digit from 1 to 9.  For example:

          $ gawk '
          > BEGIN {
          >      a = "abc def"
          >      b = gensub(/(.+) (.+)/, "\\2 \\1", "g", a)
          >      print b
          > }'
          -| def abc

     As with `sub()', you must type two backslashes in order to get one
     into the string.  In the replacement text, the sequence `\0'
     represents the entire matched text, as does the character `&'.

     The following example shows how you can use the third argument to
     control which match of the regexp should be changed:

          $ echo a b c a b c |
          > gawk '{ print gensub(/a/, "AA", 2) }'
          -| a b c AA b c

     In this case, `$0' is the default target string.  `gensub()'
     returns the new string as its result, which is passed directly to
     `print' for printing.

     If the HOW argument is a string that does not begin with `g' or
     `G', or if it is a number that is less than or equal to zero, only
     one substitution is performed.  If HOW is zero, `gawk' issues a
     warning message.

     If REGEXP does not match TARGET, `gensub()''s return value is the
     original unchanged value of TARGET.

     `gensub()' is a `gawk' extension; it is not available in
     compatibility mode (*note Options::).

`gsub(REGEXP, REPLACEMENT [, TARGET])'
     Search TARGET for _all_ of the longest, leftmost, _nonoverlapping_
     matching substrings it can find and replace them with REPLACEMENT.
     The `g' in `gsub()' stands for "global," which means replace
     everywhere.  For example:

          { gsub(/Britain/, "United Kingdom"); print }

     replaces all occurrences of the string `Britain' with `United
     Kingdom' for all input records.

     The `gsub()' function returns the number of substitutions made.  If
     the variable to search and alter (TARGET) is omitted, then the
     entire input record (`$0') is used.  As in `sub()', the characters
     `&' and `\' are special, and the third argument must be assignable.

`index(IN, FIND)'
     Search the string IN for the first occurrence of the string FIND,
     and return the position in characters where that occurrence begins
     in the string IN.  Consider the following example:

          $ awk 'BEGIN { print index("peanut", "an") }'
          -| 3

     If FIND is not found, `index()' returns zero.  (Remember that
     string indices in `awk' start at one.)

     It is a fatal error to use a regexp constant for FIND.

`length([STRING])'
     Return the number of characters in STRING.  If STRING is a number,
     the length of the digit string representing that number is
     returned.  For example, `length("abcde")' is five.  By contrast,
     `length(15 * 35)' works out to three. In this example, 15 * 35 =
     525, and 525 is then converted to the string `"525"', which has
     three characters.

     If no argument is supplied, `length()' returns the length of `$0'.

          NOTE: In older versions of `awk', the `length()' function
          could be called without any parentheses.  Doing so is
          considered poor practice, although the 2008 POSIX standard
          explicitly allows it, to support historical practice.  For
          programs to be maximally portable, always supply the
          parentheses.

     If `length()' is called with a variable that has not been used,
     `gawk' forces the variable to be a scalar.  Other implementations
     of `awk' leave the variable without a type.  (d.c.)  Consider:

          $ gawk 'BEGIN { print length(x) ; x[1] = 1 }'
          -| 0
          error--> gawk: fatal: attempt to use scalar `x' as array

          $ nawk 'BEGIN { print length(x) ; x[1] = 1 }'
          -| 0

     If `--lint' has been specified on the command line, `gawk' issues a
     warning about this.

     With `gawk' and several other `awk' implementations, when given an
     array argument, the `length()' function returns the number of
     elements in the array. (c.e.)  This is less useful than it might
     seem at first, as the array is not guaranteed to be indexed from
     one to the number of elements in it.  If `--lint' is provided on
     the command line (*note Options::), `gawk' warns that passing an
     array argument is not portable.  If `--posix' is supplied, using
     an array argument is a fatal error (*note Arrays::).

`match(STRING, REGEXP [, ARRAY])'
     Search STRING for the longest, leftmost substring matched by the
     regular expression, REGEXP and return the character position, or
     "index", at which that substring begins (one, if it starts at the
     beginning of STRING).  If no match is found, return zero.

     The REGEXP argument may be either a regexp constant (`/.../') or a
     string constant (`"..."').  In the latter case, the string is
     treated as a regexp to be matched.  *Note Computed Regexps::, for a
     discussion of the difference between the two forms, and the
     implications for writing your program correctly.

     The order of the first two arguments is backwards from most other
     string functions that work with regular expressions, such as
     `sub()' and `gsub()'.  It might help to remember that for
     `match()', the order is the same as for the `~' operator: `STRING
     ~ REGEXP'.

     The `match()' function sets the built-in variable `RSTART' to the
     index.  It also sets the built-in variable `RLENGTH' to the length
     in characters of the matched substring.  If no match is found,
     `RSTART' is set to zero, and `RLENGTH' to -1.

     For example:

          {
                 if ($1 == "FIND")
                   regex = $2
                 else {
                   where = match($0, regex)
                   if (where != 0)
                     print "Match of", regex, "found at",
                               where, "in", $0
                 }
          }

     This program looks for lines that match the regular expression
     stored in the variable `regex'.  This regular expression can be
     changed.  If the first word on a line is `FIND', `regex' is
     changed to be the second word on that line.  Therefore, if given:

          FIND ru+n
          My program runs
          but not very quickly
          FIND Melvin
          JF+KM
          This line is property of Reality Engineering Co.
          Melvin was here.

     `awk' prints:

          Match of ru+n found at 12 in My program runs
          Match of Melvin found at 1 in Melvin was here.

     If ARRAY is present, it is cleared, and then the zeroth element of
     ARRAY is set to the entire portion of STRING matched by REGEXP.
     If REGEXP contains parentheses, the integer-indexed elements of
     ARRAY are set to contain the portion of STRING matching the
     corresponding parenthesized subexpression.  For example:

          $ echo foooobazbarrrrr |
          > gawk '{ match($0, /(fo+).+(bar*)/, arr)
          >         print arr[1], arr[2] }'
          -| foooo barrrrr

     In addition, multidimensional subscripts are available providing
     the start index and length of each matched subexpression:

          $ echo foooobazbarrrrr |
          > gawk '{ match($0, /(fo+).+(bar*)/, arr)
          >           print arr[1], arr[2]
          >           print arr[1, "start"], arr[1, "length"]
          >           print arr[2, "start"], arr[2, "length"]
          > }'
          -| foooo barrrrr
          -| 1 5
          -| 9 7

     There may not be subscripts for the start and index for every
     parenthesized subexpression, since they may not all have matched
     text; thus they should be tested for with the `in' operator (*note
     Reference to Elements::).

     The ARRAY argument to `match()' is a `gawk' extension.  In
     compatibility mode (*note Options::), using a third argument is a
     fatal error.

`patsplit(STRING, ARRAY [, FIELDPAT [, SEPS ] ]) #'
     Divide STRING into pieces defined by FIELDPAT and store the pieces
     in ARRAY and the separator strings in the SEPS array.  The first
     piece is stored in `ARRAY[1]', the second piece in `ARRAY[2]', and
     so forth.  The third argument, FIELDPAT, is a regexp describing
     the fields in STRING (just as `FPAT' is a regexp describing the
     fields in input records).  It may be either a regexp constant or a
     string.  If FIELDPAT is omitted, the value of `FPAT' is used.
     `patsplit()' returns the number of elements created.  `SEPS[I]' is
     the separator string between `ARRAY[I]' and `ARRAY[I+1]'.  Any
     leading separator will be in `SEPS[0]'.

     The `patsplit()' function splits strings into pieces in a manner
     similar to the way input lines are split into fields using `FPAT'
     (*note Splitting By Content::.

     Before splitting the string, `patsplit()' deletes any previously
     existing elements in the arrays ARRAY and SEPS.

     The `patsplit()' function is a `gawk' extension.  In compatibility
     mode (*note Options::), it is not available.

`split(STRING, ARRAY [, FIELDSEP [, SEPS ] ])'
     Divide STRING into pieces separated by FIELDSEP and store the
     pieces in ARRAY and the separator strings in the SEPS array.  The
     first piece is stored in `ARRAY[1]', the second piece in
     `ARRAY[2]', and so forth.  The string value of the third argument,
     FIELDSEP, is a regexp describing where to split STRING (much as
     `FS' can be a regexp describing where to split input records;
     *note Regexp Field Splitting::).  If FIELDSEP is omitted, the
     value of `FS' is used.  `split()' returns the number of elements
     created.  SEPS is a `gawk' extension with `SEPS[I]' being the
     separator string between `ARRAY[I]' and `ARRAY[I+1]'.  If FIELDSEP
     is a single space then any leading whitespace goes into `SEPS[0]'
     and any trailing whitespace goes into `SEPS[N]' where N is the
     return value of `split()' (that is, the number of elements in
     ARRAY).

     The `split()' function splits strings into pieces in a manner
     similar to the way input lines are split into fields.  For example:

          split("cul-de-sac", a, "-", seps)

     splits the string `cul-de-sac' into three fields using `-' as the
     separator.  It sets the contents of the array `a' as follows:

          a[1] = "cul"
          a[2] = "de"
          a[3] = "sac"

     and sets the contents of the array `seps' as follows:

          seps[1] = "-"
          seps[2] = "-"

     The value returned by this call to `split()' is three.

     As with input field-splitting, when the value of FIELDSEP is
     `" "', leading and trailing whitespace is ignored in values
     assigned to the elements of ARRAY but not in SEPS, and the elements
     are separated by runs of whitespace.  Also as with input
     field-splitting, if FIELDSEP is the null string, each individual
     character in the string is split into its own array element.
     (c.e.)

     Note, however, that `RS' has no effect on the way `split()' works.
     Even though `RS = ""' causes newline to also be an input field
     separator, this does not affect how `split()' splits strings.

     Modern implementations of `awk', including `gawk', allow the third
     argument to be a regexp constant (`/abc/') as well as a string.
     (d.c.)  The POSIX standard allows this as well.  *Note Computed
     Regexps::, for a discussion of the difference between using a
     string constant or a regexp constant, and the implications for
     writing your program correctly.

     Before splitting the string, `split()' deletes any previously
     existing elements in the arrays ARRAY and SEPS.

     If STRING is null, the array has no elements. (So this is a
     portable way to delete an entire array with one statement.  *Note
     Delete::.)

     If STRING does not match FIELDSEP at all (but is not null), ARRAY
     has one element only. The value of that element is the original
     STRING.

`sprintf(FORMAT, EXPRESSION1, ...)'
     Return (without printing) the string that `printf' would have
     printed out with the same arguments (*note Printf::).  For example:

          pival = sprintf("pi = %.2f (approx.)", 22/7)

     assigns the string `pi = 3.14 (approx.)' to the variable `pival'.

`strtonum(STR) #'
     Examine STR and return its numeric value.  If STR begins with a
     leading `0', `strtonum()' assumes that STR is an octal number.  If
     STR begins with a leading `0x' or `0X', `strtonum()' assumes that
     STR is a hexadecimal number.  For example:

          $ echo 0x11 |
          > gawk '{ printf "%d\n", strtonum($1) }'
          -| 17

     Using the `strtonum()' function is _not_ the same as adding zero
     to a string value; the automatic coercion of strings to numbers
     works only for decimal data, not for octal or hexadecimal.(1)

     Note also that `strtonum()' uses the current locale's decimal point
     for recognizing numbers (*note Locales::).

     `strtonum()' is a `gawk' extension; it is not available in
     compatibility mode (*note Options::).

`sub(REGEXP, REPLACEMENT [, TARGET])'
     Search TARGET, which is treated as a string, for the leftmost,
     longest substring matched by the regular expression REGEXP.
     Modify the entire string by replacing the matched text with
     REPLACEMENT.  The modified string becomes the new value of TARGET.
     Return the number of substitutions made (zero or one).

     The REGEXP argument may be either a regexp constant (`/.../') or a
     string constant (`"..."').  In the latter case, the string is
     treated as a regexp to be matched.  *Note Computed Regexps::, for a
     discussion of the difference between the two forms, and the
     implications for writing your program correctly.

     This function is peculiar because TARGET is not simply used to
     compute a value, and not just any expression will do--it must be a
     variable, field, or array element so that `sub()' can store a
     modified value there.  If this argument is omitted, then the
     default is to use and alter `$0'.(2) For example:

          str = "water, water, everywhere"
          sub(/at/, "ith", str)

     sets `str' to `wither, water, everywhere', by replacing the
     leftmost longest occurrence of `at' with `ith'.

     If the special character `&' appears in REPLACEMENT, it stands for
     the precise substring that was matched by REGEXP.  (If the regexp
     can match more than one string, then this precise substring may
     vary.)  For example:

          { sub(/candidate/, "& and his wife"); print }

     changes the first occurrence of `candidate' to `candidate and his
     wife' on each input line.  Here is another example:

          $ awk 'BEGIN {
          >         str = "daabaaa"
          >         sub(/a+/, "C&C", str)
          >         print str
          > }'
          -| dCaaCbaaa

     This shows how `&' can represent a nonconstant string and also
     illustrates the "leftmost, longest" rule in regexp matching (*note
     Leftmost Longest::).

     The effect of this special character (`&') can be turned off by
     putting a backslash before it in the string.  As usual, to insert
     one backslash in the string, you must write two backslashes.
     Therefore, write `\\&' in a string constant to include a literal
     `&' in the replacement.  For example, the following shows how to
     replace the first `|' on each line with an `&':

          { sub(/\|/, "\\&"); print }

     As mentioned, the third argument to `sub()' must be a variable,
     field or array element.  Some versions of `awk' allow the third
     argument to be an expression that is not an lvalue.  In such a
     case, `sub()' still searches for the pattern and returns zero or
     one, but the result of the substitution (if any) is thrown away
     because there is no place to put it.  Such versions of `awk'
     accept expressions like the following:

          sub(/USA/, "United States", "the USA and Canada")

     For historical compatibility, `gawk' accepts such erroneous code.
     However, using any other nonchangeable object as the third
     parameter causes a fatal error and your program will not run.

     Finally, if the REGEXP is not a regexp constant, it is converted
     into a string, and then the value of that string is treated as the
     regexp to match.

`substr(STRING, START [, LENGTH])'
     Return a LENGTH-character-long substring of STRING, starting at
     character number START.  The first character of a string is
     character number one.(3) For example, `substr("washington", 5, 3)'
     returns `"ing"'.

     If LENGTH is not present, `substr()' returns the whole suffix of
     STRING that begins at character number START.  For example,
     `substr("washington", 5)' returns `"ington"'.  The whole suffix is
     also returned if LENGTH is greater than the number of characters
     remaining in the string, counting from character START.

     If START is less than one, `substr()' treats it as if it was one.
     (POSIX doesn't specify what to do in this case: Brian Kernighan's
     `awk' acts this way, and therefore `gawk' does too.)  If START is
     greater than the number of characters in the string, `substr()'
     returns the null string.  Similarly, if LENGTH is present but less
     than or equal to zero, the null string is returned.

     The string returned by `substr()' _cannot_ be assigned.  Thus, it
     is a mistake to attempt to change a portion of a string, as shown
     in the following example:

          string = "abcdef"
          # try to get "abCDEf", won't work
          substr(string, 3, 3) = "CDE"

     It is also a mistake to use `substr()' as the third argument of
     `sub()' or `gsub()':

          gsub(/xyz/, "pdq", substr($0, 5, 20))  # WRONG

     (Some commercial versions of `awk' treat `substr()' as assignable,
     but doing so is not portable.)

     If you need to replace bits and pieces of a string, combine
     `substr()' with string concatenation, in the following manner:

          string = "abcdef"
          ...
          string = substr(string, 1, 2) "CDE" substr(string, 6)

`tolower(STRING)'
     Return a copy of STRING, with each uppercase character in the
     string replaced with its corresponding lowercase character.
     Nonalphabetic characters are left unchanged.  For example,
     `tolower("MiXeD cAsE 123")' returns `"mixed case 123"'.

`toupper(STRING)'
     Return a copy of STRING, with each lowercase character in the
     string replaced with its corresponding uppercase character.
     Nonalphabetic characters are left unchanged.  For example,
     `toupper("MiXeD cAsE 123")' returns `"MIXED CASE 123"'.

   ---------- Footnotes ----------

   (1) Unless you use the `--non-decimal-data' option, which isn't
recommended.  *Note Nondecimal Data::, for more information.

   (2) Note that this means that the record will first be regenerated
using the value of `OFS' if any fields have been changed, and that the
fields will be updated after the substitution, even if the operation is
a "no-op" such as `sub(/^/, "")'.

   (3) This is different from C and C++, in which the first character
is number zero.


File: gawk.info,  Node: Gory Details,  Up: String Functions

9.1.3.1 More About `\' and `&' with `sub()', `gsub()', and `gensub()'
.....................................................................

When using `sub()', `gsub()', or `gensub()', and trying to get literal
backslashes and ampersands into the replacement text, you need to
remember that there are several levels of "escape processing" going on.

   First, there is the "lexical" level, which is when `awk' reads your
program and builds an internal copy of it that can be executed.  Then
there is the runtime level, which is when `awk' actually scans the
replacement string to determine what to generate.

   At both levels, `awk' looks for a defined set of characters that can
come after a backslash.  At the lexical level, it looks for the escape
sequences listed in *note Escape Sequences::.  Thus, for every `\' that
`awk' processes at the runtime level, you must type two backslashes at
the lexical level.  When a character that is not valid for an escape
sequence follows the `\', Brian Kernighan's `awk' and `gawk' both
simply remove the initial `\' and put the next character into the
string. Thus, for example, `"a\qb"' is treated as `"aqb"'.

   At the runtime level, the various functions handle sequences of `\'
and `&' differently.  The situation is (sadly) somewhat complex.
Historically, the `sub()' and `gsub()' functions treated the two
character sequence `\&' specially; this sequence was replaced in the
generated text with a single `&'.  Any other `\' within the REPLACEMENT
string that did not precede an `&' was passed through unchanged.  This
is illustrated in *note table-sub-escapes::.

      You type         `sub()' sees          `sub()' generates
      -------         ---------          --------------
          `\&'              `&'            the matched text
         `\\&'             `\&'            a literal `&'
        `\\\&'             `\&'            a literal `&'
       `\\\\&'            `\\&'            a literal `\&'
      `\\\\\&'            `\\&'            a literal `\&'
     `\\\\\\&'           `\\\&'            a literal `\\&'
         `\\q'             `\q'            a literal `\q'

Table 9.1: Historical Escape Sequence Processing for `sub()' and
`gsub()'

This table shows both the lexical-level processing, where an odd number
of backslashes becomes an even number at the runtime level, as well as
the runtime processing done by `sub()'.  (For the sake of simplicity,
the rest of the following tables only show the case of even numbers of
backslashes entered at the lexical level.)

   The problem with the historical approach is that there is no way to
get a literal `\' followed by the matched text.

   The 1992 POSIX standard attempted to fix this problem. That standard
says that `sub()' and `gsub()' look for either a `\' or an `&' after
the `\'. If either one follows a `\', that character is output
literally.  The interpretation of `\' and `&' then becomes as shown in
*note table-sub-posix-92::.

      You type         `sub()' sees          `sub()' generates
      -------         ---------          --------------
           `&'              `&'            the matched text
         `\\&'             `\&'            a literal `&'
       `\\\\&'            `\\&'            a literal `\', then the matched text
     `\\\\\\&'           `\\\&'            a literal `\&'

Table 9.2: 1992 POSIX Rules for `sub()' and `gsub()' Escape Sequence
Processing

This appears to solve the problem.  Unfortunately, the phrasing of the
standard is unusual. It says, in effect, that `\' turns off the special
meaning of any following character, but for anything other than `\' and
`&', such special meaning is undefined.  This wording leads to two
problems:

   * Backslashes must now be doubled in the REPLACEMENT string, breaking
     historical `awk' programs.

   * To make sure that an `awk' program is portable, _every_ character
     in the REPLACEMENT string must be preceded with a backslash.(1)

   Because of the problems just listed, in 1996, the `gawk' maintainer
submitted proposed text for a revised standard that reverts to rules
that correspond more closely to the original existing practice. The
proposed rules have special cases that make it possible to produce a
`\' preceding the matched text. This is shown in *note
table-sub-proposed::.

      You type         `sub()' sees         `sub()' generates
      -------         ---------         --------------
     `\\\\\\&'           `\\\&'            a literal `\&'
       `\\\\&'            `\\&'            a literal `\', followed by the matched text
         `\\&'             `\&'            a literal `&'
         `\\q'             `\q'            a literal `\q'
        `\\\\'             `\\'            `\\'

Table 9.3: Proposed Rules For `sub()' And Backslash

   In a nutshell, at the runtime level, there are now three special
sequences of characters (`\\\&', `\\&' and `\&') whereas historically
there was only one.  However, as in the historical case, any `\' that
is not part of one of these three sequences is not special and appears
in the output literally.

   `gawk' 3.0 and 3.1 follow these proposed POSIX rules for `sub()' and
`gsub()'.  The POSIX standard took much longer to be revised than was
expected in 1996.  The 2001 standard does not follow the above rules.
Instead, the rules there are somewhat simpler.  The results are similar
except for one case.

   The POSIX rules state that `\&' in the replacement string produces a
literal `&', `\\' produces a literal `\', and `\' followed by anything
else is not special; the `\' is placed straight into the output.  These
rules are presented in *note table-posix-sub::.

      You type         `sub()' sees         `sub()' generates
      -------         ---------         --------------
     `\\\\\\&'           `\\\&'            a literal `\&'
       `\\\\&'            `\\&'            a literal `\', followed by the matched text
         `\\&'             `\&'            a literal `&'
         `\\q'             `\q'            a literal `\q'
        `\\\\'             `\\'            `\'

Table 9.4: POSIX Rules For `sub()' And `gsub()'

   The only case where the difference is noticeable is the last one:
`\\\\' is seen as `\\' and produces `\' instead of `\\'.

   Starting with version 3.1.4, `gawk' followed the POSIX rules when
`--posix' is specified (*note Options::). Otherwise, it continued to
follow the 1996 proposed rules, since that had been its behavior for
many years.

   When version 4.0.0 was released, the `gawk' maintainer made the
POSIX rules the default, breaking well over a decade's worth of
backwards compatibility.(2) Needless to say, this was a bad idea, and
as of version 4.0.1, `gawk' resumed its historical behavior, and only
follows the POSIX rules when `--posix' is given.

   The rules for `gensub()' are considerably simpler. At the runtime
level, whenever `gawk' sees a `\', if the following character is a
digit, then the text that matched the corresponding parenthesized
subexpression is placed in the generated output.  Otherwise, no matter
what character follows the `\', it appears in the generated text and
the `\' does not, as shown in *note table-gensub-escapes::.

       You type          `gensub()' sees         `gensub()' generates
       -------          ------------         -----------------
           `&'                    `&'            the matched text
         `\\&'                   `\&'            a literal `&'
        `\\\\'                   `\\'            a literal `\'
       `\\\\&'                  `\\&'            a literal `\', then the matched text
     `\\\\\\&'                 `\\\&'            a literal `\&'
         `\\q'                   `\q'            a literal `q'

Table 9.5: Escape Sequence Processing For `gensub()'

   Because of the complexity of the lexical and runtime level processing
and the special cases for `sub()' and `gsub()', we recommend the use of
`gawk' and `gensub()' when you have to do substitutions.

                       Matching the Null String

   In `awk', the `*' operator can match the null string.  This is
particularly important for the `sub()', `gsub()', and `gensub()'
functions.  For example:

     $ echo abc | awk '{ gsub(/m*/, "X"); print }'
     -| XaXbXcX

Although this makes a certain amount of sense, it can be surprising.

   ---------- Footnotes ----------

   (1) This consequence was certainly unintended.

   (2) This was rather naive of him, despite there being a note in this
section indicating that the next major version would move to the POSIX
rules.


File: gawk.info,  Node: I/O Functions,  Next: Time Functions,  Prev: String Functions,  Up: Built-in

9.1.4 Input/Output Functions
----------------------------

The following functions relate to input/output (I/O).  Optional
parameters are enclosed in square brackets ([ ]):

`close(FILENAME [, HOW])'
     Close the file FILENAME for input or output. Alternatively, the
     argument may be a shell command that was used for creating a
     coprocess, or for redirecting to or from a pipe; then the
     coprocess or pipe is closed.  *Note Close Files And Pipes::, for
     more information.

     When closing a coprocess, it is occasionally useful to first close
     one end of the two-way pipe and then to close the other.  This is
     done by providing a second argument to `close()'.  This second
     argument should be one of the two string values `"to"' or `"from"',
     indicating which end of the pipe to close.  Case in the string does
     not matter.  *Note Two-way I/O::, which discusses this feature in
     more detail and gives an example.

`fflush([FILENAME])'
     Flush any buffered output associated with FILENAME, which is
     either a file opened for writing or a shell command for
     redirecting output to a pipe or coprocess.

     Many utility programs "buffer" their output; i.e., they save
     information to write to a disk file or the screen in memory until
     there is enough for it to be worthwhile to send the data to the
     output device.  This is often more efficient than writing every
     little bit of information as soon as it is ready.  However,
     sometimes it is necessary to force a program to "flush" its
     buffers; that is, write the information to its destination, even
     if a buffer is not full.  This is the purpose of the `fflush()'
     function--`gawk' also buffers its output and the `fflush()'
     function forces `gawk' to flush its buffers.

     `fflush()' was added to Brian Kernighan's version of `awk' in 1994.
     For over two decades, it was not part of the POSIX standard.  As
     of December, 2012, it was accepted for inclusion into the POSIX
     standard.  See the Austin Group website
     (http://austingroupbugs.net/view.php?id=634).

     POSIX standardizes `fflush()' as follows: If there is no argument,
     or if the argument is the null string (`""'), then `awk' flushes
     the buffers for _all_ open output files and pipes.

          NOTE: Prior to version 4.0.2, `gawk' would flush only the
          standard output if there was no argument, and flush all
          output files and pipes if the argument was the null string.
          This was changed in order to be compatible with Brian
          Kernighan's `awk', in the hope that standardizing this
          feature in POSIX would then be easier (which indeed helped).

          With `gawk', you can use `fflush("/dev/stdout")' if you wish
          to flush only the standard output.

     `fflush()' returns zero if the buffer is successfully flushed;
     otherwise, it returns non-zero (`gawk' returns -1).  In the case
     where all buffers are flushed, the return value is zero only if
     all buffers were flushed successfully.  Otherwise, it is -1, and
     `gawk' warns about the problem FILENAME.

     `gawk' also issues a warning message if you attempt to flush a
     file or pipe that was opened for reading (such as with `getline'),
     or if FILENAME is not an open file, pipe, or coprocess.  In such a
     case, `fflush()' returns -1, as well.

`system(COMMAND)'
     Execute the operating-system command COMMAND and then return to
     the `awk' program.  Return COMMAND's exit status.

     For example, if the following fragment of code is put in your `awk'
     program:

          END {
               system("date | mail -s 'awk run done' root")
          }

     the system administrator is sent mail when the `awk' program
     finishes processing input and begins its end-of-input processing.

     Note that redirecting `print' or `printf' into a pipe is often
     enough to accomplish your task.  If you need to run many commands,
     it is more efficient to simply print them down a pipeline to the
     shell:

          while (MORE STUFF TO DO)
              print COMMAND | "/bin/sh"
          close("/bin/sh")

     However, if your `awk' program is interactive, `system()' is
     useful for running large self-contained programs, such as a shell
     or an editor.  Some operating systems cannot implement the
     `system()' function.  `system()' causes a fatal error if it is not
     supported.

          NOTE: When `--sandbox' is specified, the `system()' function
          is disabled (*note Options::).


              Interactive Versus Noninteractive Buffering

   As a side point, buffering issues can be even more confusing,
depending upon whether your program is "interactive", i.e.,
communicating with a user sitting at a keyboard.(1)

   Interactive programs generally "line buffer" their output; i.e., they
write out every line.  Noninteractive programs wait until they have a
full buffer, which may be many lines of output.  Here is an example of
the difference:

     $ awk '{ print $1 + $2 }'
     1 1
     -| 2
     2 3
     -| 5
     Ctrl-d

Each line of output is printed immediately. Compare that behavior with
this example:

     $ awk '{ print $1 + $2 }' | cat
     1 1
     2 3
     Ctrl-d
     -| 2
     -| 5

Here, no output is printed until after the `Ctrl-d' is typed, because
it is all buffered and sent down the pipe to `cat' in one shot.

             Controlling Output Buffering with `system()'

   The `fflush()' function provides explicit control over output
buffering for individual files and pipes.  However, its use is not
portable to many older `awk' implementations.  An alternative method to
flush output buffers is to call `system()' with a null string as its
argument:

     system("")   # flush output

`gawk' treats this use of the `system()' function as a special case and
is smart enough not to run a shell (or other command interpreter) with
the empty command.  Therefore, with `gawk', this idiom is not only
useful, it is also efficient.  While this method should work with other
`awk' implementations, it does not necessarily avoid starting an
unnecessary shell.  (Other implementations may only flush the buffer
associated with the standard output and not necessarily all buffered
output.)

   If you think about what a programmer expects, it makes sense that
`system()' should flush any pending output.  The following program:

     BEGIN {
          print "first print"
          system("echo system echo")
          print "second print"
     }

must print:

     first print
     system echo
     second print

and not:

     system echo
     first print
     second print

   If `awk' did not flush its buffers before calling `system()', you
would see the latter (undesirable) output.

   ---------- Footnotes ----------

   (1) A program is interactive if the standard output is connected to
a terminal device. On modern systems, this means your keyboard and
screen.


File: gawk.info,  Node: Time Functions,  Next: Bitwise Functions,  Prev: I/O Functions,  Up: Built-in

9.1.5 Time Functions
--------------------

`awk' programs are commonly used to process log files containing
timestamp information, indicating when a particular log record was
written.  Many programs log their timestamp in the form returned by the
`time()' system call, which is the number of seconds since a particular
epoch.  On POSIX-compliant systems, it is the number of seconds since
1970-01-01 00:00:00 UTC, not counting leap seconds.(1) All known
POSIX-compliant systems support timestamps from 0 through 2^31 - 1,
which is sufficient to represent times through 2038-01-19 03:14:07 UTC.
Many systems support a wider range of timestamps, including negative
timestamps that represent times before the epoch.

   In order to make it easier to process such log files and to produce
useful reports, `gawk' provides the following functions for working
with timestamps.  They are `gawk' extensions; they are not specified in
the POSIX standard.(2) However, recent versions of `mawk' (*note Other
Versions::) also support these functions.  Optional parameters are
enclosed in square brackets ([ ]):

`mktime(DATESPEC)'
     Turn DATESPEC into a timestamp in the same form as is returned by
     `systime()'.  It is similar to the function of the same name in
     ISO C.  The argument, DATESPEC, is a string of the form
     `"YYYY MM DD HH MM SS [DST]"'.  The string consists of six or
     seven numbers representing, respectively, the full year including
     century, the month from 1 to 12, the day of the month from 1 to
     31, the hour of the day from 0 to 23, the minute from 0 to 59, the
     second from 0 to 60,(3) and an optional daylight-savings flag.

     The values of these numbers need not be within the ranges
     specified; for example, an hour of -1 means 1 hour before midnight.
     The origin-zero Gregorian calendar is assumed, with year 0
     preceding year 1 and year -1 preceding year 0.  The time is
     assumed to be in the local timezone.  If the daylight-savings flag
     is positive, the time is assumed to be daylight savings time; if
     zero, the time is assumed to be standard time; and if negative
     (the default), `mktime()' attempts to determine whether daylight
     savings time is in effect for the specified time.

     If DATESPEC does not contain enough elements or if the resulting
     time is out of range, `mktime()' returns -1.

`strftime([FORMAT [, TIMESTAMP [, UTC-FLAG]]])'
     Format the time specified by TIMESTAMP based on the contents of
     the FORMAT string and return the result.  It is similar to the
     function of the same name in ISO C.  If UTC-FLAG is present and is
     either nonzero or non-null, the value is formatted as UTC
     (Coordinated Universal Time, formerly GMT or Greenwich Mean Time).
     Otherwise, the value is formatted for the local time zone.  The
     TIMESTAMP is in the same format as the value returned by the
     `systime()' function.  If no TIMESTAMP argument is supplied,
     `gawk' uses the current time of day as the timestamp.  If no
     FORMAT argument is supplied, `strftime()' uses the value of
     `PROCINFO["strftime"]' as the format string (*note Built-in
     Variables::).  The default string value is
     `"%a %b %e %H:%M:%S %Z %Y"'.  This format string produces output
     that is equivalent to that of the `date' utility.  You can assign
     a new value to `PROCINFO["strftime"]' to change the default format.

`systime()'
     Return the current time as the number of seconds since the system
     epoch.  On POSIX systems, this is the number of seconds since
     1970-01-01 00:00:00 UTC, not counting leap seconds.  It may be a
     different number on other systems.

   The `systime()' function allows you to compare a timestamp from a
log file with the current time of day.  In particular, it is easy to
determine how long ago a particular record was logged.  It also allows
you to produce log records using the "seconds since the epoch" format.

   The `mktime()' function allows you to convert a textual
representation of a date and time into a timestamp.   This makes it
easy to do before/after comparisons of dates and times, particularly
when dealing with date and time data coming from an external source,
such as a log file.

   The `strftime()' function allows you to easily turn a timestamp into
human-readable information.  It is similar in nature to the `sprintf()'
function (*note String Functions::), in that it copies nonformat
specification characters verbatim to the returned string, while
substituting date and time values for format specifications in the
FORMAT string.

   `strftime()' is guaranteed by the 1999 ISO C standard(4) to support
the following date format specifications:

`%a'
     The locale's abbreviated weekday name.

`%A'
     The locale's full weekday name.

`%b'
     The locale's abbreviated month name.

`%B'
     The locale's full month name.

`%c'
     The locale's "appropriate" date and time representation.  (This is
     `%A %B %d %T %Y' in the `"C"' locale.)

`%C'
     The century part of the current year.  This is the year divided by
     100 and truncated to the next lower integer.

`%d'
     The day of the month as a decimal number (01-31).

`%D'
     Equivalent to specifying `%m/%d/%y'.

`%e'
     The day of the month, padded with a space if it is only one digit.

`%F'
     Equivalent to specifying `%Y-%m-%d'.  This is the ISO 8601 date
     format.

`%g'
     The year modulo 100 of the ISO 8601 week number, as a decimal
     number (00-99).  For example, January 1, 1993 is in week 53 of
     1992. Thus, the year of its ISO 8601 week number is 1992, even
     though its year is 1993.  Similarly, December 31, 1973 is in week
     1 of 1974. Thus, the year of its ISO week number is 1974, even
     though its year is 1973.

`%G'
     The full year of the ISO week number, as a decimal number.

`%h'
     Equivalent to `%b'.

`%H'
     The hour (24-hour clock) as a decimal number (00-23).

`%I'
     The hour (12-hour clock) as a decimal number (01-12).

`%j'
     The day of the year as a decimal number (001-366).

`%m'
     The month as a decimal number (01-12).

`%M'
     The minute as a decimal number (00-59).

`%n'
     A newline character (ASCII LF).

`%p'
     The locale's equivalent of the AM/PM designations associated with
     a 12-hour clock.

`%r'
     The locale's 12-hour clock time.  (This is `%I:%M:%S %p' in the
     `"C"' locale.)

`%R'
     Equivalent to specifying `%H:%M'.

`%S'
     The second as a decimal number (00-60).

`%t'
     A TAB character.

`%T'
     Equivalent to specifying `%H:%M:%S'.

`%u'
     The weekday as a decimal number (1-7).  Monday is day one.

`%U'
     The week number of the year (the first Sunday as the first day of
     week one) as a decimal number (00-53).

`%V'
     The week number of the year (the first Monday as the first day of
     week one) as a decimal number (01-53).  The method for determining
     the week number is as specified by ISO 8601.  (To wit: if the week
     containing January 1 has four or more days in the new year, then
     it is week one; otherwise it is week 53 of the previous year and
     the next week is week one.)

`%w'
     The weekday as a decimal number (0-6).  Sunday is day zero.

`%W'
     The week number of the year (the first Monday as the first day of
     week one) as a decimal number (00-53).

`%x'
     The locale's "appropriate" date representation.  (This is `%A %B
     %d %Y' in the `"C"' locale.)

`%X'
     The locale's "appropriate" time representation.  (This is `%T' in
     the `"C"' locale.)

`%y'
     The year modulo 100 as a decimal number (00-99).

`%Y'
     The full year as a decimal number (e.g., 2011).

`%z'
     The timezone offset in a +HHMM format (e.g., the format necessary
     to produce RFC 822/RFC 1036 date headers).

`%Z'
     The time zone name or abbreviation; no characters if no time zone
     is determinable.

`%Ec %EC %Ex %EX %Ey %EY %Od %Oe %OH'
`%OI %Om %OM %OS %Ou %OU %OV %Ow %OW %Oy'
     "Alternate representations" for the specifications that use only
     the second letter (`%c', `%C', and so on).(5) (These facilitate
     compliance with the POSIX `date' utility.)

`%%'
     A literal `%'.

   If a conversion specifier is not one of the above, the behavior is
undefined.(6)

   Informally, a "locale" is the geographic place in which a program is
meant to run.  For example, a common way to abbreviate the date
September 4, 2012 in the United States is "9/4/12."  In many countries
in Europe, however, it is abbreviated "4.9.12."  Thus, the `%x'
specification in a `"US"' locale might produce `9/4/12', while in a
`"EUROPE"' locale, it might produce `4.9.12'.  The ISO C standard
defines a default `"C"' locale, which is an environment that is typical
of what many C programmers are used to.

   For systems that are not yet fully standards-compliant, `gawk'
supplies a copy of `strftime()' from the GNU C Library.  It supports
all of the just-listed format specifications.  If that version is used
to compile `gawk' (*note Installation::), then the following additional
format specifications are available:

`%k'
     The hour (24-hour clock) as a decimal number (0-23).  Single-digit
     numbers are padded with a space.

`%l'
     The hour (12-hour clock) as a decimal number (1-12).  Single-digit
     numbers are padded with a space.

`%s'
     The time as a decimal timestamp in seconds since the epoch.


   Additionally, the alternate representations are recognized but their
normal representations are used.

   The following example is an `awk' implementation of the POSIX `date'
utility.  Normally, the `date' utility prints the current date and time
of day in a well-known format.  However, if you provide an argument to
it that begins with a `+', `date' copies nonformat specifier characters
to the standard output and interprets the current time according to the
format specifiers in the string.  For example:

     $ date '+Today is %A, %B %d, %Y.'
     -| Today is Wednesday, March 30, 2011.

   Here is the `gawk' version of the `date' utility.  It has a shell
"wrapper" to handle the `-u' option, which requires that `date' run as
if the time zone is set to UTC:

     #! /bin/sh
     #
     # date --- approximate the POSIX 'date' command

     case $1 in
     -u)  TZ=UTC0     # use UTC
          export TZ
          shift ;;
     esac

     gawk 'BEGIN  {
         format = "%a %b %e %H:%M:%S %Z %Y"
         exitval = 0

         if (ARGC > 2)
             exitval = 1
         else if (ARGC == 2) {
             format = ARGV[1]
             if (format ~ /^\+/)
                 format = substr(format, 2)   # remove leading +
         }
         print strftime(format)
         exit exitval
     }' "$@"

   ---------- Footnotes ----------

   (1) *Note Glossary::, especially the entries "Epoch" and "UTC."

   (2) The GNU `date' utility can also do many of the things described
here.  Its use may be preferable for simple time-related operations in
shell scripts.

   (3) Occasionally there are minutes in a year with a leap second,
which is why the seconds can go up to 60.

   (4) Unfortunately, not every system's `strftime()' necessarily
supports all of the conversions listed here.

   (5) If you don't understand any of this, don't worry about it; these
facilities are meant to make it easier to "internationalize" programs.
Other internationalization features are described in *note
Internationalization::.

   (6) This is because ISO C leaves the behavior of the C version of
`strftime()' undefined and `gawk' uses the system's version of
`strftime()' if it's there.  Typically, the conversion specifier either
does not appear in the returned string or appears literally.


File: gawk.info,  Node: Bitwise Functions,  Next: Type Functions,  Prev: Time Functions,  Up: Built-in

9.1.6 Bit-Manipulation Functions
--------------------------------

     I can explain it for you, but I can't understand it for you.  --
     Anonymous

   Many languages provide the ability to perform "bitwise" operations
on two integer numbers.  In other words, the operation is performed on
each successive pair of bits in the operands.  Three common operations
are bitwise AND, OR, and XOR.  The operations are described in *note
table-bitwise-ops::.

                     Bit Operator
               |  AND  |   OR  |  XOR
               |--+--+--+--+--+--
     Operands  | 0 | 1 | 0 | 1 | 0 | 1
     ---------+--+--+--+--+--+--
         0     | 0   0 | 0   1 | 0   1
         1     | 0   1 | 1   1 | 1   0

Table 9.6: Bitwise Operations

   As you can see, the result of an AND operation is 1 only when _both_
bits are 1.  The result of an OR operation is 1 if _either_ bit is 1.
The result of an XOR operation is 1 if either bit is 1, but not both.
The next operation is the "complement"; the complement of 1 is 0 and
the complement of 0 is 1. Thus, this operation "flips" all the bits of
a given value.

   Finally, two other common operations are to shift the bits left or
right.  For example, if you have a bit string `10111001' and you shift
it right by three bits, you end up with `00010111'.(1) If you start over
again with `10111001' and shift it left by three bits, you end up with
`11001000'.  `gawk' provides built-in functions that implement the
bitwise operations just described. They are:

`and(V1, V2 [, ...])'
     Return the bitwise AND of the arguments. There must be at least
     two.

`compl(VAL)'
     Return the bitwise complement of VAL.

`lshift(VAL, COUNT)'
     Return the value of VAL, shifted left by COUNT bits.

`or(V1, V2 [, ...])'
     Return the bitwise OR of the arguments. There must be at least two.

`rshift(VAL, COUNT)'
     Return the value of VAL, shifted right by COUNT bits.

`xor(V1, V2 [, ...])'
     Return the bitwise XOR of the arguments. There must be at least
     two.

   For all of these functions, first the double precision
floating-point value is converted to the widest C unsigned integer
type, then the bitwise operation is performed.  If the result cannot be
represented exactly as a C `double', leading nonzero bits are removed
one by one until it can be represented exactly.  The result is then
converted back into a C `double'.  (If you don't understand this
paragraph, don't worry about it.)

   Here is a user-defined function (*note User-defined::) that
illustrates the use of these functions:

     # bits2str --- turn a byte into readable 1's and 0's

     function bits2str(bits,        data, mask)
     {
         if (bits == 0)
             return "0"

         mask = 1
         for (; bits != 0; bits = rshift(bits, 1))
             data = (and(bits, mask) ? "1" : "0") data

         while ((length(data) % 8) != 0)
             data = "0" data

         return data
     }

     BEGIN {
         printf "123 = %s\n", bits2str(123)
         printf "0123 = %s\n", bits2str(0123)
         printf "0x99 = %s\n", bits2str(0x99)
         comp = compl(0x99)
         printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp)
         shift = lshift(0x99, 2)
         printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
         shift = rshift(0x99, 2)
         printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
     }

This program produces the following output when run:

     $ gawk -f testbits.awk
     -| 123 = 01111011
     -| 0123 = 01010011
     -| 0x99 = 10011001
     -| compl(0x99) = 0xffffff66 = 11111111111111111111111101100110
     -| lshift(0x99, 2) = 0x264 = 0000001001100100
     -| rshift(0x99, 2) = 0x26 = 00100110

   The `bits2str()' function turns a binary number into a string.  The
number `1' represents a binary value where the rightmost bit is set to
1.  Using this mask, the function repeatedly checks the rightmost bit.
ANDing the mask with the value indicates whether the rightmost bit is 1
or not. If so, a `"1"' is concatenated onto the front of the string.
Otherwise, a `"0"' is added.  The value is then shifted right by one
bit and the loop continues until there are no more 1 bits.

   If the initial value is zero it returns a simple `"0"'.  Otherwise,
at the end, it pads the value with zeros to represent multiples of
8-bit quantities. This is typical in modern computers.

   The main code in the `BEGIN' rule shows the difference between the
decimal and octal values for the same numbers (*note
Nondecimal-numbers::), and then demonstrates the results of the
`compl()', `lshift()', and `rshift()' functions.

   ---------- Footnotes ----------

   (1) This example shows that 0's come in on the left side. For
`gawk', this is always true, but in some languages, it's possible to
have the left side fill with 1's. Caveat emptor.


File: gawk.info,  Node: Type Functions,  Next: I18N Functions,  Prev: Bitwise Functions,  Up: Built-in

9.1.7 Getting Type Information
------------------------------

`gawk' provides a single function that lets you distinguish an array
from a scalar variable.  This is necessary for writing code that
traverses every element of a true multidimensional array (*note Arrays
of Arrays::).

`isarray(X)'
     Return a true value if X is an array. Otherwise return false.

   `isarray()' is meant for use in two circumstances. The first is when
traversing a multidimensional array: you can test if an element is
itself an array or not.  The second is inside the body of a
user-defined function (not discussed yet; *note User-defined::), to
test if a paramater is an array or not.

   Note, however, that using `isarray()' at the global level to test
variables makes no sense. Since you are the one writing the program, you
are supposed to know if your variables are arrays or not. And in fact,
due to the way `gawk' works, if you pass the name of a variable that
has not been previously used to `isarray()', `gawk' will end up turning
it into a scalar.


File: gawk.info,  Node: I18N Functions,  Prev: Type Functions,  Up: Built-in

9.1.8 String-Translation Functions
----------------------------------

`gawk' provides facilities for internationalizing `awk' programs.
These include the functions described in the following list.  The
descriptions here are purposely brief.  *Note Internationalization::,
for the full story.  Optional parameters are enclosed in square
brackets ([ ]):

`bindtextdomain(DIRECTORY [, DOMAIN])'
     Set the directory in which `gawk' will look for message
     translation files, in case they will not or cannot be placed in
     the "standard" locations (e.g., during testing).  It returns the
     directory in which DOMAIN is "bound."

     The default DOMAIN is the value of `TEXTDOMAIN'.  If DIRECTORY is
     the null string (`""'), then `bindtextdomain()' returns the
     current binding for the given DOMAIN.

`dcgettext(STRING [, DOMAIN [, CATEGORY]])'
     Return the translation of STRING in text domain DOMAIN for locale
     category CATEGORY.  The default value for DOMAIN is the current
     value of `TEXTDOMAIN'.  The default value for CATEGORY is
     `"LC_MESSAGES"'.

`dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])'
     Return the plural form used for NUMBER of the translation of
     STRING1 and STRING2 in text domain DOMAIN for locale category
     CATEGORY. STRING1 is the English singular variant of a message,
     and STRING2 the English plural variant of the same message.  The
     default value for DOMAIN is the current value of `TEXTDOMAIN'.
     The default value for CATEGORY is `"LC_MESSAGES"'.


File: gawk.info,  Node: User-defined,  Next: Indirect Calls,  Prev: Built-in,  Up: Functions

9.2 User-Defined Functions
==========================

Complicated `awk' programs can often be simplified by defining your own
functions.  User-defined functions can be called just like built-in
ones (*note Function Calls::), but it is up to you to define them,
i.e., to tell `awk' what they should do.

* Menu:

* Definition Syntax::           How to write definitions and what they mean.
* Function Example::            An example function definition and what it
                                does.
* Function Caveats::            Things to watch out for.
* Return Statement::            Specifying the value a function returns.
* Dynamic Typing::              How variable types can change at runtime.


File: gawk.info,  Node: Definition Syntax,  Next: Function Example,  Up: User-defined

9.2.1 Function Definition Syntax
--------------------------------

Definitions of functions can appear anywhere between the rules of an
`awk' program.  Thus, the general form of an `awk' program is extended
to include sequences of rules _and_ user-defined function definitions.
There is no need to put the definition of a function before all uses of
the function.  This is because `awk' reads the entire program before
starting to execute any of it.

   The definition of a function named NAME looks like this:

     function NAME([PARAMETER-LIST])
     {
          BODY-OF-FUNCTION
     }

Here, NAME is the name of the function to define.  A valid function
name is like a valid variable name: a sequence of letters, digits, and
underscores that doesn't start with a digit.  Within a single `awk'
program, any particular name can only be used as a variable, array, or
function.

   PARAMETER-LIST is an optional list of the function's arguments and
local variable names, separated by commas.  When the function is called,
the argument names are used to hold the argument values given in the
call.  The local variables are initialized to the empty string.  A
function cannot have two parameters with the same name, nor may it have
a parameter with the same name as the function itself.

   In addition, according to the POSIX standard, function parameters
cannot have the same name as one of the special built-in variables
(*note Built-in Variables::.  Not all versions of `awk' enforce this
restriction.

   The BODY-OF-FUNCTION consists of `awk' statements.  It is the most
important part of the definition, because it says what the function
should actually _do_.  The argument names exist to give the body a way
to talk about the arguments; local variables exist to give the body
places to keep temporary values.

   Argument names are not distinguished syntactically from local
variable names. Instead, the number of arguments supplied when the
function is called determines how many argument variables there are.
Thus, if three argument values are given, the first three names in
PARAMETER-LIST are arguments and the rest are local variables.

   It follows that if the number of arguments is not the same in all
calls to the function, some of the names in PARAMETER-LIST may be
arguments on some occasions and local variables on others.  Another way
to think of this is that omitted arguments default to the null string.

   Usually when you write a function, you know how many names you
intend to use for arguments and how many you intend to use as local
variables.  It is conventional to place some extra space between the
arguments and the local variables, in order to document how your
function is supposed to be used.

   During execution of the function body, the arguments and local
variable values hide, or "shadow", any variables of the same names used
in the rest of the program.  The shadowed variables are not accessible
in the function definition, because there is no way to name them while
their names have been taken away for the local variables.  All other
variables used in the `awk' program can be referenced or set normally
in the function's body.

   The arguments and local variables last only as long as the function
body is executing.  Once the body finishes, you can once again access
the variables that were shadowed while the function was running.

   The function body can contain expressions that call functions.  They
can even call this function, either directly or by way of another
function.  When this happens, we say the function is "recursive".  The
act of a function calling itself is called "recursion".

   All the built-in functions return a value to their caller.
User-defined functions can do also, using the `return' statement, which
is described in detail in *note Return Statement::.  Many of the
subsequent examples in this minor node use the `return' statement.

   In many `awk' implementations, including `gawk', the keyword
`function' may be abbreviated `func'. (c.e.)  However, POSIX only
specifies the use of the keyword `function'.  This actually has some
practical implications.  If `gawk' is in POSIX-compatibility mode
(*note Options::), then the following statement does _not_ define a
function:

     func foo() { a = sqrt($1) ; print a }

Instead it defines a rule that, for each record, concatenates the value
of the variable `func' with the return value of the function `foo'.  If
the resulting string is non-null, the action is executed.  This is
probably not what is desired.  (`awk' accepts this input as
syntactically valid, because functions may be used before they are
defined in `awk' programs.(1))

   To ensure that your `awk' programs are portable, always use the
keyword `function' when defining a function.

   ---------- Footnotes ----------

   (1) This program won't actually run, since `foo()' is undefined.


File: gawk.info,  Node: Function Example,  Next: Function Caveats,  Prev: Definition Syntax,  Up: User-defined

9.2.2 Function Definition Examples
----------------------------------

Here is an example of a user-defined function, called `myprint()', that
takes a number and prints it in a specific format:

     function myprint(num)
     {
          printf "%6.3g\n", num
     }

To illustrate, here is an `awk' rule that uses our `myprint' function:

     $3 > 0     { myprint($3) }

This program prints, in our special format, all the third fields that
contain a positive number in our input.  Therefore, when given the
following input:

      1.2   3.4    5.6   7.8
      9.10 11.12 -13.14 15.16
     17.18 19.20  21.22 23.24

this program, using our function to format the results, prints:

        5.6
       21.2

   This function deletes all the elements in an array:

     function delarray(a,    i)
     {
         for (i in a)
            delete a[i]
     }

   When working with arrays, it is often necessary to delete all the
elements in an array and start over with a new list of elements (*note
Delete::).  Instead of having to repeat this loop everywhere that you
need to clear out an array, your program can just call `delarray'.
(This guarantees portability.  The use of `delete ARRAY' to delete the
contents of an entire array is a nonstandard extension.)

   The following is an example of a recursive function.  It takes a
string as an input parameter and returns the string in backwards order.
Recursive functions must always have a test that stops the recursion.
In this case, the recursion terminates when the starting position is
zero, i.e., when there are no more characters left in the string.

     function rev(str, start)
     {
         if (start == 0)
             return ""

         return (substr(str, start, 1) rev(str, start - 1))
     }

   If this function is in a file named `rev.awk', it can be tested this
way:

     $ echo "Don't Panic!" |
     > gawk --source '{ print rev($0, length($0)) }' -f rev.awk
     -| !cinaP t'noD

   The C `ctime()' function takes a timestamp and returns it in a
string, formatted in a well-known fashion.  The following example uses
the built-in `strftime()' function (*note Time Functions::) to create
an `awk' version of `ctime()':

     # ctime.awk
     #
     # awk version of C ctime(3) function

     function ctime(ts,    format)
     {
         format = "%a %b %e %H:%M:%S %Z %Y"
         if (ts == 0)
             ts = systime()       # use current time as default
         return strftime(format, ts)
     }


File: gawk.info,  Node: Function Caveats,  Next: Return Statement,  Prev: Function Example,  Up: User-defined

9.2.3 Calling User-Defined Functions
------------------------------------

This section describes how to call a user-defined function.

* Menu:

* Calling A Function::          Don't use spaces.
* Variable Scope::              Controlling variable scope.
* Pass By Value/Reference::     Passing parameters.


File: gawk.info,  Node: Calling A Function,  Next: Variable Scope,  Up: Function Caveats

9.2.3.1 Writing A Function Call
...............................

"Calling a function" means causing the function to run and do its job.
A function call is an expression and its value is the value returned by
the function.

   A function call consists of the function name followed by the
arguments in parentheses.  `awk' expressions are what you write in the
call for the arguments.  Each time the call is executed, these
expressions are evaluated, and the values become the actual arguments.
For example, here is a call to `foo()' with three arguments (the first
being a string concatenation):

     foo(x y, "lose", 4 * z)

     CAUTION: Whitespace characters (spaces and TABs) are not allowed
     between the function name and the open-parenthesis of the argument
     list.  If you write whitespace by mistake, `awk' might think that
     you mean to concatenate a variable with an expression in
     parentheses.  However, it notices that you used a function name
     and not a variable name, and reports an error.


File: gawk.info,  Node: Variable Scope,  Next: Pass By Value/Reference,  Prev: Calling A Function,  Up: Function Caveats

9.2.3.2 Controlling Variable Scope
..................................

There is no way to make a variable local to a `{ ... }' block in `awk',
but you can make a variable local to a function. It is good practice to
do so whenever a variable is needed only in that function.

   To make a variable local to a function, simply declare the variable
as an argument after the actual function arguments (*note Definition
Syntax::).  Look at the following example where variable `i' is a
global variable used by both functions `foo()' and `bar()':

     function bar()
     {
         for (i = 0; i < 3; i++)
             print "bar's i=" i
     }

     function foo(j)
     {
         i = j + 1
         print "foo's i=" i
         bar()
         print "foo's i=" i
     }

     BEGIN {
           i = 10
           print "top's i=" i
           foo(0)
           print "top's i=" i
     }

   Running this script produces the following, because the `i' in
functions `foo()' and `bar()' and at the top level refer to the same
variable instance:

     top's i=10
     foo's i=1
     bar's i=0
     bar's i=1
     bar's i=2
     foo's i=3
     top's i=3

   If you want `i' to be local to both `foo()' and `bar()' do as
follows (the extra-space before `i' is a coding convention to indicate
that `i' is a local variable, not an argument):

     function bar(    i)
     {
         for (i = 0; i < 3; i++)
             print "bar's i=" i
     }

     function foo(j,    i)
     {
         i = j + 1
         print "foo's i=" i
         bar()
         print "foo's i=" i
     }

     BEGIN {
           i = 10
           print "top's i=" i
           foo(0)
           print "top's i=" i
     }

   Running the corrected script produces the following:

     top's i=10
     foo's i=1
     bar's i=0
     bar's i=1
     bar's i=2
     foo's i=1
     top's i=10

   Besides scalar values (strings and numbers), you may also have local
arrays.  By using a parameter name as an array, `awk' treats it as an
array, and it is local to the function.  In addition, recursive calls
create new arrays.  Consider this example:

     function some_func(p1,      a)
     {
         if (p1++ > 3)
             return

         a[p1] = p1

         some_func(p1)

         printf("At level %d, index %d %s found in a\n",
              p1, (p1 - 1), (p1 - 1) in a ? "is" : "is not")
         printf("At level %d, index %d %s found in a\n",
              p1, p1, p1 in a ? "is" : "is not")
         print ""
     }

     BEGIN {
         some_func(1)
     }

   When run, this program produces the following output:

     At level 4, index 3 is not found in a
     At level 4, index 4 is found in a

     At level 3, index 2 is not found in a
     At level 3, index 3 is found in a

     At level 2, index 1 is not found in a
     At level 2, index 2 is found in a


File: gawk.info,  Node: Pass By Value/Reference,  Prev: Variable Scope,  Up: Function Caveats

9.2.3.3 Passing Function Arguments By Value Or By Reference
...........................................................

In `awk', when you declare a function, there is no way to declare
explicitly whether the arguments are passed "by value" or "by
reference".

   Instead the passing convention is determined at runtime when the
function is called according to the following rule:

   * If the argument is an array variable, then it is passed by
     reference,

   * Otherwise the argument is passed by value.

   Passing an argument by value means that when a function is called, it
is given a _copy_ of the value of this argument.  The caller may use a
variable as the expression for the argument, but the called function
does not know this--it only knows what value the argument had.  For
example, if you write the following code:

     foo = "bar"
     z = myfunc(foo)

then you should not think of the argument to `myfunc()' as being "the
variable `foo'."  Instead, think of the argument as the string value
`"bar"'.  If the function `myfunc()' alters the values of its local
variables, this has no effect on any other variables.  Thus, if
`myfunc()' does this:

     function myfunc(str)
     {
        print str
        str = "zzz"
        print str
     }

to change its first argument variable `str', it does _not_ change the
value of `foo' in the caller.  The role of `foo' in calling `myfunc()'
ended when its value (`"bar"') was computed.  If `str' also exists
outside of `myfunc()', the function body cannot alter this outer value,
because it is shadowed during the execution of `myfunc()' and cannot be
seen or changed from there.

   However, when arrays are the parameters to functions, they are _not_
copied.  Instead, the array itself is made available for direct
manipulation by the function.  This is usually termed "call by
reference".  Changes made to an array parameter inside the body of a
function _are_ visible outside that function.

     NOTE: Changing an array parameter inside a function can be very
     dangerous if you do not watch what you are doing.  For example:

          function changeit(array, ind, nvalue)
          {
               array[ind] = nvalue
          }

          BEGIN {
              a[1] = 1; a[2] = 2; a[3] = 3
              changeit(a, 2, "two")
              printf "a[1] = %s, a[2] = %s, a[3] = %s\n",
                      a[1], a[2], a[3]
          }

     prints `a[1] = 1, a[2] = two, a[3] = 3', because `changeit' stores
     `"two"' in the second element of `a'.

   Some `awk' implementations allow you to call a function that has not
been defined. They only report a problem at runtime when the program
actually tries to call the function. For example:

     BEGIN {
         if (0)
             foo()
         else
             bar()
     }
     function bar() { ... }
     # note that `foo' is not defined

Because the `if' statement will never be true, it is not really a
problem that `foo()' has not been defined.  Usually, though, it is a
problem if a program calls an undefined function.

   If `--lint' is specified (*note Options::), `gawk' reports calls to
undefined functions.

   Some `awk' implementations generate a runtime error if you use
either the `next' statement or the `nextfile' statement (*note Next
Statement::, also *note Nextfile Statement::) inside a user-defined
function.  `gawk' does not have this limitation.


File: gawk.info,  Node: Return Statement,  Next: Dynamic Typing,  Prev: Function Caveats,  Up: User-defined

9.2.4 The `return' Statement
----------------------------

As seen in several earlier examples, the body of a user-defined
function can contain a `return' statement.  This statement returns
control to the calling part of the `awk' program.  It can also be used
to return a value for use in the rest of the `awk' program.  It looks
like this:

     return [EXPRESSION]

   The EXPRESSION part is optional.  Due most likely to an oversight,
POSIX does not define what the return value is if you omit the
EXPRESSION.  Technically speaking, this make the returned value
undefined, and therefore, unpredictable.  In practice, though, all
versions of `awk' simply return the null string, which acts like zero
if used in a numeric context.

   A `return' statement with no value expression is assumed at the end
of every function definition.  So if control reaches the end of the
function body, then technically, the function returns an unpredictable
value.  In practice, it returns the empty string.  `awk' does _not_
warn you if you use the return value of such a function.

   Sometimes, you want to write a function for what it does, not for
what it returns.  Such a function corresponds to a `void' function in
C, C++ or Java, or to a `procedure' in Ada.  Thus, it may be
appropriate to not return any value; simply bear in mind that you
should not be using the return value of such a function.

   The following is an example of a user-defined function that returns
a value for the largest number among the elements of an array:

     function maxelt(vec,   i, ret)
     {
          for (i in vec) {
               if (ret == "" || vec[i] > ret)
                    ret = vec[i]
          }
          return ret
     }

You call `maxelt()' with one argument, which is an array name.  The
local variables `i' and `ret' are not intended to be arguments; while
there is nothing to stop you from passing more than one argument to
`maxelt()', the results would be strange.  The extra space before `i'
in the function parameter list indicates that `i' and `ret' are local
variables.  You should follow this convention when defining functions.

   The following program uses the `maxelt()' function.  It loads an
array, calls `maxelt()', and then reports the maximum number in that
array:

     function maxelt(vec,   i, ret)
     {
          for (i in vec) {
               if (ret == "" || vec[i] > ret)
                    ret = vec[i]
          }
          return ret
     }

     # Load all fields of each record into nums.
     {
          for(i = 1; i <= NF; i++)
               nums[NR, i] = $i
     }

     END {
          print maxelt(nums)
     }

   Given the following input:

      1 5 23 8 16
     44 3 5 2 8 26
     256 291 1396 2962 100
     -6 467 998 1101
     99385 11 0 225

the program reports (predictably) that 99,385 is the largest value in
the array.


File: gawk.info,  Node: Dynamic Typing,  Prev: Return Statement,  Up: User-defined

9.2.5 Functions and Their Effects on Variable Typing
----------------------------------------------------

`awk' is a very fluid language.  It is possible that `awk' can't tell
if an identifier represents a scalar variable or an array until runtime.
Here is an annotated sample program:

     function foo(a)
     {
         a[1] = 1   # parameter is an array
     }

     BEGIN {
         b = 1
         foo(b)  # invalid: fatal type mismatch

         foo(x)  # x uninitialized, becomes an array dynamically
         x = 1   # now not allowed, runtime error
     }

   In this example, the first call to `foo()' generates a fatal error,
so `gawk' will not report the second error. If you comment out that
call, though, then `gawk' will report the second error.

   Usually, such things aren't a big issue, but it's worth being aware
of them.


File: gawk.info,  Node: Indirect Calls,  Prev: User-defined,  Up: Functions

9.3 Indirect Function Calls
===========================

This section describes a `gawk'-specific extension.

   Often, you may wish to defer the choice of function to call until
runtime.  For example, you may have different kinds of records, each of
which should be processed differently.

   Normally, you would have to use a series of `if'-`else' statements
to decide which function to call.  By using "indirect" function calls,
you can specify the name of the function to call as a string variable,
and then call the function.  Let's look at an example.

   Suppose you have a file with your test scores for the classes you
are taking.  The first field is the class name. The following fields
are the functions to call to process the data, up to a "marker" field
`data:'.  Following the marker, to the end of the record, are the
various numeric test scores.

   Here is the initial file; you wish to get the sum and the average of
your test scores:

     Biology_101 sum average data: 87.0 92.4 78.5 94.9
     Chemistry_305 sum average data: 75.2 98.3 94.7 88.2
     English_401 sum average data: 100.0 95.6 87.1 93.4

   To process the data, you might write initially:

     {
         class = $1
         for (i = 2; $i != "data:"; i++) {
             if ($i == "sum")
                 sum()   # processes the whole record
             else if ($i == "average")
                 average()
             ...           # and so on
         }
     }

This style of programming works, but can be awkward.  With "indirect"
function calls, you tell `gawk' to use the _value_ of a variable as the
name of the function to call.

   The syntax is similar to that of a regular function call: an
identifier immediately followed by a left parenthesis, any arguments,
and then a closing right parenthesis, with the addition of a leading `@'
character:

     the_func = "sum"
     result = @the_func()   # calls the `sum' function

   Here is a full program that processes the previously shown data,
using indirect function calls.

     # indirectcall.awk --- Demonstrate indirect function calls

     # average --- return the average of the values in fields $first - $last

     function average(first, last,   sum, i)
     {
         sum = 0;
         for (i = first; i <= last; i++)
             sum += $i

         return sum / (last - first + 1)
     }

     # sum --- return the sum of the values in fields $first - $last

     function sum(first, last,   ret, i)
     {
         ret = 0;
         for (i = first; i <= last; i++)
             ret += $i

         return ret
     }

   These two functions expect to work on fields; thus the parameters
`first' and `last' indicate where in the fields to start and end.
Otherwise they perform the expected computations and are not unusual.

     # For each record, print the class name and the requested statistics

     {
         class_name = $1
         gsub(/_/, " ", class_name)  # Replace _ with spaces

         # find start
         for (i = 1; i <= NF; i++) {
             if ($i == "data:") {
                 start = i + 1
                 break
             }
         }

         printf("%s:\n", class_name)
         for (i = 2; $i != "data:"; i++) {
             the_function = $i
             printf("\t%s: <%s>\n", $i, @the_function(start, NF) "")
         }
         print ""
     }

   This is the main processing for each record. It prints the class
name (with underscores replaced with spaces). It then finds the start
of the actual data, saving it in `start'.  The last part of the code
loops through each function name (from `$2' up to the marker, `data:'),
calling the function named by the field. The indirect function call
itself occurs as a parameter in the call to `printf'.  (The `printf'
format string uses `%s' as the format specifier so that we can use
functions that return strings, as well as numbers. Note that the result
from the indirect call is concatenated with the empty string, in order
to force it to be a string value.)

   Here is the result of running the program:

     $ gawk -f indirectcall.awk class_data1
     -| Biology 101:
     -|     sum: <352.8>
     -|     average: <88.2>
     -|
     -| Chemistry 305:
     -|     sum: <356.4>
     -|     average: <89.1>
     -|
     -| English 401:
     -|     sum: <376.1>
     -|     average: <94.025>

   The ability to use indirect function calls is more powerful than you
may think at first.  The C and C++ languages provide "function
pointers," which are a mechanism for calling a function chosen at
runtime.  One of the most well-known uses of this ability is the C
`qsort()' function, which sorts an array using the famous "quick sort"
algorithm (see the Wikipedia article
(http://en.wikipedia.org/wiki/Quick_sort) for more information).  To
use this function, you supply a pointer to a comparison function.  This
mechanism allows you to sort arbitrary data in an arbitrary fashion.

   We can do something similar using `gawk', like this:

     # quicksort.awk --- Quicksort algorithm, with user-supplied
     #                   comparison function
     # quicksort --- C.A.R. Hoare's quick sort algorithm. See Wikipedia
     #               or almost any algorithms or computer science text

     function quicksort(data, left, right, less_than,    i, last)
     {
         if (left >= right)  # do nothing if array contains fewer
             return          # than two elements

         quicksort_swap(data, left, int((left + right) / 2))
         last = left
         for (i = left + 1; i <= right; i++)
             if (@less_than(data[i], data[left]))
                 quicksort_swap(data, ++last, i)
         quicksort_swap(data, left, last)
         quicksort(data, left, last - 1, less_than)
         quicksort(data, last + 1, right, less_than)
     }

     # quicksort_swap --- helper function for quicksort, should really be inline

     function quicksort_swap(data, i, j, temp)
     {
         temp = data[i]
         data[i] = data[j]
         data[j] = temp
     }

   The `quicksort()' function receives the `data' array, the starting
and ending indices to sort (`left' and `right'), and the name of a
function that performs a "less than" comparison.  It then implements
the quick sort algorithm.

   To make use of the sorting function, we return to our previous
example. The first thing to do is write some comparison functions:

     # num_lt --- do a numeric less than comparison

     function num_lt(left, right)
     {
         return ((left + 0) < (right + 0))
     }

     # num_ge --- do a numeric greater than or equal to comparison

     function num_ge(left, right)
     {
         return ((left + 0) >= (right + 0))
     }

   The `num_ge()' function is needed to perform a descending sort; when
used to perform a "less than" test, it actually does the opposite
(greater than or equal to), which yields data sorted in descending
order.

   Next comes a sorting function.  It is parameterized with the
starting and ending field numbers and the comparison function. It
builds an array with the data and calls `quicksort' appropriately, and
then formats the results as a single string:

     # do_sort --- sort the data according to `compare'
     #             and return it as a string

     function do_sort(first, last, compare,      data, i, retval)
     {
         delete data
         for (i = 1; first <= last; first++) {
             data[i] = $first
             i++
         }

         quicksort(data, 1, i-1, compare)

         retval = data[1]
         for (i = 2; i in data; i++)
             retval = retval " " data[i]

         return retval
     }

   Finally, the two sorting functions call `do_sort()', passing in the
names of the two comparison functions:

     # sort --- sort the data in ascending order and return it as a string

     function sort(first, last)
     {
         return do_sort(first, last, "num_lt")
     }

     # rsort --- sort the data in descending order and return it as a string

     function rsort(first, last)
     {
         return do_sort(first, last, "num_ge")
     }

   Here is an extended version of the data file:

     Biology_101 sum average sort rsort data: 87.0 92.4 78.5 94.9
     Chemistry_305 sum average sort rsort data: 75.2 98.3 94.7 88.2
     English_401 sum average sort rsort data: 100.0 95.6 87.1 93.4

   Finally, here are the results when the enhanced program is run:

     $ gawk -f quicksort.awk -f indirectcall.awk class_data2
     -| Biology 101:
     -|     sum: <352.8>
     -|     average: <88.2>
     -|     sort: <78.5 87.0 92.4 94.9>
     -|     rsort: <94.9 92.4 87.0 78.5>
     -|
     -| Chemistry 305:
     -|     sum: <356.4>
     -|     average: <89.1>
     -|     sort: <75.2 88.2 94.7 98.3>
     -|     rsort: <98.3 94.7 88.2 75.2>
     -|
     -| English 401:
     -|     sum: <376.1>
     -|     average: <94.025>
     -|     sort: <87.1 93.4 95.6 100.0>
     -|     rsort: <100.0 95.6 93.4 87.1>

   Remember that you must supply a leading `@' in front of an indirect
function call.

   Unfortunately, indirect function calls cannot be used with the
built-in functions.  However, you can generally write "wrapper"
functions which call the built-in ones, and those can be called
indirectly. (Other than, perhaps, the mathematical functions, there is
not a lot of reason to try to call the built-in functions indirectly.)

   `gawk' does its best to make indirect function calls efficient.  For
example, in the following case:

     for (i = 1; i <= n; i++)
         @the_func()

`gawk' will look up the actual function to call only once.


File: gawk.info,  Node: Library Functions,  Next: Sample Programs,  Prev: Functions,  Up: Top

10 A Library of `awk' Functions
*******************************

*note User-defined::, describes how to write your own `awk' functions.
Writing functions is important, because it allows you to encapsulate
algorithms and program tasks in a single place.  It simplifies
programming, making program development more manageable, and making
programs more readable.

   In their seminal 1976 book, `Software Tools',(1) Brian Kernighan and
P.J. Plauger wrote:

     Good Programming is not learned from generalities, but by seeing
     how significant programs can be made clean, easy to read, easy to
     maintain and modify, human-engineered, efficient and reliable, by
     the application of common sense and good programming practices.
     Careful study and imitation of good programs leads to better
     writing.

   In fact, they felt this idea was so important that they placed this
statement on the cover of their book.  Because we believe strongly that
their statement is correct, this major node and *note Sample
Programs::, provide a good-sized body of code for you to read, and we
hope, to learn from.

   This major node presents a library of useful `awk' functions.  Many
of the sample programs presented later in this Info file use these
functions.  The functions are presented here in a progression from
simple to complex.

   *note Extract Program::, presents a program that you can use to
extract the source code for these example library functions and
programs from the Texinfo source for this Info file.  (This has already
been done as part of the `gawk' distribution.)

   If you have written one or more useful, general-purpose `awk'
functions and would like to contribute them to the `awk' user
community, see *note How To Contribute::, for more information.

   The programs in this major node and in *note Sample Programs::,
freely use features that are `gawk'-specific.  Rewriting these programs
for different implementations of `awk' is pretty straightforward.

   * Diagnostic error messages are sent to `/dev/stderr'.  Use `| "cat
     1>&2"' instead of `> "/dev/stderr"' if your system does not have a
     `/dev/stderr', or if you cannot use `gawk'.

   * A number of programs use `nextfile' (*note Nextfile Statement::)
     to skip any remaining input in the input file.

   * Finally, some of the programs choose to ignore upper- and lowercase
     distinctions in their input. They do so by assigning one to
     `IGNORECASE'.  You can achieve almost the same effect(2) by adding
     the following rule to the beginning of the program:

          # ignore case
          { $0 = tolower($0) }

     Also, verify that all regexp and string constants used in
     comparisons use only lowercase letters.

* Menu:

* Library Names::               How to best name private global variables in
                                library functions.
* General Functions::           Functions that are of general use.
* Data File Management::        Functions for managing command-line data
                                files.
* Getopt Function::             A function for processing command-line
                                arguments.
* Passwd Functions::            Functions for getting user information.
* Group Functions::             Functions for getting group information.
* Walking Arrays::              A function to walk arrays of arrays.

   ---------- Footnotes ----------

   (1) Sadly, over 35 years later, many of the lessons taught by this
book have yet to be learned by a vast number of practicing programmers.

   (2) The effects are not identical.  Output of the transformed record
will be in all lowercase, while `IGNORECASE' preserves the original
contents of the input record.


File: gawk.info,  Node: Library Names,  Next: General Functions,  Up: Library Functions

10.1 Naming Library Function Global Variables
=============================================

Due to the way the `awk' language evolved, variables are either
"global" (usable by the entire program) or "local" (usable just by a
specific function).  There is no intermediate state analogous to
`static' variables in C.

   Library functions often need to have global variables that they can
use to preserve state information between calls to the function--for
example, `getopt()''s variable `_opti' (*note Getopt Function::).  Such
variables are called "private", since the only functions that need to
use them are the ones in the library.

   When writing a library function, you should try to choose names for
your private variables that will not conflict with any variables used by
either another library function or a user's main program.  For example,
a name like `i' or `j' is not a good choice, because user programs
often use variable names like these for their own purposes.

   The example programs shown in this major node all start the names of
their private variables with an underscore (`_').  Users generally
don't use leading underscores in their variable names, so this
convention immediately decreases the chances that the variable name
will be accidentally shared with the user's program.

   In addition, several of the library functions use a prefix that helps
indicate what function or set of functions use the variables--for
example, `_pw_byname' in the user database routines (*note Passwd
Functions::).  This convention is recommended, since it even further
decreases the chance of inadvertent conflict among variable names.
Note that this convention is used equally well for variable names and
for private function names.(1)

   As a final note on variable naming, if a function makes global
variables available for use by a main program, it is a good convention
to start that variable's name with a capital letter--for example,
`getopt()''s `Opterr' and `Optind' variables (*note Getopt Function::).
The leading capital letter indicates that it is global, while the fact
that the variable name is not all capital letters indicates that the
variable is not one of `awk''s built-in variables, such as `FS'.

   It is also important that _all_ variables in library functions that
do not need to save state are, in fact, declared local.(2) If this is
not done, the variable could accidentally be used in the user's
program, leading to bugs that are very difficult to track down:

     function lib_func(x, y,    l1, l2)
     {
         ...
         USE VARIABLE some_var   # some_var should be local
         ...                     # but is not by oversight
     }

   A different convention, common in the Tcl community, is to use a
single associative array to hold the values needed by the library
function(s), or "package."  This significantly decreases the number of
actual global names in use.  For example, the functions described in
*note Passwd Functions::, might have used array elements
`PW_data["inited"]', `PW_data["total"]', `PW_data["count"]', and
`PW_data["awklib"]', instead of `_pw_inited', `_pw_awklib', `_pw_total',
and `_pw_count'.

   The conventions presented in this minor node are exactly that:
conventions. You are not required to write your programs this way--we
merely recommend that you do so.

   ---------- Footnotes ----------

   (1) While all the library routines could have been rewritten to use
this convention, this was not done, in order to show how our own `awk'
programming style has evolved and to provide some basis for this
discussion.

   (2) `gawk''s `--dump-variables' command-line option is useful for
verifying this.


File: gawk.info,  Node: General Functions,  Next: Data File Management,  Prev: Library Names,  Up: Library Functions

10.2 General Programming
========================

This minor node presents a number of functions that are of general
programming use.

* Menu:

* Strtonum Function::           A replacement for the built-in
                                `strtonum()' function.
* Assert Function::             A function for assertions in `awk'
                                programs.
* Round Function::              A function for rounding if `sprintf()'
                                does not do it correctly.
* Cliff Random Function::       The Cliff Random Number Generator.
* Ordinal Functions::           Functions for using characters as numbers and
                                vice versa.
* Join Function::               A function to join an array into a string.
* Getlocaltime Function::       A function to get formatted times.
* Readfile Function::           A function to read an entire file at once.


File: gawk.info,  Node: Strtonum Function,  Next: Assert Function,  Up: General Functions

10.2.1 Converting Strings To Numbers
------------------------------------

The `strtonum()' function (*note String Functions::) is a `gawk'
extension.  The following function provides an implementation for other
versions of `awk':

     # mystrtonum --- convert string to number

     function mystrtonum(str,        ret, chars, n, i, k, c)
     {
         if (str ~ /^0[0-7]*$/) {
             # octal
             n = length(str)
             ret = 0
             for (i = 1; i <= n; i++) {
                 c = substr(str, i, 1)
                 if ((k = index("01234567", c)) > 0)
                     k-- # adjust for 1-basing in awk

                 ret = ret * 8 + k
             }
         } else if (str ~ /^0[xX][[:xdigit:]]+/) {
             # hexadecimal
             str = substr(str, 3)    # lop off leading 0x
             n = length(str)
             ret = 0
             for (i = 1; i <= n; i++) {
                 c = substr(str, i, 1)
                 c = tolower(c)
                 if ((k = index("0123456789", c)) > 0)
                     k-- # adjust for 1-basing in awk
                 else if ((k = index("abcdef", c)) > 0)
                     k += 9

                 ret = ret * 16 + k
             }
         } else if (str ~ \
       /^[-+]?([0-9]+([.][0-9]*([Ee][0-9]+)?)?|([.][0-9]+([Ee][-+]?[0-9]+)?))$/) {
             # decimal number, possibly floating point
             ret = str + 0
         } else
             ret = "NOT-A-NUMBER"

         return ret
     }

     # BEGIN {     # gawk test harness
     #     a[1] = "25"
     #     a[2] = ".31"
     #     a[3] = "0123"
     #     a[4] = "0xdeadBEEF"
     #     a[5] = "123.45"
     #     a[6] = "1.e3"
     #     a[7] = "1.32"
     #     a[7] = "1.32E2"
     #
     #     for (i = 1; i in a; i++)
     #         print a[i], strtonum(a[i]), mystrtonum(a[i])
     # }

   The function first looks for C-style octal numbers (base 8).  If the
input string matches a regular expression describing octal numbers,
then `mystrtonum()' loops through each character in the string.  It
sets `k' to the index in `"01234567"' of the current octal digit.
Since the return value is one-based, the `k--' adjusts `k' so it can be
used in computing the return value.

   Similar logic applies to the code that checks for and converts a
hexadecimal value, which starts with `0x' or `0X'.  The use of
`tolower()' simplifies the computation for finding the correct numeric
value for each hexadecimal digit.

   Finally, if the string matches the (rather complicated) regexp for a
regular decimal integer or floating-point number, the computation `ret
= str + 0' lets `awk' convert the value to a number.

   A commented-out test program is included, so that the function can
be tested with `gawk' and the results compared to the built-in
`strtonum()' function.


File: gawk.info,  Node: Assert Function,  Next: Round Function,  Prev: Strtonum Function,  Up: General Functions

10.2.2 Assertions
-----------------

When writing large programs, it is often useful to know that a
condition or set of conditions is true.  Before proceeding with a
particular computation, you make a statement about what you believe to
be the case.  Such a statement is known as an "assertion".  The C
language provides an `<assert.h>' header file and corresponding
`assert()' macro that the programmer can use to make assertions.  If an
assertion fails, the `assert()' macro arranges to print a diagnostic
message describing the condition that should have been true but was
not, and then it kills the program.  In C, using `assert()' looks this:

     #include <assert.h>

     int myfunc(int a, double b)
     {
          assert(a <= 5 && b >= 17.1);
          ...
     }

   If the assertion fails, the program prints a message similar to this:

     prog.c:5: assertion failed: a <= 5 && b >= 17.1

   The C language makes it possible to turn the condition into a string
for use in printing the diagnostic message.  This is not possible in
`awk', so this `assert()' function also requires a string version of
the condition that is being tested.  Following is the function:

     # assert --- assert that a condition is true. Otherwise exit.

     function assert(condition, string)
     {
         if (! condition) {
             printf("%s:%d: assertion failed: %s\n",
                 FILENAME, FNR, string) > "/dev/stderr"
             _assert_exit = 1
             exit 1
         }
     }

     END {
         if (_assert_exit)
             exit 1
     }

   The `assert()' function tests the `condition' parameter. If it is
false, it prints a message to standard error, using the `string'
parameter to describe the failed condition.  It then sets the variable
`_assert_exit' to one and executes the `exit' statement.  The `exit'
statement jumps to the `END' rule. If the `END' rules finds
`_assert_exit' to be true, it exits immediately.

   The purpose of the test in the `END' rule is to keep any other `END'
rules from running.  When an assertion fails, the program should exit
immediately.  If no assertions fail, then `_assert_exit' is still false
when the `END' rule is run normally, and the rest of the program's
`END' rules execute.  For all of this to work correctly, `assert.awk'
must be the first source file read by `awk'.  The function can be used
in a program in the following way:

     function myfunc(a, b)
     {
          assert(a <= 5 && b >= 17.1, "a <= 5 && b >= 17.1")
          ...
     }

If the assertion fails, you see a message similar to the following:

     mydata:1357: assertion failed: a <= 5 && b >= 17.1

   There is a small problem with this version of `assert()'.  An `END'
rule is automatically added to the program calling `assert()'.
Normally, if a program consists of just a `BEGIN' rule, the input files
and/or standard input are not read. However, now that the program has
an `END' rule, `awk' attempts to read the input data files or standard
input (*note Using BEGIN/END::), most likely causing the program to
hang as it waits for input.

   There is a simple workaround to this: make sure that such a `BEGIN'
rule always ends with an `exit' statement.


File: gawk.info,  Node: Round Function,  Next: Cliff Random Function,  Prev: Assert Function,  Up: General Functions

10.2.3 Rounding Numbers
-----------------------

The way `printf' and `sprintf()' (*note Printf::) perform rounding
often depends upon the system's C `sprintf()' subroutine.  On many
machines, `sprintf()' rounding is "unbiased," which means it doesn't
always round a trailing `.5' up, contrary to naive expectations.  In
unbiased rounding, `.5' rounds to even, rather than always up, so 1.5
rounds to 2 but 4.5 rounds to 4.  This means that if you are using a
format that does rounding (e.g., `"%.0f"'), you should check what your
system does.  The following function does traditional rounding; it
might be useful if your `awk''s `printf' does unbiased rounding:

     # round.awk --- do normal rounding

     function round(x,   ival, aval, fraction)
     {
        ival = int(x)    # integer part, int() truncates

        # see if fractional part
        if (ival == x)   # no fraction
           return ival   # ensure no decimals

        if (x < 0) {
           aval = -x     # absolute value
           ival = int(aval)
           fraction = aval - ival
           if (fraction >= .5)
              return int(x) - 1   # -2.5 --> -3
           else
              return int(x)       # -2.3 --> -2
        } else {
           fraction = x - ival
           if (fraction >= .5)
              return ival + 1
           else
              return ival
        }
     }

     # test harness
     { print $0, round($0) }


File: gawk.info,  Node: Cliff Random Function,  Next: Ordinal Functions,  Prev: Round Function,  Up: General Functions

10.2.4 The Cliff Random Number Generator
----------------------------------------

The Cliff random number generator
(http://mathworld.wolfram.com/CliffRandomNumberGenerator.html) is a
very simple random number generator that "passes the noise sphere test
for randomness by showing no structure."  It is easily programmed, in
less than 10 lines of `awk' code:

     # cliff_rand.awk --- generate Cliff random numbers

     BEGIN { _cliff_seed = 0.1 }

     function cliff_rand()
     {
         _cliff_seed = (100 * log(_cliff_seed)) % 1
         if (_cliff_seed < 0)
             _cliff_seed = - _cliff_seed
         return _cliff_seed
     }

   This algorithm requires an initial "seed" of 0.1.  Each new value
uses the current seed as input for the calculation.  If the built-in
`rand()' function (*note Numeric Functions::) isn't random enough, you
might try using this function instead.


File: gawk.info,  Node: Ordinal Functions,  Next: Join Function,  Prev: Cliff Random Function,  Up: General Functions

10.2.5 Translating Between Characters and Numbers
-------------------------------------------------

One commercial implementation of `awk' supplies a built-in function,
`ord()', which takes a character and returns the numeric value for that
character in the machine's character set.  If the string passed to
`ord()' has more than one character, only the first one is used.

   The inverse of this function is `chr()' (from the function of the
same name in Pascal), which takes a number and returns the
corresponding character.  Both functions are written very nicely in
`awk'; there is no real reason to build them into the `awk' interpreter:

     # ord.awk --- do ord and chr

     # Global identifiers:
     #    _ord_:        numerical values indexed by characters
     #    _ord_init:    function to initialize _ord_

     BEGIN    { _ord_init() }

     function _ord_init(    low, high, i, t)
     {
         low = sprintf("%c", 7) # BEL is ascii 7
         if (low == "\a") {    # regular ascii
             low = 0
             high = 127
         } else if (sprintf("%c", 128 + 7) == "\a") {
             # ascii, mark parity
             low = 128
             high = 255
         } else {        # ebcdic(!)
             low = 0
             high = 255
         }

         for (i = low; i <= high; i++) {
             t = sprintf("%c", i)
             _ord_[t] = i
         }
     }

   Some explanation of the numbers used by `chr' is worthwhile.  The
most prominent character set in use today is ASCII.(1) Although an
8-bit byte can hold 256 distinct values (from 0 to 255), ASCII only
defines characters that use the values from 0 to 127.(2) In the now
distant past, at least one minicomputer manufacturer used ASCII, but
with mark parity, meaning that the leftmost bit in the byte is always
1.  This means that on those systems, characters have numeric values
from 128 to 255.  Finally, large mainframe systems use the EBCDIC
character set, which uses all 256 values.  While there are other
character sets in use on some older systems, they are not really worth
worrying about:

     function ord(str,    c)
     {
         # only first character is of interest
         c = substr(str, 1, 1)
         return _ord_[c]
     }

     function chr(c)
     {
         # force c to be numeric by adding 0
         return sprintf("%c", c + 0)
     }

     #### test code ####
     # BEGIN    \
     # {
     #    for (;;) {
     #        printf("enter a character: ")
     #        if (getline var <= 0)
     #            break
     #        printf("ord(%s) = %d\n", var, ord(var))
     #    }
     # }

   An obvious improvement to these functions is to move the code for the
`_ord_init' function into the body of the `BEGIN' rule.  It was written
this way initially for ease of development.  There is a "test program"
in a `BEGIN' rule, to test the function.  It is commented out for
production use.

   ---------- Footnotes ----------

   (1) This is changing; many systems use Unicode, a very large
character set that includes ASCII as a subset.  On systems with full
Unicode support, a character can occupy up to 32 bits, making simple
tests such as used here prohibitively expensive.

   (2) ASCII has been extended in many countries to use the values from
128 to 255 for country-specific characters.  If your  system uses these
extensions, you can simplify `_ord_init' to loop from 0 to 255.


File: gawk.info,  Node: Join Function,  Next: Getlocaltime Function,  Prev: Ordinal Functions,  Up: General Functions

10.2.6 Merging an Array into a String
-------------------------------------

When doing string processing, it is often useful to be able to join all
the strings in an array into one long string.  The following function,
`join()', accomplishes this task.  It is used later in several of the
application programs (*note Sample Programs::).

   Good function design is important; this function needs to be general
but it should also have a reasonable default behavior.  It is called
with an array as well as the beginning and ending indices of the
elements in the array to be merged.  This assumes that the array
indices are numeric--a reasonable assumption since the array was likely
created with `split()' (*note String Functions::):

     # join.awk --- join an array into a string

     function join(array, start, end, sep,    result, i)
     {
         if (sep == "")
            sep = " "
         else if (sep == SUBSEP) # magic value
            sep = ""
         result = array[start]
         for (i = start + 1; i <= end; i++)
             result = result sep array[i]
         return result
     }

   An optional additional argument is the separator to use when joining
the strings back together.  If the caller supplies a nonempty value,
`join()' uses it; if it is not supplied, it has a null value.  In this
case, `join()' uses a single space as a default separator for the
strings.  If the value is equal to `SUBSEP', then `join()' joins the
strings with no separator between them.  `SUBSEP' serves as a "magic"
value to indicate that there should be no separation between the
component strings.(1)

   ---------- Footnotes ----------

   (1) It would be nice if `awk' had an assignment operator for
concatenation.  The lack of an explicit operator for concatenation
makes string operations more difficult than they really need to be.


File: gawk.info,  Node: Getlocaltime Function,  Next: Readfile Function,  Prev: Join Function,  Up: General Functions

10.2.7 Managing the Time of Day
-------------------------------

The `systime()' and `strftime()' functions described in *note Time
Functions::, provide the minimum functionality necessary for dealing
with the time of day in human readable form.  While `strftime()' is
extensive, the control formats are not necessarily easy to remember or
intuitively obvious when reading a program.

   The following function, `getlocaltime()', populates a user-supplied
array with preformatted time information.  It returns a string with the
current time formatted in the same way as the `date' utility:

     # getlocaltime.awk --- get the time of day in a usable format

     # Returns a string in the format of output of date(1)
     # Populates the array argument time with individual values:
     #    time["second"]       -- seconds (0 - 59)
     #    time["minute"]       -- minutes (0 - 59)
     #    time["hour"]         -- hours (0 - 23)
     #    time["althour"]      -- hours (0 - 12)
     #    time["monthday"]     -- day of month (1 - 31)
     #    time["month"]        -- month of year (1 - 12)
     #    time["monthname"]    -- name of the month
     #    time["shortmonth"]   -- short name of the month
     #    time["year"]         -- year modulo 100 (0 - 99)
     #    time["fullyear"]     -- full year
     #    time["weekday"]      -- day of week (Sunday = 0)
     #    time["altweekday"]   -- day of week (Monday = 0)
     #    time["dayname"]      -- name of weekday
     #    time["shortdayname"] -- short name of weekday
     #    time["yearday"]      -- day of year (0 - 365)
     #    time["timezone"]     -- abbreviation of timezone name
     #    time["ampm"]         -- AM or PM designation
     #    time["weeknum"]      -- week number, Sunday first day
     #    time["altweeknum"]   -- week number, Monday first day

     function getlocaltime(time,    ret, now, i)
     {
         # get time once, avoids unnecessary system calls
         now = systime()

         # return date(1)-style output
         ret = strftime("%a %b %e %H:%M:%S %Z %Y", now)

         # clear out target array
         delete time

         # fill in values, force numeric values to be
         # numeric by adding 0
         time["second"]       = strftime("%S", now) + 0
         time["minute"]       = strftime("%M", now) + 0
         time["hour"]         = strftime("%H", now) + 0
         time["althour"]      = strftime("%I", now) + 0
         time["monthday"]     = strftime("%d", now) + 0
         time["month"]        = strftime("%m", now) + 0
         time["monthname"]    = strftime("%B", now)
         time["shortmonth"]   = strftime("%b", now)
         time["year"]         = strftime("%y", now) + 0
         time["fullyear"]     = strftime("%Y", now) + 0
         time["weekday"]      = strftime("%w", now) + 0
         time["altweekday"]   = strftime("%u", now) + 0
         time["dayname"]      = strftime("%A", now)
         time["shortdayname"] = strftime("%a", now)
         time["yearday"]      = strftime("%j", now) + 0
         time["timezone"]     = strftime("%Z", now)
         time["ampm"]         = strftime("%p", now)
         time["weeknum"]      = strftime("%U", now) + 0
         time["altweeknum"]   = strftime("%W", now) + 0

         return ret
     }

   The string indices are easier to use and read than the various
formats required by `strftime()'.  The `alarm' program presented in
*note Alarm Program::, uses this function.  A more general design for
the `getlocaltime()' function would have allowed the user to supply an
optional timestamp value to use instead of the current time.


File: gawk.info,  Node: Readfile Function,  Prev: Getlocaltime Function,  Up: General Functions

10.2.8 Reading A Whole File At Once
-----------------------------------

Often, it is convenient to have the entire contents of a file available
in memory as a single string. A straightforward but naive way to do
that might be as follows:

     function readfile(file,    tmp, contents)
     {
         if ((getline tmp < file) < 0)
             return

         contents = tmp
         while (getline tmp < file) > 0)
             contents = contents RT tmp

         close(file)
         return contents
     }

   This function reads from `file' one record at a time, building up
the full contents of the file in the local variable `contents'.  It
works, but is not necessarily efficient.

   The following function, based on a suggestion by Denis Shirokov,
reads the entire contents of the named file in one shot:

     # readfile.awk --- read an entire file at once

     function readfile(file,     tmp, save_rs)
     {
         save_rs = RS
         RS = "^$"
         getline tmp < file
         close(file)
         RS = save_rs

         return tmp
     }

   It works by setting `RS' to `^$', a regular expression that will
never match if the file has contents.  `gawk' reads data from the file
into `tmp' attempting to match `RS'.  The match fails after each read,
but fails quickly, such that `gawk' fills `tmp' with the entire
contents of the file.  (*Note Records::, for information on `RT' and
`RS'.)

   In the case that `file' is empty, the return value is the null
string.  Thus calling code may use something like:

     contents = readfile("/some/path")
     if (length(contents) == 0)
         # file was empty ...

   This tests the result to see if it is empty or not. An equivalent
test would be `contents == ""'.


File: gawk.info,  Node: Data File Management,  Next: Getopt Function,  Prev: General Functions,  Up: Library Functions

10.3 Data File Management
=========================

This minor node presents functions that are useful for managing
command-line data files.

* Menu:

* Filetrans Function::          A function for handling data file transitions.
* Rewind Function::             A function for rereading the current file.
* File Checking::               Checking that data files are readable.
* Empty Files::                 Checking for zero-length files.
* Ignoring Assigns::            Treating assignments as file names.


File: gawk.info,  Node: Filetrans Function,  Next: Rewind Function,  Up: Data File Management

10.3.1 Noting Data File Boundaries
----------------------------------

The `BEGIN' and `END' rules are each executed exactly once at the
beginning and end of your `awk' program, respectively (*note
BEGIN/END::).  We (the `gawk' authors) once had a user who mistakenly
thought that the `BEGIN' rule is executed at the beginning of each data
file and the `END' rule is executed at the end of each data file.

   When informed that this was not the case, the user requested that we
add new special patterns to `gawk', named `BEGIN_FILE' and `END_FILE',
that would have the desired behavior.  He even supplied us the code to
do so.

   Adding these special patterns to `gawk' wasn't necessary; the job
can be done cleanly in `awk' itself, as illustrated by the following
library program.  It arranges to call two user-supplied functions,
`beginfile()' and `endfile()', at the beginning and end of each data
file.  Besides solving the problem in only nine(!) lines of code, it
does so _portably_; this works with any implementation of `awk':

     # transfile.awk
     #
     # Give the user a hook for filename transitions
     #
     # The user must supply functions beginfile() and endfile()
     # that each take the name of the file being started or
     # finished, respectively.

     FILENAME != _oldfilename \
     {
         if (_oldfilename != "")
             endfile(_oldfilename)
         _oldfilename = FILENAME
         beginfile(FILENAME)
     }

     END   { endfile(FILENAME) }

   This file must be loaded before the user's "main" program, so that
the rule it supplies is executed first.

   This rule relies on `awk''s `FILENAME' variable that automatically
changes for each new data file.  The current file name is saved in a
private variable, `_oldfilename'.  If `FILENAME' does not equal
`_oldfilename', then a new data file is being processed and it is
necessary to call `endfile()' for the old file.  Because `endfile()'
should only be called if a file has been processed, the program first
checks to make sure that `_oldfilename' is not the null string.  The
program then assigns the current file name to `_oldfilename' and calls
`beginfile()' for the file.  Because, like all `awk' variables,
`_oldfilename' is initialized to the null string, this rule executes
correctly even for the first data file.

   The program also supplies an `END' rule to do the final processing
for the last file.  Because this `END' rule comes before any `END' rules
supplied in the "main" program, `endfile()' is called first.  Once
again the value of multiple `BEGIN' and `END' rules should be clear.

   If the same data file occurs twice in a row on the command line, then
`endfile()' and `beginfile()' are not executed at the end of the first
pass and at the beginning of the second pass.  The following version
solves the problem:

     # ftrans.awk --- handle data file transitions
     #
     # user supplies beginfile() and endfile() functions

     FNR == 1 {
         if (_filename_ != "")
             endfile(_filename_)
         _filename_ = FILENAME
         beginfile(FILENAME)
     }

     END  { endfile(_filename_) }

   *note Wc Program::, shows how this library function can be used and
how it simplifies writing the main program.

          So Why Does `gawk' have `BEGINFILE' and `ENDFILE'?

   You are probably wondering, if `beginfile()' and `endfile()'
functions can do the job, why does `gawk' have `BEGINFILE' and
`ENDFILE' patterns (*note BEGINFILE/ENDFILE::)?

   Good question.  Normally, if `awk' cannot open a file, this causes
an immediate fatal error.  In this case, there is no way for a
user-defined function to deal with the problem, since the mechanism for
calling it relies on the file being open and at the first record.  Thus,
the main reason for `BEGINFILE' is to give you a "hook" to catch files
that cannot be processed.  `ENDFILE' exists for symmetry, and because
it provides an easy way to do per-file cleanup processing.


File: gawk.info,  Node: Rewind Function,  Next: File Checking,  Prev: Filetrans Function,  Up: Data File Management

10.3.2 Rereading the Current File
---------------------------------

Another request for a new built-in function was for a `rewind()'
function that would make it possible to reread the current file.  The
requesting user didn't want to have to use `getline' (*note Getline::)
inside a loop.

   However, as long as you are not in the `END' rule, it is quite easy
to arrange to immediately close the current input file and then start
over with it from the top.  For lack of a better name, we'll call it
`rewind()':

     # rewind.awk --- rewind the current file and start over

     function rewind(    i)
     {
         # shift remaining arguments up
         for (i = ARGC; i > ARGIND; i--)
             ARGV[i] = ARGV[i-1]

         # make sure gawk knows to keep going
         ARGC++

         # make current file next to get done
         ARGV[ARGIND+1] = FILENAME

         # do it
         nextfile
     }

   This code relies on the `ARGIND' variable (*note Auto-set::), which
is specific to `gawk'.  If you are not using `gawk', you can use ideas
presented in *note Filetrans Function::, to either update `ARGIND' on
your own or modify this code as appropriate.

   The `rewind()' function also relies on the `nextfile' keyword (*note
Nextfile Statement::).


File: gawk.info,  Node: File Checking,  Next: Empty Files,  Prev: Rewind Function,  Up: Data File Management

10.3.3 Checking for Readable Data Files
---------------------------------------

Normally, if you give `awk' a data file that isn't readable, it stops
with a fatal error.  There are times when you might want to just ignore
such files and keep going.  You can do this by prepending the following
program to your `awk' program:

     # readable.awk --- library file to skip over unreadable files

     BEGIN {
         for (i = 1; i < ARGC; i++) {
             if (ARGV[i] ~ /^[[:alpha:]_][[:alnum:]_]*=.*/ \
                 || ARGV[i] == "-" || ARGV[i] == "/dev/stdin")
                 continue    # assignment or standard input
             else if ((getline junk < ARGV[i]) < 0) # unreadable
                 delete ARGV[i]
             else
                 close(ARGV[i])
         }
     }

   This works, because the `getline' won't be fatal.  Removing the
element from `ARGV' with `delete' skips the file (since it's no longer
in the list).  See also *note ARGC and ARGV::.


File: gawk.info,  Node: Empty Files,  Next: Ignoring Assigns,  Prev: File Checking,  Up: Data File Management

10.3.4 Checking For Zero-length Files
-------------------------------------

All known `awk' implementations silently skip over zero-length files.
This is a by-product of `awk''s implicit
read-a-record-and-match-against-the-rules loop: when `awk' tries to
read a record from an empty file, it immediately receives an end of
file indication, closes the file, and proceeds on to the next
command-line data file, _without_ executing any user-level `awk'
program code.

   Using `gawk''s `ARGIND' variable (*note Built-in Variables::), it is
possible to detect when an empty data file has been skipped.  Similar
to the library file presented in *note Filetrans Function::, the
following library file calls a function named `zerofile()' that the
user must provide.  The arguments passed are the file name and the
position in `ARGV' where it was found:

     # zerofile.awk --- library file to process empty input files

     BEGIN { Argind = 0 }

     ARGIND > Argind + 1 {
         for (Argind++; Argind < ARGIND; Argind++)
             zerofile(ARGV[Argind], Argind)
     }

     ARGIND != Argind { Argind = ARGIND }

     END {
         if (ARGIND > Argind)
             for (Argind++; Argind <= ARGIND; Argind++)
                 zerofile(ARGV[Argind], Argind)
     }

   The user-level variable `Argind' allows the `awk' program to track
its progress through `ARGV'.  Whenever the program detects that
`ARGIND' is greater than `Argind + 1', it means that one or more empty
files were skipped.  The action then calls `zerofile()' for each such
file, incrementing `Argind' along the way.

   The `Argind != ARGIND' rule simply keeps `Argind' up to date in the
normal case.

   Finally, the `END' rule catches the case of any empty files at the
end of the command-line arguments.  Note that the test in the condition
of the `for' loop uses the `<=' operator, not `<'.

   As an exercise, you might consider whether this same problem can be
solved without relying on `gawk''s `ARGIND' variable.

   As a second exercise, revise this code to handle the case where an
intervening value in `ARGV' is a variable assignment.


File: gawk.info,  Node: Ignoring Assigns,  Prev: Empty Files,  Up: Data File Management

10.3.5 Treating Assignments as File Names
-----------------------------------------

Occasionally, you might not want `awk' to process command-line variable
assignments (*note Assignment Options::).  In particular, if you have a
file name that contain an `=' character, `awk' treats the file name as
an assignment, and does not process it.

   Some users have suggested an additional command-line option for
`gawk' to disable command-line assignments.  However, some simple
programming with a library file does the trick:

     # noassign.awk --- library file to avoid the need for a
     # special option that disables command-line assignments

     function disable_assigns(argc, argv,    i)
     {
         for (i = 1; i < argc; i++)
             if (argv[i] ~ /^[[:alpha:]_][[:alnum:]_]*=.*/)
                 argv[i] = ("./" argv[i])
     }

     BEGIN {
         if (No_command_assign)
             disable_assigns(ARGC, ARGV)
     }

   You then run your program this way:

     awk -v No_command_assign=1 -f noassign.awk -f yourprog.awk *

   The function works by looping through the arguments.  It prepends
`./' to any argument that matches the form of a variable assignment,
turning that argument into a file name.

   The use of `No_command_assign' allows you to disable command-line
assignments at invocation time, by giving the variable a true value.
When not set, it is initially zero (i.e., false), so the command-line
arguments are left alone.


File: gawk.info,  Node: Getopt Function,  Next: Passwd Functions,  Prev: Data File Management,  Up: Library Functions

10.4 Processing Command-Line Options
====================================

Most utilities on POSIX compatible systems take options on the command
line that can be used to change the way a program behaves.  `awk' is an
example of such a program (*note Options::).  Often, options take
"arguments"; i.e., data that the program needs to correctly obey the
command-line option.  For example, `awk''s `-F' option requires a
string to use as the field separator.  The first occurrence on the
command line of either `--' or a string that does not begin with `-'
ends the options.

   Modern Unix systems provide a C function named `getopt()' for
processing command-line arguments.  The programmer provides a string
describing the one-letter options. If an option requires an argument,
it is followed in the string with a colon.  `getopt()' is also passed
the count and values of the command-line arguments and is called in a
loop.  `getopt()' processes the command-line arguments for option
letters.  Each time around the loop, it returns a single character
representing the next option letter that it finds, or `?' if it finds
an invalid option.  When it returns -1, there are no options left on
the command line.

   When using `getopt()', options that do not take arguments can be
grouped together.  Furthermore, options that take arguments require
that the argument be present.  The argument can immediately follow the
option letter, or it can be a separate command-line argument.

   Given a hypothetical program that takes three command-line options,
`-a', `-b', and `-c', where `-b' requires an argument, all of the
following are valid ways of invoking the program:

     prog -a -b foo -c data1 data2 data3
     prog -ac -bfoo -- data1 data2 data3
     prog -acbfoo data1 data2 data3

   Notice that when the argument is grouped with its option, the rest of
the argument is considered to be the option's argument.  In this
example, `-acbfoo' indicates that all of the `-a', `-b', and `-c'
options were supplied, and that `foo' is the argument to the `-b'
option.

   `getopt()' provides four external variables that the programmer can
use:

`optind'
     The index in the argument value array (`argv') where the first
     nonoption command-line argument can be found.

`optarg'
     The string value of the argument to an option.

`opterr'
     Usually `getopt()' prints an error message when it finds an invalid
     option.  Setting `opterr' to zero disables this feature.  (An
     application might want to print its own error message.)

`optopt'
     The letter representing the command-line option.

   The following C fragment shows how `getopt()' might process
command-line arguments for `awk':

     int
     main(int argc, char *argv[])
     {
         ...
         /* print our own message */
         opterr = 0;
         while ((c = getopt(argc, argv, "v:f:F:W:")) != -1) {
             switch (c) {
             case 'f':    /* file */
                 ...
                 break;
             case 'F':    /* field separator */
                 ...
                 break;
             case 'v':    /* variable assignment */
                 ...
                 break;
             case 'W':    /* extension */
                 ...
                 break;
             case '?':
             default:
                 usage();
                 break;
             }
         }
         ...
     }

   As a side point, `gawk' actually uses the GNU `getopt_long()'
function to process both normal and GNU-style long options (*note
Options::).

   The abstraction provided by `getopt()' is very useful and is quite
handy in `awk' programs as well.  Following is an `awk' version of
`getopt()'.  This function highlights one of the greatest weaknesses in
`awk', which is that it is very poor at manipulating single characters.
Repeated calls to `substr()' are necessary for accessing individual
characters (*note String Functions::).(1)

   The discussion that follows walks through the code a bit at a time:

     # getopt.awk --- Do C library getopt(3) function in awk

     # External variables:
     #    Optind -- index in ARGV of first nonoption argument
     #    Optarg -- string value of argument to current option
     #    Opterr -- if nonzero, print our own diagnostic
     #    Optopt -- current option letter

     # Returns:
     #    -1     at end of options
     #    "?"    for unrecognized option
     #    <c>    a character representing the current option

     # Private Data:
     #    _opti  -- index in multiflag option, e.g., -abc

   The function starts out with comments presenting a list of the
global variables it uses, what the return values are, what they mean,
and any global variables that are "private" to this library function.
Such documentation is essential for any program, and particularly for
library functions.

   The `getopt()' function first checks that it was indeed called with
a string of options (the `options' parameter).  If `options' has a zero
length, `getopt()' immediately returns -1:

     function getopt(argc, argv, options,    thisopt, i)
     {
         if (length(options) == 0)    # no options given
             return -1

         if (argv[Optind] == "--") {  # all done
             Optind++
             _opti = 0
             return -1
         } else if (argv[Optind] !~ /^-[^:[:space:]]/) {
             _opti = 0
             return -1
         }

   The next thing to check for is the end of the options.  A `--' ends
the command-line options, as does any command-line argument that does
not begin with a `-'.  `Optind' is used to step through the array of
command-line arguments; it retains its value across calls to
`getopt()', because it is a global variable.

   The regular expression that is used, `/^-[^:[:space:]/', checks for
a `-' followed by anything that is not whitespace and not a colon.  If
the current command-line argument does not match this pattern, it is
not an option, and it ends option processing. Continuing on:

         if (_opti == 0)
             _opti = 2
         thisopt = substr(argv[Optind], _opti, 1)
         Optopt = thisopt
         i = index(options, thisopt)
         if (i == 0) {
             if (Opterr)
                 printf("%c -- invalid option\n",
                                       thisopt) > "/dev/stderr"
             if (_opti >= length(argv[Optind])) {
                 Optind++
                 _opti = 0
             } else
                 _opti++
             return "?"
         }

   The `_opti' variable tracks the position in the current command-line
argument (`argv[Optind]').  If multiple options are grouped together
with one `-' (e.g., `-abx'), it is necessary to return them to the user
one at a time.

   If `_opti' is equal to zero, it is set to two, which is the index in
the string of the next character to look at (we skip the `-', which is
at position one).  The variable `thisopt' holds the character, obtained
with `substr()'.  It is saved in `Optopt' for the main program to use.

   If `thisopt' is not in the `options' string, then it is an invalid
option.  If `Opterr' is nonzero, `getopt()' prints an error message on
the standard error that is similar to the message from the C version of
`getopt()'.

   Because the option is invalid, it is necessary to skip it and move
on to the next option character.  If `_opti' is greater than or equal
to the length of the current command-line argument, it is necessary to
move on to the next argument, so `Optind' is incremented and `_opti' is
reset to zero. Otherwise, `Optind' is left alone and `_opti' is merely
incremented.

   In any case, because the option is invalid, `getopt()' returns `"?"'.
The main program can examine `Optopt' if it needs to know what the
invalid option letter actually is. Continuing on:

         if (substr(options, i + 1, 1) == ":") {
             # get option argument
             if (length(substr(argv[Optind], _opti + 1)) > 0)
                 Optarg = substr(argv[Optind], _opti + 1)
             else
                 Optarg = argv[++Optind]
             _opti = 0
         } else
             Optarg = ""

   If the option requires an argument, the option letter is followed by
a colon in the `options' string.  If there are remaining characters in
the current command-line argument (`argv[Optind]'), then the rest of
that string is assigned to `Optarg'.  Otherwise, the next command-line
argument is used (`-xFOO' versus `-x FOO'). In either case, `_opti' is
reset to zero, because there are no more characters left to examine in
the current command-line argument. Continuing:

         if (_opti == 0 || _opti >= length(argv[Optind])) {
             Optind++
             _opti = 0
         } else
             _opti++
         return thisopt
     }

   Finally, if `_opti' is either zero or greater than the length of the
current command-line argument, it means this element in `argv' is
through being processed, so `Optind' is incremented to point to the
next element in `argv'.  If neither condition is true, then only
`_opti' is incremented, so that the next option letter can be processed
on the next call to `getopt()'.

   The `BEGIN' rule initializes both `Opterr' and `Optind' to one.
`Opterr' is set to one, since the default behavior is for `getopt()' to
print a diagnostic message upon seeing an invalid option.  `Optind' is
set to one, since there's no reason to look at the program name, which
is in `ARGV[0]':

     BEGIN {
         Opterr = 1    # default is to diagnose
         Optind = 1    # skip ARGV[0]

         # test program
         if (_getopt_test) {
             while ((_go_c = getopt(ARGC, ARGV, "ab:cd")) != -1)
                 printf("c = <%c>, optarg = <%s>\n",
                                            _go_c, Optarg)
             printf("non-option arguments:\n")
             for (; Optind < ARGC; Optind++)
                 printf("\tARGV[%d] = <%s>\n",
                                         Optind, ARGV[Optind])
         }
     }

   The rest of the `BEGIN' rule is a simple test program.  Here is the
result of two sample runs of the test program:

     $ awk -f getopt.awk -v _getopt_test=1 -- -a -cbARG bax -x
     -| c = <a>, optarg = <>
     -| c = <c>, optarg = <>
     -| c = <b>, optarg = <ARG>
     -| non-option arguments:
     -|         ARGV[3] = <bax>
     -|         ARGV[4] = <-x>

     $ awk -f getopt.awk -v _getopt_test=1 -- -a -x -- xyz abc
     -| c = <a>, optarg = <>
     error--> x -- invalid option
     -| c = <?>, optarg = <>
     -| non-option arguments:
     -|         ARGV[4] = <xyz>
     -|         ARGV[5] = <abc>

   In both runs, the first `--' terminates the arguments to `awk', so
that it does not try to interpret the `-a', etc., as its own options.

     NOTE: After `getopt()' is through, it is the responsibility of the
     user level code to clear out all the elements of `ARGV' from 1 to
     `Optind', so that `awk' does not try to process the command-line
     options as file names.

   Several of the sample programs presented in *note Sample Programs::,
use `getopt()' to process their arguments.

   ---------- Footnotes ----------

   (1) This function was written before `gawk' acquired the ability to
split strings into single characters using `""' as the separator.  We
have left it alone, since using `substr()' is more portable.


File: gawk.info,  Node: Passwd Functions,  Next: Group Functions,  Prev: Getopt Function,  Up: Library Functions

10.5 Reading the User Database
==============================

The `PROCINFO' array (*note Built-in Variables::) provides access to
the current user's real and effective user and group ID numbers, and if
available, the user's supplementary group set.  However, because these
are numbers, they do not provide very useful information to the average
user.  There needs to be some way to find the user information
associated with the user and group ID numbers.  This minor node
presents a suite of functions for retrieving information from the user
database.  *Note Group Functions::, for a similar suite that retrieves
information from the group database.

   The POSIX standard does not define the file where user information is
kept.  Instead, it provides the `<pwd.h>' header file and several C
language subroutines for obtaining user information.  The primary
function is `getpwent()', for "get password entry."  The "password"
comes from the original user database file, `/etc/passwd', which stores
user information, along with the encrypted passwords (hence the name).

   While an `awk' program could simply read `/etc/passwd' directly,
this file may not contain complete information about the system's set
of users.(1) To be sure you are able to produce a readable and complete
version of the user database, it is necessary to write a small C
program that calls `getpwent()'.  `getpwent()' is defined as returning
a pointer to a `struct passwd'.  Each time it is called, it returns the
next entry in the database.  When there are no more entries, it returns
`NULL', the null pointer.  When this happens, the C program should call
`endpwent()' to close the database.  Following is `pwcat', a C program
that "cats" the password database:

     /*
      * pwcat.c
      *
      * Generate a printable version of the password database
      */
     #include <stdio.h>
     #include <pwd.h>

     int
     main(int argc, char **argv)
     {
         struct passwd *p;

         while ((p = getpwent()) != NULL)
             printf("%s:%s:%ld:%ld:%s:%s:%s\n",
                 p->pw_name, p->pw_passwd, (long) p->pw_uid,
                 (long) p->pw_gid, p->pw_gecos, p->pw_dir, p->pw_shell);

         endpwent();
         return 0;
     }

   If you don't understand C, don't worry about it.  The output from
`pwcat' is the user database, in the traditional `/etc/passwd' format
of colon-separated fields.  The fields are:

Login name
     The user's login name.

Encrypted password
     The user's encrypted password.  This may not be available on some
     systems.

User-ID
     The user's numeric user ID number.  (On some systems it's a C
     `long', and not an `int'.  Thus we cast it to `long' for all
     cases.)

Group-ID
     The user's numeric group ID number.  (Similar comments about
     `long' vs. `int' apply here.)

Full name
     The user's full name, and perhaps other information associated
     with the user.

Home directory
     The user's login (or "home") directory (familiar to shell
     programmers as `$HOME').

Login shell
     The program that is run when the user logs in.  This is usually a
     shell, such as Bash.

   A few lines representative of `pwcat''s output are as follows:

     $ pwcat
     -| root:3Ov02d5VaUPB6:0:1:Operator:/:/bin/sh
     -| nobody:*:65534:65534::/:
     -| daemon:*:1:1::/:
     -| sys:*:2:2::/:/bin/csh
     -| bin:*:3:3::/bin:
     -| arnold:xyzzy:2076:10:Arnold Robbins:/home/arnold:/bin/sh
     -| miriam:yxaay:112:10:Miriam Robbins:/home/miriam:/bin/sh
     -| andy:abcca2:113:10:Andy Jacobs:/home/andy:/bin/sh
     ...

   With that introduction, following is a group of functions for
getting user information.  There are several functions here,
corresponding to the C functions of the same names:

     # passwd.awk --- access password file information

     BEGIN {
         # tailor this to suit your system
         _pw_awklib = "/usr/local/libexec/awk/"
     }

     function _pw_init(    oldfs, oldrs, olddol0, pwcat, using_fw, using_fpat)
     {
         if (_pw_inited)
             return

         oldfs = FS
         oldrs = RS
         olddol0 = $0
         using_fw = (PROCINFO["FS"] == "FIELDWIDTHS")
         using_fpat = (PROCINFO["FS"] == "FPAT")
         FS = ":"
         RS = "\n"

         pwcat = _pw_awklib "pwcat"
         while ((pwcat | getline) > 0) {
             _pw_byname[$1] = $0
             _pw_byuid[$3] = $0
             _pw_bycount[++_pw_total] = $0
         }
         close(pwcat)
         _pw_count = 0
         _pw_inited = 1
         FS = oldfs
         if (using_fw)
             FIELDWIDTHS = FIELDWIDTHS
         else if (using_fpat)
             FPAT = FPAT
         RS = oldrs
         $0 = olddol0
     }

   The `BEGIN' rule sets a private variable to the directory where
`pwcat' is stored.  Because it is used to help out an `awk' library
routine, we have chosen to put it in `/usr/local/libexec/awk'; however,
you might want it to be in a different directory on your system.

   The function `_pw_init()' keeps three copies of the user information
in three associative arrays.  The arrays are indexed by username
(`_pw_byname'), by user ID number (`_pw_byuid'), and by order of
occurrence (`_pw_bycount').  The variable `_pw_inited' is used for
efficiency, since `_pw_init()' needs to be called only once.

   Because this function uses `getline' to read information from
`pwcat', it first saves the values of `FS', `RS', and `$0'.  It notes
in the variable `using_fw' whether field splitting with `FIELDWIDTHS'
is in effect or not.  Doing so is necessary, since these functions
could be called from anywhere within a user's program, and the user may
have his or her own way of splitting records and fields.

   The `using_fw' variable checks `PROCINFO["FS"]', which is
`"FIELDWIDTHS"' if field splitting is being done with `FIELDWIDTHS'.
This makes it possible to restore the correct field-splitting mechanism
later.  The test can only be true for `gawk'.  It is false if using
`FS' or `FPAT', or on some other `awk' implementation.

   The code that checks for using `FPAT', using `using_fpat' and
`PROCINFO["FS"]' is similar.

   The main part of the function uses a loop to read database lines,
split the line into fields, and then store the line into each array as
necessary.  When the loop is done, `_pw_init()' cleans up by closing
the pipeline, setting `_pw_inited' to one, and restoring `FS' (and
`FIELDWIDTHS' or `FPAT' if necessary), `RS', and `$0'.  The use of
`_pw_count' is explained shortly.

   The `getpwnam()' function takes a username as a string argument. If
that user is in the database, it returns the appropriate line.
Otherwise, it relies on the array reference to a nonexistent element to
create the element with the null string as its value:

     function getpwnam(name)
     {
         _pw_init()
         return _pw_byname[name]
     }

   Similarly, the `getpwuid' function takes a user ID number argument.
If that user number is in the database, it returns the appropriate
line. Otherwise, it returns the null string:

     function getpwuid(uid)
     {
         _pw_init()
         return _pw_byuid[uid]
     }

   The `getpwent()' function simply steps through the database, one
entry at a time.  It uses `_pw_count' to track its current position in
the `_pw_bycount' array:

     function getpwent()
     {
         _pw_init()
         if (_pw_count < _pw_total)
             return _pw_bycount[++_pw_count]
         return ""
     }

   The `endpwent()' function resets `_pw_count' to zero, so that
subsequent calls to `getpwent()' start over again:

     function endpwent()
     {
         _pw_count = 0
     }

   A conscious design decision in this suite is that each subroutine
calls `_pw_init()' to initialize the database arrays.  The overhead of
running a separate process to generate the user database, and the I/O
to scan it, are only incurred if the user's main program actually calls
one of these functions.  If this library file is loaded along with a
user's program, but none of the routines are ever called, then there is
no extra runtime overhead.  (The alternative is move the body of
`_pw_init()' into a `BEGIN' rule, which always runs `pwcat'.  This
simplifies the code but runs an extra process that may never be needed.)

   In turn, calling `_pw_init()' is not too expensive, because the
`_pw_inited' variable keeps the program from reading the data more than
once.  If you are worried about squeezing every last cycle out of your
`awk' program, the check of `_pw_inited' could be moved out of
`_pw_init()' and duplicated in all the other functions.  In practice,
this is not necessary, since most `awk' programs are I/O-bound, and
such a change would clutter up the code.

   The `id' program in *note Id Program::, uses these functions.

   ---------- Footnotes ----------

   (1) It is often the case that password information is stored in a
network database.


File: gawk.info,  Node: Group Functions,  Next: Walking Arrays,  Prev: Passwd Functions,  Up: Library Functions

10.6 Reading the Group Database
===============================

Much of the discussion presented in *note Passwd Functions::, applies
to the group database as well.  Although there has traditionally been a
well-known file (`/etc/group') in a well-known format, the POSIX
standard only provides a set of C library routines (`<grp.h>' and
`getgrent()') for accessing the information.  Even though this file may
exist, it may not have complete information.  Therefore, as with the
user database, it is necessary to have a small C program that generates
the group database as its output.  `grcat', a C program that "cats" the
group database, is as follows:

     /*
      * grcat.c
      *
      * Generate a printable version of the group database
      */
     #include <stdio.h>
     #include <grp.h>

     int
     main(int argc, char **argv)
     {
         struct group *g;
         int i;

         while ((g = getgrent()) != NULL) {
             printf("%s:%s:%ld:", g->gr_name, g->gr_passwd,
                                          (long) g->gr_gid);
             for (i = 0; g->gr_mem[i] != NULL; i++) {
                 printf("%s", g->gr_mem[i]);
                 if (g->gr_mem[i+1] != NULL)
                     putchar(',');
             }
             putchar('\n');
         }
         endgrent();
         return 0;
     }

   Each line in the group database represents one group.  The fields are
separated with colons and represent the following information:

Group Name
     The group's name.

Group Password
     The group's encrypted password. In practice, this field is never
     used; it is usually empty or set to `*'.

Group ID Number
     The group's numeric group ID number; this number must be unique
     within the file.  (On some systems it's a C `long', and not an
     `int'.  Thus we cast it to `long' for all cases.)

Group Member List
     A comma-separated list of user names.  These users are members of
     the group.  Modern Unix systems allow users to be members of
     several groups simultaneously.  If your system does, then there
     are elements `"group1"' through `"groupN"' in `PROCINFO' for those
     group ID numbers.  (Note that `PROCINFO' is a `gawk' extension;
     *note Built-in Variables::.)

   Here is what running `grcat' might produce:

     $ grcat
     -| wheel:*:0:arnold
     -| nogroup:*:65534:
     -| daemon:*:1:
     -| kmem:*:2:
     -| staff:*:10:arnold,miriam,andy
     -| other:*:20:
     ...

   Here are the functions for obtaining information from the group
database.  There are several, modeled after the C library functions of
the same names:

     # group.awk --- functions for dealing with the group file

     BEGIN    \
     {
         # Change to suit your system
         _gr_awklib = "/usr/local/libexec/awk/"
     }

     function _gr_init(    oldfs, oldrs, olddol0, grcat,
                                  using_fw, using_fpat, n, a, i)
     {
         if (_gr_inited)
             return

         oldfs = FS
         oldrs = RS
         olddol0 = $0
         using_fw = (PROCINFO["FS"] == "FIELDWIDTHS")
         using_fpat = (PROCINFO["FS"] == "FPAT")
         FS = ":"
         RS = "\n"

         grcat = _gr_awklib "grcat"
         while ((grcat | getline) > 0) {
             if ($1 in _gr_byname)
                 _gr_byname[$1] = _gr_byname[$1] "," $4
             else
                 _gr_byname[$1] = $0
             if ($3 in _gr_bygid)
                 _gr_bygid[$3] = _gr_bygid[$3] "," $4
             else
                 _gr_bygid[$3] = $0

             n = split($4, a, "[ \t]*,[ \t]*")
             for (i = 1; i <= n; i++)
                 if (a[i] in _gr_groupsbyuser)
                     _gr_groupsbyuser[a[i]] = \
                         _gr_groupsbyuser[a[i]] " " $1
                 else
                     _gr_groupsbyuser[a[i]] = $1

             _gr_bycount[++_gr_count] = $0
         }
         close(grcat)
         _gr_count = 0
         _gr_inited++
         FS = oldfs
         if (using_fw)
             FIELDWIDTHS = FIELDWIDTHS
         else if (using_fpat)
             FPAT = FPAT
         RS = oldrs
         $0 = olddol0
     }

   The `BEGIN' rule sets a private variable to the directory where
`grcat' is stored.  Because it is used to help out an `awk' library
routine, we have chosen to put it in `/usr/local/libexec/awk'.  You
might want it to be in a different directory on your system.

   These routines follow the same general outline as the user database
routines (*note Passwd Functions::).  The `_gr_inited' variable is used
to ensure that the database is scanned no more than once.  The
`_gr_init()' function first saves `FS', `RS', and `$0', and then sets
`FS' and `RS' to the correct values for scanning the group information.
It also takes care to note whether `FIELDWIDTHS' or `FPAT' is being
used, and to restore the appropriate field splitting mechanism.

   The group information is stored is several associative arrays.  The
arrays are indexed by group name (`_gr_byname'), by group ID number
(`_gr_bygid'), and by position in the database (`_gr_bycount').  There
is an additional array indexed by user name (`_gr_groupsbyuser'), which
is a space-separated list of groups to which each user belongs.

   Unlike the user database, it is possible to have multiple records in
the database for the same group.  This is common when a group has a
large number of members.  A pair of such entries might look like the
following:

     tvpeople:*:101:johnny,jay,arsenio
     tvpeople:*:101:david,conan,tom,joan

   For this reason, `_gr_init()' looks to see if a group name or group
ID number is already seen.  If it is, then the user names are simply
concatenated onto the previous list of users.  (There is actually a
subtle problem with the code just presented.  Suppose that the first
time there were no names. This code adds the names with a leading
comma. It also doesn't check that there is a `$4'.)

   Finally, `_gr_init()' closes the pipeline to `grcat', restores `FS'
(and `FIELDWIDTHS' or `FPAT' if necessary), `RS', and `$0', initializes
`_gr_count' to zero (it is used later), and makes `_gr_inited' nonzero.

   The `getgrnam()' function takes a group name as its argument, and if
that group exists, it is returned.  Otherwise, it relies on the array
reference to a nonexistent element to create the element with the null
string as its value:

     function getgrnam(group)
     {
         _gr_init()
         return _gr_byname[group]
     }

   The `getgrgid()' function is similar; it takes a numeric group ID and
looks up the information associated with that group ID:

     function getgrgid(gid)
     {
         _gr_init()
         return _gr_bygid[gid]
     }

   The `getgruser()' function does not have a C counterpart. It takes a
user name and returns the list of groups that have the user as a member:

     function getgruser(user)
     {
         _gr_init()
         return _gr_groupsbyuser[user]
     }

   The `getgrent()' function steps through the database one entry at a
time.  It uses `_gr_count' to track its position in the list:

     function getgrent()
     {
         _gr_init()
         if (++_gr_count in _gr_bycount)
             return _gr_bycount[_gr_count]
         return ""
     }

   The `endgrent()' function resets `_gr_count' to zero so that
`getgrent()' can start over again:

     function endgrent()
     {
         _gr_count = 0
     }

   As with the user database routines, each function calls `_gr_init()'
to initialize the arrays.  Doing so only incurs the extra overhead of
running `grcat' if these functions are used (as opposed to moving the
body of `_gr_init()' into a `BEGIN' rule).

   Most of the work is in scanning the database and building the various
associative arrays.  The functions that the user calls are themselves
very simple, relying on `awk''s associative arrays to do work.

   The `id' program in *note Id Program::, uses these functions.


File: gawk.info,  Node: Walking Arrays,  Prev: Group Functions,  Up: Library Functions

10.7 Traversing Arrays of Arrays
================================

*note Arrays of Arrays::, described how `gawk' provides arrays of
arrays.  In particular, any element of an array may be either a scalar,
or another array. The `isarray()' function (*note Type Functions::)
lets you distinguish an array from a scalar.  The following function,
`walk_array()', recursively traverses an array, printing each element's
indices and value.  You call it with the array and a string
representing the name of the array:

     function walk_array(arr, name,      i)
     {
         for (i in arr) {
             if (isarray(arr[i]))
                 walk_array(arr[i], (name "[" i "]"))
             else
                 printf("%s[%s] = %s\n", name, i, arr[i])
         }
     }

It works by looping over each element of the array. If any given
element is itself an array, the function calls itself recursively,
passing the subarray and a new string representing the current index.
Otherwise, the function simply prints the element's name, index, and
value.  Here is a main program to demonstrate:

     BEGIN {
         a[1] = 1
         a[2][1] = 21
         a[2][2] = 22
         a[3] = 3
         a[4][1][1] = 411
         a[4][2] = 42

         walk_array(a, "a")
     }

   When run, the program produces the following output:

     $ gawk -f walk_array.awk
     -| a[4][1][1] = 411
     -| a[4][2] = 42
     -| a[1] = 1
     -| a[2][1] = 21
     -| a[2][2] = 22
     -| a[3] = 3

   Walking an array and processing each element is a general-purpose
operation.  You might want to consider generalizing the `walk_array()'
function by adding an additional parameter named `process'.

   Then, inside the loop, instead of simply printing the array element's
index and value, use the indirect function call syntax (*note Indirect
Calls::) on `process', passing it the index and the value.

   When calling `walk_array()', you would pass the name of a
user-defined function that expects to receive and index and a value,
and then processes the element.


File: gawk.info,  Node: Sample Programs,  Next: Advanced Features,  Prev: Library Functions,  Up: Top

11 Practical `awk' Programs
***************************

*note Library Functions::, presents the idea that reading programs in a
language contributes to learning that language.  This major node
continues that theme, presenting a potpourri of `awk' programs for your
reading enjoyment.

   Many of these programs use library functions presented in *note
Library Functions::.

* Menu:

* Running Examples::            How to run these examples.
* Clones::                      Clones of common utilities.
* Miscellaneous Programs::      Some interesting `awk' programs.


File: gawk.info,  Node: Running Examples,  Next: Clones,  Up: Sample Programs

11.1 Running the Example Programs
=================================

To run a given program, you would typically do something like this:

     awk -f PROGRAM -- OPTIONS FILES

Here, PROGRAM is the name of the `awk' program (such as `cut.awk'),
OPTIONS are any command-line options for the program that start with a
`-', and FILES are the actual data files.

   If your system supports the `#!' executable interpreter mechanism
(*note Executable Scripts::), you can instead run your program directly:

     cut.awk -c1-8 myfiles > results

   If your `awk' is not `gawk', you may instead need to use this:

     cut.awk -- -c1-8 myfiles > results


File: gawk.info,  Node: Clones,  Next: Miscellaneous Programs,  Prev: Running Examples,  Up: Sample Programs

11.2 Reinventing Wheels for Fun and Profit
==========================================

This minor node presents a number of POSIX utilities implemented in
`awk'.  Reinventing these programs in `awk' is often enjoyable, because
the algorithms can be very clearly expressed, and the code is usually
very concise and simple.  This is true because `awk' does so much for
you.

   It should be noted that these programs are not necessarily intended
to replace the installed versions on your system.  Nor may all of these
programs be fully compliant with the most recent POSIX standard.  This
is not a problem; their purpose is to illustrate `awk' language
programming for "real world" tasks.

   The programs are presented in alphabetical order.

* Menu:

* Cut Program::                 The `cut' utility.
* Egrep Program::               The `egrep' utility.
* Id Program::                  The `id' utility.
* Split Program::               The `split' utility.
* Tee Program::                 The `tee' utility.
* Uniq Program::                The `uniq' utility.
* Wc Program::                  The `wc' utility.


File: gawk.info,  Node: Cut Program,  Next: Egrep Program,  Up: Clones

11.2.1 Cutting out Fields and Columns
-------------------------------------

The `cut' utility selects, or "cuts," characters or fields from its
standard input and sends them to its standard output.  Fields are
separated by TABs by default, but you may supply a command-line option
to change the field "delimiter" (i.e., the field-separator character).
`cut''s definition of fields is less general than `awk''s.

   A common use of `cut' might be to pull out just the login name of
logged-on users from the output of `who'.  For example, the following
pipeline generates a sorted, unique list of the logged-on users:

     who | cut -c1-8 | sort | uniq

   The options for `cut' are:

`-c LIST'
     Use LIST as the list of characters to cut out.  Items within the
     list may be separated by commas, and ranges of characters can be
     separated with dashes.  The list `1-8,15,22-35' specifies
     characters 1 through 8, 15, and 22 through 35.

`-f LIST'
     Use LIST as the list of fields to cut out.

`-d DELIM'
     Use DELIM as the field-separator character instead of the TAB
     character.

`-s'
     Suppress printing of lines that do not contain the field delimiter.

   The `awk' implementation of `cut' uses the `getopt()' library
function (*note Getopt Function::) and the `join()' library function
(*note Join Function::).

   The program begins with a comment describing the options, the library
functions needed, and a `usage()' function that prints out a usage
message and exits.  `usage()' is called if invalid arguments are
supplied:

     # cut.awk --- implement cut in awk

     # Options:
     #    -f list     Cut fields
     #    -d c        Field delimiter character
     #    -c list     Cut characters
     #
     #    -s          Suppress lines without the delimiter
     #
     # Requires getopt() and join() library functions

     function usage(    e1, e2)
     {
         e1 = "usage: cut [-f list] [-d c] [-s] [files...]"
         e2 = "usage: cut [-c list] [files...]"
         print e1 > "/dev/stderr"
         print e2 > "/dev/stderr"
         exit 1
     }

The variables `e1' and `e2' are used so that the function fits nicely
on the screen.

   Next comes a `BEGIN' rule that parses the command-line options.  It
sets `FS' to a single TAB character, because that is `cut''s default
field separator. The rule then sets the output field separator to be the
same as the input field separator.  A loop using `getopt()' steps
through the command-line options.  Exactly one of the variables
`by_fields' or `by_chars' is set to true, to indicate that processing
should be done by fields or by characters, respectively.  When cutting
by characters, the output field separator is set to the null string:

     BEGIN    \
     {
         FS = "\t"    # default
         OFS = FS
         while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) {
             if (c == "f") {
                 by_fields = 1
                 fieldlist = Optarg
             } else if (c == "c") {
                 by_chars = 1
                 fieldlist = Optarg
                 OFS = ""
             } else if (c == "d") {
                 if (length(Optarg) > 1) {
                     printf("Using first character of %s" \
                            " for delimiter\n", Optarg) > "/dev/stderr"
                     Optarg = substr(Optarg, 1, 1)
                 }
                 FS = Optarg
                 OFS = FS
                 if (FS == " ")    # defeat awk semantics
                     FS = "[ ]"
             } else if (c == "s")
                 suppress++
             else
                 usage()
         }

         # Clear out options
         for (i = 1; i < Optind; i++)
             ARGV[i] = ""

   The code must take special care when the field delimiter is a space.
Using a single space (`" "') for the value of `FS' is incorrect--`awk'
would separate fields with runs of spaces, TABs, and/or newlines, and
we want them to be separated with individual spaces.  Also remember
that after `getopt()' is through (as described in *note Getopt
Function::), we have to clear out all the elements of `ARGV' from 1 to
`Optind', so that `awk' does not try to process the command-line options
as file names.

   After dealing with the command-line options, the program verifies
that the options make sense.  Only one or the other of `-c' and `-f'
should be used, and both require a field list.  Then the program calls
either `set_fieldlist()' or `set_charlist()' to pull apart the list of
fields or characters:

         if (by_fields && by_chars)
             usage()

         if (by_fields == 0 && by_chars == 0)
             by_fields = 1    # default

         if (fieldlist == "") {
             print "cut: needs list for -c or -f" > "/dev/stderr"
             exit 1
         }

         if (by_fields)
             set_fieldlist()
         else
             set_charlist()
     }

   `set_fieldlist()' splits the field list apart at the commas into an
array.  Then, for each element of the array, it looks to see if the
element is actually a range, and if so, splits it apart.  The function
checks the range to make sure that the first number is smaller than the
second.  Each number in the list is added to the `flist' array, which
simply lists the fields that will be printed.  Normal field splitting
is used.  The program lets `awk' handle the job of doing the field
splitting:

     function set_fieldlist(        n, m, i, j, k, f, g)
     {
         n = split(fieldlist, f, ",")
         j = 1    # index in flist
         for (i = 1; i <= n; i++) {
             if (index(f[i], "-") != 0) { # a range
                 m = split(f[i], g, "-")
                 if (m != 2 || g[1] >= g[2]) {
                     printf("bad field list: %s\n",
                                       f[i]) > "/dev/stderr"
                     exit 1
                 }
                 for (k = g[1]; k <= g[2]; k++)
                     flist[j++] = k
             } else
                 flist[j++] = f[i]
         }
         nfields = j - 1
     }

   The `set_charlist()' function is more complicated than
`set_fieldlist()'.  The idea here is to use `gawk''s `FIELDWIDTHS'
variable (*note Constant Size::), which describes constant-width input.
When using a character list, that is exactly what we have.

   Setting up `FIELDWIDTHS' is more complicated than simply listing the
fields that need to be printed.  We have to keep track of the fields to
print and also the intervening characters that have to be skipped.  For
example, suppose you wanted characters 1 through 8, 15, and 22 through
35.  You would use `-c 1-8,15,22-35'.  The necessary value for
`FIELDWIDTHS' is `"8 6 1 6 14"'.  This yields five fields, and the
fields to print are `$1', `$3', and `$5'.  The intermediate fields are
"filler", which is stuff in between the desired data.  `flist' lists
the fields to print, and `t' tracks the complete field list, including
filler fields:

     function set_charlist(    field, i, j, f, g, t,
                               filler, last, len)
     {
         field = 1   # count total fields
         n = split(fieldlist, f, ",")
         j = 1       # index in flist
         for (i = 1; i <= n; i++) {
             if (index(f[i], "-") != 0) { # range
                 m = split(f[i], g, "-")
                 if (m != 2 || g[1] >= g[2]) {
                     printf("bad character list: %s\n",
                                    f[i]) > "/dev/stderr"
                     exit 1
                 }
                 len = g[2] - g[1] + 1
                 if (g[1] > 1)  # compute length of filler
                     filler = g[1] - last - 1
                 else
                     filler = 0
                 if (filler)
                     t[field++] = filler
                 t[field++] = len  # length of field
                 last = g[2]
                 flist[j++] = field - 1
             } else {
                 if (f[i] > 1)
                     filler = f[i] - last - 1
                 else
                     filler = 0
                 if (filler)
                     t[field++] = filler
                 t[field++] = 1
                 last = f[i]
                 flist[j++] = field - 1
             }
         }
         FIELDWIDTHS = join(t, 1, field - 1)
         nfields = j - 1
     }

   Next is the rule that actually processes the data.  If the `-s'
option is given, then `suppress' is true.  The first `if' statement
makes sure that the input record does have the field separator.  If
`cut' is processing fields, `suppress' is true, and the field separator
character is not in the record, then the record is skipped.

   If the record is valid, then `gawk' has split the data into fields,
either using the character in `FS' or using fixed-length fields and
`FIELDWIDTHS'.  The loop goes through the list of fields that should be
printed.  The corresponding field is printed if it contains data.  If
the next field also has data, then the separator character is written
out between the fields:

     {
         if (by_fields && suppress && index($0, FS) == 0)
             next

         for (i = 1; i <= nfields; i++) {
             if ($flist[i] != "") {
                 printf "%s", $flist[i]
                 if (i < nfields && $flist[i+1] != "")
                     printf "%s", OFS
             }
         }
         print ""
     }

   This version of `cut' relies on `gawk''s `FIELDWIDTHS' variable to
do the character-based cutting.  While it is possible in other `awk'
implementations to use `substr()' (*note String Functions::), it is
also extremely painful.  The `FIELDWIDTHS' variable supplies an elegant
solution to the problem of picking the input line apart by characters.


File: gawk.info,  Node: Egrep Program,  Next: Id Program,  Prev: Cut Program,  Up: Clones

11.2.2 Searching for Regular Expressions in Files
-------------------------------------------------

The `egrep' utility searches files for patterns.  It uses regular
expressions that are almost identical to those available in `awk'
(*note Regexp::).  You invoke it as follows:

     egrep [ OPTIONS ] 'PATTERN' FILES ...

   The PATTERN is a regular expression.  In typical usage, the regular
expression is quoted to prevent the shell from expanding any of the
special characters as file name wildcards.  Normally, `egrep' prints
the lines that matched.  If multiple file names are provided on the
command line, each output line is preceded by the name of the file and
a colon.

   The options to `egrep' are as follows:

`-c'
     Print out a count of the lines that matched the pattern, instead
     of the lines themselves.

`-s'
     Be silent.  No output is produced and the exit value indicates
     whether the pattern was matched.

`-v'
     Invert the sense of the test. `egrep' prints the lines that do
     _not_ match the pattern and exits successfully if the pattern is
     not matched.

`-i'
     Ignore case distinctions in both the pattern and the input data.

`-l'
     Only print (list) the names of the files that matched, not the
     lines that matched.

`-e PATTERN'
     Use PATTERN as the regexp to match.  The purpose of the `-e'
     option is to allow patterns that start with a `-'.

   This version uses the `getopt()' library function (*note Getopt
Function::) and the file transition library program (*note Filetrans
Function::).

   The program begins with a descriptive comment and then a `BEGIN' rule
that processes the command-line arguments with `getopt()'.  The `-i'
(ignore case) option is particularly easy with `gawk'; we just use the
`IGNORECASE' built-in variable (*note Built-in Variables::):

     # egrep.awk --- simulate egrep in awk
     #
     # Options:
     #    -c    count of lines
     #    -s    silent - use exit value
     #    -v    invert test, success if no match
     #    -i    ignore case
     #    -l    print filenames only
     #    -e    argument is pattern
     #
     # Requires getopt and file transition library functions

     BEGIN {
         while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) {
             if (c == "c")
                 count_only++
             else if (c == "s")
                 no_print++
             else if (c == "v")
                 invert++
             else if (c == "i")
                 IGNORECASE = 1
             else if (c == "l")
                 filenames_only++
             else if (c == "e")
                 pattern = Optarg
             else
                 usage()
         }

   Next comes the code that handles the `egrep'-specific behavior. If no
pattern is supplied with `-e', the first nonoption on the command line
is used.  The `awk' command-line arguments up to `ARGV[Optind]' are
cleared, so that `awk' won't try to process them as files.  If no files
are specified, the standard input is used, and if multiple files are
specified, we make sure to note this so that the file names can precede
the matched lines in the output:

         if (pattern == "")
             pattern = ARGV[Optind++]

         for (i = 1; i < Optind; i++)
             ARGV[i] = ""
         if (Optind >= ARGC) {
             ARGV[1] = "-"
             ARGC = 2
         } else if (ARGC - Optind > 1)
             do_filenames++

     #    if (IGNORECASE)
     #        pattern = tolower(pattern)
     }

   The last two lines are commented out, since they are not needed in
`gawk'.  They should be uncommented if you have to use another version
of `awk'.

   The next set of lines should be uncommented if you are not using
`gawk'.  This rule translates all the characters in the input line into
lowercase if the `-i' option is specified.(1) The rule is commented out
since it is not necessary with `gawk':

     #{
     #    if (IGNORECASE)
     #        $0 = tolower($0)
     #}

   The `beginfile()' function is called by the rule in `ftrans.awk'
when each new file is processed.  In this case, it is very simple; all
it does is initialize a variable `fcount' to zero. `fcount' tracks how
many lines in the current file matched the pattern.  Naming the
parameter `junk' shows we know that `beginfile()' is called with a
parameter, but that we're not interested in its value:

     function beginfile(junk)
     {
         fcount = 0
     }

   The `endfile()' function is called after each file has been
processed.  It affects the output only when the user wants a count of
the number of lines that matched.  `no_print' is true only if the exit
status is desired.  `count_only' is true if line counts are desired.
`egrep' therefore only prints line counts if printing and counting are
enabled.  The output format must be adjusted depending upon the number
of files to process.  Finally, `fcount' is added to `total', so that we
know the total number of lines that matched the pattern:

     function endfile(file)
     {
         if (! no_print && count_only) {
             if (do_filenames)
                 print file ":" fcount
             else
                 print fcount
         }

         total += fcount
     }

   The following rule does most of the work of matching lines. The
variable `matches' is true if the line matched the pattern. If the user
wants lines that did not match, the sense of `matches' is inverted
using the `!' operator. `fcount' is incremented with the value of
`matches', which is either one or zero, depending upon a successful or
unsuccessful match.  If the line does not match, the `next' statement
just moves on to the next record.

   A number of additional tests are made, but they are only done if we
are not counting lines.  First, if the user only wants exit status
(`no_print' is true), then it is enough to know that _one_ line in this
file matched, and we can skip on to the next file with `nextfile'.
Similarly, if we are only printing file names, we can print the file
name, and then skip to the next file with `nextfile'.  Finally, each
line is printed, with a leading file name and colon if necessary:

     {
         matches = ($0 ~ pattern)
         if (invert)
             matches = ! matches

         fcount += matches    # 1 or 0

         if (! matches)
             next

         if (! count_only) {
             if (no_print)
                 nextfile

             if (filenames_only) {
                 print FILENAME
                 nextfile
             }

             if (do_filenames)
                 print FILENAME ":" $0
             else
                 print
         }
     }

   The `END' rule takes care of producing the correct exit status. If
there are no matches, the exit status is one; otherwise it is zero:

     END    \
     {
         if (total == 0)
             exit 1
         exit 0
     }

   The `usage()' function prints a usage message in case of invalid
options, and then exits:

     function usage(    e)
     {
         e = "Usage: egrep [-csvil] [-e pat] [files ...]"
         e = e "\n\tegrep [-csvil] pat [files ...]"
         print e > "/dev/stderr"
         exit 1
     }

   The variable `e' is used so that the function fits nicely on the
printed page.

   Just a note on programming style: you may have noticed that the `END'
rule uses backslash continuation, with the open brace on a line by
itself.  This is so that it more closely resembles the way functions
are written.  Many of the examples in this major node use this style.
You can decide for yourself if you like writing your `BEGIN' and `END'
rules this way or not.

   ---------- Footnotes ----------

   (1) It also introduces a subtle bug; if a match happens, we output
the translated line, not the original.


File: gawk.info,  Node: Id Program,  Next: Split Program,  Prev: Egrep Program,  Up: Clones

11.2.3 Printing out User Information
------------------------------------

The `id' utility lists a user's real and effective user ID numbers,
real and effective group ID numbers, and the user's group set, if any.
`id' only prints the effective user ID and group ID if they are
different from the real ones.  If possible, `id' also supplies the
corresponding user and group names.  The output might look like this:

     $ id
     -| uid=500(arnold) gid=500(arnold) groups=6(disk),7(lp),19(floppy)

   This information is part of what is provided by `gawk''s `PROCINFO'
array (*note Built-in Variables::).  However, the `id' utility provides
a more palatable output than just individual numbers.

   Here is a simple version of `id' written in `awk'.  It uses the user
database library functions (*note Passwd Functions::) and the group
database library functions (*note Group Functions::):

   The program is fairly straightforward.  All the work is done in the
`BEGIN' rule.  The user and group ID numbers are obtained from
`PROCINFO'.  The code is repetitive.  The entry in the user database
for the real user ID number is split into parts at the `:'. The name is
the first field.  Similar code is used for the effective user ID number
and the group numbers:

     # id.awk --- implement id in awk
     #
     # Requires user and group library functions
     # output is:
     # uid=12(foo) euid=34(bar) gid=3(baz) \
     #             egid=5(blat) groups=9(nine),2(two),1(one)

     BEGIN    \
     {
         uid = PROCINFO["uid"]
         euid = PROCINFO["euid"]
         gid = PROCINFO["gid"]
         egid = PROCINFO["egid"]

         printf("uid=%d", uid)
         pw = getpwuid(uid)
         if (pw != "") {
             split(pw, a, ":")
             printf("(%s)", a[1])
         }

         if (euid != uid) {
             printf(" euid=%d", euid)
             pw = getpwuid(euid)
             if (pw != "") {
                 split(pw, a, ":")
                 printf("(%s)", a[1])
             }
         }

         printf(" gid=%d", gid)
         pw = getgrgid(gid)
         if (pw != "") {
             split(pw, a, ":")
             printf("(%s)", a[1])
         }

         if (egid != gid) {
             printf(" egid=%d", egid)
             pw = getgrgid(egid)
             if (pw != "") {
                 split(pw, a, ":")
                 printf("(%s)", a[1])
             }
         }

         for (i = 1; ("group" i) in PROCINFO; i++) {
             if (i == 1)
                 printf(" groups=")
             group = PROCINFO["group" i]
             printf("%d", group)
             pw = getgrgid(group)
             if (pw != "") {
                 split(pw, a, ":")
                 printf("(%s)", a[1])
             }
             if (("group" (i+1)) in PROCINFO)
                 printf(",")
         }

         print ""
     }

   The test in the `for' loop is worth noting.  Any supplementary
groups in the `PROCINFO' array have the indices `"group1"' through
`"groupN"' for some N, i.e., the total number of supplementary groups.
However, we don't know in advance how many of these groups there are.

   This loop works by starting at one, concatenating the value with
`"group"', and then using `in' to see if that value is in the array.
Eventually, `i' is incremented past the last group in the array and the
loop exits.

   The loop is also correct if there are _no_ supplementary groups;
then the condition is false the first time it's tested, and the loop
body never executes.


File: gawk.info,  Node: Split Program,  Next: Tee Program,  Prev: Id Program,  Up: Clones

11.2.4 Splitting a Large File into Pieces
-----------------------------------------

The `split' program splits large text files into smaller pieces.  Usage
is as follows:(1)

     split [-COUNT] file [ PREFIX ]

   By default, the output files are named `xaa', `xab', and so on. Each
file has 1000 lines in it, with the likely exception of the last file.
To change the number of lines in each file, supply a number on the
command line preceded with a minus; e.g., `-500' for files with 500
lines in them instead of 1000.  To change the name of the output files
to something like `myfileaa', `myfileab', and so on, supply an
additional argument that specifies the file name prefix.

   Here is a version of `split' in `awk'. It uses the `ord()' and
`chr()' functions presented in *note Ordinal Functions::.

   The program first sets its defaults, and then tests to make sure
there are not too many arguments.  It then looks at each argument in
turn.  The first argument could be a minus sign followed by a number.
If it is, this happens to look like a negative number, so it is made
positive, and that is the count of lines.  The data file name is
skipped over and the final argument is used as the prefix for the
output file names:

     # split.awk --- do split in awk
     #
     # Requires ord() and chr() library functions
     # usage: split [-num] [file] [outname]

     BEGIN {
         outfile = "x"    # default
         count = 1000
         if (ARGC > 4)
             usage()

         i = 1
         if (ARGV[i] ~ /^-[[:digit:]]+$/) {
             count = -ARGV[i]
             ARGV[i] = ""
             i++
         }
         # test argv in case reading from stdin instead of file
         if (i in ARGV)
             i++    # skip data file name
         if (i in ARGV) {
             outfile = ARGV[i]
             ARGV[i] = ""
         }

         s1 = s2 = "a"
         out = (outfile s1 s2)
     }

   The next rule does most of the work. `tcount' (temporary count)
tracks how many lines have been printed to the output file so far. If
it is greater than `count', it is time to close the current file and
start a new one.  `s1' and `s2' track the current suffixes for the file
name. If they are both `z', the file is just too big.  Otherwise, `s1'
moves to the next letter in the alphabet and `s2' starts over again at
`a':

     {
         if (++tcount > count) {
             close(out)
             if (s2 == "z") {
                 if (s1 == "z") {
                     printf("split: %s is too large to split\n",
                            FILENAME) > "/dev/stderr"
                     exit 1
                 }
                 s1 = chr(ord(s1) + 1)
                 s2 = "a"
             }
             else
                 s2 = chr(ord(s2) + 1)
             out = (outfile s1 s2)
             tcount = 1
         }
         print > out
     }

The `usage()' function simply prints an error message and exits:

     function usage(   e)
     {
         e = "usage: split [-num] [file] [outname]"
         print e > "/dev/stderr"
         exit 1
     }

The variable `e' is used so that the function fits nicely on the screen.

   This program is a bit sloppy; it relies on `awk' to automatically
close the last file instead of doing it in an `END' rule.  It also
assumes that letters are contiguous in the character set, which isn't
true for EBCDIC systems.

   ---------- Footnotes ----------

   (1) This is the traditional usage. The POSIX usage is different, but
not relevant for what the program aims to demonstrate.


File: gawk.info,  Node: Tee Program,  Next: Uniq Program,  Prev: Split Program,  Up: Clones

11.2.5 Duplicating Output into Multiple Files
---------------------------------------------

The `tee' program is known as a "pipe fitting."  `tee' copies its
standard input to its standard output and also duplicates it to the
files named on the command line.  Its usage is as follows:

     tee [-a] file ...

   The `-a' option tells `tee' to append to the named files, instead of
truncating them and starting over.

   The `BEGIN' rule first makes a copy of all the command-line arguments
into an array named `copy'.  `ARGV[0]' is not copied, since it is not
needed.  `tee' cannot use `ARGV' directly, since `awk' attempts to
process each file name in `ARGV' as input data.

   If the first argument is `-a', then the flag variable `append' is
set to true, and both `ARGV[1]' and `copy[1]' are deleted. If `ARGC' is
less than two, then no file names were supplied and `tee' prints a
usage message and exits.  Finally, `awk' is forced to read the standard
input by setting `ARGV[1]' to `"-"' and `ARGC' to two:

     # tee.awk --- tee in awk
     #
     # Copy standard input to all named output files.
     # Append content if -a option is supplied.
     #
     BEGIN    \
     {
         for (i = 1; i < ARGC; i++)
             copy[i] = ARGV[i]

         if (ARGV[1] == "-a") {
             append = 1
             delete ARGV[1]
             delete copy[1]
             ARGC--
         }
         if (ARGC < 2) {
             print "usage: tee [-a] file ..." > "/dev/stderr"
             exit 1
         }
         ARGV[1] = "-"
         ARGC = 2
     }

   The following single rule does all the work.  Since there is no
pattern, it is executed for each line of input.  The body of the rule
simply prints the line into each file on the command line, and then to
the standard output:

     {
         # moving the if outside the loop makes it run faster
         if (append)
             for (i in copy)
                 print >> copy[i]
         else
             for (i in copy)
                 print > copy[i]
         print
     }

It is also possible to write the loop this way:

     for (i in copy)
         if (append)
             print >> copy[i]
         else
             print > copy[i]

This is more concise but it is also less efficient.  The `if' is tested
for each record and for each output file.  By duplicating the loop
body, the `if' is only tested once for each input record.  If there are
N input records and M output files, the first method only executes N
`if' statements, while the second executes N`*'M `if' statements.

   Finally, the `END' rule cleans up by closing all the output files:

     END    \
     {
         for (i in copy)
             close(copy[i])
     }


File: gawk.info,  Node: Uniq Program,  Next: Wc Program,  Prev: Tee Program,  Up: Clones

11.2.6 Printing Nonduplicated Lines of Text
-------------------------------------------

The `uniq' utility reads sorted lines of data on its standard input,
and by default removes duplicate lines.  In other words, it only prints
unique lines--hence the name.  `uniq' has a number of options. The
usage is as follows:

     uniq [-udc [-N]] [+N] [ INPUT FILE [ OUTPUT FILE ]]

   The options for `uniq' are:

`-d'
     Print only repeated lines.

`-u'
     Print only nonrepeated lines.

`-c'
     Count lines. This option overrides `-d' and `-u'.  Both repeated
     and nonrepeated lines are counted.

`-N'
     Skip N fields before comparing lines.  The definition of fields is
     similar to `awk''s default: nonwhitespace characters separated by
     runs of spaces and/or TABs.

`+N'
     Skip N characters before comparing lines.  Any fields specified
     with `-N' are skipped first.

`INPUT FILE'
     Data is read from the input file named on the command line,
     instead of from the standard input.

`OUTPUT FILE'
     The generated output is sent to the named output file, instead of
     to the standard output.

   Normally `uniq' behaves as if both the `-d' and `-u' options are
provided.

   `uniq' uses the `getopt()' library function (*note Getopt Function::)
and the `join()' library function (*note Join Function::).

   The program begins with a `usage()' function and then a brief
outline of the options and their meanings in comments.  The `BEGIN'
rule deals with the command-line arguments and options. It uses a trick
to get `getopt()' to handle options of the form `-25', treating such an
option as the option letter `2' with an argument of `5'. If indeed two
or more digits are supplied (`Optarg' looks like a number), `Optarg' is
concatenated with the option digit and then the result is added to zero
to make it into a number.  If there is only one digit in the option,
then `Optarg' is not needed. In this case, `Optind' must be decremented
so that `getopt()' processes it next time.  This code is admittedly a
bit tricky.

   If no options are supplied, then the default is taken, to print both
repeated and nonrepeated lines.  The output file, if provided, is
assigned to `outputfile'.  Early on, `outputfile' is initialized to the
standard output, `/dev/stdout':

     # uniq.awk --- do uniq in awk
     #
     # Requires getopt() and join() library functions

     function usage(    e)
     {
         e = "Usage: uniq [-udc [-n]] [+n] [ in [ out ]]"
         print e > "/dev/stderr"
         exit 1
     }

     # -c    count lines. overrides -d and -u
     # -d    only repeated lines
     # -u    only nonrepeated lines
     # -n    skip n fields
     # +n    skip n characters, skip fields first

     BEGIN   \
     {
         count = 1
         outputfile = "/dev/stdout"
         opts = "udc0:1:2:3:4:5:6:7:8:9:"
         while ((c = getopt(ARGC, ARGV, opts)) != -1) {
             if (c == "u")
                 non_repeated_only++
             else if (c == "d")
                 repeated_only++
             else if (c == "c")
                 do_count++
             else if (index("0123456789", c) != 0) {
                 # getopt requires args to options
                 # this messes us up for things like -5
                 if (Optarg ~ /^[[:digit:]]+$/)
                     fcount = (c Optarg) + 0
                 else {
                     fcount = c + 0
                     Optind--
                 }
             } else
                 usage()
         }

         if (ARGV[Optind] ~ /^\+[[:digit:]]+$/) {
             charcount = substr(ARGV[Optind], 2) + 0
             Optind++
         }

         for (i = 1; i < Optind; i++)
             ARGV[i] = ""

         if (repeated_only == 0 && non_repeated_only == 0)
             repeated_only = non_repeated_only = 1

         if (ARGC - Optind == 2) {
             outputfile = ARGV[ARGC - 1]
             ARGV[ARGC - 1] = ""
         }
     }

   The following function, `are_equal()', compares the current line,
`$0', to the previous line, `last'.  It handles skipping fields and
characters.  If no field count and no character count are specified,
`are_equal()' simply returns one or zero depending upon the result of a
simple string comparison of `last' and `$0'.  Otherwise, things get more
complicated.  If fields have to be skipped, each line is broken into an
array using `split()' (*note String Functions::); the desired fields
are then joined back into a line using `join()'.  The joined lines are
stored in `clast' and `cline'.  If no fields are skipped, `clast' and
`cline' are set to `last' and `$0', respectively.  Finally, if
characters are skipped, `substr()' is used to strip off the leading
`charcount' characters in `clast' and `cline'.  The two strings are
then compared and `are_equal()' returns the result:

     function are_equal(    n, m, clast, cline, alast, aline)
     {
         if (fcount == 0 && charcount == 0)
             return (last == $0)

         if (fcount > 0) {
             n = split(last, alast)
             m = split($0, aline)
             clast = join(alast, fcount+1, n)
             cline = join(aline, fcount+1, m)
         } else {
             clast = last
             cline = $0
         }
         if (charcount) {
             clast = substr(clast, charcount + 1)
             cline = substr(cline, charcount + 1)
         }

         return (clast == cline)
     }

   The following two rules are the body of the program.  The first one
is executed only for the very first line of data.  It sets `last' equal
to `$0', so that subsequent lines of text have something to be compared
to.

   The second rule does the work. The variable `equal' is one or zero,
depending upon the results of `are_equal()''s comparison. If `uniq' is
counting repeated lines, and the lines are equal, then it increments
the `count' variable.  Otherwise, it prints the line and resets `count',
since the two lines are not equal.

   If `uniq' is not counting, and if the lines are equal, `count' is
incremented.  Nothing is printed, since the point is to remove
duplicates.  Otherwise, if `uniq' is counting repeated lines and more
than one line is seen, or if `uniq' is counting nonrepeated lines and
only one line is seen, then the line is printed, and `count' is reset.

   Finally, similar logic is used in the `END' rule to print the final
line of input data:

     NR == 1 {
         last = $0
         next
     }

     {
         equal = are_equal()

         if (do_count) {    # overrides -d and -u
             if (equal)
                 count++
             else {
                 printf("%4d %s\n", count, last) > outputfile
                 last = $0
                 count = 1    # reset
             }
             next
         }

         if (equal)
             count++
         else {
             if ((repeated_only && count > 1) ||
                 (non_repeated_only && count == 1))
                     print last > outputfile
             last = $0
             count = 1
         }
     }

     END {
         if (do_count)
             printf("%4d %s\n", count, last) > outputfile
         else if ((repeated_only && count > 1) ||
                 (non_repeated_only && count == 1))
             print last > outputfile
         close(outputfile)
     }


File: gawk.info,  Node: Wc Program,  Prev: Uniq Program,  Up: Clones

11.2.7 Counting Things
----------------------

The `wc' (word count) utility counts lines, words, and characters in
one or more input files. Its usage is as follows:

     wc [-lwc] [ FILES ... ]

   If no files are specified on the command line, `wc' reads its
standard input. If there are multiple files, it also prints total
counts for all the files.  The options and their meanings are shown in
the following list:

`-l'
     Count only lines.

`-w'
     Count only words.  A "word" is a contiguous sequence of
     nonwhitespace characters, separated by spaces and/or TABs.
     Luckily, this is the normal way `awk' separates fields in its
     input data.

`-c'
     Count only characters.

   Implementing `wc' in `awk' is particularly elegant, since `awk' does
a lot of the work for us; it splits lines into words (i.e., fields) and
counts them, it counts lines (i.e., records), and it can easily tell us
how long a line is.

   This program uses the `getopt()' library function (*note Getopt
Function::) and the file-transition functions (*note Filetrans
Function::).

   This version has one notable difference from traditional versions of
`wc': it always prints the counts in the order lines, words, and
characters.  Traditional versions note the order of the `-l', `-w', and
`-c' options on the command line, and print the counts in that order.

   The `BEGIN' rule does the argument processing.  The variable
`print_total' is true if more than one file is named on the command
line:

     # wc.awk --- count lines, words, characters

     # Options:
     #    -l    only count lines
     #    -w    only count words
     #    -c    only count characters
     #
     # Default is to count lines, words, characters
     #
     # Requires getopt() and file transition library functions

     BEGIN {
         # let getopt() print a message about
         # invalid options. we ignore them
         while ((c = getopt(ARGC, ARGV, "lwc")) != -1) {
             if (c == "l")
                 do_lines = 1
             else if (c == "w")
                 do_words = 1
             else if (c == "c")
                 do_chars = 1
         }
         for (i = 1; i < Optind; i++)
             ARGV[i] = ""

         # if no options, do all
         if (! do_lines && ! do_words && ! do_chars)
             do_lines = do_words = do_chars = 1

         print_total = (ARGC - i > 2)
     }

   The `beginfile()' function is simple; it just resets the counts of
lines, words, and characters to zero, and saves the current file name in
`fname':

     function beginfile(file)
     {
         lines = words = chars = 0
         fname = FILENAME
     }

   The `endfile()' function adds the current file's numbers to the
running totals of lines, words, and characters.(1)  It then prints out
those numbers for the file that was just read. It relies on
`beginfile()' to reset the numbers for the following data file:

     function endfile(file)
     {
         tlines += lines
         twords += words
         tchars += chars
         if (do_lines)
             printf "\t%d", lines
         if (do_words)
             printf "\t%d", words
         if (do_chars)
             printf "\t%d", chars
         printf "\t%s\n", fname
     }

   There is one rule that is executed for each line. It adds the length
of the record, plus one, to `chars'.(2) Adding one plus the record
length is needed because the newline character separating records (the
value of `RS') is not part of the record itself, and thus not included
in its length.  Next, `lines' is incremented for each line read, and
`words' is incremented by the value of `NF', which is the number of
"words" on this line:

     # do per line
     {
         chars += length($0) + 1    # get newline
         lines++
         words += NF
     }

   Finally, the `END' rule simply prints the totals for all the files:

     END {
         if (print_total) {
             if (do_lines)
                 printf "\t%d", tlines
             if (do_words)
                 printf "\t%d", twords
             if (do_chars)
                 printf "\t%d", tchars
             print "\ttotal"
         }
     }

   ---------- Footnotes ----------

   (1) `wc' can't just use the value of `FNR' in `endfile()'. If you
examine the code in *note Filetrans Function::, you will see that `FNR'
has already been reset by the time `endfile()' is called.

   (2) Since `gawk' understands multibyte locales, this code counts
characters, not bytes.


File: gawk.info,  Node: Miscellaneous Programs,  Prev: Clones,  Up: Sample Programs

11.3 A Grab Bag of `awk' Programs
=================================

This minor node is a large "grab bag" of miscellaneous programs.  We
hope you find them both interesting and enjoyable.

* Menu:

* Dupword Program::             Finding duplicated words in a document.
* Alarm Program::               An alarm clock.
* Translate Program::           A program similar to the `tr' utility.
* Labels Program::              Printing mailing labels.
* Word Sorting::                A program to produce a word usage count.
* History Sorting::             Eliminating duplicate entries from a history
                                file.
* Extract Program::             Pulling out programs from Texinfo source
                                files.
* Simple Sed::                  A Simple Stream Editor.
* Igawk Program::               A wrapper for `awk' that includes
                                files.
* Anagram Program::             Finding anagrams from a dictionary.
* Signature Program::           People do amazing things with too much time on
                                their hands.


File: gawk.info,  Node: Dupword Program,  Next: Alarm Program,  Up: Miscellaneous Programs

11.3.1 Finding Duplicated Words in a Document
---------------------------------------------

A common error when writing large amounts of prose is to accidentally
duplicate words.  Typically you will see this in text as something like
"the the program does the following..."  When the text is online, often
the duplicated words occur at the end of one line and the beginning of
another, making them very difficult to spot.

   This program, `dupword.awk', scans through a file one line at a time
and looks for adjacent occurrences of the same word.  It also saves the
last word on a line (in the variable `prev') for comparison with the
first word on the next line.

   The first two statements make sure that the line is all lowercase,
so that, for example, "The" and "the" compare equal to each other.  The
next statement replaces nonalphanumeric and nonwhitespace characters
with spaces, so that punctuation does not affect the comparison either.
The characters are replaced with spaces so that formatting controls
don't create nonsense words (e.g., the Texinfo `@code{NF}' becomes
`codeNF' if punctuation is simply deleted).  The record is then resplit
into fields, yielding just the actual words on the line, and ensuring
that there are no empty fields.

   If there are no fields left after removing all the punctuation, the
current record is skipped.  Otherwise, the program loops through each
word, comparing it to the previous one:

     # dupword.awk --- find duplicate words in text
     {
         $0 = tolower($0)
         gsub(/[^[:alnum:][:blank:]]/, " ");
         $0 = $0         # re-split
         if (NF == 0)
             next
         if ($1 == prev)
             printf("%s:%d: duplicate %s\n",
                 FILENAME, FNR, $1)
         for (i = 2; i <= NF; i++)
             if ($i == $(i-1))
                 printf("%s:%d: duplicate %s\n",
                     FILENAME, FNR, $i)
         prev = $NF
     }


File: gawk.info,  Node: Alarm Program,  Next: Translate Program,  Prev: Dupword Program,  Up: Miscellaneous Programs

11.3.2 An Alarm Clock Program
-----------------------------

     Nothing cures insomnia like a ringing alarm clock.  -- Arnold
     Robbins

   The following program is a simple "alarm clock" program.  You give
it a time of day and an optional message.  At the specified time, it
prints the message on the standard output. In addition, you can give it
the number of times to repeat the message as well as a delay between
repetitions.

   This program uses the `getlocaltime()' function from *note
Getlocaltime Function::.

   All the work is done in the `BEGIN' rule.  The first part is argument
checking and setting of defaults: the delay, the count, and the message
to print.  If the user supplied a message without the ASCII BEL
character (known as the "alert" character, `"\a"'), then it is added to
the message.  (On many systems, printing the ASCII BEL generates an
audible alert. Thus when the alarm goes off, the system calls attention
to itself in case the user is not looking at the computer.)  Just for a
change, this program uses a `switch' statement (*note Switch
Statement::), but the processing could be done with a series of
`if'-`else' statements instead.  Here is the program:

     # alarm.awk --- set an alarm
     #
     # Requires getlocaltime() library function
     # usage: alarm time [ "message" [ count [ delay ] ] ]

     BEGIN    \
     {
         # Initial argument sanity checking
         usage1 = "usage: alarm time ['message' [count [delay]]]"
         usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1])

         if (ARGC < 2) {
             print usage1 > "/dev/stderr"
             print usage2 > "/dev/stderr"
             exit 1
         }
         switch (ARGC) {
         case 5:
             delay = ARGV[4] + 0
             # fall through
         case 4:
             count = ARGV[3] + 0
             # fall through
         case 3:
             message = ARGV[2]
             break
         default:
             if (ARGV[1] !~ /[[:digit:]]?[[:digit:]]:[[:digit:]]{2}/) {
                 print usage1 > "/dev/stderr"
                 print usage2 > "/dev/stderr"
                 exit 1
             }
             break
         }

         # set defaults for once we reach the desired time
         if (delay == 0)
             delay = 180    # 3 minutes
         if (count == 0)
             count = 5
         if (message == "")
             message = sprintf("\aIt is now %s!\a", ARGV[1])
         else if (index(message, "\a") == 0)
             message = "\a" message "\a"

   The next minor node of code turns the alarm time into hours and
minutes, converts it (if necessary) to a 24-hour clock, and then turns
that time into a count of the seconds since midnight.  Next it turns
the current time into a count of seconds since midnight.  The
difference between the two is how long to wait before setting off the
alarm:

         # split up alarm time
         split(ARGV[1], atime, ":")
         hour = atime[1] + 0    # force numeric
         minute = atime[2] + 0  # force numeric

         # get current broken down time
         getlocaltime(now)

         # if time given is 12-hour hours and it's after that
         # hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m.,
         # then add 12 to real hour
         if (hour < 12 && now["hour"] > hour)
             hour += 12

         # set target time in seconds since midnight
         target = (hour * 60 * 60) + (minute * 60)

         # get current time in seconds since midnight
         current = (now["hour"] * 60 * 60) + \
                    (now["minute"] * 60) + now["second"]

         # how long to sleep for
         naptime = target - current
         if (naptime <= 0) {
             print "time is in the past!" > "/dev/stderr"
             exit 1
         }

   Finally, the program uses the `system()' function (*note I/O
Functions::) to call the `sleep' utility.  The `sleep' utility simply
pauses for the given number of seconds.  If the exit status is not zero,
the program assumes that `sleep' was interrupted and exits. If `sleep'
exited with an OK status (zero), then the program prints the message in
a loop, again using `sleep' to delay for however many seconds are
necessary:

         # zzzzzz..... go away if interrupted
         if (system(sprintf("sleep %d", naptime)) != 0)
             exit 1

         # time to notify!
         command = sprintf("sleep %d", delay)
         for (i = 1; i <= count; i++) {
             print message
             # if sleep command interrupted, go away
             if (system(command) != 0)
                 break
         }

         exit 0
     }


File: gawk.info,  Node: Translate Program,  Next: Labels Program,  Prev: Alarm Program,  Up: Miscellaneous Programs

11.3.3 Transliterating Characters
---------------------------------

The system `tr' utility transliterates characters.  For example, it is
often used to map uppercase letters into lowercase for further
processing:

     GENERATE DATA | tr 'A-Z' 'a-z' | PROCESS DATA ...

   `tr' requires two lists of characters.(1)  When processing the
input, the first character in the first list is replaced with the first
character in the second list, the second character in the first list is
replaced with the second character in the second list, and so on.  If
there are more characters in the "from" list than in the "to" list, the
last character of the "to" list is used for the remaining characters in
the "from" list.

   Some time ago, a user proposed that a transliteration function should
be added to `gawk'.  The following program was written to prove that
character transliteration could be done with a user-level function.
This program is not as complete as the system `tr' utility but it does
most of the job.

   The `translate' program demonstrates one of the few weaknesses of
standard `awk': dealing with individual characters is very painful,
requiring repeated use of the `substr()', `index()', and `gsub()'
built-in functions (*note String Functions::).(2) There are two
functions.  The first, `stranslate()', takes three arguments:

`from'
     A list of characters from which to translate.

`to'
     A list of characters to which to translate.

`target'
     The string on which to do the translation.

   Associative arrays make the translation part fairly easy. `t_ar'
holds the "to" characters, indexed by the "from" characters.  Then a
simple loop goes through `from', one character at a time.  For each
character in `from', if the character appears in `target', it is
replaced with the corresponding `to' character.

   The `translate()' function simply calls `stranslate()' using `$0' as
the target.  The main program sets two global variables, `FROM' and
`TO', from the command line, and then changes `ARGV' so that `awk'
reads from the standard input.

   Finally, the processing rule simply calls `translate()' for each
record:

     # translate.awk --- do tr-like stuff
     # Bugs: does not handle things like: tr A-Z a-z, it has
     # to be spelled out. However, if `to' is shorter than `from',
     # the last character in `to' is used for the rest of `from'.

     function stranslate(from, to, target,     lf, lt, ltarget, t_ar, i, c,
                                                                    result)
     {
         lf = length(from)
         lt = length(to)
         ltarget = length(target)
         for (i = 1; i <= lt; i++)
             t_ar[substr(from, i, 1)] = substr(to, i, 1)
         if (lt < lf)
             for (; i <= lf; i++)
                 t_ar[substr(from, i, 1)] = substr(to, lt, 1)
         for (i = 1; i <= ltarget; i++) {
             c = substr(target, i, 1)
             if (c in t_ar)
                 c = t_ar[c]
             result = result c
         }
         return result
     }

     function translate(from, to)
     {
         return $0 = stranslate(from, to, $0)
     }

     # main program
     BEGIN {
         if (ARGC < 3) {
             print "usage: translate from to" > "/dev/stderr"
             exit
         }
         FROM = ARGV[1]
         TO = ARGV[2]
         ARGC = 2
         ARGV[1] = "-"
     }

     {
         translate(FROM, TO)
         print
     }

   While it is possible to do character transliteration in a user-level
function, it is not necessarily efficient, and we (the `gawk' authors)
started to consider adding a built-in function.  However, shortly after
writing this program, we learned that the System V Release 4 `awk' had
added the `toupper()' and `tolower()' functions (*note String
Functions::).  These functions handle the vast majority of the cases
where character transliteration is necessary, and so we chose to simply
add those functions to `gawk' as well and then leave well enough alone.

   An obvious improvement to this program would be to set up the `t_ar'
array only once, in a `BEGIN' rule. However, this assumes that the
"from" and "to" lists will never change throughout the lifetime of the
program.

   ---------- Footnotes ----------

   (1) On some older systems, including Solaris, `tr' may require that
the lists be written as range expressions enclosed in square brackets
(`[a-z]') and quoted, to prevent the shell from attempting a file name
expansion.  This is not a feature.

   (2) This program was written before `gawk' acquired the ability to
split each character in a string into separate array elements.


File: gawk.info,  Node: Labels Program,  Next: Word Sorting,  Prev: Translate Program,  Up: Miscellaneous Programs

11.3.4 Printing Mailing Labels
------------------------------

Here is a "real world"(1) program.  This script reads lists of names and
addresses and generates mailing labels.  Each page of labels has 20
labels on it, two across and 10 down.  The addresses are guaranteed to
be no more than five lines of data.  Each address is separated from the
next by a blank line.

   The basic idea is to read 20 labels worth of data.  Each line of
each label is stored in the `line' array.  The single rule takes care
of filling the `line' array and printing the page when 20 labels have
been read.

   The `BEGIN' rule simply sets `RS' to the empty string, so that `awk'
splits records at blank lines (*note Records::).  It sets `MAXLINES' to
100, since 100 is the maximum number of lines on the page (20 * 5 =
100).

   Most of the work is done in the `printpage()' function.  The label
lines are stored sequentially in the `line' array.  But they have to
print horizontally; `line[1]' next to `line[6]', `line[2]' next to
`line[7]', and so on.  Two loops are used to accomplish this.  The
outer loop, controlled by `i', steps through every 10 lines of data;
this is each row of labels.  The inner loop, controlled by `j', goes
through the lines within the row.  As `j' goes from 0 to 4, `i+j' is
the `j'-th line in the row, and `i+j+5' is the entry next to it.  The
output ends up looking something like this:

     line 1          line 6
     line 2          line 7
     line 3          line 8
     line 4          line 9
     line 5          line 10
     ...

The `printf' format string `%-41s' left-aligns the data and prints it
within a fixed-width field.

   As a final note, an extra blank line is printed at lines 21 and 61,
to keep the output lined up on the labels.  This is dependent on the
particular brand of labels in use when the program was written.  You
will also note that there are two blank lines at the top and two blank
lines at the bottom.

   The `END' rule arranges to flush the final page of labels; there may
not have been an even multiple of 20 labels in the data:

     # labels.awk --- print mailing labels

     # Each label is 5 lines of data that may have blank lines.
     # The label sheets have 2 blank lines at the top and 2 at
     # the bottom.

     BEGIN    { RS = "" ; MAXLINES = 100 }

     function printpage(    i, j)
     {
         if (Nlines <= 0)
             return

         printf "\n\n"        # header

         for (i = 1; i <= Nlines; i += 10) {
             if (i == 21 || i == 61)
                 print ""
             for (j = 0; j < 5; j++) {
                 if (i + j > MAXLINES)
                     break
                 printf "   %-41s %s\n", line[i+j], line[i+j+5]
             }
             print ""
         }

         printf "\n\n"        # footer

         delete line
     }

     # main rule
     {
         if (Count >= 20) {
             printpage()
             Count = 0
             Nlines = 0
         }
         n = split($0, a, "\n")
         for (i = 1; i <= n; i++)
             line[++Nlines] = a[i]
         for (; i <= 5; i++)
             line[++Nlines] = ""
         Count++
     }

     END    \
     {
         printpage()
     }

   ---------- Footnotes ----------

   (1) "Real world" is defined as "a program actually used to get
something done."


File: gawk.info,  Node: Word Sorting,  Next: History Sorting,  Prev: Labels Program,  Up: Miscellaneous Programs

11.3.5 Generating Word-Usage Counts
-----------------------------------

When working with large amounts of text, it can be interesting to know
how often different words appear.  For example, an author may overuse
certain words, in which case she might wish to find synonyms to
substitute for words that appear too often. This node develops a
program for counting words and presenting the frequency information in
a useful format.

   At first glance, a program like this would seem to do the job:

     # Print list of word frequencies

     {
         for (i = 1; i <= NF; i++)
             freq[$i]++
     }

     END {
         for (word in freq)
             printf "%s\t%d\n", word, freq[word]
     }

   The program relies on `awk''s default field splitting mechanism to
break each line up into "words," and uses an associative array named
`freq', indexed by each word, to count the number of times the word
occurs. In the `END' rule, it prints the counts.

   This program has several problems that prevent it from being useful
on real text files:

   * The `awk' language considers upper- and lowercase characters to be
     distinct.  Therefore, "bartender" and "Bartender" are not treated
     as the same word.  This is undesirable, since in normal text, words
     are capitalized if they begin sentences, and a frequency analyzer
     should not be sensitive to capitalization.

   * Words are detected using the `awk' convention that fields are
     separated just by whitespace.  Other characters in the input
     (except newlines) don't have any special meaning to `awk'.  This
     means that punctuation characters count as part of words.

   * The output does not come out in any useful order.  You're more
     likely to be interested in which words occur most frequently or in
     having an alphabetized table of how frequently each word occurs.

   The first problem can be solved by using `tolower()' to remove case
distinctions.  The second problem can be solved by using `gsub()' to
remove punctuation characters.  Finally, we solve the third problem by
using the system `sort' utility to process the output of the `awk'
script.  Here is the new version of the program:

     # wordfreq.awk --- print list of word frequencies

     {
         $0 = tolower($0)    # remove case distinctions
         # remove punctuation
         gsub(/[^[:alnum:]_[:blank:]]/, "", $0)
         for (i = 1; i <= NF; i++)
             freq[$i]++
     }

     END {
         for (word in freq)
             printf "%s\t%d\n", word, freq[word]
     }

   Assuming we have saved this program in a file named `wordfreq.awk',
and that the data is in `file1', the following pipeline:

     awk -f wordfreq.awk file1 | sort -k 2nr

produces a table of the words appearing in `file1' in order of
decreasing frequency.

   The `awk' program suitably massages the data and produces a word
frequency table, which is not ordered.  The `awk' script's output is
then sorted by the `sort' utility and printed on the screen.

   The options given to `sort' specify a sort that uses the second
field of each input line (skipping one field), that the sort keys
should be treated as numeric quantities (otherwise `15' would come
before `5'), and that the sorting should be done in descending
(reverse) order.

   The `sort' could even be done from within the program, by changing
the `END' action to:

     END {
         sort = "sort -k 2nr"
         for (word in freq)
             printf "%s\t%d\n", word, freq[word] | sort
         close(sort)
     }

   This way of sorting must be used on systems that do not have true
pipes at the command-line (or batch-file) level.  See the general
operating system documentation for more information on how to use the
`sort' program.


File: gawk.info,  Node: History Sorting,  Next: Extract Program,  Prev: Word Sorting,  Up: Miscellaneous Programs

11.3.6 Removing Duplicates from Unsorted Text
---------------------------------------------

The `uniq' program (*note Uniq Program::), removes duplicate lines from
_sorted_ data.

   Suppose, however, you need to remove duplicate lines from a data
file but that you want to preserve the order the lines are in.  A good
example of this might be a shell history file.  The history file keeps
a copy of all the commands you have entered, and it is not unusual to
repeat a command several times in a row.  Occasionally you might want
to compact the history by removing duplicate entries.  Yet it is
desirable to maintain the order of the original commands.

   This simple program does the job.  It uses two arrays.  The `data'
array is indexed by the text of each line.  For each line, `data[$0]'
is incremented.  If a particular line has not been seen before, then
`data[$0]' is zero.  In this case, the text of the line is stored in
`lines[count]'.  Each element of `lines' is a unique command, and the
indices of `lines' indicate the order in which those lines are
encountered.  The `END' rule simply prints out the lines, in order:

     # histsort.awk --- compact a shell history file
     # Thanks to Byron Rakitzis for the general idea

     {
         if (data[$0]++ == 0)
             lines[++count] = $0
     }

     END {
         for (i = 1; i <= count; i++)
             print lines[i]
     }

   This program also provides a foundation for generating other useful
information.  For example, using the following `print' statement in the
`END' rule indicates how often a particular command is used:

     print data[lines[i]], lines[i]

   This works because `data[$0]' is incremented each time a line is
seen.


File: gawk.info,  Node: Extract Program,  Next: Simple Sed,  Prev: History Sorting,  Up: Miscellaneous Programs

11.3.7 Extracting Programs from Texinfo Source Files
----------------------------------------------------

The nodes *note Library Functions::, and *note Sample Programs::, are
the top level nodes for a large number of `awk' programs.  If you want
to experiment with these programs, it is tedious to have to type them
in by hand.  Here we present a program that can extract parts of a
Texinfo input file into separate files.

This Info file is written in Texinfo
(http://www.gnu.org/software/texinfo/), the GNU project's document
formatting language.  A single Texinfo source file can be used to
produce both printed and online documentation.  The Texinfo language is
described fully, starting with *note (Texinfo)Top::
texinfo,Texinfo--The GNU Documentation Format.

   For our purposes, it is enough to know three things about Texinfo
input files:

   * The "at" symbol (`@') is special in Texinfo, much as the backslash
     (`\') is in C or `awk'.  Literal `@' symbols are represented in
     Texinfo source files as `@@'.

   * Comments start with either `@c' or `@comment'.  The
     file-extraction program works by using special comments that start
     at the beginning of a line.

   * Lines containing `@group' and `@end group' commands bracket
     example text that should not be split across a page boundary.
     (Unfortunately, TeX isn't always smart enough to do things exactly
     right, so we have to give it some help.)

   The following program, `extract.awk', reads through a Texinfo source
file and does two things, based on the special comments.  Upon seeing
`@c system ...', it runs a command, by extracting the command text from
the control line and passing it on to the `system()' function (*note
I/O Functions::).  Upon seeing `@c file FILENAME', each subsequent line
is sent to the file FILENAME, until `@c endfile' is encountered.  The
rules in `extract.awk' match either `@c' or `@comment' by letting the
`omment' part be optional.  Lines containing `@group' and `@end group'
are simply removed.  `extract.awk' uses the `join()' library function
(*note Join Function::).

   The example programs in the online Texinfo source for `GAWK:
Effective AWK Programming' (`gawktexi.in') have all been bracketed
inside `file' and `endfile' lines.  The `gawk' distribution uses a copy
of `extract.awk' to extract the sample programs and install many of
them in a standard directory where `gawk' can find them.  The Texinfo
file looks something like this:

     ...
     This program has a @code{BEGIN} rule,
     that prints a nice message:

     @example
     @c file examples/messages.awk
     BEGIN @{ print "Don't panic!" @}
     @c end file
     @end example

     It also prints some final advice:

     @example
     @c file examples/messages.awk
     END @{ print "Always avoid bored archeologists!" @}
     @c end file
     @end example
     ...

   `extract.awk' begins by setting `IGNORECASE' to one, so that mixed
upper- and lowercase letters in the directives won't matter.

   The first rule handles calling `system()', checking that a command is
given (`NF' is at least three) and also checking that the command exits
with a zero exit status, signifying OK:

     # extract.awk --- extract files and run programs
     #                 from texinfo files

     BEGIN    { IGNORECASE = 1 }

     /^@c(omment)?[ \t]+system/    \
     {
         if (NF < 3) {
             e = (FILENAME ":" FNR)
             e = (e  ": badly formed `system' line")
             print e > "/dev/stderr"
             next
         }
         $1 = ""
         $2 = ""
         stat = system($0)
         if (stat != 0) {
             e = (FILENAME ":" FNR)
             e = (e ": warning: system returned " stat)
             print e > "/dev/stderr"
         }
     }

The variable `e' is used so that the rule fits nicely on the screen.

   The second rule handles moving data into files.  It verifies that a
file name is given in the directive.  If the file named is not the
current file, then the current file is closed.  Keeping the current file
open until a new file is encountered allows the use of the `>'
redirection for printing the contents, keeping open file management
simple.

   The `for' loop does the work.  It reads lines using `getline' (*note
Getline::).  For an unexpected end of file, it calls the
`unexpected_eof()' function.  If the line is an "endfile" line, then it
breaks out of the loop.  If the line is an `@group' or `@end group'
line, then it ignores it and goes on to the next line.  Similarly,
comments within examples are also ignored.

   Most of the work is in the following few lines.  If the line has no
`@' symbols, the program can print it directly.  Otherwise, each
leading `@' must be stripped off.  To remove the `@' symbols, the line
is split into separate elements of the array `a', using the `split()'
function (*note String Functions::).  The `@' symbol is used as the
separator character.  Each element of `a' that is empty indicates two
successive `@' symbols in the original line.  For each two empty
elements (`@@' in the original file), we have to add a single `@'
symbol back in.(1)

   When the processing of the array is finished, `join()' is called
with the value of `SUBSEP', to rejoin the pieces back into a single
line.  That line is then printed to the output file:

     /^@c(omment)?[ \t]+file/    \
     {
         if (NF != 3) {
             e = (FILENAME ":" FNR ": badly formed `file' line")
             print e > "/dev/stderr"
             next
         }
         if ($3 != curfile) {
             if (curfile != "")
                 close(curfile)
             curfile = $3
         }

         for (;;) {
             if ((getline line) <= 0)
                 unexpected_eof()
             if (line ~ /^@c(omment)?[ \t]+endfile/)
                 break
             else if (line ~ /^@(end[ \t]+)?group/)
                 continue
             else if (line ~ /^@c(omment+)?[ \t]+/)
                 continue
             if (index(line, "@") == 0) {
                 print line > curfile
                 continue
             }
             n = split(line, a, "@")
             # if a[1] == "", means leading @,
             # don't add one back in.
             for (i = 2; i <= n; i++) {
                 if (a[i] == "") { # was an @@
                     a[i] = "@"
                     if (a[i+1] == "")
                         i++
                 }
             }
             print join(a, 1, n, SUBSEP) > curfile
         }
     }

   An important thing to note is the use of the `>' redirection.
Output done with `>' only opens the file once; it stays open and
subsequent output is appended to the file (*note Redirection::).  This
makes it easy to mix program text and explanatory prose for the same
sample source file (as has been done here!) without any hassle.  The
file is only closed when a new data file name is encountered or at the
end of the input file.

   Finally, the function `unexpected_eof()' prints an appropriate error
message and then exits.  The `END' rule handles the final cleanup,
closing the open file:

     function unexpected_eof()
     {
         printf("%s:%d: unexpected EOF or error\n",
             FILENAME, FNR) > "/dev/stderr"
         exit 1
     }

     END {
         if (curfile)
             close(curfile)
     }

   ---------- Footnotes ----------

   (1) This program was written before `gawk' had the `gensub()'
function. Consider how you might use it to simplify the code.


File: gawk.info,  Node: Simple Sed,  Next: Igawk Program,  Prev: Extract Program,  Up: Miscellaneous Programs

11.3.8 A Simple Stream Editor
-----------------------------

The `sed' utility is a stream editor, a program that reads a stream of
data, makes changes to it, and passes it on.  It is often used to make
global changes to a large file or to a stream of data generated by a
pipeline of commands.  While `sed' is a complicated program in its own
right, its most common use is to perform global substitutions in the
middle of a pipeline:

     command1 < orig.data | sed 's/old/new/g' | command2 > result

   Here, `s/old/new/g' tells `sed' to look for the regexp `old' on each
input line and globally replace it with the text `new', i.e., all the
occurrences on a line.  This is similar to `awk''s `gsub()' function
(*note String Functions::).

   The following program, `awksed.awk', accepts at least two
command-line arguments: the pattern to look for and the text to replace
it with. Any additional arguments are treated as data file names to
process. If none are provided, the standard input is used:

     # awksed.awk --- do s/foo/bar/g using just print
     #    Thanks to Michael Brennan for the idea

     function usage()
     {
         print "usage: awksed pat repl [files...]" > "/dev/stderr"
         exit 1
     }

     BEGIN {
         # validate arguments
         if (ARGC < 3)
             usage()

         RS = ARGV[1]
         ORS = ARGV[2]

         # don't use arguments as files
         ARGV[1] = ARGV[2] = ""
     }

     # look ma, no hands!
     {
         if (RT == "")
             printf "%s", $0
         else
             print
     }

   The program relies on `gawk''s ability to have `RS' be a regexp, as
well as on the setting of `RT' to the actual text that terminates the
record (*note Records::).

   The idea is to have `RS' be the pattern to look for. `gawk'
automatically sets `$0' to the text between matches of the pattern.
This is text that we want to keep, unmodified.  Then, by setting `ORS'
to the replacement text, a simple `print' statement outputs the text we
want to keep, followed by the replacement text.

   There is one wrinkle to this scheme, which is what to do if the last
record doesn't end with text that matches `RS'.  Using a `print'
statement unconditionally prints the replacement text, which is not
correct.  However, if the file did not end in text that matches `RS',
`RT' is set to the null string.  In this case, we can print `$0' using
`printf' (*note Printf::).

   The `BEGIN' rule handles the setup, checking for the right number of
arguments and calling `usage()' if there is a problem. Then it sets
`RS' and `ORS' from the command-line arguments and sets `ARGV[1]' and
`ARGV[2]' to the null string, so that they are not treated as file names
(*note ARGC and ARGV::).

   The `usage()' function prints an error message and exits.  Finally,
the single rule handles the printing scheme outlined above, using
`print' or `printf' as appropriate, depending upon the value of `RT'.


File: gawk.info,  Node: Igawk Program,  Next: Anagram Program,  Prev: Simple Sed,  Up: Miscellaneous Programs

11.3.9 An Easy Way to Use Library Functions
-------------------------------------------

In *note Include Files::, we saw how `gawk' provides a built-in
file-inclusion capability.  However, this is a `gawk' extension.  This
minor node provides the motivation for making file inclusion available
for standard `awk', and shows how to do it using a combination of shell
and `awk' programming.

   Using library functions in `awk' can be very beneficial. It
encourages code reuse and the writing of general functions. Programs are
smaller and therefore clearer.  However, using library functions is
only easy when writing `awk' programs; it is painful when running them,
requiring multiple `-f' options.  If `gawk' is unavailable, then so too
is the `AWKPATH' environment variable and the ability to put `awk'
functions into a library directory (*note Options::).  It would be nice
to be able to write programs in the following manner:

     # library functions
     @include getopt.awk
     @include join.awk
     ...

     # main program
     BEGIN {
         while ((c = getopt(ARGC, ARGV, "a:b:cde")) != -1)
             ...
         ...
     }

   The following program, `igawk.sh', provides this service.  It
simulates `gawk''s searching of the `AWKPATH' variable and also allows
"nested" includes; i.e., a file that is included with `@include' can
contain further `@include' statements.  `igawk' makes an effort to only
include files once, so that nested includes don't accidentally include
a library function twice.

   `igawk' should behave just like `gawk' externally.  This means it
should accept all of `gawk''s command-line arguments, including the
ability to have multiple source files specified via `-f', and the
ability to mix command-line and library source files.

   The program is written using the POSIX Shell (`sh') command
language.(1) It works as follows:

  1. Loop through the arguments, saving anything that doesn't represent
     `awk' source code for later, when the expanded program is run.

  2. For any arguments that do represent `awk' text, put the arguments
     into a shell variable that will be expanded.  There are two cases:

       a. Literal text, provided with `--source' or `--source='.  This
          text is just appended directly.

       b. Source file names, provided with `-f'.  We use a neat trick
          and append `@include FILENAME' to the shell variable's
          contents.  Since the file-inclusion program works the way
          `gawk' does, this gets the text of the file included into the
          program at the correct point.

  3. Run an `awk' program (naturally) over the shell variable's
     contents to expand `@include' statements.  The expanded program is
     placed in a second shell variable.

  4. Run the expanded program with `gawk' and any other original
     command-line arguments that the user supplied (such as the data
     file names).

   This program uses shell variables extensively: for storing
command-line arguments, the text of the `awk' program that will expand
the user's program, for the user's original program, and for the
expanded program.  Doing so removes some potential problems that might
arise were we to use temporary files instead, at the cost of making the
script somewhat more complicated.

   The initial part of the program turns on shell tracing if the first
argument is `debug'.

   The next part loops through all the command-line arguments.  There
are several cases of interest:

`--'
     This ends the arguments to `igawk'.  Anything else should be
     passed on to the user's `awk' program without being evaluated.

`-W'
     This indicates that the next option is specific to `gawk'.  To make
     argument processing easier, the `-W' is appended to the front of
     the remaining arguments and the loop continues.  (This is an `sh'
     programming trick.  Don't worry about it if you are not familiar
     with `sh'.)

`-v, -F'
     These are saved and passed on to `gawk'.

`-f, --file, --file=, -Wfile='
     The file name is appended to the shell variable `program' with an
     `@include' statement.  The `expr' utility is used to remove the
     leading option part of the argument (e.g., `--file=').  (Typical
     `sh' usage would be to use the `echo' and `sed' utilities to do
     this work.  Unfortunately, some versions of `echo' evaluate escape
     sequences in their arguments, possibly mangling the program text.
     Using `expr' avoids this problem.)

`--source, --source=, -Wsource='
     The source text is appended to `program'.

`--version, -Wversion'
     `igawk' prints its version number, runs `gawk --version' to get
     the `gawk' version information, and then exits.

   If none of the `-f', `--file', `-Wfile', `--source', or `-Wsource'
arguments are supplied, then the first nonoption argument should be the
`awk' program.  If there are no command-line arguments left, `igawk'
prints an error message and exits.  Otherwise, the first argument is
appended to `program'.  In any case, after the arguments have been
processed, `program' contains the complete text of the original `awk'
program.

   The program is as follows:

     #! /bin/sh
     # igawk --- like gawk but do @include processing

     if [ "$1" = debug ]
     then
         set -x
         shift
     fi

     # A literal newline, so that program text is formatted correctly
     n='
     '

     # Initialize variables to empty
     program=
     opts=

     while [ $# -ne 0 ] # loop over arguments
     do
         case $1 in
         --)     shift
                 break ;;

         -W)     shift
                 # The ${x?'message here'} construct prints a
                 # diagnostic if $x is the null string
                 set -- -W"${@?'missing operand'}"
                 continue ;;

         -[vF])  opts="$opts $1 '${2?'missing operand'}'"
                 shift ;;

         -[vF]*) opts="$opts '$1'" ;;

         -f)     program="$program$n@include ${2?'missing operand'}"
                 shift ;;

         -f*)    f=$(expr "$1" : '-f\(.*\)')
                 program="$program$n@include $f" ;;

         -[W-]file=*)
                 f=$(expr "$1" : '-.file=\(.*\)')
                 program="$program$n@include $f" ;;

         -[W-]file)
                 program="$program$n@include ${2?'missing operand'}"
                 shift ;;

         -[W-]source=*)
                 t=$(expr "$1" : '-.source=\(.*\)')
                 program="$program$n$t" ;;

         -[W-]source)
                 program="$program$n${2?'missing operand'}"
                 shift ;;

         -[W-]version)
                 echo igawk: version 3.0 1>&2
                 gawk --version
                 exit 0 ;;

         -[W-]*) opts="$opts '$1'" ;;

         *)      break ;;
         esac
         shift
     done

     if [ -z "$program" ]
     then
          program=${1?'missing program'}
          shift
     fi

     # At this point, `program' has the program.

   The `awk' program to process `@include' directives is stored in the
shell variable `expand_prog'.  Doing this keeps the shell script
readable.  The `awk' program reads through the user's program, one line
at a time, using `getline' (*note Getline::).  The input file names and
`@include' statements are managed using a stack.  As each `@include' is
encountered, the current file name is "pushed" onto the stack and the
file named in the `@include' directive becomes the current file name.
As each file is finished, the stack is "popped," and the previous input
file becomes the current input file again.  The process is started by
making the original file the first one on the stack.

   The `pathto()' function does the work of finding the full path to a
file.  It simulates `gawk''s behavior when searching the `AWKPATH'
environment variable (*note AWKPATH Variable::).  If a file name has a
`/' in it, no path search is done.  Similarly, if the file name is
`"-"', then that string is used as-is.  Otherwise, the file name is
concatenated with the name of each directory in the path, and an
attempt is made to open the generated file name.  The only way to test
if a file can be read in `awk' is to go ahead and try to read it with
`getline'; this is what `pathto()' does.(2) If the file can be read, it
is closed and the file name is returned:

     expand_prog='

     function pathto(file,    i, t, junk)
     {
         if (index(file, "/") != 0)
             return file

         if (file == "-")
             return file

         for (i = 1; i <= ndirs; i++) {
             t = (pathlist[i] "/" file)
             if ((getline junk < t) > 0) {
                 # found it
                 close(t)
                 return t
             }
         }
         return ""
     }

   The main program is contained inside one `BEGIN' rule.  The first
thing it does is set up the `pathlist' array that `pathto()' uses.
After splitting the path on `:', null elements are replaced with `"."',
which represents the current directory:

     BEGIN {
         path = ENVIRON["AWKPATH"]
         ndirs = split(path, pathlist, ":")
         for (i = 1; i <= ndirs; i++) {
             if (pathlist[i] == "")
                 pathlist[i] = "."
         }

   The stack is initialized with `ARGV[1]', which will be `/dev/stdin'.
The main loop comes next.  Input lines are read in succession. Lines
that do not start with `@include' are printed verbatim.  If the line
does start with `@include', the file name is in `$2'.  `pathto()' is
called to generate the full path.  If it cannot, then the program
prints an error message and continues.

   The next thing to check is if the file is included already.  The
`processed' array is indexed by the full file name of each included
file and it tracks this information for us.  If the file is seen again,
a warning message is printed. Otherwise, the new file name is pushed
onto the stack and processing continues.

   Finally, when `getline' encounters the end of the input file, the
file is closed and the stack is popped.  When `stackptr' is less than
zero, the program is done:

         stackptr = 0
         input[stackptr] = ARGV[1] # ARGV[1] is first file

         for (; stackptr >= 0; stackptr--) {
             while ((getline < input[stackptr]) > 0) {
                 if (tolower($1) != "@include") {
                     print
                     continue
                 }
                 fpath = pathto($2)
                 if (fpath == "") {
                     printf("igawk:%s:%d: cannot find %s\n",
                         input[stackptr], FNR, $2) > "/dev/stderr"
                     continue
                 }
                 if (! (fpath in processed)) {
                     processed[fpath] = input[stackptr]
                     input[++stackptr] = fpath  # push onto stack
                 } else
                     print $2, "included in", input[stackptr],
                         "already included in",
                         processed[fpath] > "/dev/stderr"
             }
             close(input[stackptr])
         }
     }'  # close quote ends `expand_prog' variable

     processed_program=$(gawk -- "$expand_prog" /dev/stdin << EOF
     $program
     EOF
     )

   The shell construct `COMMAND << MARKER' is called a "here document".
Everything in the shell script up to the MARKER is fed to COMMAND as
input.  The shell processes the contents of the here document for
variable and command substitution (and possibly other things as well,
depending upon the shell).

   The shell construct `$(...)' is called "command substitution".  The
output of the command inside the parentheses is substituted into the
command line.  Because the result is used in a variable assignment, it
is saved as a single string, even if the results contain whitespace.

   The expanded program is saved in the variable `processed_program'.
It's done in these steps:

  1. Run `gawk' with the `@include'-processing program (the value of
     the `expand_prog' shell variable) on standard input.

  2. Standard input is the contents of the user's program, from the
     shell variable `program'.  Its contents are fed to `gawk' via a
     here document.

  3. The results of this processing are saved in the shell variable
     `processed_program' by using command substitution.

   The last step is to call `gawk' with the expanded program, along
with the original options and command-line arguments that the user
supplied.

     eval gawk $opts -- '"$processed_program"' '"$@"'

   The `eval' command is a shell construct that reruns the shell's
parsing process.  This keeps things properly quoted.

   This version of `igawk' represents my fifth version of this program.
There are four key simplifications that make the program work better:

   * Using `@include' even for the files named with `-f' makes building
     the initial collected `awk' program much simpler; all the
     `@include' processing can be done once.

   * Not trying to save the line read with `getline' in the `pathto()'
     function when testing for the file's accessibility for use with
     the main program simplifies things considerably.

   * Using a `getline' loop in the `BEGIN' rule does it all in one
     place.  It is not necessary to call out to a separate loop for
     processing nested `@include' statements.

   * Instead of saving the expanded program in a temporary file,
     putting it in a shell variable avoids some potential security
     problems.  This has the disadvantage that the script relies upon
     more features of the `sh' language, making it harder to follow for
     those who aren't familiar with `sh'.

   Also, this program illustrates that it is often worthwhile to combine
`sh' and `awk' programming together.  You can usually accomplish quite
a lot, without having to resort to low-level programming in C or C++,
and it is frequently easier to do certain kinds of string and argument
manipulation using the shell than it is in `awk'.

   Finally, `igawk' shows that it is not always necessary to add new
features to a program; they can often be layered on top.

   As an additional example of this, consider the idea of having two
files in a directory in the search path:

`default.awk'
     This file contains a set of default library functions, such as
     `getopt()' and `assert()'.

`site.awk'
     This file contains library functions that are specific to a site or
     installation; i.e., locally developed functions.  Having a
     separate file allows `default.awk' to change with new `gawk'
     releases, without requiring the system administrator to update it
     each time by adding the local functions.

   One user suggested that `gawk' be modified to automatically read
these files upon startup.  Instead, it would be very simple to modify
`igawk' to do this. Since `igawk' can process nested `@include'
directives, `default.awk' could simply contain `@include' statements
for the desired library functions.

   ---------- Footnotes ----------

   (1) Fully explaining the `sh' language is beyond the scope of this
book. We provide some minimal explanations, but see a good shell
programming book if you wish to understand things in more depth.

   (2) On some very old versions of `awk', the test `getline junk < t'
can loop forever if the file exists but is empty.  Caveat emptor.


File: gawk.info,  Node: Anagram Program,  Next: Signature Program,  Prev: Igawk Program,  Up: Miscellaneous Programs

11.3.10 Finding Anagrams From A Dictionary
------------------------------------------

An interesting programming challenge is to search for "anagrams" in a
word list (such as `/usr/share/dict/words' on many GNU/Linux systems).
One word is an anagram of another if both words contain the same letters
(for example, "babbling" and "blabbing").

   An elegant algorithm is presented in Column 2, Problem C of Jon
Bentley's `Programming Pearls', second edition.  The idea is to give
words that are anagrams a common signature, sort all the words together
by their signature, and then print them.  Dr. Bentley observes that
taking the letters in each word and sorting them produces that common
signature.

   The following program uses arrays of arrays to bring together words
with the same signature and array sorting to print the words in sorted
order.

     # anagram.awk --- An implementation of the anagram finding algorithm
     #                 from Jon Bentley's "Programming Pearls", 2nd edition.
     #                 Addison Wesley, 2000, ISBN 0-201-65788-0.
     #                 Column 2, Problem C, section 2.8, pp 18-20.

     /'s$/   { next }        # Skip possessives

   The program starts with a header, and then a rule to skip
possessives in the dictionary file. The next rule builds up the data
structure. The first dimension of the array is indexed by the
signature; the second dimension is the word itself:

     {
         key = word2key($1)  # Build signature
         data[key][$1] = $1  # Store word with signature
     }

   The `word2key()' function creates the signature.  It splits the word
apart into individual letters, sorts the letters, and then joins them
back together:

     # word2key --- split word apart into letters, sort, joining back together

     function word2key(word,     a, i, n, result)
     {
         n = split(word, a, "")
         asort(a)

         for (i = 1; i <= n; i++)
             result = result a[i]

         return result
     }

   Finally, the `END' rule traverses the array and prints out the
anagram lists.  It sends the output to the system `sort' command, since
otherwise the anagrams would appear in arbitrary order:

     END {
         sort = "sort"
         for (key in data) {
             # Sort words with same key
             nwords = asorti(data[key], words)
             if (nwords == 1)
                 continue

             # And print. Minor glitch: trailing space at end of each line
             for (j = 1; j <= nwords; j++)
                 printf("%s ", words[j]) | sort
             print "" | sort
         }
         close(sort)
     }

   Here is some partial output when the program is run:

     $ gawk -f anagram.awk /usr/share/dict/words | grep '^b'
     ...
     babbled blabbed
     babbler blabber brabble
     babblers blabbers brabbles
     babbling blabbing
     babbly blabby
     babel bable
     babels beslab
     babery yabber
     ...


File: gawk.info,  Node: Signature Program,  Prev: Anagram Program,  Up: Miscellaneous Programs

11.3.11 And Now For Something Completely Different
--------------------------------------------------

The following program was written by Davide Brini and is published on
his website (http://backreference.org/2011/02/03/obfuscated-awk/).  It
serves as his signature in the Usenet group `comp.lang.awk'.  He
supplies the following copyright terms:

     Copyright (C) 2008 Davide Brini

     Copying and distribution of the code published in this page, with
     or without modification, are permitted in any medium without
     royalty provided the copyright notice and this notice are
     preserved.

   Here is the program:

     awk 'BEGIN{O="~"~"~";o="=="=="==";o+=+o;x=O""O;while(X++<=x+o+o)c=c"%c";
     printf c,(x-O)*(x-O),x*(x-o)-o,x*(x-O)+x-O-o,+x*(x-O)-x+o,X*(o*o+O)+x-O,
     X*(X-x)-o*o,(x+X)*o*o+o,x*(X-x)-O-O,x-O+(O+o+X+x)*(o+O),X*X-X*(x-O)-x+O,
     O+X*(o*(o+O)+O),+x+O+X*o,x*(x-o),(o+X+x)*o*o-(x-O-O),O+(X-x)*(X+O),x-O}'

   We leave it to you to determine what the program does.


File: gawk.info,  Node: Advanced Features,  Next: Internationalization,  Prev: Sample Programs,  Up: Top

12 Advanced Features of `gawk'
******************************

     Write documentation as if whoever reads it is a violent psychopath
     who knows where you live.  -- Steve English, as quoted by Peter
     Langston

   This major node discusses advanced features in `gawk'.  It's a bit
of a "grab bag" of items that are otherwise unrelated to each other.
First, a command-line option allows `gawk' to recognize nondecimal
numbers in input data, not just in `awk' programs.  Then, `gawk''s
special features for sorting arrays are presented.  Next, two-way I/O,
discussed briefly in earlier parts of this Info file, is described in
full detail, along with the basics of TCP/IP networking.  Finally,
`gawk' can "profile" an `awk' program, making it possible to tune it
for performance.

   A number of advanced features require separate major nodes of their
own:

   * *note Internationalization::, discusses how to internationalize
     your `awk' programs, so that they can speak multiple national
     languages.

   * *note Debugger::, describes `gawk''s built-in command-line
     debugger for debugging `awk' programs.

   * *note Arbitrary Precision Arithmetic::, describes how you can use
     `gawk' to perform arbitrary-precision arithmetic.

   * *note Dynamic Extensions::, discusses the ability to dynamically
     add new built-in functions to `gawk'.

* Menu:

* Nondecimal Data::             Allowing nondecimal input data.
* Array Sorting::               Facilities for controlling array traversal and
                                sorting arrays.
* Two-way I/O::                 Two-way communications with another process.
* TCP/IP Networking::           Using `gawk' for network programming.
* Profiling::                   Profiling your `awk' programs.


File: gawk.info,  Node: Nondecimal Data,  Next: Array Sorting,  Up: Advanced Features

12.1 Allowing Nondecimal Input Data
===================================

If you run `gawk' with the `--non-decimal-data' option, you can have
nondecimal constants in your input data:

     $ echo 0123 123 0x123 |
     > gawk --non-decimal-data '{ printf "%d, %d, %d\n",
     >                                         $1, $2, $3 }'
     -| 83, 123, 291

   For this feature to work, write your program so that `gawk' treats
your data as numeric:

     $ echo 0123 123 0x123 | gawk '{ print $1, $2, $3 }'
     -| 0123 123 0x123

The `print' statement treats its expressions as strings.  Although the
fields can act as numbers when necessary, they are still strings, so
`print' does not try to treat them numerically.  You may need to add
zero to a field to force it to be treated as a number.  For example:

     $ echo 0123 123 0x123 | gawk --non-decimal-data '
     > { print $1, $2, $3
     >   print $1 + 0, $2 + 0, $3 + 0 }'
     -| 0123 123 0x123
     -| 83 123 291

   Because it is common to have decimal data with leading zeros, and
because using this facility could lead to surprising results, the
default is to leave it disabled.  If you want it, you must explicitly
request it.

     CAUTION: _Use of this option is not recommended._ It can break old
     programs very badly.  Instead, use the `strtonum()' function to
     convert your data (*note Nondecimal-numbers::).  This makes your
     programs easier to write and easier to read, and leads to less
     surprising results.


File: gawk.info,  Node: Array Sorting,  Next: Two-way I/O,  Prev: Nondecimal Data,  Up: Advanced Features

12.2 Controlling Array Traversal and Array Sorting
==================================================

`gawk' lets you control the order in which a `for (i in array)' loop
traverses an array.

   In addition, two built-in functions, `asort()' and `asorti()', let
you sort arrays based on the array values and indices, respectively.
These two functions also provide control over the sorting criteria used
to order the elements during sorting.

* Menu:

* Controlling Array Traversal:: How to use PROCINFO["sorted_in"].
* Array Sorting Functions::     How to use `asort()' and `asorti()'.


File: gawk.info,  Node: Controlling Array Traversal,  Next: Array Sorting Functions,  Up: Array Sorting

12.2.1 Controlling Array Traversal
----------------------------------

By default, the order in which a `for (i in array)' loop scans an array
is not defined; it is generally based upon the internal implementation
of arrays inside `awk'.

   Often, though, it is desirable to be able to loop over the elements
in a particular order that you, the programmer, choose.  `gawk' lets
you do this.

   *note Controlling Scanning::, describes how you can assign special,
pre-defined values to `PROCINFO["sorted_in"]' in order to control the
order in which `gawk' will traverse an array during a `for' loop.

   In addition, the value of `PROCINFO["sorted_in"]' can be a function
name.  This lets you traverse an array based on any custom criterion.
The array elements are ordered according to the return value of this
function.  The comparison function should be defined with at least four
arguments:

     function comp_func(i1, v1, i2, v2)
     {
         COMPARE ELEMENTS 1 AND 2 IN SOME FASHION
         RETURN < 0; 0; OR > 0
     }

   Here, I1 and I2 are the indices, and V1 and V2 are the corresponding
values of the two elements being compared.  Either V1 or V2, or both,
can be arrays if the array being traversed contains subarrays as values.
(*Note Arrays of Arrays::, for more information about subarrays.)  The
three possible return values are interpreted as follows:

`comp_func(i1, v1, i2, v2) < 0'
     Index I1 comes before index I2 during loop traversal.

`comp_func(i1, v1, i2, v2) == 0'
     Indices I1 and I2 come together but the relative order with
     respect to each other is undefined.

`comp_func(i1, v1, i2, v2) > 0'
     Index I1 comes after index I2 during loop traversal.

   Our first comparison function can be used to scan an array in
numerical order of the indices:

     function cmp_num_idx(i1, v1, i2, v2)
     {
          # numerical index comparison, ascending order
          return (i1 - i2)
     }

   Our second function traverses an array based on the string order of
the element values rather than by indices:

     function cmp_str_val(i1, v1, i2, v2)
     {
         # string value comparison, ascending order
         v1 = v1 ""
         v2 = v2 ""
         if (v1 < v2)
             return -1
         return (v1 != v2)
     }

   The third comparison function makes all numbers, and numeric strings
without any leading or trailing spaces, come out first during loop
traversal:

     function cmp_num_str_val(i1, v1, i2, v2,   n1, n2)
     {
          # numbers before string value comparison, ascending order
          n1 = v1 + 0
          n2 = v2 + 0
          if (n1 == v1)
              return (n2 == v2) ? (n1 - n2) : -1
          else if (n2 == v2)
              return 1
          return (v1 < v2) ? -1 : (v1 != v2)
     }

   Here is a main program to demonstrate how `gawk' behaves using each
of the previous functions:

     BEGIN {
         data["one"] = 10
         data["two"] = 20
         data[10] = "one"
         data[100] = 100
         data[20] = "two"

         f[1] = "cmp_num_idx"
         f[2] = "cmp_str_val"
         f[3] = "cmp_num_str_val"
         for (i = 1; i <= 3; i++) {
             printf("Sort function: %s\n", f[i])
             PROCINFO["sorted_in"] = f[i]
             for (j in data)
                 printf("\tdata[%s] = %s\n", j, data[j])
             print ""
         }
     }

   Here are the results when the program is run:

     $ gawk -f compdemo.awk
     -| Sort function: cmp_num_idx      Sort by numeric index
     -|     data[two] = 20
     -|     data[one] = 10              Both strings are numerically zero
     -|     data[10] = one
     -|     data[20] = two
     -|     data[100] = 100
     -|
     -| Sort function: cmp_str_val      Sort by element values as strings
     -|     data[one] = 10
     -|     data[100] = 100             String 100 is less than string 20
     -|     data[two] = 20
     -|     data[10] = one
     -|     data[20] = two
     -|
     -| Sort function: cmp_num_str_val  Sort all numeric values before all strings
     -|     data[one] = 10
     -|     data[two] = 20
     -|     data[100] = 100
     -|     data[10] = one
     -|     data[20] = two

   Consider sorting the entries of a GNU/Linux system password file
according to login name.  The following program sorts records by a
specific field position and can be used for this purpose:

     # sort.awk --- simple program to sort by field position
     # field position is specified by the global variable POS

     function cmp_field(i1, v1, i2, v2)
     {
         # comparison by value, as string, and ascending order
         return v1[POS] < v2[POS] ? -1 : (v1[POS] != v2[POS])
     }

     {
         for (i = 1; i <= NF; i++)
             a[NR][i] = $i
     }

     END {
         PROCINFO["sorted_in"] = "cmp_field"
         if (POS < 1 || POS > NF)
             POS = 1
         for (i in a) {
             for (j = 1; j <= NF; j++)
                 printf("%s%c", a[i][j], j < NF ? ":" : "")
             print ""
         }
     }

   The first field in each entry of the password file is the user's
login name, and the fields are separated by colons.  Each record
defines a subarray, with each field as an element in the subarray.
Running the program produces the following output:

     $ gawk -v POS=1 -F: -f sort.awk /etc/passwd
     -| adm:x:3:4:adm:/var/adm:/sbin/nologin
     -| apache:x:48:48:Apache:/var/www:/sbin/nologin
     -| avahi:x:70:70:Avahi daemon:/:/sbin/nologin
     ...

   The comparison should normally always return the same value when
given a specific pair of array elements as its arguments.  If
inconsistent results are returned then the order is undefined.  This
behavior can be exploited to introduce random order into otherwise
seemingly ordered data:

     function cmp_randomize(i1, v1, i2, v2)
     {
         # random order (caution: this may never terminate!)
         return (2 - 4 * rand())
     }

   As mentioned above, the order of the indices is arbitrary if two
elements compare equal.  This is usually not a problem, but letting the
tied elements come out in arbitrary order can be an issue, especially
when comparing item values.  The partial ordering of the equal elements
may change during the next loop traversal, if other elements are added
or removed from the array.  One way to resolve ties when comparing
elements with otherwise equal values is to include the indices in the
comparison rules.  Note that doing this may make the loop traversal
less efficient, so consider it only if necessary.  The following
comparison functions force a deterministic order, and are based on the
fact that the (string) indices of two elements are never equal:

     function cmp_numeric(i1, v1, i2, v2)
     {
         # numerical value (and index) comparison, descending order
         return (v1 != v2) ? (v2 - v1) : (i2 - i1)
     }

     function cmp_string(i1, v1, i2, v2)
     {
         # string value (and index) comparison, descending order
         v1 = v1 i1
         v2 = v2 i2
         return (v1 > v2) ? -1 : (v1 != v2)
     }

   A custom comparison function can often simplify ordered loop
traversal, and the sky is really the limit when it comes to designing
such a function.

   When string comparisons are made during a sort, either for element
values where one or both aren't numbers, or for element indices handled
as strings, the value of `IGNORECASE' (*note Built-in Variables::)
controls whether the comparisons treat corresponding uppercase and
lowercase letters as equivalent or distinct.

   Another point to keep in mind is that in the case of subarrays the
element values can themselves be arrays; a production comparison
function should use the `isarray()' function (*note Type Functions::),
to check for this, and choose a defined sorting order for subarrays.

   All sorting based on `PROCINFO["sorted_in"]' is disabled in POSIX
mode, since the `PROCINFO' array is not special in that case.

   As a side note, sorting the array indices before traversing the
array has been reported to add 15% to 20% overhead to the execution
time of `awk' programs. For this reason, sorted array traversal is not
the default.


File: gawk.info,  Node: Array Sorting Functions,  Prev: Controlling Array Traversal,  Up: Array Sorting

12.2.2 Sorting Array Values and Indices with `gawk'
---------------------------------------------------

In most `awk' implementations, sorting an array requires writing a
`sort()' function.  While this can be educational for exploring
different sorting algorithms, usually that's not the point of the
program.  `gawk' provides the built-in `asort()' and `asorti()'
functions (*note String Functions::) for sorting arrays.  For example:

     POPULATE THE ARRAY data
     n = asort(data)
     for (i = 1; i <= n; i++)
         DO SOMETHING WITH data[i]

   After the call to `asort()', the array `data' is indexed from 1 to
some number N, the total number of elements in `data'.  (This count is
`asort()''s return value.)  `data[1]' <= `data[2]' <= `data[3]', and so
on.  The default comparison is based on the type of the elements (*note
Typing and Comparison::).  All numeric values come before all string
values, which in turn come before all subarrays.

   An important side effect of calling `asort()' is that _the array's
original indices are irrevocably lost_.  As this isn't always
desirable, `asort()' accepts a second argument:

     POPULATE THE ARRAY source
     n = asort(source, dest)
     for (i = 1; i <= n; i++)
         DO SOMETHING WITH dest[i]

   In this case, `gawk' copies the `source' array into the `dest' array
and then sorts `dest', destroying its indices.  However, the `source'
array is not affected.

   Often, what's needed is to sort on the values of the _indices_
instead of the values of the elements.  To do that, use the `asorti()'
function.  The interface and behavior are identical to that of
`asort()', except that the index values are used for sorting, and
become the values of the result array:

     { source[$0] = some_func($0) }

     END {
         n = asorti(source, dest)
         for (i = 1; i <= n; i++) {
             Work with sorted indices directly:
             DO SOMETHING WITH dest[i]
             ...
             Access original array via sorted indices:
             DO SOMETHING WITH source[dest[i]]
         }
     }

   So far, so good. Now it starts to get interesting.  Both `asort()'
and `asorti()' accept a third string argument to control comparison of
array elements.  In *note String Functions::, we ignored this third
argument; however, the time has now come to describe how this argument
affects these two functions.

   Basically, the third argument specifies how the array is to be
sorted.  There are two possibilities.  As with `PROCINFO["sorted_in"]',
this argument may be one of the predefined names that `gawk' provides
(*note Controlling Scanning::), or it may be the name of a user-defined
function (*note Controlling Array Traversal::).

   In the latter case, _the function can compare elements in any way it
chooses_, taking into account just the indices, just the values, or
both.  This is extremely powerful.

   Once the array is sorted, `asort()' takes the _values_ in their
final order, and uses them to fill in the result array, whereas
`asorti()' takes the _indices_ in their final order, and uses them to
fill in the result array.

     NOTE: Copying array indices and elements isn't expensive in terms
     of memory.  Internally, `gawk' maintains "reference counts" to
     data.  For example, when `asort()' copies the first array to the
     second one, there is only one copy of the original array elements'
     data, even though both arrays use the values.

   Because `IGNORECASE' affects string comparisons, the value of
`IGNORECASE' also affects sorting for both `asort()' and `asorti()'.
Note also that the locale's sorting order does _not_ come into play;
comparisons are based on character values only.(1) Caveat Emptor.

   ---------- Footnotes ----------

   (1) This is true because locale-based comparison occurs only when in
POSIX compatibility mode, and since `asort()' and `asorti()' are `gawk'
extensions, they are not available in that case.


File: gawk.info,  Node: Two-way I/O,  Next: TCP/IP Networking,  Prev: Array Sorting,  Up: Advanced Features

12.3 Two-Way Communications with Another Process
================================================

     From: brennan@whidbey.com (Mike Brennan)
     Newsgroups: comp.lang.awk
     Subject: Re: Learn the SECRET to Attract Women Easily
     Date: 4 Aug 1997 17:34:46 GMT
     Message-ID: <5s53rm$eca@news.whidbey.com>

     On 3 Aug 1997 13:17:43 GMT, Want More Dates???
     <tracy78@kilgrona.com> wrote:
     >Learn the SECRET to Attract Women Easily
     >
     >The SCENT(tm)  Pheromone Sex Attractant For Men to Attract Women

     The scent of awk programmers is a lot more attractive to women than
     the scent of perl programmers.
     --
     Mike Brennan

   It is often useful to be able to send data to a separate program for
processing and then read the result.  This can always be done with
temporary files:

     # Write the data for processing
     tempfile = ("mydata." PROCINFO["pid"])
     while (NOT DONE WITH DATA)
         print DATA | ("subprogram > " tempfile)
     close("subprogram > " tempfile)

     # Read the results, remove tempfile when done
     while ((getline newdata < tempfile) > 0)
         PROCESS newdata APPROPRIATELY
     close(tempfile)
     system("rm " tempfile)

This works, but not elegantly.  Among other things, it requires that
the program be run in a directory that cannot be shared among users;
for example, `/tmp' will not do, as another user might happen to be
using a temporary file with the same name.

   However, with `gawk', it is possible to open a _two-way_ pipe to
another process.  The second process is termed a "coprocess", since it
runs in parallel with `gawk'.  The two-way connection is created using
the `|&' operator (borrowed from the Korn shell, `ksh'):(1)

     do {
         print DATA |& "subprogram"
         "subprogram" |& getline results
     } while (DATA LEFT TO PROCESS)
     close("subprogram")

   The first time an I/O operation is executed using the `|&' operator,
`gawk' creates a two-way pipeline to a child process that runs the
other program.  Output created with `print' or `printf' is written to
the program's standard input, and output from the program's standard
output can be read by the `gawk' program using `getline'.  As is the
case with processes started by `|', the subprogram can be any program,
or pipeline of programs, that can be started by the shell.

   There are some cautionary items to be aware of:

   * As the code inside `gawk' currently stands, the coprocess's
     standard error goes to the same place that the parent `gawk''s
     standard error goes. It is not possible to read the child's
     standard error separately.

   * I/O buffering may be a problem.  `gawk' automatically flushes all
     output down the pipe to the coprocess.  However, if the coprocess
     does not flush its output, `gawk' may hang when doing a `getline'
     in order to read the coprocess's results.  This could lead to a
     situation known as "deadlock", where each process is waiting for
     the other one to do something.

   It is possible to close just one end of the two-way pipe to a
coprocess, by supplying a second argument to the `close()' function of
either `"to"' or `"from"' (*note Close Files And Pipes::).  These
strings tell `gawk' to close the end of the pipe that sends data to the
coprocess or the end that reads from it, respectively.

   This is particularly necessary in order to use the system `sort'
utility as part of a coprocess; `sort' must read _all_ of its input
data before it can produce any output.  The `sort' program does not
receive an end-of-file indication until `gawk' closes the write end of
the pipe.

   When you have finished writing data to the `sort' utility, you can
close the `"to"' end of the pipe, and then start reading sorted data
via `getline'.  For example:

     BEGIN {
         command = "LC_ALL=C sort"
         n = split("abcdefghijklmnopqrstuvwxyz", a, "")

         for (i = n; i > 0; i--)
             print a[i] |& command
         close(command, "to")

         while ((command |& getline line) > 0)
             print "got", line
         close(command)
     }

   This program writes the letters of the alphabet in reverse order, one
per line, down the two-way pipe to `sort'.  It then closes the write
end of the pipe, so that `sort' receives an end-of-file indication.
This causes `sort' to sort the data and write the sorted data back to
the `gawk' program.  Once all of the data has been read, `gawk'
terminates the coprocess and exits.

   As a side note, the assignment `LC_ALL=C' in the `sort' command
ensures traditional Unix (ASCII) sorting from `sort'.

   You may also use pseudo-ttys (ptys) for two-way communication
instead of pipes, if your system supports them.  This is done on a
per-command basis, by setting a special element in the `PROCINFO' array
(*note Auto-set::), like so:

     command = "sort -nr"           # command, save in convenience variable
     PROCINFO[command, "pty"] = 1   # update PROCINFO
     print ... |& command       # start two-way pipe
     ...

Using ptys avoids the buffer deadlock issues described earlier, at some
loss in performance.  If your system does not have ptys, or if all the
system's ptys are in use, `gawk' automatically falls back to using
regular pipes.

   ---------- Footnotes ----------

   (1) This is very different from the same operator in the C shell.


File: gawk.info,  Node: TCP/IP Networking,  Next: Profiling,  Prev: Two-way I/O,  Up: Advanced Features

12.4 Using `gawk' for Network Programming
=========================================

     `EMISTERED':
     A host is a host from coast to coast,
     and no-one can talk to host that's close,
     unless the host that isn't close
     is busy hung or dead.

   In addition to being able to open a two-way pipeline to a coprocess
on the same system (*note Two-way I/O::), it is possible to make a
two-way connection to another process on another system across an IP
network connection.

   You can think of this as just a _very long_ two-way pipeline to a
coprocess.  The way `gawk' decides that you want to use TCP/IP
networking is by recognizing special file names that begin with one of
`/inet/', `/inet4/' or `/inet6'.

   The full syntax of the special file name is
`/NET-TYPE/PROTOCOL/LOCAL-PORT/REMOTE-HOST/REMOTE-PORT'.  The
components are:

NET-TYPE
     Specifies the kind of Internet connection to make.  Use `/inet4/'
     to force IPv4, and `/inet6/' to force IPv6.  Plain `/inet/' (which
     used to be the only option) uses the system default, most likely
     IPv4.

PROTOCOL
     The protocol to use over IP.  This must be either `tcp', or `udp',
     for a TCP or UDP IP connection, respectively.  The use of TCP is
     recommended for most applications.

LOCAL-PORT
     The local TCP or UDP port number to use.  Use a port number of `0'
     when you want the system to pick a port. This is what you should do
     when writing a TCP or UDP client.  You may also use a well-known
     service name, such as `smtp' or `http', in which case `gawk'
     attempts to determine the predefined port number using the C
     `getaddrinfo()' function.

REMOTE-HOST
     The IP address or fully-qualified domain name of the Internet host
     to which you want to connect.

REMOTE-PORT
     The TCP or UDP port number to use on the given REMOTE-HOST.
     Again, use `0' if you don't care, or else a well-known service
     name.

     NOTE: Failure in opening a two-way socket will result in a
     non-fatal error being returned to the calling code. The value of
     `ERRNO' indicates the error (*note Auto-set::).

   Consider the following very simple example:

     BEGIN {
       Service = "/inet/tcp/0/localhost/daytime"
       Service |& getline
       print $0
       close(Service)
     }

   This program reads the current date and time from the local system's
TCP `daytime' server.  It then prints the results and closes the
connection.

   Because this topic is extensive, the use of `gawk' for TCP/IP
programming is documented separately.  See *note (General
Introduction)Top:: gawkinet, TCP/IP Internetworking with `gawk', for a
much more complete introduction and discussion, as well as extensive
examples.


File: gawk.info,  Node: Profiling,  Prev: TCP/IP Networking,  Up: Advanced Features

12.5 Profiling Your `awk' Programs
==================================

You may produce execution traces of your `awk' programs.  This is done
by passing the option `--profile' to `gawk'.  When `gawk' has finished
running, it creates a profile of your program in a file named
`awkprof.out'. Because it is profiling, it also executes up to 45%
slower than `gawk' normally does.

   As shown in the following example, the `--profile' option can be
used to change the name of the file where `gawk' will write the profile:

     gawk --profile=myprog.prof -f myprog.awk data1 data2

In the above example, `gawk' places the profile in `myprog.prof'
instead of in `awkprof.out'.

   Here is a sample session showing a simple `awk' program, its input
data, and the results from running `gawk' with the `--profile' option.
First, the `awk' program:

     BEGIN { print "First BEGIN rule" }

     END { print "First END rule" }

     /foo/ {
         print "matched /foo/, gosh"
         for (i = 1; i <= 3; i++)
             sing()
     }

     {
         if (/foo/)
             print "if is true"
         else
             print "else is true"
     }

     BEGIN { print "Second BEGIN rule" }

     END { print "Second END rule" }

     function sing(    dummy)
     {
         print "I gotta be me!"
     }

   Following is the input data:

     foo
     bar
     baz
     foo
     junk

   Here is the `awkprof.out' that results from running the `gawk'
profiler on this program and data (this example also illustrates that
`awk' programmers sometimes have to work late):

             # gawk profile, created Sun Aug 13 00:00:15 2000

             # BEGIN block(s)

             BEGIN {
          1          print "First BEGIN rule"
          1          print "Second BEGIN rule"
             }

             # Rule(s)

          5  /foo/   { # 2
          2          print "matched /foo/, gosh"
          6          for (i = 1; i <= 3; i++) {
          6                  sing()
                     }
             }

          5  {
          5          if (/foo/) { # 2
          2                  print "if is true"
          3          } else {
          3                  print "else is true"
                     }
             }

             # END block(s)

             END {
          1          print "First END rule"
          1          print "Second END rule"
             }

             # Functions, listed alphabetically

          6  function sing(dummy)
             {
          6          print "I gotta be me!"
             }

   This example illustrates many of the basic features of profiling
output.  They are as follows:

   * The program is printed in the order `BEGIN' rule, `BEGINFILE' rule,
     pattern/action rules, `ENDFILE' rule, `END' rule and functions,
     listed alphabetically.  Multiple `BEGIN' and `END' rules are
     merged together, as are multiple `BEGINFILE' and `ENDFILE' rules.

   * Pattern-action rules have two counts.  The first count, to the
     left of the rule, shows how many times the rule's pattern was
     _tested_.  The second count, to the right of the rule's opening
     left brace in a comment, shows how many times the rule's action
     was _executed_.  The difference between the two indicates how many
     times the rule's pattern evaluated to false.

   * Similarly, the count for an `if'-`else' statement shows how many
     times the condition was tested.  To the right of the opening left
     brace for the `if''s body is a count showing how many times the
     condition was true.  The count for the `else' indicates how many
     times the test failed.

   * The count for a loop header (such as `for' or `while') shows how
     many times the loop test was executed.  (Because of this, you
     can't just look at the count on the first statement in a rule to
     determine how many times the rule was executed.  If the first
     statement is a loop, the count is misleading.)

   * For user-defined functions, the count next to the `function'
     keyword indicates how many times the function was called.  The
     counts next to the statements in the body show how many times
     those statements were executed.

   * The layout uses "K&R" style with TABs.  Braces are used
     everywhere, even when the body of an `if', `else', or loop is only
     a single statement.

   * Parentheses are used only where needed, as indicated by the
     structure of the program and the precedence rules.  For example,
     `(3 + 5) * 4' means add three plus five, then multiply the total
     by four.  However, `3 + 5 * 4' has no parentheses, and means `3 +
     (5 * 4)'.

   * Parentheses are used around the arguments to `print' and `printf'
     only when the `print' or `printf' statement is followed by a
     redirection.  Similarly, if the target of a redirection isn't a
     scalar, it gets parenthesized.

   * `gawk' supplies leading comments in front of the `BEGIN' and `END'
     rules, the `BEGINFILE' and `ENDFILE' rules, the pattern/action
     rules, and the functions.


   The profiled version of your program may not look exactly like what
you typed when you wrote it.  This is because `gawk' creates the
profiled version by "pretty printing" its internal representation of
the program.  The advantage to this is that `gawk' can produce a
standard representation.  The disadvantage is that all source-code
comments are lost, as are the distinctions among multiple `BEGIN',
`END', `BEGINFILE', and `ENDFILE' rules.  Also, things such as:

     /foo/

come out as:

     /foo/   {
         print $0
     }

which is correct, but possibly surprising.

   Besides creating profiles when a program has completed, `gawk' can
produce a profile while it is running.  This is useful if your `awk'
program goes into an infinite loop and you want to see what has been
executed.  To use this feature, run `gawk' with the `--profile' option
in the background:

     $ gawk --profile -f myprog &
     [1] 13992

The shell prints a job number and process ID number; in this case,
13992.  Use the `kill' command to send the `USR1' signal to `gawk':

     $ kill -USR1 13992

As usual, the profiled version of the program is written to
`awkprof.out', or to a different file if one specified with the
`--profile' option.

   Along with the regular profile, as shown earlier, the profile
includes a trace of any active functions:

     # Function Call Stack:

     #   3. baz
     #   2. bar
     #   1. foo
     # -- main --

   You may send `gawk' the `USR1' signal as many times as you like.
Each time, the profile and function call trace are appended to the
output profile file.

   If you use the `HUP' signal instead of the `USR1' signal, `gawk'
produces the profile and the function call trace and then exits.

   When `gawk' runs on MS-Windows systems, it uses the `INT' and `QUIT'
signals for producing the profile and, in the case of the `INT' signal,
`gawk' exits.  This is because these systems don't support the `kill'
command, so the only signals you can deliver to a program are those
generated by the keyboard.  The `INT' signal is generated by the
`Ctrl-<C>' or `Ctrl-<BREAK>' key, while the `QUIT' signal is generated
by the `Ctrl-<\>' key.

   Finally, `gawk' also accepts another option, `--pretty-print'.  When
called this way, `gawk' "pretty prints" the program into `awkprof.out',
without any execution counts.


File: gawk.info,  Node: Internationalization,  Next: Debugger,  Prev: Advanced Features,  Up: Top

13 Internationalization with `gawk'
***********************************

Once upon a time, computer makers wrote software that worked only in
English.  Eventually, hardware and software vendors noticed that if
their systems worked in the native languages of non-English-speaking
countries, they were able to sell more systems.  As a result,
internationalization and localization of programs and software systems
became a common practice.

   For many years, the ability to provide internationalization was
largely restricted to programs written in C and C++.  This major node
describes the underlying library `gawk' uses for internationalization,
as well as how `gawk' makes internationalization features available at
the `awk' program level.  Having internationalization available at the
`awk' level gives software developers additional flexibility--they are
no longer forced to write in C or C++ when internationalization is a
requirement.

* Menu:

* I18N and L10N::               Internationalization and Localization.
* Explaining gettext::          How GNU `gettext' works.
* Programmer i18n::             Features for the programmer.
* Translator i18n::             Features for the translator.
* I18N Example::                A simple i18n example.
* Gawk I18N::                   `gawk' is also internationalized.


File: gawk.info,  Node: I18N and L10N,  Next: Explaining gettext,  Up: Internationalization

13.1 Internationalization and Localization
==========================================

"Internationalization" means writing (or modifying) a program once, in
such a way that it can use multiple languages without requiring further
source-code changes.  "Localization" means providing the data necessary
for an internationalized program to work in a particular language.
Most typically, these terms refer to features such as the language used
for printing error messages, the language used to read responses, and
information related to how numerical and monetary values are printed
and read.


File: gawk.info,  Node: Explaining gettext,  Next: Programmer i18n,  Prev: I18N and L10N,  Up: Internationalization

13.2 GNU `gettext'
==================

The facilities in GNU `gettext' focus on messages; strings printed by a
program, either directly or via formatting with `printf' or
`sprintf()'.(1)

   When using GNU `gettext', each application has its own "text
domain".  This is a unique name, such as `kpilot' or `gawk', that
identifies the application.  A complete application may have multiple
components--programs written in C or C++, as well as scripts written in
`sh' or `awk'.  All of the components use the same text domain.

   To make the discussion concrete, assume we're writing an application
named `guide'.  Internationalization consists of the following steps,
in this order:

  1. The programmer goes through the source for all of `guide''s
     components and marks each string that is a candidate for
     translation.  For example, `"`-F': option required"' is a good
     candidate for translation.  A table with strings of option names
     is not (e.g., `gawk''s `--profile' option should remain the same,
     no matter what the local language).

  2. The programmer indicates the application's text domain (`"guide"')
     to the `gettext' library, by calling the `textdomain()' function.

  3. Messages from the application are extracted from the source code
     and collected into a portable object template file (`guide.pot'),
     which lists the strings and their translations.  The translations
     are initially empty.  The original (usually English) messages
     serve as the key for lookup of the translations.

  4. For each language with a translator, `guide.pot' is copied to a
     portable object file (`.po') and translations are created and
     shipped with the application.  For example, there might be a
     `fr.po' for a French translation.

  5. Each language's `.po' file is converted into a binary message
     object (`.gmo') file.  A message object file contains the original
     messages and their translations in a binary format that allows
     fast lookup of translations at runtime.

  6. When `guide' is built and installed, the binary translation files
     are installed in a standard place.

  7. For testing and development, it is possible to tell `gettext' to
     use `.gmo' files in a different directory than the standard one by
     using the `bindtextdomain()' function.

  8. At runtime, `guide' looks up each string via a call to
     `gettext()'.  The returned string is the translated string if
     available, or the original string if not.

  9. If necessary, it is possible to access messages from a different
     text domain than the one belonging to the application, without
     having to switch the application's default text domain back and
     forth.

   In C (or C++), the string marking and dynamic translation lookup are
accomplished by wrapping each string in a call to `gettext()':

     printf("%s", gettext("Don't Panic!\n"));

   The tools that extract messages from source code pull out all
strings enclosed in calls to `gettext()'.

   The GNU `gettext' developers, recognizing that typing `gettext(...)'
over and over again is both painful and ugly to look at, use the macro
`_' (an underscore) to make things easier:

     /* In the standard header file: */
     #define _(str) gettext(str)

     /* In the program text: */
     printf("%s", _("Don't Panic!\n"));

This reduces the typing overhead to just three extra characters per
string and is considerably easier to read as well.

   There are locale "categories" for different types of locale-related
information.  The defined locale categories that `gettext' knows about
are:

`LC_MESSAGES'
     Text messages.  This is the default category for `gettext'
     operations, but it is possible to supply a different one
     explicitly, if necessary.  (It is almost never necessary to supply
     a different category.)

`LC_COLLATE'
     Text-collation information; i.e., how different characters and/or
     groups of characters sort in a given language.

`LC_CTYPE'
     Character-type information (alphabetic, digit, upper- or
     lowercase, and so on).  This information is accessed via the POSIX
     character classes in regular expressions, such as `/[[:alnum:]]/'
     (*note Regexp Operators::).

`LC_MONETARY'
     Monetary information, such as the currency symbol, and whether the
     symbol goes before or after a number.

`LC_NUMERIC'
     Numeric information, such as which characters to use for the
     decimal point and the thousands separator.(2)

`LC_RESPONSE'
     Response information, such as how "yes" and "no" appear in the
     local language, and possibly other information as well.

`LC_TIME'
     Time- and date-related information, such as 12- or 24-hour clock,
     month printed before or after the day in a date, local month
     abbreviations, and so on.

`LC_ALL'
     All of the above.  (Not too useful in the context of `gettext'.)

   ---------- Footnotes ----------

   (1) For some operating systems, the `gawk' port doesn't support GNU
`gettext'.  Therefore, these features are not available if you are
using one of those operating systems. Sorry.

   (2) Americans use a comma every three decimal places and a period
for the decimal point, while many Europeans do exactly the opposite:
1,234.56 versus 1.234,56.


File: gawk.info,  Node: Programmer i18n,  Next: Translator i18n,  Prev: Explaining gettext,  Up: Internationalization

13.3 Internationalizing `awk' Programs
======================================

`gawk' provides the following variables and functions for
internationalization:

`TEXTDOMAIN'
     This variable indicates the application's text domain.  For
     compatibility with GNU `gettext', the default value is
     `"messages"'.

`_"your message here"'
     String constants marked with a leading underscore are candidates
     for translation at runtime.  String constants without a leading
     underscore are not translated.

`dcgettext(STRING [, DOMAIN [, CATEGORY]])'
     Return the translation of STRING in text domain DOMAIN for locale
     category CATEGORY.  The default value for DOMAIN is the current
     value of `TEXTDOMAIN'.  The default value for CATEGORY is
     `"LC_MESSAGES"'.

     If you supply a value for CATEGORY, it must be a string equal to
     one of the known locale categories described in *note Explaining
     gettext::.  You must also supply a text domain.  Use `TEXTDOMAIN'
     if you want to use the current domain.

          CAUTION: The order of arguments to the `awk' version of the
          `dcgettext()' function is purposely different from the order
          for the C version.  The `awk' version's order was chosen to
          be simple and to allow for reasonable `awk'-style default
          arguments.

`dcngettext(STRING1, STRING2, NUMBER [, DOMAIN [, CATEGORY]])'
     Return the plural form used for NUMBER of the translation of
     STRING1 and STRING2 in text domain DOMAIN for locale category
     CATEGORY. STRING1 is the English singular variant of a message,
     and STRING2 the English plural variant of the same message.  The
     default value for DOMAIN is the current value of `TEXTDOMAIN'.
     The default value for CATEGORY is `"LC_MESSAGES"'.

     The same remarks about argument order as for the `dcgettext()'
     function apply.

`bindtextdomain(DIRECTORY [, DOMAIN])'
     Change the directory in which `gettext' looks for `.gmo' files, in
     case they will not or cannot be placed in the standard locations
     (e.g., during testing).  Return the directory in which DOMAIN is
     "bound."

     The default DOMAIN is the value of `TEXTDOMAIN'.  If DIRECTORY is
     the null string (`""'), then `bindtextdomain()' returns the
     current binding for the given DOMAIN.

   To use these facilities in your `awk' program, follow the steps
outlined in *note Explaining gettext::, like so:

  1. Set the variable `TEXTDOMAIN' to the text domain of your program.
     This is best done in a `BEGIN' rule (*note BEGIN/END::), or it can
     also be done via the `-v' command-line option (*note Options::):

          BEGIN {
              TEXTDOMAIN = "guide"
              ...
          }

  2. Mark all translatable strings with a leading underscore (`_')
     character.  It _must_ be adjacent to the opening quote of the
     string.  For example:

          print _"hello, world"
          x = _"you goofed"
          printf(_"Number of users is %d\n", nusers)

  3. If you are creating strings dynamically, you can still translate
     them, using the `dcgettext()' built-in function:

          message = nusers " users logged in"
          message = dcgettext(message, "adminprog")
          print message

     Here, the call to `dcgettext()' supplies a different text domain
     (`"adminprog"') in which to find the message, but it uses the
     default `"LC_MESSAGES"' category.

  4. During development, you might want to put the `.gmo' file in a
     private directory for testing.  This is done with the
     `bindtextdomain()' built-in function:

          BEGIN {
             TEXTDOMAIN = "guide"   # our text domain
             if (Testing) {
                 # where to find our files
                 bindtextdomain("testdir")
                 # joe is in charge of adminprog
                 bindtextdomain("../joe/testdir", "adminprog")
             }
             ...
          }


   *Note I18N Example::, for an example program showing the steps to
create and use translations from `awk'.


File: gawk.info,  Node: Translator i18n,  Next: I18N Example,  Prev: Programmer i18n,  Up: Internationalization

13.4 Translating `awk' Programs
===============================

Once a program's translatable strings have been marked, they must be
extracted to create the initial `.po' file.  As part of translation, it
is often helpful to rearrange the order in which arguments to `printf'
are output.

   `gawk''s `--gen-pot' command-line option extracts the messages and
is discussed next.  After that, `printf''s ability to rearrange the
order for `printf' arguments at runtime is covered.

* Menu:

* String Extraction::           Extracting marked strings.
* Printf Ordering::             Rearranging `printf' arguments.
* I18N Portability::            `awk'-level portability issues.


File: gawk.info,  Node: String Extraction,  Next: Printf Ordering,  Up: Translator i18n

13.4.1 Extracting Marked Strings
--------------------------------

Once your `awk' program is working, and all the strings have been
marked and you've set (and perhaps bound) the text domain, it is time
to produce translations.  First, use the `--gen-pot' command-line
option to create the initial `.pot' file:

     $ gawk --gen-pot -f guide.awk > guide.pot

   When run with `--gen-pot', `gawk' does not execute your program.
Instead, it parses it as usual and prints all marked strings to
standard output in the format of a GNU `gettext' Portable Object file.
Also included in the output are any constant strings that appear as the
first argument to `dcgettext()' or as the first and second argument to
`dcngettext()'.(1) *Note I18N Example::, for the full list of steps to
go through to create and test translations for `guide'.

   ---------- Footnotes ----------

   (1) The `xgettext' utility that comes with GNU `gettext' can handle
`.awk' files.


File: gawk.info,  Node: Printf Ordering,  Next: I18N Portability,  Prev: String Extraction,  Up: Translator i18n

13.4.2 Rearranging `printf' Arguments
-------------------------------------

Format strings for `printf' and `sprintf()' (*note Printf::) present a
special problem for translation.  Consider the following:(1)

     printf(_"String `%s' has %d characters\n",
               string, length(string)))

   A possible German translation for this might be:

     "%d Zeichen lang ist die Zeichenkette `%s'\n"

   The problem should be obvious: the order of the format
specifications is different from the original!  Even though `gettext()'
can return the translated string at runtime, it cannot change the
argument order in the call to `printf'.

   To solve this problem, `printf' format specifiers may have an
additional optional element, which we call a "positional specifier".
For example:

     "%2$d Zeichen lang ist die Zeichenkette `%1$s'\n"

   Here, the positional specifier consists of an integer count, which
indicates which argument to use, and a `$'. Counts are one-based, and
the format string itself is _not_ included.  Thus, in the following
example, `string' is the first argument and `length(string)' is the
second:

     $ gawk 'BEGIN {
     >     string = "Dont Panic"
     >     printf _"%2$d characters live in \"%1$s\"\n",
     >                         string, length(string)
     > }'
     -| 10 characters live in "Dont Panic"

   If present, positional specifiers come first in the format
specification, before the flags, the field width, and/or the precision.

   Positional specifiers can be used with the dynamic field width and
precision capability:

     $ gawk 'BEGIN {
     >    printf("%*.*s\n", 10, 20, "hello")
     >    printf("%3$*2$.*1$s\n", 20, 10, "hello")
     > }'
     -|      hello
     -|      hello

     NOTE: When using `*' with a positional specifier, the `*' comes
     first, then the integer position, and then the `$'.  This is
     somewhat counterintuitive.

   `gawk' does not allow you to mix regular format specifiers and those
with positional specifiers in the same string:

     $ gawk 'BEGIN { printf _"%d %3$s\n", 1, 2, "hi" }'
     error--> gawk: cmd. line:1: fatal: must use `count$' on all formats or none

     NOTE: There are some pathological cases that `gawk' may fail to
     diagnose.  In such cases, the output may not be what you expect.
     It's still a bad idea to try mixing them, even if `gawk' doesn't
     detect it.

   Although positional specifiers can be used directly in `awk'
programs, their primary purpose is to help in producing correct
translations of format strings into languages different from the one in
which the program is first written.

   ---------- Footnotes ----------

   (1) This example is borrowed from the GNU `gettext' manual.


File: gawk.info,  Node: I18N Portability,  Prev: Printf Ordering,  Up: Translator i18n

13.4.3 `awk' Portability Issues
-------------------------------

`gawk''s internationalization features were purposely chosen to have as
little impact as possible on the portability of `awk' programs that use
them to other versions of `awk'.  Consider this program:

     BEGIN {
         TEXTDOMAIN = "guide"
         if (Test_Guide)   # set with -v
             bindtextdomain("/test/guide/messages")
         print _"don't panic!"
     }

As written, it won't work on other versions of `awk'.  However, it is
actually almost portable, requiring very little change:

   * Assignments to `TEXTDOMAIN' won't have any effect, since
     `TEXTDOMAIN' is not special in other `awk' implementations.

   * Non-GNU versions of `awk' treat marked strings as the
     concatenation of a variable named `_' with the string following
     it.(1) Typically, the variable `_' has the null string (`""') as
     its value, leaving the original string constant as the result.

   * By defining "dummy" functions to replace `dcgettext()',
     `dcngettext()' and `bindtextdomain()', the `awk' program can be
     made to run, but all the messages are output in the original
     language.  For example:

          function bindtextdomain(dir, domain)
          {
              return dir
          }

          function dcgettext(string, domain, category)
          {
              return string
          }

          function dcngettext(string1, string2, number, domain, category)
          {
              return (number == 1 ? string1 : string2)
          }

   * The use of positional specifications in `printf' or `sprintf()' is
     _not_ portable.  To support `gettext()' at the C level, many
     systems' C versions of `sprintf()' do support positional
     specifiers.  But it works only if enough arguments are supplied in
     the function call.  Many versions of `awk' pass `printf' formats
     and arguments unchanged to the underlying C library version of
     `sprintf()', but only one format and argument at a time.  What
     happens if a positional specification is used is anybody's guess.
     However, since the positional specifications are primarily for use
     in _translated_ format strings, and since non-GNU `awk's never
     retrieve the translated string, this should not be a problem in
     practice.

   ---------- Footnotes ----------

   (1) This is good fodder for an "Obfuscated `awk'" contest.


File: gawk.info,  Node: I18N Example,  Next: Gawk I18N,  Prev: Translator i18n,  Up: Internationalization

13.5 A Simple Internationalization Example
==========================================

Now let's look at a step-by-step example of how to internationalize and
localize a simple `awk' program, using `guide.awk' as our original
source:

     BEGIN {
         TEXTDOMAIN = "guide"
         bindtextdomain(".")  # for testing
         print _"Don't Panic"
         print _"The Answer Is", 42
         print "Pardon me, Zaphod who?"
     }

Run `gawk --gen-pot' to create the `.pot' file:

     $ gawk --gen-pot -f guide.awk > guide.pot

This produces:

     #: guide.awk:4
     msgid "Don't Panic"
     msgstr ""

     #: guide.awk:5
     msgid "The Answer Is"
     msgstr ""

   This original portable object template file is saved and reused for
each language into which the application is translated.  The `msgid' is
the original string and the `msgstr' is the translation.

     NOTE: Strings not marked with a leading underscore do not appear
     in the `guide.pot' file.

   Next, the messages must be translated.  Here is a translation to a
hypothetical dialect of English, called "Mellow":(1)

     $ cp guide.pot guide-mellow.po
     ADD TRANSLATIONS TO guide-mellow.po ...

Following are the translations:

     #: guide.awk:4
     msgid "Don't Panic"
     msgstr "Hey man, relax!"

     #: guide.awk:5
     msgid "The Answer Is"
     msgstr "Like, the scoop is"

   The next step is to make the directory to hold the binary message
object file and then to create the `guide.gmo' file.  The directory
layout shown here is standard for GNU `gettext' on GNU/Linux systems.
Other versions of `gettext' may use a different layout:

     $ mkdir en_US en_US/LC_MESSAGES

   The `msgfmt' utility does the conversion from human-readable `.po'
file to machine-readable `.gmo' file.  By default, `msgfmt' creates a
file named `messages'.  This file must be renamed and placed in the
proper directory so that `gawk' can find it:

     $ msgfmt guide-mellow.po
     $ mv messages en_US/LC_MESSAGES/guide.gmo

   Finally, we run the program to test it:

     $ gawk -f guide.awk
     -| Hey man, relax!
     -| Like, the scoop is 42
     -| Pardon me, Zaphod who?

   If the three replacement functions for `dcgettext()', `dcngettext()'
and `bindtextdomain()' (*note I18N Portability::) are in a file named
`libintl.awk', then we can run `guide.awk' unchanged as follows:

     $ gawk --posix -f guide.awk -f libintl.awk
     -| Don't Panic
     -| The Answer Is 42
     -| Pardon me, Zaphod who?

   ---------- Footnotes ----------

   (1) Perhaps it would be better if it were called "Hippy." Ah, well.


File: gawk.info,  Node: Gawk I18N,  Prev: I18N Example,  Up: Internationalization

13.6 `gawk' Can Speak Your Language
===================================

`gawk' itself has been internationalized using the GNU `gettext'
package.  (GNU `gettext' is described in complete detail in *note (GNU
`gettext' utilities)Top:: gettext, GNU gettext tools.)  As of this
writing, the latest version of GNU `gettext' is version 0.18.2.1
(ftp://ftp.gnu.org/gnu/gettext/gettext-0.18.2.1.tar.gz).

   If a translation of `gawk''s messages exists, then `gawk' produces
usage messages, warnings, and fatal errors in the local language.


File: gawk.info,  Node: Debugger,  Next: Arbitrary Precision Arithmetic,  Prev: Internationalization,  Up: Top

14 Debugging `awk' Programs
***************************

It would be nice if computer programs worked perfectly the first time
they were run, but in real life, this rarely happens for programs of
any complexity.  Thus, most programming languages have facilities
available for "debugging" programs, and now `awk' is no exception.

   The `gawk' debugger is purposely modeled after the GNU Debugger
(GDB) (http://www.gnu.org/software/gdb/) command-line debugger.  If you
are familiar with GDB, learning how to use `gawk' for debugging your
program is easy.

* Menu:

* Debugging::                   Introduction to `gawk' debugger.
* Sample Debugging Session::    Sample debugging session.
* List of Debugger Commands::   Main debugger commands.
* Readline Support::            Readline support.
* Limitations::                 Limitations and future plans.


File: gawk.info,  Node: Debugging,  Next: Sample Debugging Session,  Up: Debugger

14.1 Introduction to `gawk' Debugger
====================================

This minor node introduces debugging in general and begins the
discussion of debugging in `gawk'.

* Menu:

* Debugging Concepts::          Debugging in General.
* Debugging Terms::             Additional Debugging Concepts.
* Awk Debugging::               Awk Debugging.


File: gawk.info,  Node: Debugging Concepts,  Next: Debugging Terms,  Up: Debugging

14.1.1 Debugging in General
---------------------------

(If you have used debuggers in other languages, you may want to skip
ahead to the next section on the specific features of the `awk'
debugger.)

   Of course, a debugging program cannot remove bugs for you, since it
has no way of knowing what you or your users consider a "bug" and what
is a "feature."  (Sometimes, we humans have a hard time with this
ourselves.)  In that case, what can you expect from such a tool?  The
answer to that depends on the language being debugged, but in general,
you can expect at least the following:

   * The ability to watch a program execute its instructions one by one,
     giving you, the programmer, the opportunity to think about what is
     happening on a time scale of seconds, minutes, or hours, rather
     than the nanosecond time scale at which the code usually runs.

   * The opportunity to not only passively observe the operation of your
     program, but to control it and try different paths of execution,
     without having to change your source files.

   * The chance to see the values of data in the program at any point in
     execution, and also to change that data on the fly, to see how that
     affects what happens afterwards.  (This often includes the ability
     to look at internal data structures besides the variables you
     actually defined in your code.)

   * The ability to obtain additional information about your program's
     state or even its internal structure.

   All of these tools provide a great amount of help in using your own
skills and understanding of the goals of your program to find where it
is going wrong (or, for that matter, to better comprehend a perfectly
functional program that you or someone else wrote).


File: gawk.info,  Node: Debugging Terms,  Next: Awk Debugging,  Prev: Debugging Concepts,  Up: Debugging

14.1.2 Additional Debugging Concepts
------------------------------------

Before diving in to the details, we need to introduce several important
concepts that apply to just about all debuggers.  The following list
defines terms used throughout the rest of this major node.

"Stack Frame"
     Programs generally call functions during the course of their
     execution.  One function can call another, or a function can call
     itself (recursion).  You can view the chain of called functions
     (main program calls A, which calls B, which calls C), as a stack
     of executing functions: the currently running function is the
     topmost one on the stack, and when it finishes (returns), the next
     one down then becomes the active function.  Such a stack is termed
     a "call stack".

     For each function on the call stack, the system maintains a data
     area that contains the function's parameters, local variables, and
     return value, as well as any other "bookkeeping" information
     needed to manage the call stack.  This data area is termed a
     "stack frame".

     `gawk' also follows this model, and gives you access to the call
     stack and to each stack frame. You can see the call stack, as well
     as from where each function on the stack was invoked. Commands
     that print the call stack print information about each stack frame
     (as detailed later on).

"Breakpoint"
     During debugging, you often wish to let the program run until it
     reaches a certain point, and then continue execution from there one
     statement (or instruction) at a time.  The way to do this is to set
     a "breakpoint" within the program.  A breakpoint is where the
     execution of the program should break off (stop), so that you can
     take over control of the program's execution.  You can add and
     remove as many breakpoints as you like.

"Watchpoint"
     A watchpoint is similar to a breakpoint.  The difference is that
     breakpoints are oriented around the code: stop when a certain
     point in the code is reached.  A watchpoint, however, specifies
     that program execution should stop when a _data value_ is changed.
     This is useful, since sometimes it happens that a variable
     receives an erroneous value, and it's hard to track down where
     this happens just by looking at the code.  By using a watchpoint,
     you can stop whenever a variable is assigned to, and usually find
     the errant code quite quickly.


File: gawk.info,  Node: Awk Debugging,  Prev: Debugging Terms,  Up: Debugging

14.1.3 Awk Debugging
--------------------

Debugging an `awk' program has some specific aspects that are not
shared with other programming languages.

   First of all, the fact that `awk' programs usually take input
line-by-line from a file or files and operate on those lines using
specific rules makes it especially useful to organize viewing the
execution of the program in terms of these rules.  As we will see, each
`awk' rule is treated almost like a function call, with its own
specific block of instructions.

   In addition, since `awk' is by design a very concise language, it is
easy to lose sight of everything that is going on "inside" each line of
`awk' code.  The debugger provides the opportunity to look at the
individual primitive instructions carried out by the higher-level `awk'
commands.


File: gawk.info,  Node: Sample Debugging Session,  Next: List of Debugger Commands,  Prev: Debugging,  Up: Debugger

14.2 Sample Debugging Session
=============================

In order to illustrate the use of `gawk' as a debugger, let's look at a
sample debugging session.  We will use the `awk' implementation of the
POSIX `uniq' command described earlier (*note Uniq Program::) as our
example.

* Menu:

* Debugger Invocation::         How to Start the Debugger.
* Finding The Bug::             Finding the Bug.


File: gawk.info,  Node: Debugger Invocation,  Next: Finding The Bug,  Up: Sample Debugging Session

14.2.1 How to Start the Debugger
--------------------------------

Starting the debugger is almost exactly like running `awk', except you
have to pass an additional option `--debug' or the corresponding short
option `-D'.  The file(s) containing the program and any supporting
code are given on the command line as arguments to one or more `-f'
options. (`gawk' is not designed to debug command-line programs, only
programs contained in files.)  In our case, we invoke the debugger like
this:

     $ gawk -D -f getopt.awk -f join.awk -f uniq.awk inputfile

where both `getopt.awk' and `uniq.awk' are in `$AWKPATH'.  (Experienced
users of GDB or similar debuggers should note that this syntax is
slightly different from what they are used to.  With the `gawk'
debugger, you give the arguments for running the program in the command
line to the debugger rather than as part of the `run' command at the
debugger prompt.)

   Instead of immediately running the program on `inputfile', as `gawk'
would ordinarily do, the debugger merely loads all the program source
files, compiles them internally, and then gives us a prompt:

     gawk>

from which we can issue commands to the debugger.  At this point, no
code has been executed.


File: gawk.info,  Node: Finding The Bug,  Prev: Debugger Invocation,  Up: Sample Debugging Session

14.2.2 Finding the Bug
----------------------

Let's say that we are having a problem using (a faulty version of)
`uniq.awk' in the "field-skipping" mode, and it doesn't seem to be
catching lines which should be identical when skipping the first field,
such as:

     awk is a wonderful program!
     gawk is a wonderful program!

   This could happen if we were thinking (C-like) of the fields in a
record as being numbered in a zero-based fashion, so instead of the
lines:

     clast = join(alast, fcount+1, n)
     cline = join(aline, fcount+1, m)

we wrote:

     clast = join(alast, fcount, n)
     cline = join(aline, fcount, m)

   The first thing we usually want to do when trying to investigate a
problem like this is to put a breakpoint in the program so that we can
watch it at work and catch what it is doing wrong.  A reasonable spot
for a breakpoint in `uniq.awk' is at the beginning of the function
`are_equal()', which compares the current line with the previous one.
To set the breakpoint, use the `b' (breakpoint) command:

     gawk> b are_equal
     -| Breakpoint 1 set at file `awklib/eg/prog/uniq.awk', line 64

   The debugger tells us the file and line number where the breakpoint
is.  Now type `r' or `run' and the program runs until it hits the
breakpoint for the first time:

     gawk> r
     -| Starting program:
     -| Stopping in Rule ...
     -| Breakpoint 1, are_equal(n, m, clast, cline, alast, aline)
              at `awklib/eg/prog/uniq.awk':64
     -| 64          if (fcount == 0 && charcount == 0)
     gawk>

   Now we can look at what's going on inside our program.  First of all,
let's see how we got to where we are.  At the prompt, we type `bt'
(short for "backtrace"), and the debugger responds with a listing of
the current stack frames:

     gawk> bt
     -| #0  are_equal(n, m, clast, cline, alast, aline)
              at `awklib/eg/prog/uniq.awk':69
     -| #1  in main() at `awklib/eg/prog/uniq.awk':89

   This tells us that `are_equal()' was called by the main program at
line 89 of `uniq.awk'.  (This is not a big surprise, since this is the
only call to `are_equal()' in the program, but in more complex
programs, knowing who called a function and with what parameters can be
the key to finding the source of the problem.)

   Now that we're in `are_equal()', we can start looking at the values
of some variables.  Let's say we type `p n' (`p' is short for "print").
We would expect to see the value of `n', a parameter to `are_equal()'.
Actually, the debugger gives us:

     gawk> p n
     -| n = untyped variable

In this case, `n' is an uninitialized local variable, since the
function was called without arguments (*note Function Calls::).

   A more useful variable to display might be the current record:

     gawk> p $0
     -| $0 = string ("gawk is a wonderful program!")

This might be a bit puzzling at first since this is the second line of
our test input above.  Let's look at `NR':

     gawk> p NR
     -| NR = number (2)

So we can see that `are_equal()' was only called for the second record
of the file.  Of course, this is because our program contained a rule
for `NR == 1':

     NR == 1 {
         last = $0
         next
     }

   OK, let's just check that that rule worked correctly:

     gawk> p last
     -| last = string ("awk is a wonderful program!")

   Everything we have done so far has verified that the program has
worked as planned, up to and including the call to `are_equal()', so
the problem must be inside this function.  To investigate further, we
must begin "stepping through" the lines of `are_equal()'.  We start by
typing `n' (for "next"):

     gawk> n
     -| 67          if (fcount > 0) {

   This tells us that `gawk' is now ready to execute line 67, which
decides whether to give the lines the special "field skipping" treatment
indicated by the `-f' command-line option.  (Notice that we skipped
from where we were before at line 64 to here, since the condition in
line 64

     if (fcount == 0 && charcount == 0)

was false.)

   Continuing to step, we now get to the splitting of the current and
last records:

     gawk> n
     -| 68              n = split(last, alast)
     gawk> n
     -| 69              m = split($0, aline)

   At this point, we should be curious to see what our records were
split into, so we try to look:

     gawk> p n m alast aline
     -| n = number (5)
     -| m = number (5)
     -| alast = array, 5 elements
     -| aline = array, 5 elements

(The `p' command can take more than one argument, similar to `awk''s
`print' statement.)

   This is kind of disappointing, though.  All we found out is that
there are five elements in each of our arrays.  Useful enough (we now
know that none of the words were accidentally left out), but what if we
want to see inside the array?

   The first choice would be to use subscripts:

     gawk> p alast[0]
     -| "0" not in array `alast'

Oops!

     gawk> p alast[1]
     -| alast["1"] = string ("awk")

   This would be kind of slow for a 100-member array, though, so `gawk'
provides a shortcut (reminiscent of another language not to be
mentioned):

     gawk> p @alast
     -| alast["1"] = string ("awk")
     -| alast["2"] = string ("is")
     -| alast["3"] = string ("a")
     -| alast["4"] = string ("wonderful")
     -| alast["5"] = string ("program!")

   It looks like we got this far OK.  Let's take another step or two:

     gawk> n
     -| 70              clast = join(alast, fcount, n)
     gawk> n
     -| 71              cline = join(aline, fcount, m)

   Well, here we are at our error (sorry to spoil the suspense).  What
we had in mind was to join the fields starting from the second one to
make the virtual record to compare, and if the first field was numbered
zero, this would work.  Let's look at what we've got:

     gawk> p cline clast
     -| cline = string ("gawk is a wonderful program!")
     -| clast = string ("awk is a wonderful program!")

   Hey, those look pretty familiar!  They're just our original,
unaltered, input records.  A little thinking (the human brain is still
the best debugging tool), and we realize that we were off by one!

   We get out of the debugger:

     gawk> q
     -| The program is running. Exit anyway (y/n)? y

Then we get into an editor:

     clast = join(alast, fcount+1, n)
     cline = join(aline, fcount+1, m)

and problem solved!


File: gawk.info,  Node: List of Debugger Commands,  Next: Readline Support,  Prev: Sample Debugging Session,  Up: Debugger

14.3 Main Debugger Commands
===========================

The `gawk' debugger command set can be divided into the following
categories:

   * Breakpoint control

   * Execution control

   * Viewing and changing data

   * Working with the stack

   * Getting information

   * Miscellaneous

   Each of these are discussed in the following subsections.  In the
following descriptions, commands which may be abbreviated show the
abbreviation on a second description line.  A debugger command name may
also be truncated if that partial name is unambiguous. The debugger has
the built-in capability to automatically repeat the previous command
when just hitting <Enter>.  This works for the commands `list', `next',
`nexti', `step', `stepi' and `continue' executed without any argument.

* Menu:

* Breakpoint Control::          Control of Breakpoints.
* Debugger Execution Control::  Control of Execution.
* Viewing And Changing Data::   Viewing and Changing Data.
* Execution Stack::             Dealing with the Stack.
* Debugger Info::               Obtaining Information about the Program and
                                the Debugger State.
* Miscellaneous Debugger Commands:: Miscellaneous Commands.


File: gawk.info,  Node: Breakpoint Control,  Next: Debugger Execution Control,  Up: List of Debugger Commands

14.3.1 Control of Breakpoints
-----------------------------

As we saw above, the first thing you probably want to do in a debugging
session is to get your breakpoints set up, since otherwise your program
will just run as if it was not under the debugger.  The commands for
controlling breakpoints are:

`break' [[FILENAME`:']N | FUNCTION] [`"EXPRESSION"']
`b' [[FILENAME`:']N | FUNCTION] [`"EXPRESSION"']
     Without any argument, set a breakpoint at the next instruction to
     be executed in the selected stack frame.  Arguments can be one of
     the following:

    N
          Set a breakpoint at line number N in the current source file.

    FILENAME`:'N
          Set a breakpoint at line number N in source file FILENAME.

    FUNCTION
          Set a breakpoint at entry to (the first instruction of)
          function FUNCTION.

     Each breakpoint is assigned a number which can be used to delete
     it from the breakpoint list using the `delete' command.

     With a breakpoint, you may also supply a condition.  This is an
     `awk' expression (enclosed in double quotes) that the debugger
     evaluates whenever the breakpoint is reached. If the condition is
     true, then the debugger stops execution and prompts for a command.
     Otherwise, it continues executing the program.

`clear' [[FILENAME`:']N | FUNCTION]
     Without any argument, delete any breakpoint at the next instruction
     to be executed in the selected stack frame. If the program stops at
     a breakpoint, this deletes that breakpoint so that the program
     does not stop at that location again.  Arguments can be one of the
     following:

    N
          Delete breakpoint(s) set at line number N in the current
          source file.

    FILENAME`:'N
          Delete breakpoint(s) set at line number N in source file
          FILENAME.

    FUNCTION
          Delete breakpoint(s) set at entry to function FUNCTION.

`condition' N `"EXPRESSION"'
     Add a condition to existing breakpoint or watchpoint N. The
     condition is an `awk' expression that the debugger evaluates
     whenever the breakpoint or watchpoint is reached. If the condition
     is true, then the debugger stops execution and prompts for a
     command. Otherwise, the debugger continues executing the program.
     If the condition expression is not specified, any existing
     condition is removed; i.e., the breakpoint or watchpoint is made
     unconditional.

`delete' [N1 N2 ...] [N-M]
`d' [N1 N2 ...] [N-M]
     Delete specified breakpoints or a range of breakpoints. Deletes
     all defined breakpoints if no argument is supplied.

`disable' [N1 N2 ... | N-M]
     Disable specified breakpoints or a range of breakpoints. Without
     any argument, disables all breakpoints.

`enable' [`del' | `once'] [N1 N2 ...] [N-M]
`e' [`del' | `once'] [N1 N2 ...] [N-M]
     Enable specified breakpoints or a range of breakpoints. Without
     any argument, enables all breakpoints.  Optionally, you can
     specify how to enable the breakpoint:

    `del'
          Enable the breakpoint(s) temporarily, then delete it when the
          program stops at the breakpoint.

    `once'
          Enable the breakpoint(s) temporarily, then disable it when
          the program stops at the breakpoint.

`ignore' N COUNT
     Ignore breakpoint number N the next COUNT times it is hit.

`tbreak' [[FILENAME`:']N | FUNCTION]
`t' [[FILENAME`:']N | FUNCTION]
     Set a temporary breakpoint (enabled for only one stop).  The
     arguments are the same as for `break'.


File: gawk.info,  Node: Debugger Execution Control,  Next: Viewing And Changing Data,  Prev: Breakpoint Control,  Up: List of Debugger Commands

14.3.2 Control of Execution
---------------------------

Now that your breakpoints are ready, you can start running the program
and observing its behavior.  There are more commands for controlling
execution of the program than we saw in our earlier example:

`commands' [N]
`silent'
...
`end'
     Set a list of commands to be executed upon stopping at a
     breakpoint or watchpoint. N is the breakpoint or watchpoint number.
     Without a number, the last one set is used. The actual commands
     follow, starting on the next line, and terminated by the `end'
     command.  If the command `silent' is in the list, the usual
     messages about stopping at a breakpoint and the source line are
     not printed. Any command in the list that resumes execution (e.g.,
     `continue') terminates the list (an implicit `end'), and
     subsequent commands are ignored.  For example:

          gawk> commands
          > silent
          > printf "A silent breakpoint; i = %d\n", i
          > info locals
          > set i = 10
          > continue
          > end
          gawk>

`continue' [COUNT]
`c' [COUNT]
     Resume program execution. If continued from a breakpoint and COUNT
     is specified, ignores the breakpoint at that location the next
     COUNT times before stopping.

`finish'
     Execute until the selected stack frame returns.  Print the
     returned value.

`next' [COUNT]
`n' [COUNT]
     Continue execution to the next source line, stepping over function
     calls.  The argument COUNT controls how many times to repeat the
     action, as in `step'.

`nexti' [COUNT]
`ni' [COUNT]
     Execute one (or COUNT) instruction(s), stepping over function
     calls.

`return' [VALUE]
     Cancel execution of a function call. If VALUE (either a string or a
     number) is specified, it is used as the function's return value.
     If used in a frame other than the innermost one (the currently
     executing function, i.e., frame number 0), discard all inner
     frames in addition to the selected one, and the caller of that
     frame becomes the innermost frame.

`run'
`r'
     Start/restart execution of the program. When restarting, the
     debugger retains the current breakpoints, watchpoints, command
     history, automatic display variables, and debugger options.

`step' [COUNT]
`s' [COUNT]
     Continue execution until control reaches a different source line
     in the current stack frame. `step' steps inside any function
     called within the line.  If the argument COUNT is supplied, steps
     that many times before stopping, unless it encounters a breakpoint
     or watchpoint.

`stepi' [COUNT]
`si' [COUNT]
     Execute one (or COUNT) instruction(s), stepping inside function
     calls.  (For illustration of what is meant by an "instruction" in
     `gawk', see the output shown under `dump' in *note Miscellaneous
     Debugger Commands::.)

`until' [[FILENAME`:']N | FUNCTION]
`u' [[FILENAME`:']N | FUNCTION]
     Without any argument, continue execution until a line past the
     current line in current stack frame is reached. With an argument,
     continue execution until the specified location is reached, or the
     current stack frame returns.


File: gawk.info,  Node: Viewing And Changing Data,  Next: Execution Stack,  Prev: Debugger Execution Control,  Up: List of Debugger Commands

14.3.3 Viewing and Changing Data
--------------------------------

The commands for viewing and changing variables inside of `gawk' are:

`display' [VAR | `$'N]
     Add variable VAR (or field `$N') to the display list.  The value
     of the variable or field is displayed each time the program stops.
     Each variable added to the list is identified by a unique number:

          gawk> display x
          -| 10: x = 1

     displays the assigned item number, the variable name and its
     current value.  If the display variable refers to a function
     parameter, it is silently deleted from the list as soon as the
     execution reaches a context where no such variable of the given
     name exists.  Without argument, `display' displays the current
     values of items on the list.

`eval "AWK STATEMENTS"'
     Evaluate AWK STATEMENTS in the context of the running program.
     You can do anything that an `awk' program would do: assign values
     to variables, call functions, and so on.

`eval' PARAM, ...
AWK STATEMENTS
`end'
     This form of `eval' is similar, but it allows you to define "local
     variables" that exist in the context of the AWK STATEMENTS,
     instead of using variables or function parameters defined by the
     program.

`print' VAR1[`,' VAR2 ...]
`p' VAR1[`,' VAR2 ...]
     Print the value of a `gawk' variable or field.  Fields must be
     referenced by constants:

          gawk> print $3

     This prints the third field in the input record (if the specified
     field does not exist, it prints `Null field'). A variable can be
     an array element, with the subscripts being constant values. To
     print the contents of an array, prefix the name of the array with
     the `@' symbol:

          gawk> print @a

     This prints the indices and the corresponding values for all
     elements in the array `a'.

`printf' FORMAT [`,' ARG ...]
     Print formatted text. The FORMAT may include escape sequences,
     such as `\n' (*note Escape Sequences::).  No newline is printed
     unless one is specified.

`set' VAR`='VALUE
     Assign a constant (number or string) value to an `awk' variable or
     field.  String values must be enclosed between double quotes
     (`"..."').

     You can also set special `awk' variables, such as `FS', `NF',
     `NR', etc.

`watch' VAR | `$'N [`"EXPRESSION"']
`w' VAR | `$'N [`"EXPRESSION"']
     Add variable VAR (or field `$N') to the watch list.  The debugger
     then stops whenever the value of the variable or field changes.
     Each watched item is assigned a number which can be used to delete
     it from the watch list using the `unwatch' command.

     With a watchpoint, you may also supply a condition.  This is an
     `awk' expression (enclosed in double quotes) that the debugger
     evaluates whenever the watchpoint is reached. If the condition is
     true, then the debugger stops execution and prompts for a command.
     Otherwise, `gawk' continues executing the program.

`undisplay' [N]
     Remove item number N (or all items, if no argument) from the
     automatic display list.

`unwatch' [N]
     Remove item number N (or all items, if no argument) from the watch
     list.



File: gawk.info,  Node: Execution Stack,  Next: Debugger Info,  Prev: Viewing And Changing Data,  Up: List of Debugger Commands

14.3.4 Dealing with the Stack
-----------------------------

Whenever you run a program which contains any function calls, `gawk'
maintains a stack of all of the function calls leading up to where the
program is right now.  You can see how you got to where you are, and
also move around in the stack to see what the state of things was in the
functions which called the one you are in.  The commands for doing this
are:

`backtrace' [COUNT]
`bt' [COUNT]
     Print a backtrace of all function calls (stack frames), or
     innermost COUNT frames if COUNT > 0. Print the outermost COUNT
     frames if COUNT < 0.  The backtrace displays the name and
     arguments to each function, the source file name, and the line
     number.

`down' [COUNT]
     Move COUNT (default 1) frames down the stack toward the innermost
     frame.  Then select and print the frame.

`frame' [N]
`f' [N]
     Select and print (frame number, function and argument names,
     source file, and the source line) stack frame N. Frame 0 is the
     currently executing, or "innermost", frame (function call), frame
     1 is the frame that called the innermost one. The highest numbered
     frame is the one for the main program.

`up' [COUNT]
     Move COUNT (default 1) frames up the stack toward the outermost
     frame.  Then select and print the frame.


File: gawk.info,  Node: Debugger Info,  Next: Miscellaneous Debugger Commands,  Prev: Execution Stack,  Up: List of Debugger Commands

14.3.5 Obtaining Information about the Program and the Debugger State
---------------------------------------------------------------------

Besides looking at the values of variables, there is often a need to get
other sorts of information about the state of your program and of the
debugging environment itself.  The `gawk' debugger has one command which
provides this information, appropriately called `info'.  `info' is used
with one of a number of arguments that tell it exactly what you want to
know:

`info' WHAT
`i' WHAT
     The value for WHAT should be one of the following:

    `args'
          Arguments of the selected frame.

    `break'
          List all currently set breakpoints.

    `display'
          List all items in the automatic display list.

    `frame'
          Description of the selected stack frame.

    `functions'
          List all function definitions including source file names and
          line numbers.

    `locals'
          Local variables of the selected frame.

    `source'
          The name of the current source file. Each time the program
          stops, the current source file is the file containing the
          current instruction.  When the debugger first starts, the
          current source file is the first file included via the `-f'
          option. The `list FILENAME:LINENO' command can be used at any
          time to change the current source.

    `sources'
          List all program sources.

    `variables'
          List all global variables.

    `watch'
          List all items in the watch list.

   Additional commands give you control over the debugger, the ability
to save the debugger's state, and the ability to run debugger commands
from a file.  The commands are:

`option' [NAME[`='VALUE]]
`o' [NAME[`='VALUE]]
     Without an argument, display the available debugger options and
     their current values. `option NAME' shows the current value of the
     named option. `option NAME=VALUE' assigns a new value to the named
     option.  The available options are:

    `history_size'
          The maximum number of lines to keep in the history file
          `./.gawk_history'.  The default is 100.

    `listsize'
          The number of lines that `list' prints. The default is 15.

    `outfile'
          Send `gawk' output to a file; debugger output still goes to
          standard output. An empty string (`""') resets output to
          standard output.

    `prompt'
          The debugger prompt. The default is `gawk> '.

    `save_history [on | off]'
          Save command history to file `./.gawk_history'.  The default
          is `on'.

    `save_options [on | off]'
          Save current options to file `./.gawkrc' upon exit.  The
          default is `on'.  Options are read back in to the next
          session upon startup.

    `trace [on | off]'
          Turn instruction tracing on or off. The default is `off'.

`save' FILENAME
     Save the commands from the current session to the given file name,
     so that they can be replayed using the `source' command.

`source' FILENAME
     Run command(s) from a file; an error in any command does not
     terminate execution of subsequent commands. Comments (lines
     starting with `#') are allowed in a command file.  Empty lines are
     ignored; they do _not_ repeat the last command.  You can't restart
     the program by having more than one `run' command in the file.
     Also, the list of commands may include additional `source'
     commands; however, the `gawk' debugger will not source the same
     file more than once in order to avoid infinite recursion.

     In addition to, or instead of the `source' command, you can use
     the `-D FILE' or `--debug=FILE' command-line options to execute
     commands from a file non-interactively (*note Options::).


File: gawk.info,  Node: Miscellaneous Debugger Commands,  Prev: Debugger Info,  Up: List of Debugger Commands

14.3.6 Miscellaneous Commands
-----------------------------

There are a few more commands which do not fit into the previous
categories, as follows:

`dump' [FILENAME]
     Dump bytecode of the program to standard output or to the file
     named in FILENAME.  This prints a representation of the internal
     instructions which `gawk' executes to implement the `awk' commands
     in a program.  This can be very enlightening, as the following
     partial dump of Davide Brini's obfuscated code (*note Signature
     Program::) demonstrates:

          gawk> dump
          -| 	# BEGIN
          -|
          -| [     1:0xfcd340] Op_rule             : [in_rule = BEGIN] [source_file = brini.awk]
          -| [     1:0xfcc240] Op_push_i           : "~" [MALLOC|STRING|STRCUR]
          -| [     1:0xfcc2a0] Op_push_i           : "~" [MALLOC|STRING|STRCUR]
          -| [     1:0xfcc280] Op_match            :
          -| [     1:0xfcc1e0] Op_store_var        : O
          -| [     1:0xfcc2e0] Op_push_i           : "==" [MALLOC|STRING|STRCUR]
          -| [     1:0xfcc340] Op_push_i           : "==" [MALLOC|STRING|STRCUR]
          -| [     1:0xfcc320] Op_equal            :
          -| [     1:0xfcc200] Op_store_var        : o
          -| [     1:0xfcc380] Op_push             : o
          -| [     1:0xfcc360] Op_plus_i           : 0 [MALLOC|NUMCUR|NUMBER]
          -| [     1:0xfcc220] Op_push_lhs         : o [do_reference = true]
          -| [     1:0xfcc300] Op_assign_plus      :
          -| [      :0xfcc2c0] Op_pop              :
          -| [     1:0xfcc400] Op_push             : O
          -| [     1:0xfcc420] Op_push_i           : "" [MALLOC|STRING|STRCUR]
          -| [      :0xfcc4a0] Op_no_op            :
          -| [     1:0xfcc480] Op_push             : O
          -| [      :0xfcc4c0] Op_concat           : [expr_count = 3] [concat_flag = 0]
          -| [     1:0xfcc3c0] Op_store_var        : x
          -| [     1:0xfcc440] Op_push_lhs         : X [do_reference = true]
          -| [     1:0xfcc3a0] Op_postincrement    :
          -| [     1:0xfcc4e0] Op_push             : x
          -| [     1:0xfcc540] Op_push             : o
          -| [     1:0xfcc500] Op_plus             :
          -| [     1:0xfcc580] Op_push             : o
          -| [     1:0xfcc560] Op_plus             :
          -| [     1:0xfcc460] Op_leq              :
          -| [      :0xfcc5c0] Op_jmp_false        : [target_jmp = 0xfcc5e0]
          -| [     1:0xfcc600] Op_push_i           : "%c" [MALLOC|STRING|STRCUR]
          -| [      :0xfcc660] Op_no_op            :
          -| [     1:0xfcc520] Op_assign_concat    : c
          -| [      :0xfcc620] Op_jmp              : [target_jmp = 0xfcc440]
          -|
          ...
          -|
          -| [     2:0xfcc5a0] Op_K_printf         : [expr_count = 17] [redir_type = ""]
          -| [      :0xfcc140] Op_no_op            :
          -| [      :0xfcc1c0] Op_atexit           :
          -| [      :0xfcc640] Op_stop             :
          -| [      :0xfcc180] Op_no_op            :
          -| [      :0xfcd150] Op_after_beginfile  :
          -| [      :0xfcc160] Op_no_op            :
          -| [      :0xfcc1a0] Op_after_endfile    :
          gawk>

`help'
`h'
     Print a list of all of the `gawk' debugger commands with a short
     summary of their usage.  `help COMMAND' prints the information
     about the command COMMAND.

`list' [`-' | `+' | N | FILENAME`:'N | N-M | FUNCTION]
`l' [`-' | `+' | N | FILENAME`:'N | N-M | FUNCTION]
     Print the specified lines (default 15) from the current source file
     or the file named FILENAME. The possible arguments to `list' are
     as follows:

    `-'
          Print lines before the lines last printed.

    `+'
          Print lines after the lines last printed.  `list' without any
          argument does the same thing.

    N
          Print lines centered around line number N.

    N-M
          Print lines from N to M.

    FILENAME`:'N
          Print lines centered around line number N in source file
          FILENAME. This command may change the current source file.

    FUNCTION
          Print lines centered around beginning of the function
          FUNCTION. This command may change the current source file.

`quit'
`q'
     Exit the debugger.  Debugging is great fun, but sometimes we all
     have to tend to other obligations in life, and sometimes we find
     the bug, and are free to go on to the next one!  As we saw above,
     if you are running a program, the debugger warns you if you
     accidentally type `q' or `quit', to make sure you really want to
     quit.

`trace' `on' | `off'
     Turn on or off a continuous printing of instructions which are
     about to be executed, along with printing the `awk' line which they
     implement.  The default is `off'.

     It is to be hoped that most of the "opcodes" in these instructions
     are fairly self-explanatory, and using `stepi' and `nexti' while
     `trace' is on will make them into familiar friends.



File: gawk.info,  Node: Readline Support,  Next: Limitations,  Prev: List of Debugger Commands,  Up: Debugger

14.4 Readline Support
=====================

If `gawk' is compiled with the `readline' library, you can take
advantage of that library's command completion and history expansion
features. The following types of completion are available:

Command completion
     Command names.

Source file name completion
     Source file names. Relevant commands are `break', `clear', `list',
     `tbreak', and `until'.

Argument completion
     Non-numeric arguments to a command.  Relevant commands are
     `enable' and `info'.

Variable name completion
     Global variable names, and function arguments in the current
     context if the program is running. Relevant commands are `display',
     `print', `set', and `watch'.



File: gawk.info,  Node: Limitations,  Prev: Readline Support,  Up: Debugger

14.5 Limitations and Future Plans
=================================

We hope you find the `gawk' debugger useful and enjoyable to work with,
but as with any program, especially in its early releases, it still has
some limitations.  A few which are worth being aware of are:

   * At this point, the debugger does not give a detailed explanation of
     what you did wrong when you type in something it doesn't like.
     Rather, it just responds `syntax error'.  When you do figure out
     what your mistake was, though, you'll feel like a real guru.

   * If you perused the dump of opcodes in *note Miscellaneous Debugger
     Commands::, (or if you are already familiar with `gawk' internals),
     you will realize that much of the internal manipulation of data in
     `gawk', as in many interpreters, is done on a stack.  `Op_push',
     `Op_pop', etc., are the "bread and butter" of most `gawk' code.
     Unfortunately, as of now, the `gawk' debugger does not allow you
     to examine the stack's contents.

     That is, the intermediate results of expression evaluation are on
     the stack, but cannot be printed.  Rather, only variables which
     are defined in the program can be printed.  Of course, a
     workaround for this is to use more explicit variables at the
     debugging stage and then change back to obscure, perhaps more
     optimal code later.

   * There is no way to look "inside" the process of compiling regular
     expressions to see if you got it right.  As an `awk' programmer,
     you are expected to know what `/[^[:alnum:][:blank:]]/' means.

   * The `gawk' debugger is designed to be used by running a program
     (with all its parameters) on the command line, as described in
     *note Debugger Invocation::.  There is no way (as of now) to
     attach or "break in" to a running program.  This seems reasonable
     for a language which is used mainly for quickly executing, short
     programs.

   * The `gawk' debugger only accepts source supplied with the `-f'
     option.

   Look forward to a future release when these and other missing
features may be added, and of course feel free to try to add them
yourself!


File: gawk.info,  Node: Arbitrary Precision Arithmetic,  Next: Dynamic Extensions,  Prev: Debugger,  Up: Top

15 Arithmetic and Arbitrary Precision Arithmetic with `gawk'
************************************************************

     There's a credibility gap: We don't know how much of the
     computer's answers to believe. Novice computer users solve this
     problem by implicitly trusting in the computer as an infallible
     authority; they tend to believe that all digits of a printed
     answer are significant. Disillusioned computer users have just the
     opposite approach; they are constantly afraid that their answers
     are almost meaningless.(1) -- Donald Knuth

   This major node discusses issues that you may encounter when
performing arithmetic.  It begins by discussing some of the general
attributes of computer arithmetic, along with how this can influence
what you see when running `awk' programs.  This discussion applies to
all versions of `awk'.

   The major node then moves on to describe "arbitrary precision
arithmetic", a feature which is specific to `gawk'.

* Menu:

* General Arithmetic::          An introduction to computer arithmetic.
* Floating-point Programming::  Effective Floating-point Programming.
* Gawk and MPFR::               How `gawk' provides
                                arbitrary-precision arithmetic.
* Arbitrary Precision Floats::  Arbitrary Precision Floating-point Arithmetic
                                with `gawk'.
* Arbitrary Precision Integers:: Arbitrary Precision Integer Arithmetic with
                                `gawk'.

   ---------- Footnotes ----------

   (1) Donald E. Knuth.  `The Art of Computer Programming'. Volume 2,
`Seminumerical Algorithms', third edition, 1998, ISBN 0-201-89683-4, p.
229.


File: gawk.info,  Node: General Arithmetic,  Next: Floating-point Programming,  Up: Arbitrary Precision Arithmetic

15.1 A General Description of Computer Arithmetic
=================================================

Within computers, there are two kinds of numeric values: "integers" and
"floating-point".  In school, integer values were referred to as
"whole" numbers--that is, numbers without any fractional part, such as
1, 42, or -17.  The advantage to integer numbers is that they represent
values exactly.  The disadvantage is that their range is limited.  On
most systems, this range is -2,147,483,648 to 2,147,483,647.  However,
many systems now support a range from -9,223,372,036,854,775,808 to
9,223,372,036,854,775,807.

   Integer values come in two flavors: "signed" and "unsigned".  Signed
values may be negative or positive, with the range of values just
described.  Unsigned values are always positive.  On most systems, the
range is from 0 to 4,294,967,295.  However, many systems now support a
range from 0 to 18,446,744,073,709,551,615.

   Floating-point numbers represent what are called "real" numbers;
i.e., those that do have a fractional part, such as 3.1415927.  The
advantage to floating-point numbers is that they can represent a much
larger range of values.  The disadvantage is that there are numbers
that they cannot represent exactly.  `awk' uses "double precision"
floating-point numbers, which can hold more digits than "single
precision" floating-point numbers.

   There a several important issues to be aware of, described next.

* Menu:

* Floating Point Issues::       Stuff to know about floating-point numbers.
* Integer Programming::         Effective integer programming.


File: gawk.info,  Node: Floating Point Issues,  Next: Integer Programming,  Up: General Arithmetic

15.1.1 Floating-Point Number Caveats
------------------------------------

This minor node describes some of the issues involved in using
floating-point numbers.

   There is a very nice paper on floating-point arithmetic
(http://www.validlab.com/goldberg/paper.pdf) by David Goldberg, "What
Every Computer Scientist Should Know About Floating-point Arithmetic,"
`ACM Computing Surveys' *23*, 1 (1991-03), 5-48.  This is worth reading
if you are interested in the details, but it does require a background
in computer science.

* Menu:

* String Conversion Precision:: The String Value Can Lie.
* Unexpected Results::          Floating Point Numbers Are Not Abstract
                                Numbers.
* POSIX Floating Point Problems:: Standards Versus Existing Practice.


File: gawk.info,  Node: String Conversion Precision,  Next: Unexpected Results,  Up: Floating Point Issues

15.1.1.1 The String Value Can Lie
.................................

Internally, `awk' keeps both the numeric value (double precision
floating-point) and the string value for a variable.  Separately, `awk'
keeps track of what type the variable has (*note Typing and
Comparison::), which plays a role in how variables are used in
comparisons.

   It is important to note that the string value for a number may not
reflect the full value (all the digits) that the numeric value actually
contains.  The following program, `values.awk', illustrates this:

     {
        sum = $1 + $2
        # see it for what it is
        printf("sum = %.12g\n", sum)
        # use CONVFMT
        a = "<" sum ">"
        print "a =", a
        # use OFMT
        print "sum =", sum
     }

This program shows the full value of the sum of `$1' and `$2' using
`printf', and then prints the string values obtained from both
automatic conversion (via `CONVFMT') and from printing (via `OFMT').

   Here is what happens when the program is run:

     $ echo 3.654321 1.2345678 | awk -f values.awk
     -| sum = 4.8888888
     -| a = <4.88889>
     -| sum = 4.88889

   This makes it clear that the full numeric value is different from
what the default string representations show.

   `CONVFMT''s default value is `"%.6g"', which yields a value with at
most six significant digits.  For some applications, you might want to
change it to specify more precision.  On most modern machines, most of
the time, 17 digits is enough to capture a floating-point number's
value exactly.(1)

   ---------- Footnotes ----------

   (1) Pathological cases can require up to 752 digits (!), but we
doubt that you need to worry about this.


File: gawk.info,  Node: Unexpected Results,  Next: POSIX Floating Point Problems,  Prev: String Conversion Precision,  Up: Floating Point Issues

15.1.1.2 Floating Point Numbers Are Not Abstract Numbers
........................................................

Unlike numbers in the abstract sense (such as what you studied in high
school or college arithmetic), numbers stored in computers are limited
in certain ways.  They cannot represent an infinite number of digits,
nor can they always represent things exactly.  In particular,
floating-point numbers cannot always represent values exactly.  Here is
an example:

     $ awk '{ printf("%010d\n", $1 * 100) }'
     515.79
     -| 0000051579
     515.80
     -| 0000051579
     515.81
     -| 0000051580
     515.82
     -| 0000051582
     Ctrl-d

This shows that some values can be represented exactly, whereas others
are only approximated.  This is not a "bug" in `awk', but simply an
artifact of how computers represent numbers.

     NOTE: It cannot be emphasized enough that the behavior just
     described is fundamental to modern computers. You will see this
     kind of thing happen in _any_ programming language using hardware
     floating-point numbers. It is _not_ a bug in `gawk', nor is it
     something that can be "just fixed."

   Another peculiarity of floating-point numbers on modern systems is
that they often have more than one representation for the number zero!
In particular, it is possible to represent "minus zero" as well as
regular, or "positive" zero.

   This example shows that negative and positive zero are distinct
values when stored internally, but that they are in fact equal to each
other, as well as to "regular" zero:

     $ gawk 'BEGIN { mz = -0 ; pz = 0
     > printf "-0 = %g, +0 = %g, (-0 == +0) -> %d\n", mz, pz, mz == pz
     > printf "mz == 0 -> %d, pz == 0 -> %d\n", mz == 0, pz == 0
     > }'
     -| -0 = -0, +0 = 0, (-0 == +0) -> 1
     -| mz == 0 -> 1, pz == 0 -> 1

   It helps to keep this in mind should you process numeric data that
contains negative zero values; the fact that the zero is negative is
noted and can affect comparisons.


File: gawk.info,  Node: POSIX Floating Point Problems,  Prev: Unexpected Results,  Up: Floating Point Issues

15.1.1.3 Standards Versus Existing Practice
...........................................

Historically, `awk' has converted any non-numeric looking string to the
numeric value zero, when required.  Furthermore, the original
definition of the language and the original POSIX standards specified
that `awk' only understands decimal numbers (base 10), and not octal
(base 8) or hexadecimal numbers (base 16).

   Changes in the language of the 2001 and 2004 POSIX standards can be
interpreted to imply that `awk' should support additional features.
These features are:

   * Interpretation of floating point data values specified in
     hexadecimal notation (`0xDEADBEEF'). (Note: data values, _not_
     source code constants.)

   * Support for the special IEEE 754 floating point values "Not A
     Number" (NaN), positive Infinity ("inf") and negative Infinity
     ("-inf").  In particular, the format for these values is as
     specified by the ISO 1999 C standard, which ignores case and can
     allow machine-dependent additional characters after the `nan' and
     allow either `inf' or `infinity'.

   The first problem is that both of these are clear changes to
historical practice:

   * The `gawk' maintainer feels that supporting hexadecimal floating
     point values, in particular, is ugly, and was never intended by the
     original designers to be part of the language.

   * Allowing completely alphabetic strings to have valid numeric
     values is also a very severe departure from historical practice.

   The second problem is that the `gawk' maintainer feels that this
interpretation of the standard, which requires a certain amount of
"language lawyering" to arrive at in the first place, was not even
intended by the standard developers.  In other words, "we see how you
got where you are, but we don't think that that's where you want to be."

   Recognizing the above issues, but attempting to provide compatibility
with the earlier versions of the standard, the 2008 POSIX standard
added explicit wording to allow, but not require, that `awk' support
hexadecimal floating point values and special values for "Not A Number"
and infinity.

   Although the `gawk' maintainer continues to feel that providing
those features is inadvisable, nevertheless, on systems that support
IEEE floating point, it seems reasonable to provide _some_ way to
support NaN and Infinity values.  The solution implemented in `gawk' is
as follows:

   * With the `--posix' command-line option, `gawk' becomes "hands
     off." String values are passed directly to the system library's
     `strtod()' function, and if it successfully returns a numeric
     value, that is what's used.(1) By definition, the results are not
     portable across different systems.  They are also a little
     surprising:

          $ echo nanny | gawk --posix '{ print $1 + 0 }'
          -| nan
          $ echo 0xDeadBeef | gawk --posix '{ print $1 + 0 }'
          -| 3735928559

   * Without `--posix', `gawk' interprets the four strings `+inf',
     `-inf', `+nan', and `-nan' specially, producing the corresponding
     special numeric values.  The leading sign acts a signal to `gawk'
     (and the user) that the value is really numeric.  Hexadecimal
     floating point is not supported (unless you also use
     `--non-decimal-data', which is _not_ recommended). For example:

          $ echo nanny | gawk '{ print $1 + 0 }'
          -| 0
          $ echo +nan | gawk '{ print $1 + 0 }'
          -| nan
          $ echo 0xDeadBeef | gawk '{ print $1 + 0 }'
          -| 0

     `gawk' does ignore case in the four special values.  Thus `+nan'
     and `+NaN' are the same.

   ---------- Footnotes ----------

   (1) You asked for it, you got it.


File: gawk.info,  Node: Integer Programming,  Prev: Floating Point Issues,  Up: General Arithmetic

15.1.2 Mixing Integers And Floating-point
-----------------------------------------

As has been mentioned already, `awk' uses hardware double precision
with 64-bit IEEE binary floating-point representation for numbers on
most systems. A large integer like 9,007,199,254,740,997 has a binary
representation that, although finite, is more than 53 bits long; it
must also be rounded to 53 bits.  The biggest integer that can be
stored in a C `double' is usually the same as the largest possible
value of a `double'. If your system `double' is an IEEE 64-bit
`double', this largest possible value is an integer and can be
represented precisely.  What more should one know about integers?

   If you want to know what is the largest integer, such that it and
all smaller integers can be stored in 64-bit doubles without losing
precision, then the answer is 2^53.  The next representable number is
the even number 2^53 + 2, meaning it is unlikely that you will be able
to make `gawk' print 2^53 + 1 in integer format.  The range of integers
exactly representable by a 64-bit double is [-2^53, 2^53].  If you ever
see an integer outside this range in `awk' using 64-bit doubles, you
have reason to be very suspicious about the accuracy of the output.
Here is a simple program with erroneous output:

     $ gawk 'BEGIN { i = 2^53 - 1; for (j = 0; j < 4; j++) print i + j }'
     -| 9007199254740991
     -| 9007199254740992
     -| 9007199254740992
     -| 9007199254740994

   The lesson is to not assume that any large integer printed by `awk'
represents an exact result from your computation, especially if it wraps
around on your screen.


File: gawk.info,  Node: Floating-point Programming,  Next: Gawk and MPFR,  Prev: General Arithmetic,  Up: Arbitrary Precision Arithmetic

15.2 Understanding Floating-point Programming
=============================================

Numerical programming is an extensive area; if you need to develop
sophisticated numerical algorithms then `gawk' may not be the ideal
tool, and this documentation may not be sufficient.  It might require
digesting a book or two(1) to really internalize how to compute with
ideal accuracy and precision, and the result often depends on the
particular application.

     NOTE: A floating-point calculation's "accuracy" is how close it
     comes to the real value.  This is as opposed to the "precision",
     which usually refers to the number of bits used to represent the
     number (see the Wikipedia article
     (http://en.wikipedia.org/wiki/Accuracy_and_precision) for more
     information).

   There are two options for doing floating-point calculations:
hardware floating-point (as used by standard `awk' and the default for
`gawk'), and "arbitrary-precision" floating-point, which is software
based.  From this point forward, this major node aims to provide enough
information to understand both, and then will focus on `gawk''s
facilities for the latter.(2)

   Binary floating-point representations and arithmetic are inexact.
Simple values like 0.1 cannot be precisely represented using binary
floating-point numbers, and the limited precision of floating-point
numbers means that slight changes in the order of operations or the
precision of intermediate storage can change the result. To make
matters worse, with arbitrary precision floating-point, you can set the
precision before starting a computation, but then you cannot be sure of
the number of significant decimal places in the final result.

   Sometimes, before you start to write any code, you should think more
about what you really want and what's really happening. Consider the
two numbers in the following example:

     x = 0.875             # 1/2 + 1/4 + 1/8
     y = 0.425

   Unlike the number in `y', the number stored in `x' is exactly
representable in binary since it can be written as a finite sum of one
or more fractions whose denominators are all powers of two.  When
`gawk' reads a floating-point number from program source, it
automatically rounds that number to whatever precision your machine
supports. If you try to print the numeric content of a variable using
an output format string of `"%.17g"', it may not produce the same
number as you assigned to it:

     $ gawk 'BEGIN { x = 0.875; y = 0.425
     >               printf("%0.17g, %0.17g\n", x, y) }'
     -| 0.875, 0.42499999999999999

   Often the error is so small you do not even notice it, and if you do,
you can always specify how much precision you would like in your output.
Usually this is a format string like `"%.15g"', which when used in the
previous example, produces an output identical to the input.

   Because the underlying representation can be a little bit off from
the exact value, comparing floating-point values to see if they are
equal is generally not a good idea.  Here is an example where it does
not work like you expect:

     $ gawk 'BEGIN { print (0.1 + 12.2 == 12.3) }'
     -| 0

   The loss of accuracy during a single computation with floating-point
numbers usually isn't enough to worry about. However, if you compute a
value which is the result of a sequence of floating point operations,
the error can accumulate and greatly affect the computation itself.
Here is an attempt to compute the value of the constant pi using one of
its many series representations:

     BEGIN {
         x = 1.0 / sqrt(3.0)
         n = 6
         for (i = 1; i < 30; i++) {
             n = n * 2.0
             x = (sqrt(x * x + 1) - 1) / x
             printf("%.15f\n", n * x)
         }
     }

   When run, the early errors propagating through later computations
cause the loop to terminate prematurely after an attempt to divide by
zero.

     $ gawk -f pi.awk
     -| 3.215390309173475
     -| 3.159659942097510
     -| 3.146086215131467
     -| 3.142714599645573
     ...
     -| 3.224515243534819
     -| 2.791117213058638
     -| 0.000000000000000
     error--> gawk: pi.awk:6: fatal: division by zero attempted

   Here is an additional example where the inaccuracies in internal
representations yield an unexpected result:

     $ gawk 'BEGIN {
     >   for (d = 1.1; d <= 1.5; d += 0.1)    # loop five times (?)
     >       i++
     >   print i
     > }'
     -| 4

   Can computation using arbitrary precision help with the previous
examples?  If you are impatient to know, see *note Exact Arithmetic::.

   Instead of arbitrary precision floating-point arithmetic, often all
you need is an adjustment of your logic or a different order for the
operations in your calculation.  The stability and the accuracy of the
computation of the constant pi in the earlier example can be enhanced
by using the following simple algebraic transformation:

     (sqrt(x * x + 1) - 1) / x = x / (sqrt(x * x + 1) + 1)

After making this, change the program does converge to pi in under 30
iterations:

     $ gawk -f pi2.awk
     -| 3.215390309173473
     -| 3.159659942097501
     -| 3.146086215131436
     -| 3.142714599645370
     -| 3.141873049979825
     ...
     -| 3.141592653589797
     -| 3.141592653589797

   There is no need to be unduly suspicious about the results from
floating-point arithmetic. The lesson to remember is that
floating-point arithmetic is always more complex than arithmetic using
pencil and paper. In order to take advantage of the power of computer
floating-point, you need to know its limitations and work within them.
For most casual use of floating-point arithmetic, you will often get
the expected result in the end if you simply round the display of your
final results to the correct number of significant decimal digits.

   As general advice, avoid presenting numerical data in a manner that
implies better precision than is actually the case.

* Menu:

* Floating-point Representation:: Binary floating-point representation.
* Floating-point Context::        Floating-point context.
* Rounding Mode::                 Floating-point rounding mode.

   ---------- Footnotes ----------

   (1) One recommended title is `Numerical Computing with IEEE Floating
Point Arithmetic', Michael L.  Overton, Society for Industrial and
Applied Mathematics, 2004.  ISBN: 0-89871-482-6, ISBN-13:
978-0-89871-482-1. See `http://www.cs.nyu.edu/cs/faculty/overton/book'.

   (2) If you are interested in other tools that perform arbitrary
precision arithmetic, you may want to investigate the POSIX `bc' tool.
See the POSIX specification for it
(http://pubs.opengroup.org/onlinepubs/009695399/utilities/bc.html), for
more information.


File: gawk.info,  Node: Floating-point Representation,  Next: Floating-point Context,  Up: Floating-point Programming

15.2.1 Binary Floating-point Representation
-------------------------------------------

Although floating-point representations vary from machine to machine,
the most commonly encountered representation is that defined by the
IEEE 754 Standard. An IEEE-754 format value has three components:

   * A sign bit telling whether the number is positive or negative.

   * An "exponent", E, giving its order of magnitude.

   * A "significand", S, specifying the actual digits of the number.

   The value of the number is then S * 2^E.  The first bit of a
non-zero binary significand is always one, so the significand in an
IEEE-754 format only includes the fractional part, leaving the leading
one implicit.  The significand is stored in "normalized" format, which
means that the first bit is always a one.

   Three of the standard IEEE-754 types are 32-bit single precision,
64-bit double precision and 128-bit quadruple precision.  The standard
also specifies extended precision formats to allow greater precisions
and larger exponent ranges.


File: gawk.info,  Node: Floating-point Context,  Next: Rounding Mode,  Prev: Floating-point Representation,  Up: Floating-point Programming

15.2.2 Floating-point Context
-----------------------------

A floating-point "context" defines the environment for arithmetic
operations.  It governs precision, sets rules for rounding, and limits
the range for exponents.  The context has the following primary
components:

"Precision"
     Precision of the floating-point format in bits.

"emax"
     Maximum exponent allowed for the format.

"emin"
     Minimum exponent allowed for the format.

"Underflow behavior"
     The format may or may not support gradual underflow.

"Rounding"
     The rounding mode of the context.

   *note table-ieee-formats:: lists the precision and exponent field
values for the basic IEEE-754 binary formats:

Name           Total bits     Precision      emin           emax
--------------------------------------------------------------------------- 
Single         32             24             -126           +127
Double         64             53             -1022          +1023
Quadruple      128            113            -16382         +16383

Table 15.1: Basic IEEE Format Context Values

     NOTE: The precision numbers include the implied leading one that
     gives them one extra bit of significand.

   A floating-point context can also determine which signals are treated
as exceptions, and can set rules for arithmetic with special values.
Please consult the IEEE-754 standard or other resources for details.

   `gawk' ordinarily uses the hardware double precision representation
for numbers.  On most systems, this is IEEE-754 floating-point format,
corresponding to 64-bit binary with 53 bits of precision.

     NOTE: In case an underflow occurs, the standard allows, but does
     not require, the result from an arithmetic operation to be a
     number smaller than the smallest nonzero normalized number. Such
     numbers do not have as many significant digits as normal numbers,
     and are called "denormals" or "subnormals". The alternative,
     simply returning a zero, is called "flush to zero". The basic
     IEEE-754 binary formats support subnormal numbers.


File: gawk.info,  Node: Rounding Mode,  Prev: Floating-point Context,  Up: Floating-point Programming

15.2.3 Floating-point Rounding Mode
-----------------------------------

The "rounding mode" specifies the behavior for the results of numerical
operations when discarding extra precision. Each rounding mode indicates
how the least significant returned digit of a rounded result is to be
calculated.  *note table-rounding-modes:: lists the IEEE-754 defined
rounding modes:

Rounding Mode                    IEEE Name
-------------------------------------------------------------------------- 
Round to nearest, ties to even   `roundTiesToEven'
Round toward plus Infinity       `roundTowardPositive'
Round toward negative Infinity   `roundTowardNegative'
Round toward zero                `roundTowardZero'
Round to nearest, ties away      `roundTiesToAway'
from zero                        

Table 15.2: IEEE 754 Rounding Modes

   The default mode `roundTiesToEven' is the most preferred, but the
least intuitive. This method does the obvious thing for most values, by
rounding them up or down to the nearest digit.  For example, rounding
1.132 to two digits yields 1.13, and rounding 1.157 yields 1.16.

   However, when it comes to rounding a value that is exactly halfway
between, things do not work the way you probably learned in school.  In
this case, the number is rounded to the nearest even digit.  So
rounding 0.125 to two digits rounds down to 0.12, but rounding 0.6875
to three digits rounds up to 0.688.  You probably have already
encountered this rounding mode when using `printf' to format
floating-point numbers.  For example:

     BEGIN {
         x = -4.5
         for (i = 1; i < 10; i++) {
             x += 1.0
             printf("%4.1f => %2.0f\n", x, x)
         }
     }

produces the following output when run on the author's system:(1)

     -3.5 => -4
     -2.5 => -2
     -1.5 => -2
     -0.5 => 0
      0.5 => 0
      1.5 => 2
      2.5 => 2
      3.5 => 4
      4.5 => 4

   The theory behind the rounding mode `roundTiesToEven' is that it
more or less evenly distributes upward and downward rounds of exact
halves, which might cause any round-off error to cancel itself out.
This is the default rounding mode used in IEEE-754 computing functions
and operators.

   The other rounding modes are rarely used.  Round toward positive
infinity (`roundTowardPositive') and round toward negative infinity
(`roundTowardNegative') are often used to implement interval arithmetic,
where you adjust the rounding mode to calculate upper and lower bounds
for the range of output. The `roundTowardZero' mode can be used for
converting floating-point numbers to integers.  The rounding mode
`roundTiesToAway' rounds the result to the nearest number and selects
the number with the larger magnitude if a tie occurs.

   Some numerical analysts will tell you that your choice of rounding
style has tremendous impact on the final outcome, and advise you to
wait until final output for any rounding. Instead, you can often avoid
round-off error problems by setting the precision initially to some
value sufficiently larger than the final desired precision, so that the
accumulation of round-off error does not influence the outcome.  If you
suspect that results from your computation are sensitive to
accumulation of round-off error, one way to be sure is to look for a
significant difference in output when you change the rounding mode.

   ---------- Footnotes ----------

   (1) It is possible for the output to be completely different if the
C library in your system does not use the IEEE-754 even-rounding rule
to round halfway cases for `printf'.


File: gawk.info,  Node: Gawk and MPFR,  Next: Arbitrary Precision Floats,  Prev: Floating-point Programming,  Up: Arbitrary Precision Arithmetic

15.3 `gawk' + MPFR = Powerful Arithmetic
========================================

The rest of this major node describes how to use the arbitrary precision
(also known as "multiple precision" or "infinite precision") numeric
capabilities in `gawk' to produce maximally accurate results when you
need it.

   But first you should check if your version of `gawk' supports
arbitrary precision arithmetic.  The easiest way to find out is to look
at the output of the following command:

     $ gawk --version
     -| GNU Awk 4.1.0, API: 1.0 (GNU MPFR 3.1.0-p3, GNU MP 5.0.2)
     -| Copyright (C) 1989, 1991-2013 Free Software Foundation.
     ...

   `gawk' uses the GNU MPFR (http://www.mpfr.org) and GNU MP
(http://gmplib.org) (GMP) libraries for arbitrary precision arithmetic
on numbers. So if you do not see the names of these libraries in the
output, then your version of `gawk' does not support arbitrary
precision arithmetic.

   Additionally, there are a few elements available in the `PROCINFO'
array to provide information about the MPFR and GMP libraries.  *Note
Auto-set::, for more information.


File: gawk.info,  Node: Arbitrary Precision Floats,  Next: Arbitrary Precision Integers,  Prev: Gawk and MPFR,  Up: Arbitrary Precision Arithmetic

15.4 Arbitrary Precision Floating-point Arithmetic with `gawk'
==============================================================

`gawk' uses the GNU MPFR library for arbitrary precision floating-point
arithmetic.  The MPFR library provides precise control over precisions
and rounding modes, and gives correctly rounded, reproducible,
platform-independent results.  With one of the command-line options
`--bignum' or `-M', all floating-point arithmetic operators and numeric
functions can yield results to any desired precision level supported by
MPFR.  Two built-in variables, `PREC' and `ROUNDMODE', provide control
over the working precision and the rounding mode (*note Setting
Precision::, and *note Setting Rounding Mode::).  The precision and the
rounding mode are set globally for every operation to follow.

   The default working precision for arbitrary precision floating-point
values is 53 bits, and the default value for `ROUNDMODE' is `"N"',
which selects the IEEE-754 `roundTiesToEven' rounding mode (*note
Rounding Mode::).(1) `gawk' uses the default exponent range in MPFR
(EMAX = 2^30 - 1, EMIN = -EMAX) for all floating-point contexts.  There
is no explicit mechanism to adjust the exponent range.  MPFR does not
implement subnormal numbers by default, and this behavior cannot be
changed in `gawk'.

     NOTE: When emulating an IEEE-754 format (*note Setting
     Precision::), `gawk' internally adjusts the exponent range to the
     value defined for the format and also performs computations needed
     for gradual underflow (subnormal numbers).

     NOTE: MPFR numbers are variable-size entities, consuming only as
     much space as needed to store the significant digits. Since the
     performance using MPFR numbers pales in comparison to doing
     arithmetic using the underlying machine types, you should consider
     using only as much precision as needed by your program.

* Menu:

* Setting Precision::           Setting the working precision.
* Setting Rounding Mode::       Setting the rounding mode.
* Floating-point Constants::    Representing floating-point constants.
* Changing Precision::          Changing the precision of a number.
* Exact Arithmetic::            Exact arithmetic with floating-point numbers.

   ---------- Footnotes ----------

   (1) The default precision is 53 bits, since according to the MPFR
documentation, the library should be able to exactly reproduce all
computations with double-precision machine floating-point numbers
(`double' type in C), except the default exponent range is much wider
and subnormal numbers are not implemented.


File: gawk.info,  Node: Setting Precision,  Next: Setting Rounding Mode,  Up: Arbitrary Precision Floats

15.4.1 Setting the Working Precision
------------------------------------

`gawk' uses a global working precision; it does not keep track of the
precision or accuracy of individual numbers. Performing an arithmetic
operation or calling a built-in function rounds the result to the
current working precision. The default working precision is 53 bits,
which can be modified using the built-in variable `PREC'. You can also
set the value to one of the pre-defined case-insensitive strings shown
in *note table-predefined-precision-strings::, to emulate an IEEE-754
binary format.

`PREC'       IEEE-754 Binary Format
--------------------------------------------------- 
`"half"'     16-bit half-precision.
`"single"'   Basic 32-bit single precision.
`"double"'   Basic 64-bit double precision.
`"quad"'     Basic 128-bit quadruple precision.
`"oct"'      256-bit octuple precision.

Table 15.3: Predefined precision strings for `PREC'

   The following example illustrates the effects of changing precision
on arithmetic operations:

     $ gawk -M -v PREC=100 'BEGIN { x = 1.0e-400; print x + 0
     >   PREC = "double"; print x + 0 }'
     -| 1e-400
     -| 0

   Binary and decimal precisions are related approximately, according
to the formula:

   PREC = 3.322 * DPS

Here, PREC denotes the binary precision (measured in bits) and DPS
(short for decimal places) is the decimal digits. We can easily
calculate how many decimal digits the 53-bit significand of an IEEE
double is equivalent to: 53 / 3.322 which is equal to about 15.95.  But
what does 15.95 digits actually mean? It depends whether you are
concerned about how many digits you can rely on, or how many digits you
need.

   It is important to know how many bits it takes to uniquely identify
a double-precision value (the C type `double').  If you want to convert
from `double' to decimal and back to `double' (e.g., saving a `double'
representing an intermediate result to a file, and later reading it
back to restart the computation), then a few more decimal digits are
required. 17 digits is generally enough for a `double'.

   It can also be important to know what decimal numbers can be uniquely
represented with a `double'. If you want to convert from decimal to
`double' and back again, 15 digits is the most that you can get. Stated
differently, you should not present the numbers from your
floating-point computations with more than 15 significant digits in
them.

   Conversely, it takes a precision of 332 bits to hold an approximation
of the constant pi that is accurate to 100 decimal places.

   You should always add some extra bits in order to avoid the
confusing round-off issues that occur because numbers are stored
internally in binary.


File: gawk.info,  Node: Setting Rounding Mode,  Next: Floating-point Constants,  Prev: Setting Precision,  Up: Arbitrary Precision Floats

15.4.2 Setting the Rounding Mode
--------------------------------

The `ROUNDMODE' variable provides program level control over the
rounding mode.  The correspondence between `ROUNDMODE' and the IEEE
rounding modes is shown in *note table-gawk-rounding-modes::.

Rounding Mode                    IEEE Name              `ROUNDMODE'
--------------------------------------------------------------------------- 
Round to nearest, ties to even   `roundTiesToEven'      `"N"' or `"n"'
Round toward plus Infinity       `roundTowardPositive'  `"U"' or `"u"'
Round toward negative Infinity   `roundTowardNegative'  `"D"' or `"d"'
Round toward zero                `roundTowardZero'      `"Z"' or `"z"'
Round to nearest, ties away      `roundTiesToAway'      `"A"' or `"a"'
from zero                                               

Table 15.4: `gawk' Rounding Modes

   `ROUNDMODE' has the default value `"N"', which selects the IEEE-754
rounding mode `roundTiesToEven'.  In *note Table 15.4:
table-gawk-rounding-modes, `"A"' is listed to select the IEEE-754 mode
`roundTiesToAway'.  This is only available if your version of the MPFR
library supports it; otherwise setting `ROUNDMODE' to this value has no
effect. *Note Rounding Mode::, for the meanings of the various rounding
modes.

   Here is an example of how to change the default rounding behavior of
`printf''s output:

     $ gawk -M -v ROUNDMODE="Z" 'BEGIN { printf("%.2f\n", 1.378) }'
     -| 1.37


File: gawk.info,  Node: Floating-point Constants,  Next: Changing Precision,  Prev: Setting Rounding Mode,  Up: Arbitrary Precision Floats

15.4.3 Representing Floating-point Constants
--------------------------------------------

Be wary of floating-point constants! When reading a floating-point
constant from program source code, `gawk' uses the default precision,
unless overridden by an assignment to the special variable `PREC' on
the command line, to store it internally as a MPFR number.  Changing
the precision using `PREC' in the program text does _not_ change the
precision of a constant. If you need to represent a floating-point
constant at a higher precision than the default and cannot use a
command line assignment to `PREC', you should either specify the
constant as a string, or as a rational number, whenever possible. The
following example illustrates the differences among various ways to
print a floating-point constant:

     $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", 0.1) }'
     -| 0.1000000000000000055511151
     $ gawk -M -v PREC=113 'BEGIN { printf("%0.25f\n", 0.1) }'
     -| 0.1000000000000000000000000
     $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", "0.1") }'
     -| 0.1000000000000000000000000
     $ gawk -M 'BEGIN { PREC = 113; printf("%0.25f\n", 1/10) }'
     -| 0.1000000000000000000000000

   In the first case, the number is stored with the default precision
of 53 bits.


File: gawk.info,  Node: Changing Precision,  Next: Exact Arithmetic,  Prev: Floating-point Constants,  Up: Arbitrary Precision Floats

15.4.4 Changing the Precision of a Number
-----------------------------------------

     The point is that in any variable-precision package, a decision is
     made on how to treat numbers given as data, or arising in
     intermediate results, which are represented in floating-point
     format to a precision lower than working precision.  Do we promote
     them to full membership of the high-precision club, or do we treat
     them and all their associates as second-class citizens?  Sometimes
     the first course is proper, sometimes the second, and it takes
     careful analysis to tell which.(1) -- Dirk Laurie

   `gawk' does not implicitly modify the precision of any previously
computed results when the working precision is changed with an
assignment to `PREC'.  The precision of a number is always the one that
was used at the time of its creation, and there is no way for the user
to explicitly change it afterwards. However, since the result of a
floating-point arithmetic operation is always an arbitrary precision
floating-point value--with a precision set by the value of `PREC'--one
of the following workarounds effectively accomplishes the desired
behavior:

     x = x + 0.0

or:

     x += 0.0

   ---------- Footnotes ----------

   (1) Dirk Laurie.  `Variable-precision Arithmetic Considered Perilous
-- A Detective Story'.  Electronic Transactions on Numerical Analysis.
Volume 28, pp. 168-173, 2008.


File: gawk.info,  Node: Exact Arithmetic,  Prev: Changing Precision,  Up: Arbitrary Precision Floats

15.4.5 Exact Arithmetic with Floating-point Numbers
---------------------------------------------------

     CAUTION: Never depend on the exactness of floating-point
     arithmetic, even for apparently simple expressions!

   Can arbitrary precision arithmetic give exact results? There are no
easy answers. The standard rules of algebra often do not apply when
using floating-point arithmetic.  Among other things, the distributive
and associative laws do not hold completely, and order of operation may
be important for your computation. Rounding error, cumulative precision
loss and underflow are often troublesome.

   When `gawk' tests the expressions `0.1 + 12.2' and `12.3' for
equality using the machine double precision arithmetic, it decides that
they are not equal!  (*Note Floating-point Programming::.)  You can get
the result you want by increasing the precision; 56 bits in this case
will get the job done:

     $ gawk -M -v PREC=56 'BEGIN { print (0.1 + 12.2 == 12.3) }'
     -| 1

   If adding more bits is good, perhaps adding even more bits of
precision is better?  Here is what happens if we use an even larger
value of `PREC':

     $ gawk -M -v PREC=201 'BEGIN { print (0.1 + 12.2 == 12.3) }'
     -| 0

   This is not a bug in `gawk' or in the MPFR library.  It is easy to
forget that the finite number of bits used to store the value is often
just an approximation after proper rounding.  The test for equality
succeeds if and only if _all_ bits in the two operands are exactly the
same. Since this is not necessarily true after floating-point
computations with a particular precision and effective rounding rule, a
straight test for equality may not work.

   So, don't assume that floating-point values can be compared for
equality.  You should also exercise caution when using other forms of
comparisons.  The standard way to compare between floating-point
numbers is to determine how much error (or "tolerance") you will allow
in a comparison and check to see if one value is within this error
range of the other.

   In applications where 15 or fewer decimal places suffice, hardware
double precision arithmetic can be adequate, and is usually much faster.
But you do need to keep in mind that every floating-point operation can
suffer a new rounding error with catastrophic consequences as
illustrated by our earlier attempt to compute the value of the constant
pi (*note Floating-point Programming::).  Extra precision can greatly
enhance the stability and the accuracy of your computation in such
cases.

   Repeated addition is not necessarily equivalent to multiplication in
floating-point arithmetic. In the example in *note Floating-point
Programming:::

     $ gawk 'BEGIN {
     >   for (d = 1.1; d <= 1.5; d += 0.1)    # loop five times (?)
     >       i++
     >   print i
     > }'
     -| 4

you may or may not succeed in getting the correct result by choosing an
arbitrarily large value for `PREC'. Reformulation of the problem at
hand is often the correct approach in such situations.


File: gawk.info,  Node: Arbitrary Precision Integers,  Prev: Arbitrary Precision Floats,  Up: Arbitrary Precision Arithmetic

15.5 Arbitrary Precision Integer Arithmetic with `gawk'
=======================================================

If one of the options `--bignum' or `-M' is specified, `gawk' performs
all integer arithmetic using GMP arbitrary precision integers.  Any
number that looks like an integer in a program source or data file is
stored as an arbitrary precision integer.  The size of the integer is
limited only by your computer's memory.  The current floating-point
context has no effect on operations involving integers.  For example,
the following computes 5^4^3^2, the result of which is beyond the
limits of ordinary `gawk' numbers:

     $ gawk -M 'BEGIN {
     >   x = 5^4^3^2
     >   print "# of digits =", length(x)
     >   print substr(x, 1, 20), "...", substr(x, length(x) - 19, 20)
     > }'
     -| # of digits = 183231
     -| 62060698786608744707 ... 92256259918212890625

   If you were to compute the same value using arbitrary precision
floating-point values instead, the precision needed for correct output
(using the formula `prec = 3.322 * dps'), would be 3.322 x 183231, or
608693.

   The result from an arithmetic operation with an integer and a
floating-point value is a floating-point value with a precision equal
to the working precision.  The following program calculates the eighth
term in Sylvester's sequence(1) using a recurrence:

     $ gawk -M 'BEGIN {
     >   s = 2.0
     >   for (i = 1; i <= 7; i++)
     >       s = s * (s - 1) + 1
     >   print s
     > }'
     -| 113423713055421845118910464

   The output differs from the actual number,
113,423,713,055,421,844,361,000,443, because the default precision of
53 bits is not enough to represent the floating-point results exactly.
You can either increase the precision (100 bits is enough in this
case), or replace the floating-point constant `2.0' with an integer, to
perform all computations using integer arithmetic to get the correct
output.

   It will sometimes be necessary for `gawk' to implicitly convert an
arbitrary precision integer into an arbitrary precision floating-point
value.  This is primarily because the MPFR library does not always
provide the relevant interface to process arbitrary precision integers
or mixed-mode numbers as needed by an operation or function.  In such a
case, the precision is set to the minimum value necessary for exact
conversion, and the working precision is not used for this purpose.  If
this is not what you need or want, you can employ a subterfuge like
this:

     gawk -M 'BEGIN { n = 13; print (n + 0.0) % 2.0 }'

   You can avoid this issue altogether by specifying the number as a
floating-point value to begin with:

     gawk -M 'BEGIN { n = 13.0; print n % 2.0 }'

   Note that for the particular example above, there is likely best to
just use the following:

     gawk -M 'BEGIN { n = 13; print n % 2 }'

   ---------- Footnotes ----------

   (1) Weisstein, Eric W.  `Sylvester's Sequence'. From MathWorld--A
Wolfram Web Resource.
`http://mathworld.wolfram.com/SylvestersSequence.html'


File: gawk.info,  Node: Dynamic Extensions,  Next: Language History,  Prev: Arbitrary Precision Arithmetic,  Up: Top

16 Writing Extensions for `gawk'
********************************

It is possible to add new functions written in C or C++ to `gawk' using
dynamically loaded libraries. This facility is available on systems
that support the C `dlopen()' and `dlsym()' functions.  This major node
describes how to create extensions using code written in C or C++.

   If you don't know anything about C programming, you can safely skip
this major node, although you may wish to review the documentation on
the extensions that come with `gawk' (*note Extension Samples::), and
the information on the `gawkextlib' project (*note gawkextlib::).  The
sample extensions are automatically built and installed when `gawk' is.

     NOTE: When `--sandbox' is specified, extensions are disabled
     (*note Options::).

* Menu:

* Extension Intro::             What is an extension.
* Plugin License::              A note about licensing.
* Extension Mechanism Outline:: An outline of how it works.
* Extension API Description::   A full description of the API.
* Finding Extensions::          How `gawk' finds compiled extensions.
* Extension Example::           Example C code for an extension.
* Extension Samples::           The sample extensions that ship with
                                `gawk'.
* gawkextlib::                  The `gawkextlib' project.


File: gawk.info,  Node: Extension Intro,  Next: Plugin License,  Up: Dynamic Extensions

16.1 Introduction
=================

An "extension" (sometimes called a "plug-in") is a piece of external
compiled code that `gawk' can load at runtime to provide additional
functionality, over and above the built-in capabilities described in
the rest of this Info file.

   Extensions are useful because they allow you (of course) to extend
`gawk''s functionality. For example, they can provide access to system
calls (such as `chdir()' to change directory) and to other C library
routines that could be of use.  As with most software, "the sky is the
limit;" if you can imagine something that you might want to do and can
write in C or C++, you can write an extension to do it!

   Extensions are written in C or C++, using the "Application
Programming Interface" (API) defined for this purpose by the `gawk'
developers.  The rest of this major node explains the facilities that
the API provides and how to use them, and presents a small sample
extension.  In addition, it documents the sample extensions included in
the `gawk' distribution, and describes the `gawkextlib' project.  *Note
Extension Design::, for a discussion of the extension mechanism goals
and design.


File: gawk.info,  Node: Plugin License,  Next: Extension Mechanism Outline,  Prev: Extension Intro,  Up: Dynamic Extensions

16.2 Extension Licensing
========================

Every dynamic extension should define the global symbol
`plugin_is_GPL_compatible' to assert that it has been licensed under a
GPL-compatible license.  If this symbol does not exist, `gawk' emits a
fatal error and exits when it tries to load your extension.

   The declared type of the symbol should be `int'.  It does not need
to be in any allocated section, though.  The code merely asserts that
the symbol exists in the global scope.  Something like this is enough:

     int plugin_is_GPL_compatible;


File: gawk.info,  Node: Extension Mechanism Outline,  Next: Extension API Description,  Prev: Plugin License,  Up: Dynamic Extensions

16.3 At A High Level How It Works
=================================

Communication between `gawk' and an extension is two-way.  First, when
an extension is loaded, it is passed a pointer to a `struct' whose
fields are function pointers.  This is shown in *note load-extension::.

                          API
                         Struct
                         +---+
                         |   |
                         +---+
         +---------------|   |
         |               +---+      dl_load(api_p, id);
         |               |   |  ___________________
         |               +---+                     |
         |     +---------|   |  __________________ |
         |     |         +---+                    ||
         |     |         |   |                    ||
         |     |         +---+                    ||
         |     |     +---|   |                    ||
         |     |     |   +---+                  \ || /
         |     |     |                           \  /
         v     v     v                            \/
+-------+-+---+-+---+-+------------------+--------------------+
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOOOOOOOO|
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOOOOOOOO|
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOOOOOOOO|
+-------+-+---+-+---+-+------------------+--------------------+

    gawk Main Program Address Space              Extension
Figure 16.1: Loading The Extension

   The extension can call functions inside `gawk' through these
function pointers, at runtime, without needing (link-time) access to
`gawk''s symbols.  One of these function pointers is to a function for
"registering" new built-in functions.  This is shown in *note
load-new-function::.

            register_ext_func({ "chdir", do_chdir, 1 });

            +--------------------------------------------+
            |                                            |
            V                                            |
+-------+-+---+-+---+-+------------------+--------------+-+---+
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOO|X|OOO|
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOO|X|OOO|
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOO|X|OOO|
+-------+-+---+-+---+-+------------------+--------------+-+---+

    gawk Main Program Address Space              Extension
Figure 16.2: Loading The New Function

   In the other direction, the extension registers its new functions
with `gawk' by passing function pointers to the functions that provide
the new feature (`do_chdir()', for example).  `gawk' associates the
function pointer with a name and can then call it, using a defined
calling convention.  This is shown in *note call-new-function::.

    BEGIN {
        chdir("/path")                             (*fnptr)(1);
    }
            +--------------------------------------------+
            |                                            |
            |                                            V
+-------+-+---+-+---+-+------------------+--------------+-+---+
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOO|X|OOO|
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOO|X|OOO|
|       |x|   |x|   |x|                  |OOOOOOOOOOOOOO|X|OOO|
+-------+-+---+-+---+-+------------------+--------------+-+---+

    gawk Main Program Address Space              Extension
Figure 16.3: Calling The New Function

   The `do_XXX()' function, in turn, then uses the function pointers in
the API `struct' to do its work, such as updating variables or arrays,
printing messages, setting `ERRNO', and so on.

   Convenience macros in the `gawkapi.h' header file make calling
through the function pointers look like regular function calls so that
extension code is quite readable and understandable.

   Although all of this sounds somewhat complicated, the result is that
extension code is quite straightforward to write and to read. You can
see this in the sample extensions `filefuncs.c' (*note Extension
Example::) and also the `testext.c' code for testing the APIs.

   Some other bits and pieces:

   * The API provides access to `gawk''s `do_XXX' values, reflecting
     command line options, like `do_lint', `do_profiling' and so on
     (*note Extension API Variables::).  These are informational: an
     extension cannot affect their values inside `gawk'.  In addition,
     attempting to assign to them produces a compile-time error.

   * The API also provides major and minor version numbers, so that an
     extension can check if the `gawk' it is loaded with supports the
     facilities it was compiled with.  (Version mismatches "shouldn't"
     happen, but we all know how _that_ goes.)  *Note Extension
     Versioning::, for details.


File: gawk.info,  Node: Extension API Description,  Next: Finding Extensions,  Prev: Extension Mechanism Outline,  Up: Dynamic Extensions

16.4 API Description
====================

This (rather large) minor node describes the API in detail.

* Menu:

* Extension API Functions Introduction:: Introduction to the API functions.
* General Data Types::                   The data types.
* Requesting Values::                    How to get a value.
* Constructor Functions::                Functions for creating values.
* Registration Functions::               Functions to register things with
                                         `gawk'.
* Printing Messages::                    Functions for printing messages.
* Updating `ERRNO'::                Functions for updating `ERRNO'.
* Accessing Parameters::                 Functions for accessing parameters.
* Symbol Table Access::                  Functions for accessing global
                                         variables.
* Array Manipulation::                   Functions for working with arrays.
* Extension API Variables::              Variables provided by the API.
* Extension API Boilerplate::            Boilerplate code for using the API.


File: gawk.info,  Node: Extension API Functions Introduction,  Next: General Data Types,  Up: Extension API Description

16.4.1 Introduction
-------------------

Access to facilities within `gawk' are made available by calling
through function pointers passed into your extension.

   API function pointers are provided for the following kinds of
operations:

   * Registrations functions. You may register:
        - extension functions,

        - exit callbacks,

        - a version string,

        - input parsers,

        - output wrappers,

        - and two-way processors.
     All of these are discussed in detail, later in this major node.

   * Printing fatal, warning, and "lint" warning messages.

   * Updating `ERRNO', or unsetting it.

   * Accessing parameters, including converting an undefined parameter
     into an array.

   * Symbol table access: retrieving a global variable, creating one,
     or changing one.

   * Creating and releasing cached values; this provides an efficient
     way to use values for multiple variables and can be a big
     performance win.

   * Manipulating arrays:

        - Retrieving, adding, deleting, and modifying elements

        - Getting the count of elements in an array

        - Creating a new array

        - Clearing an array

        - Flattening an array for easy C style looping over all its
          indices and elements

   Some points about using the API:

   * The following types and/or macros and/or functions are referenced
     in `gawkapi.h'.  For correct use, you must therefore include the
     corresponding standard header file _before_ including `gawkapi.h':

     C Entity                 Header File
     ------------------------------------------- 
     `EOF'                    `<stdio.h>'
     `FILE'                   `<stdio.h>'
     `NULL'                   `<stddef.h>'
     `malloc()'               `<stdlib.h>'
     `memcpy()'               `<string.h>'
     `memset()'               `<string.h>'
     `realloc()'              `<stdlib.h>'
     `size_t'                 `<sys/types.h>'
     `struct stat'            `<sys/stat.h>'

     Due to portability concerns, especially to systems that are not
     fully standards-compliant, it is your responsibility to include
     the correct files in the correct way. This requirement is
     necessary in order to keep `gawkapi.h' clean, instead of becoming
     a portability hodge-podge as can be seen in some parts of the
     `gawk' source code.

     To pass reasonable integer values for `ERRNO', you will also need
     to include `<errno.h>'.

   * The `gawkapi.h' file may be included more than once without ill
     effect.  Doing so, however, is poor coding practice.

   * Although the API only uses ISO C 90 features, there is an
     exception; the "constructor" functions use the `inline' keyword.
     If your compiler does not support this keyword, you should either
     place `-Dinline=''' on your command line, or use the GNU Autotools
     and include a `config.h' file in your extensions.

   * All pointers filled in by `gawk' are to memory managed by `gawk'
     and should be treated by the extension as read-only.  Memory for
     _all_ strings passed into `gawk' from the extension _must_ come
     from `malloc()' and is managed by `gawk' from then on.

   * The API defines several simple `struct's that map values as seen
     from `awk'.  A value can be a `double', a string, or an array (as
     in multidimensional arrays, or when creating a new array).  String
     values maintain both pointer and length since embedded `NUL'
     characters are allowed.

          NOTE: By intent, strings are maintained using the current
          multibyte encoding (as defined by `LC_XXX' environment
          variables) and not using wide characters.  This matches how
          `gawk' stores strings internally and also how characters are
          likely to be input and output from files.

   * When retrieving a value (such as a parameter or that of a global
     variable or array element), the extension requests a specific type
     (number, string, scalars, value cookie, array, or "undefined").
     When the request is "undefined," the returned value will have the
     real underlying type.

     However, if the request and actual type don't match, the access
     function returns "false" and fills in the type of the actual value
     that is there, so that the extension can, e.g., print an error
     message (such as "scalar passed where array expected").


   While you may call the API functions by using the function pointers
directly, the interface is not so pretty. To make extension code look
more like regular code, the `gawkapi.h' header file defines several
macros that you should use in your code.  This minor node presents the
macros as if they were functions.


File: gawk.info,  Node: General Data Types,  Next: Requesting Values,  Prev: Extension API Functions Introduction,  Up: Extension API Description

16.4.2 General Purpose Data Types
---------------------------------

     I have a true love/hate relationship with unions.  -- Arnold
     Robbins That's the thing about unions: the compiler will arrange
     things so they can accommodate both love and hate.  -- Chet Ramey

   The extension API defines a number of simple types and structures
for general purpose use. Additional, more specialized, data structures
are introduced in subsequent minor nodes, together with the functions
that use them.

`typedef void *awk_ext_id_t;'
     A value of this type is received from `gawk' when an extension is
     loaded.  That value must then be passed back to `gawk' as the
     first parameter of each API function.

`#define awk_const ...'
     This macro expands to `const' when compiling an extension, and to
     nothing when compiling `gawk' itself.  This makes certain fields
     in the API data structures unwritable from extension code, while
     allowing `gawk' to use them as it needs to.

`typedef enum awk_bool {'

`    awk_false = 0,'

`    awk_true'

`} awk_bool_t;'
     A simple boolean type.

`typedef struct awk_string {'
`    char *str;      /* data */'
`    size_t len;     /* length thereof, in chars */'
`} awk_string_t;'
     This represents a mutable string. `gawk' owns the memory pointed
     to if it supplied the value. Otherwise, it takes ownership of the
     memory pointed to.  *Such memory must come from `malloc()'!*

     As mentioned earlier, strings are maintained using the current
     multibyte encoding.

`typedef enum {'
`    AWK_UNDEFINED,'
`    AWK_NUMBER,'
`    AWK_STRING,'
`    AWK_ARRAY,'
`    AWK_SCALAR,         /* opaque access to a variable */'
`    AWK_VALUE_COOKIE    /* for updating a previously created value */'
`} awk_valtype_t;'
     This `enum' indicates the type of a value.  It is used in the
     following `struct'.

`typedef struct awk_value {'
`    awk_valtype_t   val_type;'
`    union {'
`        awk_string_t       s;'
`        double             d;'
`        awk_array_t        a;'
`        awk_scalar_t       scl;'
`        awk_value_cookie_t vc;'
`    } u;'
`} awk_value_t;'
     An "`awk' value."  The `val_type' member indicates what kind of
     value the `union' holds, and each member is of the appropriate
     type.

`#define str_value      u.s'
`#define num_value      u.d'
`#define array_cookie   u.a'
`#define scalar_cookie  u.scl'
`#define value_cookie   u.vc'
     These macros make accessing the fields of the `awk_value_t' more
     readable.

`typedef void *awk_scalar_t;'
     Scalars can be represented as an opaque type. These values are
     obtained from `gawk' and then passed back into it. This is
     discussed in a general fashion below, and in more detail in *note
     Symbol table by cookie::.

`typedef void *awk_value_cookie_t;'
     A "value cookie" is an opaque type representing a cached value.
     This is also discussed in a general fashion below, and in more
     detail in *note Cached values::.


   Scalar values in `awk' are either numbers or strings. The
`awk_value_t' struct represents values.  The `val_type' member
indicates what is in the `union'.

   Representing numbers is easy--the API uses a C `double'.  Strings
require more work. Since `gawk' allows embedded `NUL' bytes in string
values, a string must be represented as a pair containing a
data-pointer and length. This is the `awk_string_t' type.

   Identifiers (i.e., the names of global variables) can be associated
with either scalar values or with arrays.  In addition, `gawk' provides
true arrays of arrays, where any given array element can itself be an
array.  Discussion of arrays is delayed until *note Array
Manipulation::.

   The various macros listed earlier make it easier to use the elements
of the `union' as if they were fields in a `struct'; this is a common
coding practice in C.  Such code is easier to write and to read,
however it remains _your_ responsibility to make sure that the
`val_type' member correctly reflects the type of the value in the
`awk_value_t'.

   Conceptually, the first three members of the `union' (number, string,
and array) are all that is needed for working with `awk' values.
However, since the API provides routines for accessing and changing the
value of global scalar variables only by using the variable's name,
there is a performance penalty: `gawk' must find the variable each time
it is accessed and changed.  This turns out to be a real issue, not
just a theoretical one.

   Thus, if you know that your extension will spend considerable time
reading and/or changing the value of one or more scalar variables, you
can obtain a "scalar cookie"(1) object for that variable, and then use
the cookie for getting the variable's value or for changing the
variable's value.  This is the `awk_scalar_t' type and `scalar_cookie'
macro.  Given a scalar cookie, `gawk' can directly retrieve or modify
the value, as required, without having to first find it.

   The `awk_value_cookie_t' type and `value_cookie' macro are similar.
If you know that you wish to use the same numeric or string _value_ for
one or more variables, you can create the value once, retaining a
"value cookie" for it, and then pass in that value cookie whenever you
wish to set the value of a variable.  This saves both storage space
within the running `gawk' process as well as the time needed to create
the value.

   ---------- Footnotes ----------

   (1) See the "cookie" entry in the Jargon file
(http://catb.org/jargon/html/C/cookie.html) for a definition of
"cookie", and the "magic cookie" entry in the Jargon file
(http://catb.org/jargon/html/M/magic-cookie.html) for a nice example.
See also the entry for "Cookie" in the *note Glossary::.


File: gawk.info,  Node: Requesting Values,  Next: Constructor Functions,  Prev: General Data Types,  Up: Extension API Description

16.4.3 Requesting Values
------------------------

All of the functions that return values from `gawk' work in the same
way. You pass in an `awk_valtype_t' value to indicate what kind of
value you expect.  If the actual value matches what you requested, the
function returns true and fills in the `awk_value_t' result.
Otherwise, the function returns false, and the `val_type' member
indicates the type of the actual value.  You may then print an error
message, or reissue the request for the actual value type, as
appropriate.  This behavior is summarized in *note
table-value-types-returned::.

                                     Type of Actual Value:
-------------------------------------------------------------------------- 

                          String         Number      Array       Undefined
------------------------------------------------------------------------------ 
             String       String         String      false       false
             Number       Number if can  Number      false       false
                          be converted,                          
                          else false                             
Type         Array        false          false       Array       false
Requested:   Scalar       Scalar         Scalar      false       false
             Undefined    String         Number      Array       Undefined
             Value        false          false       false       false
             Cookie                                              

Table 16.1: Value Types Returned


File: gawk.info,  Node: Constructor Functions,  Next: Registration Functions,  Prev: Requesting Values,  Up: Extension API Description

16.4.4 Constructor Functions and Convenience Macros
---------------------------------------------------

The API provides a number of "constructor" functions for creating
string and numeric values, as well as a number of convenience macros.
This node presents them all as function prototypes, in the way that
extension code would use them.

`static inline awk_value_t *'
`make_const_string(const char *string, size_t length, awk_value_t *result)'
     This function creates a string value in the `awk_value_t' variable
     pointed to by `result'. It expects `string' to be a C string
     constant (or other string data), and automatically creates a
     _copy_ of the data for storage in `result'. It returns `result'.

`static inline awk_value_t *'
`make_malloced_string(const char *string, size_t length, awk_value_t *result)'
     This function creates a string value in the `awk_value_t' variable
     pointed to by `result'. It expects `string' to be a `char *' value
     pointing to data previously obtained from `malloc()'. The idea here
     is that the data is passed directly to `gawk', which assumes
     responsibility for it. It returns `result'.

`static inline awk_value_t *'
`make_null_string(awk_value_t *result)'
     This specialized function creates a null string (the "undefined"
     value) in the `awk_value_t' variable pointed to by `result'.  It
     returns `result'.

`static inline awk_value_t *'
`make_number(double num, awk_value_t *result)'
     This function simply creates a numeric value in the `awk_value_t'
     variable pointed to by `result'.

   Two convenience macros may be used for allocating storage from
`malloc()' and `realloc()'. If the allocation fails, they cause `gawk'
to exit with a fatal error message.  They should be used as if they were
procedure calls that do not return a value.

`#define emalloc(pointer, type, size, message) ...'
     The arguments to this macro are as follows:
    `pointer'
          The pointer variable to point at the allocated storage.

    `type'
          The type of the pointer variable, used to create a cast for
          the call to `malloc()'.

    `size'
          The total number of bytes to be allocated.

    `message'
          A message to be prefixed to the fatal error message.
          Typically this is the name of the function using the macro.

     For example, you might allocate a string value like so:

          awk_value_t result;
          char *message;
          const char greet[] = "Don't Panic!";

          emalloc(message, char *, sizeof(greet), "myfunc");
          strcpy(message, greet);
          make_malloced_string(message, strlen(message), & result);

`#define erealloc(pointer, type, size, message) ...'
     This is like `emalloc()', but it calls `realloc()', instead of
     `malloc()'.  The arguments are the same as for the `emalloc()'
     macro.


File: gawk.info,  Node: Registration Functions,  Next: Printing Messages,  Prev: Constructor Functions,  Up: Extension API Description

16.4.5 Registration Functions
-----------------------------

This minor node describes the API functions for registering parts of
your extension with `gawk'.

* Menu:

* Extension Functions::         Registering extension functions.
* Exit Callback Functions::     Registering an exit callback.
* Extension Version String::    Registering a version string.
* Input Parsers::               Registering an input parser.
* Output Wrappers::             Registering an output wrapper.
* Two-way processors::          Registering a two-way processor.


File: gawk.info,  Node: Extension Functions,  Next: Exit Callback Functions,  Up: Registration Functions

16.4.5.1 Registering An Extension Function
..........................................

Extension functions are described by the following record:

     typedef struct awk_ext_func {
         const char *name;
         awk_value_t *(*function)(int num_actual_args, awk_value_t *result);
         size_t num_expected_args;
     } awk_ext_func_t;

   The fields are:

`const char *name;'
     The name of the new function.  `awk' level code calls the function
     by this name.  This is a regular C string.

     Function names must obey the rules for `awk' identifiers. That is,
     they must begin with either a letter or an underscore, which may
     be followed by any number of letters, digits, and underscores.
     Letter case in function names is significant.

`awk_value_t *(*function)(int num_actual_args, awk_value_t *result);'
     This is a pointer to the C function that provides the desired
     functionality.  The function must fill in the result with either a
     number or a string. `awk' takes ownership of any string memory.
     As mentioned earlier, string memory *must* come from `malloc()'.

     The `num_actual_args' argument tells the C function how many
     actual parameters were passed from the calling `awk' code.

     The function must return the value of `result'.  This is for the
     convenience of the calling code inside `gawk'.

`size_t num_expected_args;'
     This is the number of arguments the function expects to receive.
     Each extension function may decide what to do if the number of
     arguments isn't what it expected.  Following `awk' functions, it
     is likely OK to ignore extra arguments.

   Once you have a record representing your extension function, you
register it with `gawk' using this API function:

`awk_bool_t add_ext_func(const char *namespace, const awk_ext_func_t *func);'
     This function returns true upon success, false otherwise.  The
     `namespace' parameter is currently not used; you should pass in an
     empty string (`""').  The `func' pointer is the address of a
     `struct' representing your function, as just described.


File: gawk.info,  Node: Exit Callback Functions,  Next: Extension Version String,  Prev: Extension Functions,  Up: Registration Functions

16.4.5.2 Registering An Exit Callback Function
..............................................

An "exit callback" function is a function that `gawk' calls before it
exits.  Such functions are useful if you have general "clean up" tasks
that should be performed in your extension (such as closing data base
connections or other resource deallocations).  You can register such a
function with `gawk' using the following function.

`void awk_atexit(void (*funcp)(void *data, int exit_status),'
`                void *arg0);'
     The parameters are:
    `funcp'
          A pointer to the function to be called before `gawk' exits.
          The `data' parameter will be the original value of `arg0'.
          The `exit_status' parameter is the exit status value that
          `gawk' intends to pass to the `exit()' system call.

    `arg0'
          A pointer to private data which `gawk' saves in order to pass
          to the function pointed to by `funcp'.

   Exit callback functions are called in Last-In-First-Out (LIFO)
order--that is, in the reverse order in which they are registered with
`gawk'.


File: gawk.info,  Node: Extension Version String,  Next: Input Parsers,  Prev: Exit Callback Functions,  Up: Registration Functions

16.4.5.3 Registering An Extension Version String
................................................

You can register a version string which indicates the name and version
of your extension, with `gawk', as follows:

`void register_ext_version(const char *version);'
     Register the string pointed to by `version' with `gawk'.  `gawk'
     does _not_ copy the `version' string, so it should not be changed.

   `gawk' prints all registered extension version strings when it is
invoked with the `--version' option.


File: gawk.info,  Node: Input Parsers,  Next: Output Wrappers,  Prev: Extension Version String,  Up: Registration Functions

16.4.5.4 Customized Input Parsers
.................................

By default, `gawk' reads text files as its input. It uses the value of
`RS' to find the end of the record, and then uses `FS' (or
`FIELDWIDTHS' or `FPAT') to split it into fields (*note Reading
Files::).  Additionally, it sets the value of `RT' (*note Built-in
Variables::).

   If you want, you can provide your own custom input parser.  An input
parser's job is to return a record to the `gawk' record processing
code, along with indicators for the value and length of the data to be
used for `RT', if any.

   To provide an input parser, you must first provide two functions
(where XXX is a prefix name for your extension):

`awk_bool_t XXX_can_take_file(const awk_input_buf_t *iobuf)'
     This function examines the information available in `iobuf' (which
     we discuss shortly).  Based on the information there, it decides
     if the input parser should be used for this file.  If so, it
     should return true. Otherwise, it should return false.  It should
     not change any state (variable values, etc.) within `gawk'.

`awk_bool_t XXX_take_control_of(awk_input_buf_t *iobuf)'
     When `gawk' decides to hand control of the file over to the input
     parser, it calls this function.  This function in turn must fill
     in certain fields in the `awk_input_buf_t' structure, and ensure
     that certain conditions are true.  It should then return true. If
     an error of some kind occurs, it should not fill in any fields,
     and should return false; then `gawk' will not use the input parser.
     The details are presented shortly.

   Your extension should package these functions inside an
`awk_input_parser_t', which looks like this:

     typedef struct awk_input_parser {
         const char *name;   /* name of parser */
         awk_bool_t (*can_take_file)(const awk_input_buf_t *iobuf);
         awk_bool_t (*take_control_of)(awk_input_buf_t *iobuf);
         awk_const struct awk_input_parser *awk_const next;   /* for gawk */
     } awk_input_parser_t;

   The fields are:

`const char *name;'
     The name of the input parser. This is a regular C string.

`awk_bool_t (*can_take_file)(const awk_input_buf_t *iobuf);'
     A pointer to your `XXX_can_take_file()' function.

`awk_bool_t (*take_control_of)(awk_input_buf_t *iobuf);'
     A pointer to your `XXX_take_control_of()' function.

`awk_const struct input_parser *awk_const next;'
     This pointer is used by `gawk'.  The extension cannot modify it.

   The steps are as follows:

  1. Create a `static awk_input_parser_t' variable and initialize it
     appropriately.

  2. When your extension is loaded, register your input parser with
     `gawk' using the `register_input_parser()' API function (described
     below).

   An `awk_input_buf_t' looks like this:

     typedef struct awk_input {
         const char *name;       /* filename */
         int fd;                 /* file descriptor */
     #define INVALID_HANDLE (-1)
         void *opaque;           /* private data for input parsers */
         int (*get_record)(char **out, struct awk_input *iobuf,
                           int *errcode, char **rt_start, size_t *rt_len);
         ssize_t (*read_func)();
         void (*close_func)(struct awk_input *iobuf);
         struct stat sbuf;       /* stat buf */
     } awk_input_buf_t;

   The fields can be divided into two categories: those for use
(initially, at least) by `XXX_can_take_file()', and those for use by
`XXX_take_control_of()'.  The first group of fields and their uses are
as follows:

`const char *name;'
     The name of the file.

`int fd;'
     A file descriptor for the file.  If `gawk' was able to open the
     file, then `fd' will _not_ be equal to `INVALID_HANDLE'.
     Otherwise, it will.

`struct stat sbuf;'
     If file descriptor is valid, then `gawk' will have filled in this
     structure via a call to the `fstat()' system call.

   The `XXX_can_take_file()' function should examine these fields and
decide if the input parser should be used for the file.  The decision
can be made based upon `gawk' state (the value of a variable defined
previously by the extension and set by `awk' code), the name of the
file, whether or not the file descriptor is valid, the information in
the `struct stat', or any combination of the above.

   Once `XXX_can_take_file()' has returned true, and `gawk' has decided
to use your input parser, it calls `XXX_take_control_of()'.  That
function then fills one of either the `get_record' field or the
`read_func' field in the `awk_input_buf_t'.  It must also ensure that
`fd' is _not_ set to `INVALID_HANDLE'.  All of the fields that may be
filled by `XXX_take_control_of()' are as follows:

`void *opaque;'
     This is used to hold any state information needed by the input
     parser for this file.  It is "opaque" to `gawk'.  The input parser
     is not required to use this pointer.

`int (*get_record)(char **out,'
`                  struct awk_input *iobuf,'
`                  int *errcode,'
`                  char **rt_start,'
`                  size_t *rt_len);'
     This function pointer should point to a function that creates the
     input records.  Said function is the core of the input parser.
     Its behavior is described below.

`ssize_t (*read_func)();'
     This function pointer should point to function that has the same
     behavior as the standard POSIX `read()' system call.  It is an
     alternative to the `get_record' pointer.  Its behavior is also
     described below.

`void (*close_func)(struct awk_input *iobuf);'
     This function pointer should point to a function that does the
     "tear down." It should release any resources allocated by
     `XXX_take_control_of()'.  It may also close the file. If it does
     so, it should set the `fd' field to `INVALID_HANDLE'.

     If `fd' is still not `INVALID_HANDLE' after the call to this
     function, `gawk' calls the regular `close()' system call.

     Having a "tear down" function is optional. If your input parser
     does not need it, do not set this field.  Then, `gawk' calls the
     regular `close()' system call on the file descriptor, so it should
     be valid.

   The `XXX_get_record()' function does the work of creating input
records.  The parameters are as follows:

`char **out'
     This is a pointer to a `char *' variable which is set to point to
     the record.  `gawk' makes its own copy of the data, so the
     extension must manage this storage.

`struct awk_input *iobuf'
     This is the `awk_input_buf_t' for the file.  The fields should be
     used for reading data (`fd') and for managing private state
     (`opaque'), if any.

`int *errcode'
     If an error occurs, `*errcode' should be set to an appropriate
     code from `<errno.h>'.

`char **rt_start'
`size_t *rt_len'
     If the concept of a "record terminator" makes sense, then
     `*rt_start' should be set to point to the data to be used for
     `RT', and `*rt_len' should be set to the length of the data.
     Otherwise, `*rt_len' should be set to zero.  `gawk' makes its own
     copy of this data, so the extension must manage the storage.

   The return value is the length of the buffer pointed to by `*out',
or `EOF' if end-of-file was reached or an error occurred.

   It is guaranteed that `errcode' is a valid pointer, so there is no
need to test for a `NULL' value.  `gawk' sets `*errcode' to zero, so
there is no need to set it unless an error occurs.

   If an error does occur, the function should return `EOF' and set
`*errcode' to a non-zero value.  In that case, if `*errcode' does not
equal -1, `gawk' automatically updates the `ERRNO' variable based on
the value of `*errcode'.  (In general, setting `*errcode = errno'
should do the right thing.)

   As an alternative to supplying a function that returns an input
record, you may instead supply a function that simply reads bytes, and
let `gawk' parse the data into records.  If you do so, the data should
be returned in the multibyte encoding of the current locale.  Such a
function should follow the same behavior as the `read()' system call,
and you fill in the `read_func' pointer with its address in the
`awk_input_buf_t' structure.

   By default, `gawk' sets the `read_func' pointer to point to the
`read()' system call. So your extension need not set this field
explicitly.

     NOTE: You must choose one method or the other: either a function
     that returns a record, or one that returns raw data.  In
     particular, if you supply a function to get a record, `gawk' will
     call it, and never call the raw read function.

   `gawk' ships with a sample extension that reads directories,
returning records for each entry in the directory (*note Extension
Sample Readdir::).  You may wish to use that code as a guide for writing
your own input parser.

   When writing an input parser, you should think about (and document)
how it is expected to interact with `awk' code.  You may want it to
always be called, and take effect as appropriate (as the `readdir'
extension does).  Or you may want it to take effect based upon the
value of an `awk' variable, as the XML extension from the `gawkextlib'
project does (*note gawkextlib::).  In the latter case, code in a
`BEGINFILE' section can look at `FILENAME' and `ERRNO' to decide
whether or not to activate an input parser (*note BEGINFILE/ENDFILE::).

   You register your input parser with the following function:

`void register_input_parser(awk_input_parser_t *input_parser);'
     Register the input parser pointed to by `input_parser' with `gawk'.


File: gawk.info,  Node: Output Wrappers,  Next: Two-way processors,  Prev: Input Parsers,  Up: Registration Functions

16.4.5.5 Customized Output Wrappers
...................................

An "output wrapper" is the mirror image of an input parser.  It allows
an extension to take over the output to a file opened with the `>' or
`>>' I/O redirection operators (*note Redirection::).

   The output wrapper is very similar to the input parser structure:

     typedef struct awk_output_wrapper {
         const char *name;   /* name of the wrapper */
         awk_bool_t (*can_take_file)(const awk_output_buf_t *outbuf);
         awk_bool_t (*take_control_of)(awk_output_buf_t *outbuf);
         awk_const struct awk_output_wrapper *awk_const next;  /* for gawk */
     } awk_output_wrapper_t;

   The members are as follows:

`const char *name;'
     This is the name of the output wrapper.

`awk_bool_t (*can_take_file)(const awk_output_buf_t *outbuf);'
     This points to a function that examines the information in the
     `awk_output_buf_t' structure pointed to by `outbuf'.  It should
     return true if the output wrapper wants to take over the file, and
     false otherwise.  It should not change any state (variable values,
     etc.) within `gawk'.

`awk_bool_t (*take_control_of)(awk_output_buf_t *outbuf);'
     The function pointed to by this field is called when `gawk'
     decides to let the output wrapper take control of the file. It
     should fill in appropriate members of the `awk_output_buf_t'
     structure, as described below, and return true if successful,
     false otherwise.

`awk_const struct output_wrapper *awk_const next;'
     This is for use by `gawk'; therefore they are marked `awk_const'
     so that the extension cannot modify them.

   The `awk_output_buf_t' structure looks like this:

     typedef struct awk_output_buf {
         const char *name;   /* name of output file */
         const char *mode;   /* mode argument to fopen */
         FILE *fp;           /* stdio file pointer */
         awk_bool_t redirected;  /* true if a wrapper is active */
         void *opaque;       /* for use by output wrapper */
         size_t (*gawk_fwrite)(const void *buf, size_t size, size_t count,
                     FILE *fp, void *opaque);
         int (*gawk_fflush)(FILE *fp, void *opaque);
         int (*gawk_ferror)(FILE *fp, void *opaque);
         int (*gawk_fclose)(FILE *fp, void *opaque);
     } awk_output_buf_t;

   Here too, your extension will define `XXX_can_take_file()' and
`XXX_take_control_of()' functions that examine and update data members
in the `awk_output_buf_t'.  The data members are as follows:

`const char *name;'
     The name of the output file.

`const char *mode;'
     The mode string (as would be used in the second argument to
     `fopen()') with which the file was opened.

`FILE *fp;'
     The `FILE' pointer from `<stdio.h>'. `gawk' opens the file before
     attempting to find an output wrapper.

`awk_bool_t redirected;'
     This field must be set to true by the `XXX_take_control_of()'
     function.

`void *opaque;'
     This pointer is opaque to `gawk'. The extension should use it to
     store a pointer to any private data associated with the file.

`size_t (*gawk_fwrite)(const void *buf, size_t size, size_t count,'
`                      FILE *fp, void *opaque);'
`int (*gawk_fflush)(FILE *fp, void *opaque);'
`int (*gawk_ferror)(FILE *fp, void *opaque);'
`int (*gawk_fclose)(FILE *fp, void *opaque);'
     These pointers should be set to point to functions that perform
     the equivalent function as the `<stdio.h>' functions do, if
     appropriate.  `gawk' uses these function pointers for all output.
     `gawk' initializes the pointers to point to internal, "pass
     through" functions that just call the regular `<stdio.h>'
     functions, so an extension only needs to redefine those functions
     that are appropriate for what it does.

   The `XXX_can_take_file()' function should make a decision based upon
the `name' and `mode' fields, and any additional state (such as `awk'
variable values) that is appropriate.

   When `gawk' calls `XXX_take_control_of()', it should fill in the
other fields, as appropriate, except for `fp', which it should just use
normally.

   You register your output wrapper with the following function:

`void register_output_wrapper(awk_output_wrapper_t *output_wrapper);'
     Register the output wrapper pointed to by `output_wrapper' with
     `gawk'.


File: gawk.info,  Node: Two-way processors,  Prev: Output Wrappers,  Up: Registration Functions

16.4.5.6 Customized Two-way Processors
......................................

A "two-way processor" combines an input parser and an output wrapper for
two-way I/O with the `|&' operator (*note Redirection::).  It makes
identical use of the `awk_input_parser_t' and `awk_output_buf_t'
structures as described earlier.

   A two-way processor is represented by the following structure:

     typedef struct awk_two_way_processor {
         const char *name;   /* name of the two-way processor */
         awk_bool_t (*can_take_two_way)(const char *name);
         awk_bool_t (*take_control_of)(const char *name,
                                       awk_input_buf_t *inbuf,
                                       awk_output_buf_t *outbuf);
         awk_const struct awk_two_way_processor *awk_const next;  /* for gawk */
     } awk_two_way_processor_t;

   The fields are as follows:

`const char *name;'
     The name of the two-way processor.

`awk_bool_t (*can_take_two_way)(const char *name);'
     This function returns true if it wants to take over two-way I/O
     for this filename.  It should not change any state (variable
     values, etc.) within `gawk'.

`awk_bool_t (*take_control_of)(const char *name,'
`                              awk_input_buf_t *inbuf,'
`                              awk_output_buf_t *outbuf);'
     This function should fill in the `awk_input_buf_t' and
     `awk_outut_buf_t' structures pointed to by `inbuf' and `outbuf',
     respectively.  These structures were described earlier.

`awk_const struct two_way_processor *awk_const next;'
     This is for use by `gawk'; therefore they are marked `awk_const'
     so that the extension cannot modify them.

   As with the input parser and output processor, you provide "yes I
can take this" and "take over for this" functions,
`XXX_can_take_two_way()' and `XXX_take_control_of()'.

   You register your two-way processor with the following function:

`void register_two_way_processor(awk_two_way_processor_t *two_way_processor);'
     Register the two-way processor pointed to by `two_way_processor'
     with `gawk'.


File: gawk.info,  Node: Printing Messages,  Next: Updating `ERRNO',  Prev: Registration Functions,  Up: Extension API Description

16.4.6 Printing Messages
------------------------

You can print different kinds of warning messages from your extension,
as described below.  Note that for these functions, you must pass in
the extension id received from `gawk' when the extension was loaded.(1)

`void fatal(awk_ext_id_t id, const char *format, ...);'
     Print a message and then cause `gawk' to exit immediately.

`void warning(awk_ext_id_t id, const char *format, ...);'
     Print a warning message.

`void lintwarn(awk_ext_id_t id, const char *format, ...);'
     Print a "lint warning."  Normally this is the same as printing a
     warning message, but if `gawk' was invoked with `--lint=fatal',
     then lint warnings become fatal error messages.

   All of these functions are otherwise like the C `printf()' family of
functions, where the `format' parameter is a string with literal
characters and formatting codes intermixed.

   ---------- Footnotes ----------

   (1) Because the API uses only ISO C 90 features, it cannot make use
of the ISO C 99 variadic macro feature to hide that parameter. More's
the pity.


File: gawk.info,  Node: Updating `ERRNO',  Next: Accessing Parameters,  Prev: Printing Messages,  Up: Extension API Description

16.4.7 Updating `ERRNO'
-----------------------

The following functions allow you to update the `ERRNO' variable:

`void update_ERRNO_int(int errno_val);'
     Set `ERRNO' to the string equivalent of the error code in
     `errno_val'. The value should be one of the defined error codes in
     `<errno.h>', and `gawk' turns it into a (possibly translated)
     string using the C `strerror()' function.

`void update_ERRNO_string(const char *string);'
     Set `ERRNO' directly to the string value of `ERRNO'.  `gawk' makes
     a copy of the value of `string'.

`void unset_ERRNO();'
     Unset `ERRNO'.


File: gawk.info,  Node: Accessing Parameters,  Next: Symbol Table Access,  Prev: Updating `ERRNO',  Up: Extension API Description

16.4.8 Accessing and Updating Parameters
----------------------------------------

Two functions give you access to the arguments (parameters) passed to
your extension function. They are:

`awk_bool_t get_argument(size_t count,'
`                        awk_valtype_t wanted,'
`                        awk_value_t *result);'
     Fill in the `awk_value_t' structure pointed to by `result' with
     the `count''th argument.  Return true if the actual type matches
     `wanted', false otherwise.  In the latter case, `result->val_type'
     indicates the actual type (*note Table 16.1:
     table-value-types-returned.).  Counts are zero based--the first
     argument is numbered zero, the second one, and so on. `wanted'
     indicates the type of value expected.

`awk_bool_t set_argument(size_t count, awk_array_t array);'
     Convert a parameter that was undefined into an array; this provides
     call-by-reference for arrays.  Return false if `count' is too big,
     or if the argument's type is not undefined.  *Note Array
     Manipulation::, for more information on creating arrays.


File: gawk.info,  Node: Symbol Table Access,  Next: Array Manipulation,  Prev: Accessing Parameters,  Up: Extension API Description

16.4.9 Symbol Table Access
--------------------------

Two sets of routines provide access to global variables, and one set
allows you to create and release cached values.

* Menu:

* Symbol table by name::        Accessing variables by name.
* Symbol table by cookie::      Accessing variables by ``cookie''.
* Cached values::               Creating and using cached values.


File: gawk.info,  Node: Symbol table by name,  Next: Symbol table by cookie,  Up: Symbol Table Access

16.4.9.1 Variable Access and Update by Name
...........................................

The following routines provide the ability to access and update global
`awk'-level variables by name.  In compiler terminology, identifiers of
different kinds are termed "symbols", thus the "sym" in the routines'
names.  The data structure which stores information about symbols is
termed a "symbol table".

`awk_bool_t sym_lookup(const char *name,'
`                      awk_valtype_t wanted,'
`                      awk_value_t *result);'
     Fill in the `awk_value_t' structure pointed to by `result' with
     the value of the variable named by the string `name', which is a
     regular C string.  `wanted' indicates the type of value expected.
     Return true if the actual type matches `wanted', false otherwise
     In the latter case, `result->val_type' indicates the actual type
     (*note Table 16.1: table-value-types-returned.).

`awk_bool_t sym_update(const char *name, awk_value_t *value);'
     Update the variable named by the string `name', which is a regular
     C string.  The variable is added to `gawk''s symbol table if it is
     not there.  Return true if everything worked, false otherwise.

     Changing types (scalar to array or vice versa) of an existing
     variable is _not_ allowed, nor may this routine be used to update
     an array.  This routine cannot be used to update any of the
     predefined variables (such as `ARGC' or `NF').

   An extension can look up the value of `gawk''s special variables.
However, with the exception of the `PROCINFO' array, an extension
cannot change any of those variables.


File: gawk.info,  Node: Symbol table by cookie,  Next: Cached values,  Prev: Symbol table by name,  Up: Symbol Table Access

16.4.9.2 Variable Access and Update by Cookie
.............................................

A "scalar cookie" is an opaque handle that provides access to a global
variable or array. It is an optimization that avoids looking up
variables in `gawk''s symbol table every time access is needed. This
was discussed earlier, in *note General Data Types::.

   The following functions let you work with scalar cookies.

`awk_bool_t sym_lookup_scalar(awk_scalar_t cookie,'
`                             awk_valtype_t wanted,'
`                             awk_value_t *result);'
     Retrieve the current value of a scalar cookie.  Once you have
     obtained a scalar_cookie using `sym_lookup()', you can use this
     function to get its value more efficiently.  Return false if the
     value cannot be retrieved.

`awk_bool_t sym_update_scalar(awk_scalar_t cookie, awk_value_t *value);'
     Update the value associated with a scalar cookie.  Return false if
     the new value is not one of `AWK_STRING' or `AWK_NUMBER'.  Here
     too, the built-in variables may not be updated.

   It is not obvious at first glance how to work with scalar cookies or
what their raison d'e^tre really is.  In theory, the `sym_lookup()' and
`sym_update()' routines are all you really need to work with variables.
For example, you might have code that looks up the value of a variable,
evaluates a condition, and then possibly changes the value of the
variable based on the result of that evaluation, like so:

     /*  do_magic --- do something really great */

     static awk_value_t *
     do_magic(int nargs, awk_value_t *result)
     {
         awk_value_t value;

         if (   sym_lookup("MAGIC_VAR", AWK_NUMBER, & value)
             && some_condition(value.num_value)) {
                 value.num_value += 42;
                 sym_update("MAGIC_VAR", & value);
         }

         return make_number(0.0, result);
     }

This code looks (and is) simple and straightforward. So what's the
problem?

   Consider what happens if `awk'-level code associated with your
extension calls the `magic()' function (implemented in C by
`do_magic()'), once per record, while processing hundreds of thousands
or millions of records.  The `MAGIC_VAR' variable is looked up in the
symbol table once or twice per function call!

   The symbol table lookup is really pure overhead; it is considerably
more efficient to get a cookie that represents the variable, and use
that to get the variable's value and update it as needed.(1)

   Thus, the way to use cookies is as follows.  First, install your
extension's variable in `gawk''s symbol table using `sym_update()', as
usual. Then get a scalar cookie for the variable using `sym_lookup()':

     static awk_scalar_t magic_var_cookie;    /* cookie for MAGIC_VAR */

     static void
     my_extension_init()
     {
         awk_value_t value;

         /* install initial value */
         sym_update("MAGIC_VAR", make_number(42.0, & value));

         /* get cookie */
         sym_lookup("MAGIC_VAR", AWK_SCALAR, & value);

         /* save the cookie */
         magic_var_cookie = value.scalar_cookie;
         ...
     }

   Next, use the routines in this section for retrieving and updating
the value through the cookie.  Thus, `do_magic()' now becomes something
like this:

     /*  do_magic --- do something really great */

     static awk_value_t *
     do_magic(int nargs, awk_value_t *result)
     {
         awk_value_t value;

         if (   sym_lookup_scalar(magic_var_cookie, AWK_NUMBER, & value)
             && some_condition(value.num_value)) {
                 value.num_value += 42;
                 sym_update_scalar(magic_var_cookie, & value);
         }
         ...

         return make_number(0.0, result);
     }

     NOTE: The previous code omitted error checking for presentation
     purposes.  Your extension code should be more robust and carefully
     check the return values from the API functions.

   ---------- Footnotes ----------

   (1) The difference is measurable and quite real. Trust us.


File: gawk.info,  Node: Cached values,  Prev: Symbol table by cookie,  Up: Symbol Table Access

16.4.9.3 Creating and Using Cached Values
.........................................

The routines in this section allow you to create and release cached
values.  As with scalar cookies, in theory, cached values are not
necessary. You can create numbers and strings using the functions in
*note Constructor Functions::. You can then assign those values to
variables using `sym_update()' or `sym_update_scalar()', as you like.

   However, you can understand the point of cached values if you
remember that _every_ string value's storage _must_ come from
`malloc()'.  If you have 20 variables, all of which have the same
string value, you must create 20 identical copies of the string.(1)

   It is clearly more efficient, if possible, to create a value once,
and then tell `gawk' to reuse the value for multiple variables. That is
what the routines in this section let you do.  The functions are as
follows:

`awk_bool_t create_value(awk_value_t *value, awk_value_cookie_t *result);'
     Create a cached string or numeric value from `value' for efficient
     later assignment.  Only `AWK_NUMBER' and `AWK_STRING' values are
     allowed.  Any other type is rejected.  While `AWK_UNDEFINED' could
     be allowed, doing so would result in inferior performance.

`awk_bool_t release_value(awk_value_cookie_t vc);'
     Release the memory associated with a value cookie obtained from
     `create_value()'.

   You use value cookies in a fashion similar to the way you use scalar
cookies.  In the extension initialization routine, you create the value
cookie:

     static awk_value_cookie_t answer_cookie;  /* static value cookie */

     static void
     my_extension_init()
     {
         awk_value_t value;
         char *long_string;
         size_t long_string_len;

         /* code from earlier */
         ...
         /* ... fill in long_string and long_string_len ... */
         make_malloced_string(long_string, long_string_len, & value);
         create_value(& value, & answer_cookie);    /* create cookie */
         ...
     }

   Once the value is created, you can use it as the value of any number
of variables:

     static awk_value_t *
     do_magic(int nargs, awk_value_t *result)
     {
         awk_value_t new_value;

         ...    /* as earlier */

         value.val_type = AWK_VALUE_COOKIE;
         value.value_cookie = answer_cookie;
         sym_update("VAR1", & value);
         sym_update("VAR2", & value);
         ...
         sym_update("VAR100", & value);
         ...
     }

Using value cookies in this way saves considerable storage, since all of
`VAR1' through `VAR100' share the same value.

   You might be wondering, "Is this sharing problematic?  What happens
if `awk' code assigns a new value to `VAR1', are all the others be
changed too?"

   That's a great question. The answer is that no, it's not a problem.
Internally, `gawk' uses reference-counted strings. This means that many
variables can share the same string value, and `gawk' keeps track of
the usage.  When a variable's value changes, `gawk' simply decrements
the reference count on the old value and updates the variable to use
the new value.

   Finally, as part of your clean up action (*note Exit Callback
Functions::) you should release any cached values that you created,
using `release_value()'.

   ---------- Footnotes ----------

   (1) Numeric values are clearly less problematic, requiring only a C
`double' to store.


File: gawk.info,  Node: Array Manipulation,  Next: Extension API Variables,  Prev: Symbol Table Access,  Up: Extension API Description

16.4.10 Array Manipulation
--------------------------

The primary data structure(1) in `awk' is the associative array (*note
Arrays::).  Extensions need to be able to manipulate `awk' arrays.  The
API provides a number of data structures for working with arrays,
functions for working with individual elements, and functions for
working with arrays as a whole. This includes the ability to "flatten"
an array so that it is easy for C code to traverse every element in an
array.  The array data structures integrate nicely with the data
structures for values to make it easy to both work with and create true
arrays of arrays (*note General Data Types::).

* Menu:

* Array Data Types::            Data types for working with arrays.
* Array Functions::             Functions for working with arrays.
* Flattening Arrays::           How to flatten arrays.
* Creating Arrays::             How to create and populate arrays.

   ---------- Footnotes ----------

   (1) Okay, the only data structure.


File: gawk.info,  Node: Array Data Types,  Next: Array Functions,  Up: Array Manipulation

16.4.10.1 Array Data Types
..........................

The data types associated with arrays are listed below.

`typedef void *awk_array_t;'
     If you request the value of an array variable, you get back an
     `awk_array_t' value. This value is opaque(1) to the extension; it
     uniquely identifies the array but can only be used by passing it
     into API functions or receiving it from API functions. This is
     very similar to way `FILE *' values are used with the `<stdio.h>'
     library routines.

`typedef struct awk_element {'
`    /* convenience linked list pointer, not used by gawk */'
`    struct awk_element *next;'
`    enum {'
`        AWK_ELEMENT_DEFAULT = 0,  /* set by gawk */'
`        AWK_ELEMENT_DELETE = 1    /* set by extension if should be deleted */'
`    } flags;'
`    awk_value_t    index;'
`    awk_value_t    value;'
`} awk_element_t;'
     The `awk_element_t' is a "flattened" array element. `awk' produces
     an array of these inside the `awk_flat_array_t' (see the next
     item).  Individual elements may be marked for deletion. New
     elements must be added individually, one at a time, using the
     separate API for that purpose.  The fields are as follows:

    `struct awk_element *next;'
          This pointer is for the convenience of extension writers.  It
          allows an extension to create a linked list of new elements
          that can then be added to an array in a loop that traverses
          the list.

    `enum { ... } flags;'
          A set of flag values that convey information between `gawk'
          and the extension. Currently there is only one:
          `AWK_ELEMENT_DELETE'.  Setting it causes `gawk' to delete the
          element from the original array upon release of the flattened
          array.

    `index'
    `value'
          The index and value of the element, respectively.  _All_
          memory pointed to by `index' and `value' belongs to `gawk'.

`typedef struct awk_flat_array {'
`    awk_const void *awk_const opaque1;    /* private data for use by gawk */'
`    awk_const void *awk_const opaque2;    /* private data for use by gawk */'
`    awk_const size_t count;     /* how many elements */'
`    awk_element_t elements[1];  /* will be extended */'
`} awk_flat_array_t;'
     This is a flattened array. When an extension gets one of these
     from `gawk', the `elements' array is of actual size `count'.  The
     `opaque1' and `opaque2' pointers are for use by `gawk'; therefore
     they are marked `awk_const' so that the extension cannot modify
     them.

   ---------- Footnotes ----------

   (1) It is also a "cookie," but the `gawk' developers did not wish to
overuse this term.


File: gawk.info,  Node: Array Functions,  Next: Flattening Arrays,  Prev: Array Data Types,  Up: Array Manipulation

16.4.10.2 Array Functions
.........................

The following functions relate to individual array elements.

`awk_bool_t get_element_count(awk_array_t a_cookie, size_t *count);'
     For the array represented by `a_cookie', return in `*count' the
     number of elements it contains. A subarray counts as a single
     element.  Return false if there is an error.

`awk_bool_t get_array_element(awk_array_t a_cookie,'
`                             const awk_value_t *const index,'
`                             awk_valtype_t wanted,'
`                             awk_value_t *result);'
     For the array represented by `a_cookie', return in `*result' the
     value of the element whose index is `index'.  `wanted' specifies
     the type of value you wish to retrieve.  Return false if `wanted'
     does not match the actual type or if `index' is not in the array
     (*note Table 16.1: table-value-types-returned.).

     The value for `index' can be numeric, in which case `gawk'
     converts it to a string. Using non-integral values is possible, but
     requires that you understand how such values are converted to
     strings (*note Conversion::); thus using integral values is safest.

     As with _all_ strings passed into `gawk' from an extension, the
     string value of `index' must come from `malloc()', and `gawk'
     releases the storage.

`awk_bool_t set_array_element(awk_array_t a_cookie,'
`                             const awk_value_t *const index,'
`                             const awk_value_t *const value);'
     In the array represented by `a_cookie', create or modify the
     element whose index is given by `index'.  The `ARGV' and `ENVIRON'
     arrays may not be changed.

`awk_bool_t set_array_element_by_elem(awk_array_t a_cookie,'
`                                     awk_element_t element);'
     Like `set_array_element()', but take the `index' and `value' from
     `element'. This is a convenience macro.

`awk_bool_t del_array_element(awk_array_t a_cookie,'
`                             const awk_value_t* const index);'
     Remove the element with the given index from the array represented
     by `a_cookie'.  Return true if the element was removed, or false
     if the element did not exist in the array.

   The following functions relate to arrays as a whole:

`awk_array_t create_array();'
     Create a new array to which elements may be added.  *Note Creating
     Arrays::, for a discussion of how to create a new array and add
     elements to it.

`awk_bool_t clear_array(awk_array_t a_cookie);'
     Clear the array represented by `a_cookie'.  Return false if there
     was some kind of problem, true otherwise.  The array remains an
     array, but after calling this function, it has no elements. This
     is equivalent to using the `delete' statement (*note Delete::).

`awk_bool_t flatten_array(awk_array_t a_cookie, awk_flat_array_t **data);'
     For the array represented by `a_cookie', create an
     `awk_flat_array_t' structure and fill it in. Set the pointer whose
     address is passed as `data' to point to this structure.  Return
     true upon success, or false otherwise.  *Note Flattening Arrays::,
     for a discussion of how to flatten an array and work with it.

`awk_bool_t release_flattened_array(awk_array_t a_cookie,'
`                                   awk_flat_array_t *data);'
     When done with a flattened array, release the storage using this
     function.  You must pass in both the original array cookie, and
     the address of the created `awk_flat_array_t' structure.  The
     function returns true upon success, false otherwise.


File: gawk.info,  Node: Flattening Arrays,  Next: Creating Arrays,  Prev: Array Functions,  Up: Array Manipulation

16.4.10.3 Working With All The Elements of an Array
...................................................

To "flatten" an array is create a structure that represents the full
array in a fashion that makes it easy for C code to traverse the entire
array.  Test code in `extension/testext.c' does this, and also serves
as a nice example showing how to use the APIs.

   First, the `gawk' script that drives the test extension:

     @load "testext"
     BEGIN {
         n = split("blacky rusty sophie raincloud lucky", pets)
         printf("pets has %d elements\n", length(pets))
         ret = dump_array_and_delete("pets", "3")
         printf("dump_array_and_delete(pets) returned %d\n", ret)
         if ("3" in pets)
             printf("dump_array_and_delete() did NOT remove index \"3\"!\n")
         else
             printf("dump_array_and_delete() did remove index \"3\"!\n")
         print ""
     }

This code creates an array with `split()' (*note String Functions::)
and then calls `dump_array_and_delete()'. That function looks up the
array whose name is passed as the first argument, and deletes the
element at the index passed in the second argument.  The `awk' code
then prints the return value and checks if the element was indeed
deleted.  Here is the C code that implements `dump_array_and_delete()'.
It has been edited slightly for presentation.

   The first part declares variables, sets up the default return value
in `result', and checks that the function was called with the correct
number of arguments:

     static awk_value_t *
     dump_array_and_delete(int nargs, awk_value_t *result)
     {
         awk_value_t value, value2, value3;
         awk_flat_array_t *flat_array;
         size_t count;
         char *name;
         int i;

         assert(result != NULL);
         make_number(0.0, result);

         if (nargs != 2) {
             printf("dump_array_and_delete: nargs not right "
                    "(%d should be 2)\n", nargs);
             goto out;
         }

   The function then proceeds in steps, as follows. First, retrieve the
name of the array, passed as the first argument. Then retrieve the
array itself. If either operation fails, print error messages and
return:

         /* get argument named array as flat array and print it */
         if (get_argument(0, AWK_STRING, & value)) {
             name = value.str_value.str;
             if (sym_lookup(name, AWK_ARRAY, & value2))
                 printf("dump_array_and_delete: sym_lookup of %s passed\n",
                        name);
             else {
                 printf("dump_array_and_delete: sym_lookup of %s failed\n",
                        name);
                 goto out;
             }
         } else {
             printf("dump_array_and_delete: get_argument(0) failed\n");
             goto out;
         }

   For testing purposes and to make sure that the C code sees the same
number of elements as the `awk' code, the second step is to get the
count of elements in the array and print it:

         if (! get_element_count(value2.array_cookie, & count)) {
             printf("dump_array_and_delete: get_element_count failed\n");
             goto out;
         }

         printf("dump_array_and_delete: incoming size is %lu\n",
                (unsigned long) count);

   The third step is to actually flatten the array, and then to double
check that the count in the `awk_flat_array_t' is the same as the count
just retrieved:

         if (! flatten_array(value2.array_cookie, & flat_array)) {
             printf("dump_array_and_delete: could not flatten array\n");
             goto out;
         }

         if (flat_array->count != count) {
             printf("dump_array_and_delete: flat_array->count (%lu)"
                    " != count (%lu)\n",
                     (unsigned long) flat_array->count,
                     (unsigned long) count);
             goto out;
         }

   The fourth step is to retrieve the index of the element to be
deleted, which was passed as the second argument.  Remember that
argument counts passed to `get_argument()' are zero-based, thus the
second argument is numbered one:

         if (! get_argument(1, AWK_STRING, & value3)) {
             printf("dump_array_and_delete: get_argument(1) failed\n");
             goto out;
         }

   The fifth step is where the "real work" is done. The function loops
over every element in the array, printing the index and element values.
In addition, upon finding the element with the index that is supposed
to be deleted, the function sets the `AWK_ELEMENT_DELETE' bit in the
`flags' field of the element.  When the array is released, `gawk'
traverses the flattened array, and deletes any elements which have this
flag bit set:

         for (i = 0; i < flat_array->count; i++) {
             printf("\t%s[\"%.*s\"] = %s\n",
                 name,
                 (int) flat_array->elements[i].index.str_value.len,
                 flat_array->elements[i].index.str_value.str,
                 valrep2str(& flat_array->elements[i].value));

             if (strcmp(value3.str_value.str,
                        flat_array->elements[i].index.str_value.str)
                        == 0) {
                 flat_array->elements[i].flags |= AWK_ELEMENT_DELETE;
                 printf("dump_array_and_delete: marking element \"%s\" "
                        "for deletion\n",
                     flat_array->elements[i].index.str_value.str);
             }
         }

   The sixth step is to release the flattened array. This tells `gawk'
that the extension is no longer using the array, and that it should
delete any elements marked for deletion.  `gawk' also frees any storage
that was allocated, so you should not use the pointer (`flat_array' in
this code) once you have called `release_flattened_array()':

         if (! release_flattened_array(value2.array_cookie, flat_array)) {
             printf("dump_array_and_delete: could not release flattened array\n");
             goto out;
         }

   Finally, since everything was successful, the function sets the
return value to success, and returns:

         make_number(1.0, result);
     out:
         return result;
     }

   Here is the output from running this part of the test:

     pets has 5 elements
     dump_array_and_delete: sym_lookup of pets passed
     dump_array_and_delete: incoming size is 5
             pets["1"] = "blacky"
             pets["2"] = "rusty"
             pets["3"] = "sophie"
     dump_array_and_delete: marking element "3" for deletion
             pets["4"] = "raincloud"
             pets["5"] = "lucky"
     dump_array_and_delete(pets) returned 1
     dump_array_and_delete() did remove index "3"!


File: gawk.info,  Node: Creating Arrays,  Prev: Flattening Arrays,  Up: Array Manipulation

16.4.10.4 How To Create and Populate Arrays
...........................................

Besides working with arrays created by `awk' code, you can create
arrays and populate them as you see fit, and then `awk' code can access
them and manipulate them.

   There are two important points about creating arrays from extension
code:

  1. You must install a new array into `gawk''s symbol table
     immediately upon creating it.  Once you have done so, you can then
     populate the array.

     Similarly, if installing a new array as a subarray of an existing
     array, you must add the new array to its parent before adding any
     elements to it.

     Thus, the correct way to build an array is to work "top down."
     Create the array, and immediately install it in `gawk''s symbol
     table using `sym_update()', or install it as an element in a
     previously existing array using `set_element()'.  We show example
     code shortly.

  2. Due to gawk internals, after using `sym_update()' to install an
     array into `gawk', you have to retrieve the array cookie from the
     value passed in to `sym_update()' before doing anything else with
     it, like so:

          awk_value_t value;
          awk_array_t new_array;

          new_array = create_array();
          val.val_type = AWK_ARRAY;
          val.array_cookie = new_array;

          /* install array in the symbol table */
          sym_update("array", & val);

          new_array = val.array_cookie;    /* YOU MUST DO THIS */

     If installing an array as a subarray, you must also retrieve the
     value of the array cookie after the call to `set_element()'.

   The following C code is a simple test extension to create an array
with two regular elements and with a subarray. The leading `#include'
directives and boilerplate variable declarations are omitted for
brevity.  The first step is to create a new array and then install it
in the symbol table:

     /* create_new_array --- create a named array */

     static void
     create_new_array()
     {
         awk_array_t a_cookie;
         awk_array_t subarray;
         awk_value_t index, value;

         a_cookie = create_array();
         value.val_type = AWK_ARRAY;
         value.array_cookie = a_cookie;

         if (! sym_update("new_array", & value))
             printf("create_new_array: sym_update(\"new_array\") failed!\n");
         a_cookie = value.array_cookie;

Note how `a_cookie' is reset from the `array_cookie' field in the
`value' structure.

   The second step is to install two regular values into `new_array':

         (void) make_const_string("hello", 5, & index);
         (void) make_const_string("world", 5, & value);
         if (! set_array_element(a_cookie, & index, & value)) {
             printf("fill_in_array: set_array_element failed\n");
             return;
         }

         (void) make_const_string("answer", 6, & index);
         (void) make_number(42.0, & value);
         if (! set_array_element(a_cookie, & index, & value)) {
             printf("fill_in_array: set_array_element failed\n");
             return;
         }

   The third step is to create the subarray and install it:

         (void) make_const_string("subarray", 8, & index);
         subarray = create_array();
         value.val_type = AWK_ARRAY;
         value.array_cookie = subarray;
         if (! set_array_element(a_cookie, & index, & value)) {
             printf("fill_in_array: set_array_element failed\n");
             return;
         }
         subarray = value.array_cookie;

   The final step is to populate the subarray with its own element:

         (void) make_const_string("foo", 3, & index);
         (void) make_const_string("bar", 3, & value);
         if (! set_array_element(subarray, & index, & value)) {
             printf("fill_in_array: set_array_element failed\n");
             return;
         }
     }

   Here is sample script that loads the extension and then dumps the
array:

     @load "subarray"

     function dumparray(name, array,     i)
     {
         for (i in array)
             if (isarray(array[i]))
                 dumparray(name "[\"" i "\"]", array[i])
             else
                 printf("%s[\"%s\"] = %s\n", name, i, array[i])
     }

     BEGIN {
         dumparray("new_array", new_array);
     }

   Here is the result of running the script:

     $ AWKLIBPATH=$PWD ./gawk -f subarray.awk
     -| new_array["subarray"]["foo"] = bar
     -| new_array["hello"] = world
     -| new_array["answer"] = 42

(*Note Finding Extensions::, for more information on the `AWKLIBPATH'
environment variable.)


File: gawk.info,  Node: Extension API Variables,  Next: Extension API Boilerplate,  Prev: Array Manipulation,  Up: Extension API Description

16.4.11 API Variables
---------------------

The API provides two sets of variables.  The first provides information
about the version of the API (both with which the extension was
compiled, and with which `gawk' was compiled).  The second provides
information about how `gawk' was invoked.

* Menu:

* Extension Versioning::        API Version information.
* Extension API Informational Variables:: Variables providing information about
                                `gawk''s invocation.


File: gawk.info,  Node: Extension Versioning,  Next: Extension API Informational Variables,  Up: Extension API Variables

16.4.11.1 API Version Constants and Variables
.............................................

The API provides both a "major" and a "minor" version number.  The API
versions are available at compile time as constants:

`GAWK_API_MAJOR_VERSION'
     The major version of the API.

`GAWK_API_MINOR_VERSION'
     The minor version of the API.

   The minor version increases when new functions are added to the API.
Such new functions are always added to the end of the API `struct'.

   The major version increases (and the minor version is reset to zero)
if any of the data types change size or member order, or if any of the
existing functions change signature.

   It could happen that an extension may be compiled against one version
of the API but loaded by a version of `gawk' using a different version.
For this reason, the major and minor API versions of the running `gawk'
are included in the API `struct' as read-only constant integers:

`api->major_version'
     The major version of the running `gawk'.

`api->minor_version'
     The minor version of the running `gawk'.

   It is up to the extension to decide if there are API
incompatibilities.  Typically a check like this is enough:

     if (api->major_version != GAWK_API_MAJOR_VERSION
         || api->minor_version < GAWK_API_MINOR_VERSION) {
             fprintf(stderr, "foo_extension: version mismatch with gawk!\n");
             fprintf(stderr, "\tmy version (%d, %d), gawk version (%d, %d)\n",
                     GAWK_API_MAJOR_VERSION, GAWK_API_MINOR_VERSION,
                     api->major_version, api->minor_version);
             exit(1);
     }

   Such code is included in the boilerplate `dl_load_func()' macro
provided in `gawkapi.h' (discussed later, in *note Extension API
Boilerplate::).


File: gawk.info,  Node: Extension API Informational Variables,  Prev: Extension Versioning,  Up: Extension API Variables

16.4.11.2 Informational Variables
.................................

The API provides access to several variables that describe whether the
corresponding command-line options were enabled when `gawk' was
invoked.  The variables are:

`do_lint'
     This variable is true if `gawk' was invoked with `--lint' option
     (*note Options::).

`do_traditional'
     This variable is true if `gawk' was invoked with `--traditional'
     option.

`do_profile'
     This variable is true if `gawk' was invoked with `--profile'
     option.

`do_sandbox'
     This variable is true if `gawk' was invoked with `--sandbox'
     option.

`do_debug'
     This variable is true if `gawk' was invoked with `--debug' option.

`do_mpfr'
     This variable is true if `gawk' was invoked with `--bignum' option.

   The value of `do_lint' can change if `awk' code modifies the `LINT'
built-in variable (*note Built-in Variables::).  The others should not
change during execution.


File: gawk.info,  Node: Extension API Boilerplate,  Prev: Extension API Variables,  Up: Extension API Description

16.4.12 Boilerplate Code
------------------------

As mentioned earlier (*note Extension Mechanism Outline::), the function
definitions as presented are really macros. To use these macros, your
extension must provide a small amount of boilerplate code (variables and
functions) towards the top of your source file, using pre-defined names
as described below.  The boilerplate needed is also provided in comments
in the `gawkapi.h' header file:

     /* Boiler plate code: */
     int plugin_is_GPL_compatible;

     static gawk_api_t *const api;
     static awk_ext_id_t ext_id;
     static const char *ext_version = NULL; /* or ... = "some string" */

     static awk_ext_func_t func_table[] = {
         { "name", do_name, 1 },
         /* ... */
     };

     /* EITHER: */

     static awk_bool_t (*init_func)(void) = NULL;

     /* OR: */

     static awk_bool_t
     init_my_module(void)
     {
         ...
     }

     static awk_bool_t (*init_func)(void) = init_my_module;

     dl_load_func(func_table, some_name, "name_space_in_quotes")

   These variables and functions are as follows:

`int plugin_is_GPL_compatible;'
     This asserts that the extension is compatible with the GNU GPL
     (*note Copying::).  If your extension does not have this, `gawk'
     will not load it (*note Plugin License::).

`static gawk_api_t *const api;'
     This global `static' variable should be set to point to the
     `gawk_api_t' pointer that `gawk' passes to your `dl_load()'
     function.  This variable is used by all of the macros.

`static awk_ext_id_t ext_id;'
     This global static variable should be set to the `awk_ext_id_t'
     value that `gawk' passes to your `dl_load()' function.  This
     variable is used by all of the macros.

`static const char *ext_version = NULL; /* or ... = "some string" */'
     This global `static' variable should be set either to `NULL', or
     to point to a string giving the name and version of your extension.

`static awk_ext_func_t func_table[] = { ... };'
     This is an array of one or more `awk_ext_func_t' structures as
     described earlier (*note Extension Functions::).  It can then be
     looped over for multiple calls to `add_ext_func()'.

`static awk_bool_t (*init_func)(void) = NULL;'
`                   OR'
`static awk_bool_t init_my_module(void) { ... }'
`static awk_bool_t (*init_func)(void) = init_my_module;'
     If you need to do some initialization work, you should define a
     function that does it (creates variables, opens files, etc.)  and
     then define the `init_func' pointer to point to your function.
     The function should return `awk_false' upon failure, or `awk_true'
     if everything goes well.

     If you don't need to do any initialization, define the pointer and
     initialize it to `NULL'.

`dl_load_func(func_table, some_name, "name_space_in_quotes")'
     This macro expands to a `dl_load()' function that performs all the
     necessary initializations.

   The point of the all the variables and arrays is to let the
`dl_load()' function (from the `dl_load_func()' macro) do all the
standard work. It does the following:

  1. Check the API versions. If the extension major version does not
     match `gawk''s, or if the extension minor version is greater than
     `gawk''s, it prints a fatal error message and exits.

  2. Load the functions defined in `func_table'.  If any of them fails
     to load, it prints a warning message but continues on.

  3. If the `init_func' pointer is not `NULL', call the function it
     points to. If it returns `awk_false', print a warning message.

  4. If `ext_version' is not `NULL', register the version string with
     `gawk'.


File: gawk.info,  Node: Finding Extensions,  Next: Extension Example,  Prev: Extension API Description,  Up: Dynamic Extensions

16.5 How `gawk' Finds Extensions
================================

Compiled extensions have to be installed in a directory where `gawk'
can find them.  If `gawk' is configured and built in the default
fashion, the directory in which to find extensions is
`/usr/local/lib/gawk'.  You can also specify a search path with a list
of directories to search for compiled extensions.  *Note AWKLIBPATH
Variable::, for more information.


File: gawk.info,  Node: Extension Example,  Next: Extension Samples,  Prev: Finding Extensions,  Up: Dynamic Extensions

16.6 Example: Some File Functions
=================================

     No matter where you go, there you are.  -- Buckaroo Bonzai

   Two useful functions that are not in `awk' are `chdir()' (so that an
`awk' program can change its directory) and `stat()' (so that an `awk'
program can gather information about a file).  This minor node
implements these functions for `gawk' in an extension.

* Menu:

* Internal File Description::   What the new functions will do.
* Internal File Ops::           The code for internal file operations.
* Using Internal File Ops::     How to use an external extension.


File: gawk.info,  Node: Internal File Description,  Next: Internal File Ops,  Up: Extension Example

16.6.1 Using `chdir()' and `stat()'
-----------------------------------

This minor node shows how to use the new functions at the `awk' level
once they've been integrated into the running `gawk' interpreter.
Using `chdir()' is very straightforward. It takes one argument, the new
directory to change to:

     @load "filefuncs"
     ...
     newdir = "/home/arnold/funstuff"
     ret = chdir(newdir)
     if (ret < 0) {
         printf("could not change to %s: %s\n",
                        newdir, ERRNO) > "/dev/stderr"
         exit 1
     }
     ...

   The return value is negative if the `chdir()' failed, and `ERRNO'
(*note Built-in Variables::) is set to a string indicating the error.

   Using `stat()' is a bit more complicated.  The C `stat()' function
fills in a structure that has a fair amount of information.  The right
way to model this in `awk' is to fill in an associative array with the
appropriate information:

     file = "/home/arnold/.profile"
     ret = stat(file, fdata)
     if (ret < 0) {
         printf("could not stat %s: %s\n",
                  file, ERRNO) > "/dev/stderr"
         exit 1
     }
     printf("size of %s is %d bytes\n", file, fdata["size"])

   The `stat()' function always clears the data array, even if the
`stat()' fails.  It fills in the following elements:

`"name"'
     The name of the file that was `stat()''ed.

`"dev"'
`"ino"'
     The file's device and inode numbers, respectively.

`"mode"'
     The file's mode, as a numeric value. This includes both the file's
     type and its permissions.

`"nlink"'
     The number of hard links (directory entries) the file has.

`"uid"'
`"gid"'
     The numeric user and group ID numbers of the file's owner.

`"size"'
     The size in bytes of the file.

`"blocks"'
     The number of disk blocks the file actually occupies. This may not
     be a function of the file's size if the file has holes.

`"atime"'
`"mtime"'
`"ctime"'
     The file's last access, modification, and inode update times,
     respectively.  These are numeric timestamps, suitable for
     formatting with `strftime()' (*note Time Functions::).

`"pmode"'
     The file's "printable mode."  This is a string representation of
     the file's type and permissions, such as is produced by `ls
     -l'--for example, `"drwxr-xr-x"'.

`"type"'
     A printable string representation of the file's type.  The value
     is one of the following:

    `"blockdev"'
    `"chardev"'
          The file is a block or character device ("special file").

    `"directory"'
          The file is a directory.

    `"fifo"'
          The file is a named-pipe (also known as a FIFO).

    `"file"'
          The file is just a regular file.

    `"socket"'
          The file is an `AF_UNIX' ("Unix domain") socket in the
          filesystem.

    `"symlink"'
          The file is a symbolic link.

`"devbsize"'
     The size of a block for the element indexed by `"blocks"'.  This
     information is derived from either the `DEV_BSIZE' constant
     defined in `<sys/param.h>' on most systems, or the `S_BLKSIZE'
     constant in `<sys/stat.h>' on BSD systems.  For some other
     systems, "a priori" knowledge is used to provide a value. Where no
     value can be determined, it defaults to 512.

   Several additional elements may be present depending upon the
operating system and the type of the file.  You can test for them in
your `awk' program by using the `in' operator (*note Reference to
Elements::):

`"blksize"'
     The preferred block size for I/O to the file. This field is not
     present on all POSIX-like systems in the C `stat' structure.

`"linkval"'
     If the file is a symbolic link, this element is the name of the
     file the link points to (i.e., the value of the link).

`"rdev"'
`"major"'
`"minor"'
     If the file is a block or character device file, then these values
     represent the numeric device number and the major and minor
     components of that number, respectively.


File: gawk.info,  Node: Internal File Ops,  Next: Using Internal File Ops,  Prev: Internal File Description,  Up: Extension Example

16.6.2 C Code for `chdir()' and `stat()'
----------------------------------------

Here is the C code for these extensions.(1)

   The file includes a number of standard header files, and then
includes the `gawkapi.h' header file which provides the API definitions.
Those are followed by the necessary variable declarations to make use
of the API macros and boilerplate code (*note Extension API
Boilerplate::).

     #ifdef HAVE_CONFIG_H
     #include <config.h>
     #endif

     #include <stdio.h>
     #include <assert.h>
     #include <errno.h>
     #include <stdlib.h>
     #include <string.h>
     #include <unistd.h>

     #include <sys/types.h>
     #include <sys/stat.h>

     #include "gawkapi.h"

     #include "gettext.h"
     #define _(msgid)  gettext(msgid)
     #define N_(msgid) msgid

     #include "gawkfts.h"
     #include "stack.h"

     static const gawk_api_t *api;    /* for convenience macros to work */
     static awk_ext_id_t *ext_id;
     static awk_bool_t init_filefuncs(void);
     static awk_bool_t (*init_func)(void) = init_filefuncs;
     static const char *ext_version = "filefuncs extension: version 1.0";

     int plugin_is_GPL_compatible;

   By convention, for an `awk' function `foo()', the C function that
implements it is called `do_foo()'.  The function should have two
arguments: the first is an `int' usually called `nargs', that
represents the number of actual arguments for the function.  The second
is a pointer to an `awk_value_t', usually named `result'.

     /*  do_chdir --- provide dynamically loaded chdir() builtin for gawk */

     static awk_value_t *
     do_chdir(int nargs, awk_value_t *result)
     {
         awk_value_t newdir;
         int ret = -1;

         assert(result != NULL);

         if (do_lint && nargs != 1)
             lintwarn(ext_id,
                      _("chdir: called with incorrect number of arguments, "
                        "expecting 1"));

   The `newdir' variable represents the new directory to change to,
retrieved with `get_argument()'.  Note that the first argument is
numbered zero.

   If the argument is retrieved successfully, the function calls the
`chdir()' system call. If the `chdir()' fails, `ERRNO' is updated.

         if (get_argument(0, AWK_STRING, & newdir)) {
             ret = chdir(newdir.str_value.str);
             if (ret < 0)
                 update_ERRNO_int(errno);
         }

   Finally, the function returns the return value to the `awk' level:

         return make_number(ret, result);
     }

   The `stat()' extension is more involved.  First comes a function
that turns a numeric mode into a printable representation (e.g., 644
becomes `-rw-r--r--'). This is omitted here for brevity:

     /* format_mode --- turn a stat mode field into something readable */

     static char *
     format_mode(unsigned long fmode)
     {
         ...
     }

   Next comes a function for reading symbolic links, which is also
omitted here for brevity:

     /* read_symlink --- read a symbolic link into an allocated buffer.
        ... */

     static char *
     read_symlink(const char *fname, size_t bufsize, ssize_t *linksize)
     {
         ...
     }

   Two helper functions simplify entering values in the array that will
contain the result of the `stat()':

     /* array_set --- set an array element */

     static void
     array_set(awk_array_t array, const char *sub, awk_value_t *value)
     {
         awk_value_t index;

         set_array_element(array,
                           make_const_string(sub, strlen(sub), & index),
                           value);

     }

     /* array_set_numeric --- set an array element with a number */

     static void
     array_set_numeric(awk_array_t array, const char *sub, double num)
     {
         awk_value_t tmp;

         array_set(array, sub, make_number(num, & tmp));
     }

   The following function does most of the work to fill in the
`awk_array_t' result array with values obtained from a valid `struct
stat'. It is done in a separate function to support the `stat()'
function for `gawk' and also to support the `fts()' extension which is
included in the same file but whose code is not shown here (*note
Extension Sample File Functions::).

   The first part of the function is variable declarations, including a
table to map file types to strings:

     /* fill_stat_array --- do the work to fill an array with stat info */

     static int
     fill_stat_array(const char *name, awk_array_t array, struct stat *sbuf)
     {
         char *pmode;    /* printable mode */
         const char *type = "unknown";
         awk_value_t tmp;
         static struct ftype_map {
             unsigned int mask;
             const char *type;
         } ftype_map[] = {
             { S_IFREG, "file" },
             { S_IFBLK, "blockdev" },
             { S_IFCHR, "chardev" },
             { S_IFDIR, "directory" },
     #ifdef S_IFSOCK
             { S_IFSOCK, "socket" },
     #endif
     #ifdef S_IFIFO
             { S_IFIFO, "fifo" },
     #endif
     #ifdef S_IFLNK
             { S_IFLNK, "symlink" },
     #endif
     #ifdef S_IFDOOR /* Solaris weirdness */
             { S_IFDOOR, "door" },
     #endif /* S_IFDOOR */
         };
         int j, k;

   The destination array is cleared, and then code fills in various
elements based on values in the `struct stat':

         /* empty out the array */
         clear_array(array);

         /* fill in the array */
         array_set(array, "name", make_const_string(name, strlen(name),
                                                    & tmp));
         array_set_numeric(array, "dev", sbuf->st_dev);
         array_set_numeric(array, "ino", sbuf->st_ino);
         array_set_numeric(array, "mode", sbuf->st_mode);
         array_set_numeric(array, "nlink", sbuf->st_nlink);
         array_set_numeric(array, "uid", sbuf->st_uid);
         array_set_numeric(array, "gid", sbuf->st_gid);
         array_set_numeric(array, "size", sbuf->st_size);
         array_set_numeric(array, "blocks", sbuf->st_blocks);
         array_set_numeric(array, "atime", sbuf->st_atime);
         array_set_numeric(array, "mtime", sbuf->st_mtime);
         array_set_numeric(array, "ctime", sbuf->st_ctime);

         /* for block and character devices, add rdev,
            major and minor numbers */
         if (S_ISBLK(sbuf->st_mode) || S_ISCHR(sbuf->st_mode)) {
             array_set_numeric(array, "rdev", sbuf->st_rdev);
             array_set_numeric(array, "major", major(sbuf->st_rdev));
             array_set_numeric(array, "minor", minor(sbuf->st_rdev));
         }

The latter part of the function makes selective additions to the
destination array, depending upon the availability of certain members
and/or the type of the file. It then returns zero, for success:

     #ifdef HAVE_STRUCT_STAT_ST_BLKSIZE
         array_set_numeric(array, "blksize", sbuf->st_blksize);
     #endif /* HAVE_STRUCT_STAT_ST_BLKSIZE */

         pmode = format_mode(sbuf->st_mode);
         array_set(array, "pmode", make_const_string(pmode, strlen(pmode),
                                                     & tmp));

         /* for symbolic links, add a linkval field */
         if (S_ISLNK(sbuf->st_mode)) {
             char *buf;
             ssize_t linksize;

             if ((buf = read_symlink(name, sbuf->st_size,
                         & linksize)) != NULL)
                 array_set(array, "linkval",
                           make_malloced_string(buf, linksize, & tmp));
             else
                 warning(ext_id, _("stat: unable to read symbolic link `%s'"),
                         name);
         }

         /* add a type field */
         type = "unknown";   /* shouldn't happen */
         for (j = 0, k = sizeof(ftype_map)/sizeof(ftype_map[0]); j < k; j++) {
             if ((sbuf->st_mode & S_IFMT) == ftype_map[j].mask) {
                 type = ftype_map[j].type;
                 break;
             }
         }

         array_set(array, "type", make_const_string(type, strlen(type), &tmp));

         return 0;
     }

   Finally, here is the `do_stat()' function. It starts with variable
declarations and argument checking:

     /* do_stat --- provide a stat() function for gawk */

     static awk_value_t *
     do_stat(int nargs, awk_value_t *result)
     {
         awk_value_t file_param, array_param;
         char *name;
         awk_array_t array;
         int ret;
         struct stat sbuf;
         /* default is stat() */
         int (*statfunc)(const char *path, struct stat *sbuf) = lstat;

         assert(result != NULL);

         if (nargs != 2 && nargs != 3) {
             if (do_lint)
                 lintwarn(ext_id,
                    _("stat: called with wrong number of arguments"));
             return make_number(-1, result);
         }

   The third argument to `stat()' was not discussed previously. This
argument is optional. If present, it causes `stat()' to use the `stat()'
system call instead of the `lstat()' system call.

   Then comes the actual work. First, the function gets the arguments.
Next, it gets the information for the file.  The code use `lstat()'
(instead of `stat()') to get the file information, in case the file is
a symbolic link.  If there's an error, it sets `ERRNO' and returns:

         /* file is first arg, array to hold results is second */
         if (   ! get_argument(0, AWK_STRING, & file_param)
             || ! get_argument(1, AWK_ARRAY, & array_param)) {
             warning(ext_id, _("stat: bad parameters"));
             return make_number(-1, result);
         }

         if (nargs == 3) {
             statfunc = stat;
         }

         name = file_param.str_value.str;
         array = array_param.array_cookie;

         /* always empty out the array */
         clear_array(array);

         /* stat the file, if error, set ERRNO and return */
         ret = statfunc(name, & sbuf);
         if (ret < 0) {
             update_ERRNO_int(errno);
             return make_number(ret, result);
         }

   The tedious work is done by `fill_stat_array()', shown earlier.
When done, return the result from `fill_stat_array()':

         ret = fill_stat_array(name, array, & sbuf);

         return make_number(ret, result);
     }

   Finally, it's necessary to provide the "glue" that loads the new
function(s) into `gawk'.

   The `filefuncs' extension also provides an `fts()' function, which
we omit here. For its sake there is an initialization function:

     /* init_filefuncs --- initialization routine */

     static awk_bool_t
     init_filefuncs(void)
     {
         ...
     }

   We are almost done. We need an array of `awk_ext_func_t' structures
for loading each function into `gawk':

     static awk_ext_func_t func_table[] = {
         { "chdir", do_chdir, 1 },
         { "stat",  do_stat, 2 },
         { "fts",   do_fts, 3 },
     };

   Each extension must have a routine named `dl_load()' to load
everything that needs to be loaded.  It is simplest to use the
`dl_load_func()' macro in `gawkapi.h':

     /* define the dl_load() function using the boilerplate macro */

     dl_load_func(func_table, filefuncs, "")

   And that's it!  As an exercise, consider adding functions to
implement system calls such as `chown()', `chmod()', and `umask()'.

   ---------- Footnotes ----------

   (1) This version is edited slightly for presentation.  See
`extension/filefuncs.c' in the `gawk' distribution for the complete
version.


File: gawk.info,  Node: Using Internal File Ops,  Prev: Internal File Ops,  Up: Extension Example

16.6.3 Integrating The Extensions
---------------------------------

Now that the code is written, it must be possible to add it at runtime
to the running `gawk' interpreter.  First, the code must be compiled.
Assuming that the functions are in a file named `filefuncs.c', and IDIR
is the location of the `gawkapi.h' header file, the following steps(1)
create a GNU/Linux shared library:

     $ gcc -fPIC -shared -DHAVE_CONFIG_H -c -O -g -IIDIR filefuncs.c
     $ gcc -o filefuncs.so -shared filefuncs.o

   Once the library exists, it is loaded by using the `@load' keyword.

     # file testff.awk
     @load "filefuncs"

     BEGIN {
         "pwd" | getline curdir  # save current directory
         close("pwd")

         chdir("/tmp")
         system("pwd")   # test it
         chdir(curdir)   # go back

         print "Info for testff.awk"
         ret = stat("testff.awk", data)
         print "ret =", ret
         for (i in data)
             printf "data[\"%s\"] = %s\n", i, data[i]
         print "testff.awk modified:",
             strftime("%m %d %y %H:%M:%S", data["mtime"])

         print "\nInfo for JUNK"
         ret = stat("JUNK", data)
         print "ret =", ret
         for (i in data)
             printf "data[\"%s\"] = %s\n", i, data[i]
         print "JUNK modified:", strftime("%m %d %y %H:%M:%S", data["mtime"])
     }

   The `AWKLIBPATH' environment variable tells `gawk' where to find
shared libraries (*note Finding Extensions::).  We set it to the
current directory and run the program:

     $ AWKLIBPATH=$PWD gawk -f testff.awk
     -| /tmp
     -| Info for testff.awk
     -| ret = 0
     -| data["blksize"] = 4096
     -| data["mtime"] = 1350838628
     -| data["mode"] = 33204
     -| data["type"] = file
     -| data["dev"] = 2053
     -| data["gid"] = 1000
     -| data["ino"] = 1719496
     -| data["ctime"] = 1350838628
     -| data["blocks"] = 8
     -| data["nlink"] = 1
     -| data["name"] = testff.awk
     -| data["atime"] = 1350838632
     -| data["pmode"] = -rw-rw-r--
     -| data["size"] = 662
     -| data["uid"] = 1000
     -| testff.awk modified: 10 21 12 18:57:08
     -|
     -| Info for JUNK
     -| ret = -1
     -| JUNK modified: 01 01 70 02:00:00

   ---------- Footnotes ----------

   (1) In practice, you would probably want to use the GNU
Autotools--Automake, Autoconf, Libtool, and Gettext--to configure and
build your libraries. Instructions for doing so are beyond the scope of
this Info file. *Note gawkextlib::, for WWW links to the tools.


File: gawk.info,  Node: Extension Samples,  Next: gawkextlib,  Prev: Extension Example,  Up: Dynamic Extensions

16.7 The Sample Extensions In The `gawk' Distribution
=====================================================

This minor node provides brief overviews of the sample extensions that
come in the `gawk' distribution. Some of them are intended for
production use, such the `filefuncs', `readdir' and `inplace'
extensions.  Others mainly provide example code that shows how to use
the extension API.

* Menu:

* Extension Sample File Functions::   The file functions sample.
* Extension Sample Fnmatch::          An interface to `fnmatch()'.
* Extension Sample Fork::             An interface to `fork()' and other
                                      process functions.
* Extension Sample Inplace::          Enabling in-place file editing.
* Extension Sample Ord::              Character to value to character
                                      conversions.
* Extension Sample Readdir::          An interface to `readdir()'.
* Extension Sample Revout::           Reversing output sample output wrapper.
* Extension Sample Rev2way::          Reversing data sample two-way processor.
* Extension Sample Read write array:: Serializing an array to a file.
* Extension Sample Readfile::         Reading an entire file into a string.
* Extension Sample API Tests::        Tests for the API.
* Extension Sample Time::             An interface to `gettimeofday()'
                                      and `sleep()'.


File: gawk.info,  Node: Extension Sample File Functions,  Next: Extension Sample Fnmatch,  Up: Extension Samples

16.7.1 File Related Functions
-----------------------------

The `filefuncs' extension provides three different functions, as
follows: The usage is:

`@load "filefuncs"'
     This is how you load the extension.

`result = chdir("/some/directory")'
     The `chdir()' function is a direct hook to the `chdir()' system
     call to change the current directory.  It returns zero upon
     success or less than zero upon error.  In the latter case it
     updates `ERRNO'.

`result = stat("/some/path", statdata [, follow])'
     The `stat()' function provides a hook into the `stat()' system
     call.  It returns zero upon success or less than zero upon error.
     In the latter case it updates `ERRNO'.

     By default, it uses the `lstat()' system call.  However, if passed
     a third argument, it uses `stat()' instead.

     In all cases, it clears the `statdata' array.  When the call is
     successful, `stat()' fills the `statdata' array with information
     retrieved from the filesystem, as follows:

     `statdata["name"]' The name of the file.
     `statdata["dev"]'  Corresponds to the `st_dev' field in
                       the `struct stat'.
     `statdata["ino"]'  Corresponds to the `st_ino' field in
                       the `struct stat'.
     `statdata["mode"]' Corresponds to the `st_mode' field in
                       the `struct stat'.
     `statdata["nlink"]' Corresponds to the `st_nlink' field in
                       the `struct stat'.
     `statdata["uid"]'  Corresponds to the `st_uid' field in
                       the `struct stat'.
     `statdata["gid"]'  Corresponds to the `st_gid' field in
                       the `struct stat'.
     `statdata["size"]' Corresponds to the `st_size' field in
                       the `struct stat'.
     `statdata["atime"]' Corresponds to the `st_atime' field in
                       the `struct stat'.
     `statdata["mtime"]' Corresponds to the `st_mtime' field in
                       the `struct stat'.
     `statdata["ctime"]' Corresponds to the `st_ctime' field in
                       the `struct stat'.
     `statdata["rdev"]' Corresponds to the `st_rdev' field in
                       the `struct stat'.  This element is
                       only present for device files.
     `statdata["major"]' Corresponds to the `st_major' field in
                       the `struct stat'.  This element is
                       only present for device files.
     `statdata["minor"]' Corresponds to the `st_minor' field in
                       the `struct stat'.  This element is
                       only present for device files.
     `statdata["blksize"]' Corresponds to the `st_blksize' field
                       in the `struct stat', if this field is
                       present on your system.  (It is present
                       on all modern systems that we know of.)
     `statdata["pmode"]' A human-readable version of the mode
                       value, such as printed by `ls'.  For
                       example, `"-rwxr-xr-x"'.
     `statdata["linkval"]' If the named file is a symbolic link,
                       this element will exist and its value
                       is the value of the symbolic link
                       (where the symbolic link points to).
     `statdata["type"]' The type of the file as a string. One
                       of `"file"', `"blockdev"', `"chardev"',
                       `"directory"', `"socket"', `"fifo"',
                       `"symlink"', `"door"', or `"unknown"'.
                       Not all systems support all file types.

`flags = or(FTS_PHYSICAL, ...)'
`result = fts(pathlist, flags, filedata)'
     Walk the file trees provided in `pathlist' and fill in the
     `filedata' array as described below.  `flags' is the bitwise OR of
     several predefined constant values, also described below.  Return
     zero if there were no errors, otherwise return -1.

   The `fts()' function provides a hook to the C library `fts()'
routines for traversing file hierarchies.  Instead of returning data
about one file at a time in a stream, it fills in a multidimensional
array with data about each file and directory encountered in the
requested hierarchies.

   The arguments are as follows:

`pathlist'
     An array of filenames.  The element values are used; the index
     values are ignored.

`flags'
     This should be the bitwise OR of one or more of the following
     predefined constant flag values.  At least one of `FTS_LOGICAL' or
     `FTS_PHYSICAL' must be provided; otherwise `fts()' returns an
     error value and sets `ERRNO'.  The flags are:

    `FTS_LOGICAL'
          Do a "logical" file traversal, where the information returned
          for a symbolic link refers to the linked-to file, and not to
          the symbolic link itself.  This flag is mutually exclusive
          with `FTS_PHYSICAL'.

    `FTS_PHYSICAL'
          Do a "physical" file traversal, where the information
          returned for a symbolic link refers to the symbolic link
          itself.  This flag is mutually exclusive with `FTS_LOGICAL'.

    `FTS_NOCHDIR'
          As a performance optimization, the C library `fts()' routines
          change directory as they traverse a file hierarchy.  This
          flag disables that optimization.

    `FTS_COMFOLLOW'
          Immediately follow a symbolic link named in `pathlist',
          whether or not `FTS_LOGICAL' is set.

    `FTS_SEEDOT'
          By default, the `fts()' routines do not return entries for
          `.' (dot) and `..' (dot-dot).  This option causes entries for
          dot-dot to also be included.  (The extension always includes
          an entry for dot, see below.)

    `FTS_XDEV'
          During a traversal, do not cross onto a different mounted
          filesystem.

`filedata'
     The `filedata' array is first cleared.  Then, `fts()' creates an
     element in `filedata' for every element in `pathlist'.  The index
     is the name of the directory or file given in `pathlist'.  The
     element for this index is itself an array.  There are two cases.

    _The path is a file_
          In this case, the array contains two or three elements:

         `"path"'
               The full path to this file, starting from the "root"
               that was given in the `pathlist' array.

         `"stat"'
               This element is itself an array, containing the same
               information as provided by the `stat()' function
               described earlier for its `statdata' argument.  The
               element may not be present if the `stat()' system call
               for the file failed.

         `"error"'
               If some kind of error was encountered, the array will
               also contain an element named `"error"', which is a
               string describing the error.

    _The path is a directory_
          In this case, the array contains one element for each entry
          in the directory.  If an entry is a file, that element is as
          for files, just described.  If the entry is a directory, that
          element is (recursively), an array describing the
          subdirectory.  If `FTS_SEEDOT' was provided in the flags,
          then there will also be an element named `".."'.  This
          element will be an array containing the data as provided by
          `stat()'.

          In addition, there will be an element whose index is `"."'.
          This element is an array containing the same two or three
          elements as for a file: `"path"', `"stat"', and `"error"'.

   The `fts()' function returns zero if there were no errors.
Otherwise it returns -1.

     NOTE: The `fts()' extension does not exactly mimic the interface
     of the C library `fts()' routines, choosing instead to provide an
     interface that is based on associative arrays, which should be
     more comfortable to use from an `awk' program.  This includes the
     lack of a comparison function, since `gawk' already provides
     powerful array sorting facilities.  While an `fts_read()'-like
     interface could have been provided, this felt less natural than
     simply creating a multidimensional array to represent the file
     hierarchy and its information.

   See `test/fts.awk' in the `gawk' distribution for an example.


File: gawk.info,  Node: Extension Sample Fnmatch,  Next: Extension Sample Fork,  Prev: Extension Sample File Functions,  Up: Extension Samples

16.7.2 Interface To `fnmatch()'
-------------------------------

This extension provides an interface to the C library `fnmatch()'
function.  The usage is:

     @load "fnmatch"

     result = fnmatch(pattern, string, flags)

   The `fnmatch' extension adds a single function named `fnmatch()',
one constant (`FNM_NOMATCH'), and an array of flag values named `FNM'.

   The arguments to `fnmatch()' are:

`pattern'
     The filename wildcard to match.

`string'
     The filename string.

`flag'
     Either zero, or the bitwise OR of one or more of the flags in the
     `FNM' array.

   The return value is zero on success, `FNM_NOMATCH' if the string did
not match the pattern, or a different non-zero value if an error
occurred.

   The flags are follows:

`FNM["CASEFOLD"]'   Corresponds to the `FNM_CASEFOLD' flag as defined in
                   `fnmatch()'.
`FNM["FILE_NAME"]'  Corresponds to the `FNM_FILE_NAME' flag as defined
                   in `fnmatch()'.
`FNM["LEADING_DIR"]' Corresponds to the `FNM_LEADING_DIR' flag as defined
                   in `fnmatch()'.
`FNM["NOESCAPE"]'   Corresponds to the `FNM_NOESCAPE' flag as defined in
                   `fnmatch()'.
`FNM["PATHNAME"]'   Corresponds to the `FNM_PATHNAME' flag as defined in
                   `fnmatch()'.
`FNM["PERIOD"]'     Corresponds to the `FNM_PERIOD' flag as defined in
                   `fnmatch()'.

   Here is an example:

     @load "fnmatch"
     ...
     flags = or(FNM["PERIOD"], FNM["NOESCAPE"])
     if (fnmatch("*.a", "foo.c", flags) == FNM_NOMATCH)
         print "no match"


File: gawk.info,  Node: Extension Sample Fork,  Next: Extension Sample Inplace,  Prev: Extension Sample Fnmatch,  Up: Extension Samples

16.7.3 Interface To `fork()', `wait()' and `waitpid()'
------------------------------------------------------

The `fork' extension adds three functions, as follows.

`@load "fork"'
     This is how you load the extension.

`pid = fork()'
     This function creates a new process. The return value is the zero
     in the child and the process-id number of the child in the parent,
     or -1 upon error. In the latter case, `ERRNO' indicates the
     problem.  In the child, `PROCINFO["pid"]' and `PROCINFO["ppid"]'
     are updated to reflect the correct values.

`ret = waitpid(pid)'
     This function takes a numeric argument, which is the process-id to
     wait for. The return value is that of the `waitpid()' system call.

`ret = wait()'
     This function waits for the first child to die.  The return value
     is that of the `wait()' system call.

   There is no corresponding `exec()' function.

   Here is an example:

     @load "fork"
     ...
     if ((pid = fork()) == 0)
         print "hello from the child"
     else
         print "hello from the parent"


File: gawk.info,  Node: Extension Sample Inplace,  Next: Extension Sample Ord,  Prev: Extension Sample Fork,  Up: Extension Samples

16.7.4 Enabling In-Place File Editing
-------------------------------------

The `inplace' extension emulates GNU `sed''s `-i' option which performs
"in place" editing of each input file.  It uses the bundled
`inplace.awk' include file to invoke the extension properly:

     # inplace --- load and invoke the inplace extension.

     @load "inplace"

     # Please set INPLACE_SUFFIX to make a backup copy.  For example, you may
     # want to set INPLACE_SUFFIX to .bak on the command line or in a BEGIN rule.

     BEGINFILE {
         inplace_begin(FILENAME, INPLACE_SUFFIX)
     }

     ENDFILE {
         inplace_end(FILENAME, INPLACE_SUFFIX)
     }

   For each regular file that is processed, the extension redirects
standard output to a temporary file configured to have the same owner
and permissions as the original.  After the file has been processed,
the extension restores standard output to its original destination.  If
`INPLACE_SUFFIX' is not an empty string, the original file is linked to
a backup filename created by appending that suffix.  Finally, the
temporary file is renamed to the original filename.

   If any error occurs, the extension issues a fatal error to terminate
processing immediately without damaging the original file.

   Here are some simple examples:

     $ gawk -i inplace '{ gsub(/foo/, "bar") }; { print }' file1 file2 file3

   To keep a backup copy of the original files, try this:

     $ gawk -i inplace -v INPLACE_SUFFIX=.bak '{ gsub(/foo/, "bar") }
     > { print }' file1 file2 file3

   We leave it as an exercise to write a wrapper script that presents an
interface similar to `sed -i'.


File: gawk.info,  Node: Extension Sample Ord,  Next: Extension Sample Readdir,  Prev: Extension Sample Inplace,  Up: Extension Samples

16.7.5 Character and Numeric values: `ord()' and `chr()'
--------------------------------------------------------

The `ordchr' extension adds two functions, named `ord()' and `chr()',
as follows.

`@load "ordchr"'
     This is how you load the extension.

`number = ord(string)'
     Return the numeric value of the first character in `string'.

`char = chr(number)'
     Return a string whose first character is that represented by
     `number'.

   These functions are inspired by the Pascal language functions of the
same name.  Here is an example:

     @load "ordchr"
     ...
     printf("The numeric value of 'A' is %d\n", ord("A"))
     printf("The string value of 65 is %s\n", chr(65))


File: gawk.info,  Node: Extension Sample Readdir,  Next: Extension Sample Revout,  Prev: Extension Sample Ord,  Up: Extension Samples

16.7.6 Reading Directories
--------------------------

The `readdir' extension adds an input parser for directories.  The
usage is as follows:

     @load "readdir"

   When this extension is in use, instead of skipping directories named
on the command line (or with `getline'), they are read, with each entry
returned as a record.

   The record consists of three fields. The first two are the inode
number and the filename, separated by a forward slash character.  On
systems where the directory entry contains the file type, the record
has a third field (also separated by a slash) which is a single letter
indicating the type of the file:

Letter  File Type
-------------------------------------------------------------------------- 
`b'     Block device
`c'     Character device
`d'     Directory
`f'     Regular file
`l'     Symbolic link
`p'     Named pipe (FIFO)
`s'     Socket
`u'     Anything else (unknown)

   On systems without the file type information, the third field is
always `u'.

     NOTE: On GNU/Linux systems, there are filesystems that don't
     support the `d_type' entry (see the readdir(3) manual page), and
     so the file type is always `u'.  You can use the `filefuncs'
     extension to call `stat()' in order to get correct type
     information.

   Here is an example:

     @load "readdir"
     ...
     BEGIN { FS = "/" }
     { print "file name is", $2 }


File: gawk.info,  Node: Extension Sample Revout,  Next: Extension Sample Rev2way,  Prev: Extension Sample Readdir,  Up: Extension Samples

16.7.7 Reversing Output
-----------------------

The `revoutput' extension adds a simple output wrapper that reverses
the characters in each output line.  It's main purpose is to show how to
write an output wrapper, although it may be mildly amusing for the
unwary.  Here is an example:

     @load "revoutput"

     BEGIN {
         REVOUT = 1
         print "hello, world" > "/dev/stdout"
     }

   The output from this program is: `dlrow ,olleh'.


File: gawk.info,  Node: Extension Sample Rev2way,  Next: Extension Sample Read write array,  Prev: Extension Sample Revout,  Up: Extension Samples

16.7.8 Two-Way I/O Example
--------------------------

The `revtwoway' extension adds a simple two-way processor that reverses
the characters in each line sent to it for reading back by the `awk'
program.  It's main purpose is to show how to write a two-way
processor, although it may also be mildly amusing.  The following
example shows how to use it:

     @load "revtwoway"

     BEGIN {
         cmd = "/magic/mirror"
         print "hello, world" |& cmd
         cmd |& getline result
         print result
         close(cmd)
     }


File: gawk.info,  Node: Extension Sample Read write array,  Next: Extension Sample Readfile,  Prev: Extension Sample Rev2way,  Up: Extension Samples

16.7.9 Dumping and Restoring An Array
-------------------------------------

The `rwarray' extension adds two functions, named `writea()' and
`reada()', as follows:

`ret = writea(file, array)'
     This function takes a string argument, which is the name of the
     file to which dump the array, and the array itself as the second
     argument.  `writea()' understands multidimensional arrays.  It
     returns one on success, or zero upon failure.

`ret = reada(file, array)'
     `reada()' is the inverse of `writea()'; it reads the file named as
     its first argument, filling in the array named as the second
     argument. It clears the array first.  Here too, the return value
     is one on success and zero upon failure.

   The array created by `reada()' is identical to that written by
`writea()' in the sense that the contents are the same. However, due to
implementation issues, the array traversal order of the recreated array
is likely to be different from that of the original array.  As array
traversal order in `awk' is by default undefined, this is (technically)
not a problem.  If you need to guarantee a particular traversal order,
use the array sorting features in `gawk' to do so (*note Array
Sorting::).

   The file contains binary data.  All integral values are written in
network byte order.  However, double precision floating-point values
are written as native binary data.  Thus, arrays containing only string
data can theoretically be dumped on systems with one byte order and
restored on systems with a different one, but this has not been tried.

   Here is an example:

     @load "rwarray"
     ...
     ret = writea("arraydump.bin", array)
     ...
     ret = reada("arraydump.bin", array)


File: gawk.info,  Node: Extension Sample Readfile,  Next: Extension Sample API Tests,  Prev: Extension Sample Read write array,  Up: Extension Samples

16.7.10 Reading An Entire File
------------------------------

The `readfile' extension adds a single function named `readfile()':

`@load "readfile"'
     This is how you load the extension.

`result = readfile("/some/path")'
     The argument is the name of the file to read.  The return value is
     a string containing the entire contents of the requested file.
     Upon error, the function returns the empty string and sets `ERRNO'.

   Here is an example:

     @load "readfile"
     ...
     contents = readfile("/path/to/file");
     if (contents == "" && ERRNO != "") {
         print("problem reading file", ERRNO) > "/dev/stderr"
         ...
     }


File: gawk.info,  Node: Extension Sample API Tests,  Next: Extension Sample Time,  Prev: Extension Sample Readfile,  Up: Extension Samples

16.7.11 API Tests
-----------------

The `testext' extension exercises parts of the extension API that are
not tested by the other samples.  The `extension/testext.c' file
contains both the C code for the extension and `awk' test code inside C
comments that run the tests. The testing framework extracts the `awk'
code and runs the tests.  See the source file for more information.


File: gawk.info,  Node: Extension Sample Time,  Prev: Extension Sample API Tests,  Up: Extension Samples

16.7.12 Extension Time Functions
--------------------------------

These functions can be used either by invoking `gawk' with a
command-line argument of `-l time' or by inserting `@load "time"' in
your script.

`@load "time"'
     This is how you load the extension.

`the_time = gettimeofday()'
     Return the time in seconds that has elapsed since 1970-01-01 UTC
     as a floating point value.  If the time is unavailable on this
     platform, return -1 and set `ERRNO'.  The returned time should
     have sub-second precision, but the actual precision may vary based
     on the platform.  If the standard C `gettimeofday()' system call
     is available on this platform, then it simply returns the value.
     Otherwise, if on Windows, it tries to use
     `GetSystemTimeAsFileTime()'.

`result = sleep(SECONDS)'
     Attempt to sleep for SECONDS seconds.  If SECONDS is negative, or
     the attempt to sleep fails, return -1 and set `ERRNO'.  Otherwise,
     return zero after sleeping for the indicated amount of time.  Note
     that SECONDS may be a floating-point (non-integral) value.
     Implementation details: depending on platform availability, this
     function tries to use `nanosleep()' or `select()' to implement the
     delay.


File: gawk.info,  Node: gawkextlib,  Prev: Extension Samples,  Up: Dynamic Extensions

16.8 The `gawkextlib' Project
=============================

The `gawkextlib' (http://sourceforge.net/projects/gawkextlib/) project
provides a number of `gawk' extensions, including one for processing
XML files.  This is the evolution of the original `xgawk' (XML `gawk')
project.

   As of this writing, there are four extensions:

   * XML parser extension, using the Expat
     (http://expat.sourceforge.net) XML parsing library.

   * PostgreSQL extension.

   * GD graphics library extension.

   * MPFR library extension.  This provides access to a number of MPFR
     functions which `gawk''s native MPFR support does not.

   The `time' extension described earlier (*note Extension Sample
Time::) was originally from this project but has been moved in to the
main `gawk' distribution.

   You can check out the code for the `gawkextlib' project using the
GIT (http://git-scm.com) distributed source code control system.  The
command is as follows:

     git clone git://git.code.sf.net/p/gawkextlib/code gawkextlib-code

   You will need to have the Expat (http://expat.sourceforge.net) XML
parser library installed in order to build and use the XML extension.

   In addition, you must have the GNU Autotools installed (Autoconf
(http://www.gnu.org/software/autoconf), Automake
(http://www.gnu.org/software/automake), Libtool
(http://www.gnu.org/software/libtool), and Gettext
(http://www.gnu.org/software/gettext)).

   The simple recipe for building and testing `gawkextlib' is as
follows.  First, build and install `gawk':

     cd .../path/to/gawk/code
     ./configure --prefix=/tmp/newgawk     Install in /tmp/newgawk for now
     make && make check                    Build and check that all is OK
     make install                          Install gawk

   Next, build `gawkextlib' and test it:

     cd .../path/to/gawkextlib-code
     ./update-autotools                    Generate configure, etc.
                                           You may have to run this command twice
     ./configure --with-gawk=/tmp/newgawk  Configure, point at "installed" gawk
     make && make check                    Build and check that all is OK
     make install                          Install the extensions

   If you have installed `gawk' in the standard way, then you will
likely not need the `--with-gawk' option when configuring `gawkextlib'.
You may also need to use the `sudo' utility to install both `gawk' and
`gawkextlib', depending upon how your system works.

   If you write an extension that you wish to share with other `gawk'
users, please consider doing so through the `gawkextlib' project.  See
the project's web site for more information.


File: gawk.info,  Node: Language History,  Next: Installation,  Prev: Dynamic Extensions,  Up: Top

Appendix A The Evolution of the `awk' Language
**********************************************

This Info file describes the GNU implementation of `awk', which follows
the POSIX specification.  Many long-time `awk' users learned `awk'
programming with the original `awk' implementation in Version 7 Unix.
(This implementation was the basis for `awk' in Berkeley Unix, through
4.3-Reno.  Subsequent versions of Berkeley Unix, and some systems
derived from 4.4BSD-Lite, use various versions of `gawk' for their
`awk'.)  This major node briefly describes the evolution of the `awk'
language, with cross-references to other parts of the Info file where
you can find more information.

* Menu:

* V7/SVR3.1::                   The major changes between V7 and System V
                                Release 3.1.
* SVR4::                        Minor changes between System V Releases 3.1
                                and 4.
* POSIX::                       New features from the POSIX standard.
* BTL::                         New features from Brian Kernighan's version of
                                `awk'.
* POSIX/GNU::                   The extensions in `gawk' not in POSIX
                                `awk'.
* Common Extensions::           Common Extensions Summary.
* Ranges and Locales::          How locales used to affect regexp ranges.
* Contributors::                The major contributors to `gawk'.


File: gawk.info,  Node: V7/SVR3.1,  Next: SVR4,  Up: Language History

A.1 Major Changes Between V7 and SVR3.1
=======================================

The `awk' language evolved considerably between the release of Version
7 Unix (1978) and the new version that was first made generally
available in System V Release 3.1 (1987).  This minor node summarizes
the changes, with cross-references to further details:

   * The requirement for `;' to separate rules on a line (*note
     Statements/Lines::).

   * User-defined functions and the `return' statement (*note
     User-defined::).

   * The `delete' statement (*note Delete::).

   * The `do'-`while' statement (*note Do Statement::).

   * The built-in functions `atan2()', `cos()', `sin()', `rand()', and
     `srand()' (*note Numeric Functions::).

   * The built-in functions `gsub()', `sub()', and `match()' (*note
     String Functions::).

   * The built-in functions `close()' and `system()' (*note I/O
     Functions::).

   * The `ARGC', `ARGV', `FNR', `RLENGTH', `RSTART', and `SUBSEP'
     built-in variables (*note Built-in Variables::).

   * Assignable `$0' (*note Changing Fields::).

   * The conditional expression using the ternary operator `?:' (*note
     Conditional Exp::).

   * The expression `INDEX-VARIABLE in ARRAY' outside of `for'
     statements (*note Reference to Elements::).

   * The exponentiation operator `^' (*note Arithmetic Ops::) and its
     assignment operator form `^=' (*note Assignment Ops::).

   * C-compatible operator precedence, which breaks some old `awk'
     programs (*note Precedence::).

   * Regexps as the value of `FS' (*note Field Separators::) and as the
     third argument to the `split()' function (*note String
     Functions::), rather than using only the first character of `FS'.

   * Dynamic regexps as operands of the `~' and `!~' operators (*note
     Regexp Usage::).

   * The escape sequences `\b', `\f', and `\r' (*note Escape
     Sequences::).  (Some vendors have updated their old versions of
     `awk' to recognize `\b', `\f', and `\r', but this is not something
     you can rely on.)

   * Redirection of input for the `getline' function (*note Getline::).

   * Multiple `BEGIN' and `END' rules (*note BEGIN/END::).

   * Multidimensional arrays (*note Multidimensional::).


File: gawk.info,  Node: SVR4,  Next: POSIX,  Prev: V7/SVR3.1,  Up: Language History

A.2 Changes Between SVR3.1 and SVR4
===================================

The System V Release 4 (1989) version of Unix `awk' added these features
(some of which originated in `gawk'):

   * The `ENVIRON' array (*note Built-in Variables::).

   * Multiple `-f' options on the command line (*note Options::).

   * The `-v' option for assigning variables before program execution
     begins (*note Options::).

   * The `--' option for terminating command-line options.

   * The `\a', `\v', and `\x' escape sequences (*note Escape
     Sequences::).

   * A defined return value for the `srand()' built-in function (*note
     Numeric Functions::).

   * The `toupper()' and `tolower()' built-in string functions for case
     translation (*note String Functions::).

   * A cleaner specification for the `%c' format-control letter in the
     `printf' function (*note Control Letters::).

   * The ability to dynamically pass the field width and precision
     (`"%*.*d"') in the argument list of the `printf' function (*note
     Control Letters::).

   * The use of regexp constants, such as `/foo/', as expressions, where
     they are equivalent to using the matching operator, as in `$0 ~
     /foo/' (*note Using Constant Regexps::).

   * Processing of escape sequences inside command-line variable
     assignments (*note Assignment Options::).


File: gawk.info,  Node: POSIX,  Next: BTL,  Prev: SVR4,  Up: Language History

A.3 Changes Between SVR4 and POSIX `awk'
========================================

The POSIX Command Language and Utilities standard for `awk' (1992)
introduced the following changes into the language:

   * The use of `-W' for implementation-specific options (*note
     Options::).

   * The use of `CONVFMT' for controlling the conversion of numbers to
     strings (*note Conversion::).

   * The concept of a numeric string and tighter comparison rules to go
     with it (*note Typing and Comparison::).

   * The use of built-in variables as function parameter names is
     forbidden (*note Definition Syntax::.

   * More complete documentation of many of the previously undocumented
     features of the language.

   In 2012, a number of extensions that had been commonly available for
many years were finally added to POSIX. They are:

   * The `fflush()' built-in function for flushing buffered output
     (*note I/O Functions::).

   * The `nextfile' statement (*note Nextfile Statement::).

   * The ability to delete all of an array at once with `delete ARRAY'
     (*note Delete::).


   *Note Common Extensions::, for a list of common extensions not
permitted by the POSIX standard.

   The 2008 POSIX standard can be found online at
`http://www.opengroup.org/onlinepubs/9699919799/'.


File: gawk.info,  Node: BTL,  Next: POSIX/GNU,  Prev: POSIX,  Up: Language History

A.4 Extensions in Brian Kernighan's `awk'
=========================================

Brian Kernighan has made his version available via his home page (*note
Other Versions::).

   This minor node describes common extensions that originally appeared
in his version of `awk'.

   * The `**' and `**=' operators (*note Arithmetic Ops:: and *note
     Assignment Ops::).

   * The use of `func' as an abbreviation for `function' (*note
     Definition Syntax::).

   * The `fflush()' built-in function for flushing buffered output
     (*note I/O Functions::).


   *Note Common Extensions::, for a full list of the extensions
available in his `awk'.


File: gawk.info,  Node: POSIX/GNU,  Next: Common Extensions,  Prev: BTL,  Up: Language History

A.5 Extensions in `gawk' Not in POSIX `awk'
===========================================

The GNU implementation, `gawk', adds a large number of features.  They
can all be disabled with either the `--traditional' or `--posix' options
(*note Options::).

   A number of features have come and gone over the years. This minor
node summarizes the additional features over POSIX `awk' that are in
the current version of `gawk'.

   * Additional built-in variables:

        - The `ARGIND' `BINMODE', `ERRNO', `FIELDWIDTHS', `FPAT',
          `IGNORECASE', `LINT', `PROCINFO', `RT', and `TEXTDOMAIN'
          variables (*note Built-in Variables::).

   * Special files in I/O redirections:

        - The `/dev/stdin', `/dev/stdout', `/dev/stderr' and
          `/dev/fd/N' special file names (*note Special Files::).

        - The `/inet', `/inet4', and `/inet6' special files for TCP/IP
          networking using `|&' to specify which version of the IP
          protocol to use.  (*note TCP/IP Networking::).

   * Changes and/or additions to the language:

        - The `\x' escape sequence (*note Escape Sequences::).

        - Full support for both POSIX and GNU regexps (*note Regexp::).

        - The ability for `FS' and for the third argument to `split()'
          to be null strings (*note Single Character Fields::).

        - The ability for `RS' to be a regexp (*note Records::).

        - The ability to use octal and hexadecimal constants in `awk'
          program source code (*note Nondecimal-numbers::).

        - The `|&' operator for two-way I/O to a coprocess (*note
          Two-way I/O::).

        - Indirect function calls (*note Indirect Calls::).

        - Directories on the command line produce a warning and are
          skipped (*note Command line directories::).

   * New keywords:

        - The `BEGINFILE' and `ENDFILE' special patterns.  (*note
          BEGINFILE/ENDFILE::).

        - The ability to delete all of an array at once with `delete
          ARRAY' (*note Delete::).

        - The `nextfile' statement (*note Nextfile Statement::).

        - The `switch' statement (*note Switch Statement::).

   * Changes to standard `awk' functions:

        - The optional second argument to `close()' that allows closing
          one end of a two-way pipe to a coprocess (*note Two-way
          I/O::).

        - POSIX compliance for `gsub()' and `sub()'.

        - The `length()' function accepts an array argument and returns
          the number of elements in the array (*note String
          Functions::).

        - The optional third argument to the `match()' function for
          capturing text-matching subexpressions within a regexp (*note
          String Functions::).

        - Positional specifiers in `printf' formats for making
          translations easier (*note Printf Ordering::).

        - The `split()' function's additional optional fourth argument
          which is an array to hold the text of the field separators.
          (*note String Functions::).

   * Additional functions only in `gawk':

        - The `and()', `compl()', `lshift()', `or()', `rshift()', and
          `xor()' functions for bit manipulation (*note Bitwise
          Functions::).

        - The `asort()' and `asorti()' functions for sorting arrays
          (*note Array Sorting::).

        - The `bindtextdomain()', `dcgettext()' and `dcngettext()'
          functions for internationalization (*note Programmer i18n::).

        - The `fflush()' function from Brian Kernighan's version of
          `awk' (*note I/O Functions::).

        - The `gensub()', `patsplit()', and `strtonum()' functions for
          more powerful text manipulation (*note String Functions::).

        - The `mktime()', `systime()', and `strftime()' functions for
          working with timestamps (*note Time Functions::).

   * Changes and/or additions in the command-line options:

        - The `AWKPATH' environment variable for specifying a path
          search for the `-f' command-line option (*note Options::).

        - The `AWKLIBPATH' environment variable for specifying a path
          search for the `-l' command-line option (*note Options::).

        - The `-b', `-c', `-C', `-d', `-D', `-e', `-E', `-g', `-h',
          `-i', `-l', `-L', `-M', `-n', `-N', `-o', `-O', `-p', `-P',
          `-r', `-S', `-t', and `-V' short options. Also, the ability
          to use GNU-style long-named options that start with `--' and
          the `--assign', `--bignum', `--characters-as-bytes',
          `--copyright', `--debug', `--dump-variables', `--execle',
          `--field-separator', `--file', `--gen-pot', `--help',
          `--include', `--lint', `--lint-old', `--load',
          `--non-decimal-data', `--optimize', `--posix',
          `--pretty-print', `--profile', `--re-interval', `--sandbox',
          `--source', `--traditional', `--use-lc-numeric', and
          `--version' long options (*note Options::).

   * Support for the following obsolete systems was removed from the
     code and the documentation for `gawk' version 4.0:

        - Amiga

        - Atari

        - BeOS

        - Cray

        - MIPS RiscOS

        - MS-DOS with the Microsoft Compiler

        - MS-Windows with the Microsoft Compiler

        - NeXT

        - SunOS 3.x, Sun 386 (Road Runner)

        - Tandem (non-POSIX)

        - Prestandard VAX C compiler for VAX/VMS




File: gawk.info,  Node: Common Extensions,  Next: Ranges and Locales,  Prev: POSIX/GNU,  Up: Language History

A.6 Common Extensions Summary
=============================

This minor node summarizes the common extensions supported by `gawk',
Brian Kernighan's `awk', and `mawk', the three most widely-used freely
available versions of `awk' (*note Other Versions::).

Feature                      BWK Awk   Mawk   GNU Awk
-------------------------------------------------------- 
`\x' Escape sequence         X         X      X
`RS' as regexp                         X      X
`FS' as null string          X         X      X
`/dev/stdin' special file    X                X
`/dev/stdout' special file   X         X      X
`/dev/stderr' special file   X         X      X
`**' and `**=' operators     X                X
`fflush()' function          X         X      X
`func' keyword               X                X
`nextfile' statement         X         X      X
`delete' without subscript   X         X      X
`length()' of an array       X                X
`BINMODE' variable                     X      X
Time related functions                 X      X

   (Technically speaking, as of late 2012, `fflush()', `delete ARRAY',
and `nextfile' are no longer extensions, since they have been added to
POSIX.)


File: gawk.info,  Node: Ranges and Locales,  Next: Contributors,  Prev: Common Extensions,  Up: Language History

A.7 Regexp Ranges and Locales: A Long Sad Story
===============================================

This minor node describes the confusing history of ranges within
regular expressions and their interactions with locales, and how this
affected different versions of `gawk'.

   The original Unix tools that worked with regular expressions defined
character ranges (such as `[a-z]') to match any character between the
first character in the range and the last character in the range,
inclusive.  Ordering was based on the numeric value of each character
in the machine's native character set.  Thus, on ASCII-based systems,
`[a-z]' matched all the lowercase letters, and only the lowercase
letters, since the numeric values for the letters from `a' through `z'
were contiguous.  (On an EBCDIC system, the range `[a-z]' includes
additional, non-alphabetic characters as well.)

   Almost all introductory Unix literature explained range expressions
as working in this fashion, and in particular, would teach that the
"correct" way to match lowercase letters was with `[a-z]', and that
`[A-Z]' was the "correct" way to match uppercase letters.  And indeed,
this was true.(1)

   The 1993 POSIX standard introduced the idea of locales (*note
Locales::).  Since many locales include other letters besides the plain
twenty-six letters of the American English alphabet, the POSIX standard
added character classes (*note Bracket Expressions::) as a way to match
different kinds of characters besides the traditional ones in the ASCII
character set.

   However, the standard _changed_ the interpretation of range
expressions.  In the `"C"' and `"POSIX"' locales, a range expression
like `[a-dx-z]' is still equivalent to `[abcdxyz]', as in ASCII.  But
outside those locales, the ordering was defined to be based on
"collation order".

   In many locales, `A' and `a' are both less than `B'.  In other
words, these locales sort characters in dictionary order, and
`[a-dx-z]' is typically not equivalent to `[abcdxyz]'; instead it might
be equivalent to `[ABCXYabcdxyz]', for example.

   This point needs to be emphasized: Much literature teaches that you
should use `[a-z]' to match a lowercase character.  But on systems with
non-ASCII locales, this also matched all of the uppercase characters
except `A' or `Z'!  This was a continuous cause of confusion, even well
into the twenty-first century.

   To demonstrate these issues, the following example uses the `sub()'
function, which does text replacement (*note String Functions::).  Here,
the intent is to remove trailing uppercase characters:

     $ echo something1234abc | gawk-3.1.8 '{ sub("[A-Z]*$", ""); print }'
     -| something1234a

This output is unexpected, since the `bc' at the end of
`something1234abc' should not normally match `[A-Z]*'.  This result is
due to the locale setting (and thus you may not see it on your system).

   Similar considerations apply to other ranges.  For example, `["-/]'
is perfectly valid in ASCII, but is not valid in many Unicode locales,
such as `en_US.UTF-8'.

   Early versions of `gawk' used regexp matching code that was not
locale aware, so ranges had their traditional interpretation.

   When `gawk' switched to using locale-aware regexp matchers, the
problems began; especially as both GNU/Linux and commercial Unix
vendors started implementing non-ASCII locales, _and making them the
default_.  Perhaps the most frequently asked question became something
like "why does `[A-Z]' match lowercase letters?!?"

   This situation existed for close to 10 years, if not more, and the
`gawk' maintainer grew weary of trying to explain that `gawk' was being
nicely standards-compliant, and that the issue was in the user's
locale.  During the development of version 4.0, he modified `gawk' to
always treat ranges in the original, pre-POSIX fashion, unless
`--posix' was used (*note Options::).(2)

   Fortunately, shortly before the final release of `gawk' 4.0, the
maintainer learned that the 2008 standard had changed the definition of
ranges, such that outside the `"C"' and `"POSIX"' locales, the meaning
of range expressions was _undefined_.(3)

   By using this lovely technical term, the standard gives license to
implementors to implement ranges in whatever way they choose.  The
`gawk' maintainer chose to apply the pre-POSIX meaning in all cases:
the default regexp matching; with `--traditional', and with `--posix';
in all cases, `gawk' remains POSIX compliant.

   ---------- Footnotes ----------

   (1) And Life was good.

   (2) And thus was born the Campain for Rational Range Interpretation
(or RRI). A number of GNU tools, such as `grep' and `sed', have either
implemented this change, or will soon.  Thanks to Karl Berry for
coining the phrase "Rational Range Interpretation."

   (3) See the standard
(http://pubs.opengroup.org/onlinepubs/9699919799/basedefs/V1_chap09.html#tag_09_03_05)
and its rationale
(http://pubs.opengroup.org/onlinepubs/9699919799/xrat/V4_xbd_chap09.html#tag_21_09_03_05).


File: gawk.info,  Node: Contributors,  Prev: Ranges and Locales,  Up: Language History

A.8 Major Contributors to `gawk'
================================

     Always give credit where credit is due.  -- Anonymous

   This minor node names the major contributors to `gawk' and/or this
Info file, in approximate chronological order:

   * Dr. Alfred V. Aho, Dr. Peter J. Weinberger, and Dr. Brian W.
     Kernighan, all of Bell Laboratories, designed and implemented Unix
     `awk', from which `gawk' gets the majority of its feature set.

   * Paul Rubin did the initial design and implementation in 1986, and
     wrote the first draft (around 40 pages) of this Info file.

   * Jay Fenlason finished the initial implementation.

   * Diane Close revised the first draft of this Info file, bringing it
     to around 90 pages.

   * Richard Stallman helped finish the implementation and the initial
     draft of this Info file.  He is also the founder of the FSF and
     the GNU project.

   * John Woods contributed parts of the code (mostly fixes) in the
     initial version of `gawk'.

   * In 1988, David Trueman took over primary maintenance of `gawk',
     making it compatible with "new" `awk', and greatly improving its
     performance.

   * Conrad Kwok, Scott Garfinkle, and Kent Williams did the initial
     ports to MS-DOS with various versions of MSC.

   * Pat Rankin provided the VMS port and its documentation.

   * Hal Peterson provided help in porting `gawk' to Cray systems.
     (This is no longer supported.)

   * Kai Uwe Rommel provided the initial port to OS/2 and its
     documentation.

   * Michal Jaegermann provided the port to Atari systems and its
     documentation.  (This port is no longer supported.)  He continues
     to provide portability checking with DEC Alpha systems, and has
     done a lot of work to make sure `gawk' works on non-32-bit systems.

   * Fred Fish provided the port to Amiga systems and its documentation.
     (With Fred's sad passing, this is no longer supported.)

   * Scott Deifik currently maintains the MS-DOS port using DJGPP.

   * Eli Zaretskii currently maintains the MS-Windows port using MinGW.

   * Juan Grigera provided a port to Windows32 systems.  (This is no
     longer supported.)

   * For many years, Dr. Darrel Hankerson acted as coordinator for the
     various ports to different PC platforms and created binary
     distributions for various PC operating systems.  He was also
     instrumental in keeping the documentation up to date for the
     various PC platforms.

   * Christos Zoulas provided the `extension()' built-in function for
     dynamically adding new modules.  (This was obsoleted at `gawk'
     4.1.)

   * Ju"rgen Kahrs contributed the initial version of the TCP/IP
     networking code and documentation, and motivated the inclusion of
     the `|&' operator.

   * Stephen Davies provided the initial port to Tandem systems and its
     documentation.  (However, this is no longer supported.)  He was
     also instrumental in the initial work to integrate the byte-code
     internals into the `gawk' code base.

   * Matthew Woehlke provided improvements for Tandem's POSIX-compliant
     systems.

   * Martin Brown provided the port to BeOS and its documentation.
     (This is no longer supported.)

   * Arno Peters did the initial work to convert `gawk' to use GNU
     Automake and GNU `gettext'.

   * Alan J. Broder provided the initial version of the `asort()'
     function as well as the code for the optional third argument to the
     `match()' function.

   * Andreas Buening updated the `gawk' port for OS/2.

   * Isamu Hasegawa, of IBM in Japan, contributed support for multibyte
     characters.

   * Michael Benzinger contributed the initial code for `switch'
     statements.

   * Patrick T.J. McPhee contributed the code for dynamic loading in
     Windows32 environments.  (This is no longer supported)

   * John Haque made the following contributions:

        - The modifications to convert `gawk' into a byte-code
          interpreter, including the debugger.

        - The addition of true multidimensional arrays.  *note Arrays
          of Arrays::.

        - The additional modifications for support of arbitrary
          precision arithmetic.

        - The initial text of *note Arbitrary Precision Arithmetic::.

        - The work to merge the three versions of `gawk' into one, for
          the 4.1 release.

        - Improved array internals for arrays indexed by integers.

        - The improved array sorting features were driven by John
          together with Pat Rankin.

   * Efraim Yawitz contributed the original text for *note Debugger::.

   * The development of the extension API first released with `gawk'
     4.1 was driven primarily by Arnold Robbins and Andrew Schorr, with
     notable contributions from the rest of the development team.

   * Arnold Robbins has been working on `gawk' since 1988, at first
     helping David Trueman, and as the primary maintainer since around
     1994.


File: gawk.info,  Node: Installation,  Next: Notes,  Prev: Language History,  Up: Top

Appendix B Installing `gawk'
****************************

This appendix provides instructions for installing `gawk' on the
various platforms that are supported by the developers.  The primary
developer supports GNU/Linux (and Unix), whereas the other ports are
contributed.  *Note Bugs::, for the electronic mail addresses of the
people who did the respective ports.

* Menu:

* Gawk Distribution::           What is in the `gawk' distribution.
* Unix Installation::           Installing `gawk' under various
                                versions of Unix.
* Non-Unix Installation::       Installation on Other Operating Systems.
* Bugs::                        Reporting Problems and Bugs.
* Other Versions::              Other freely available `awk'
                                implementations.


File: gawk.info,  Node: Gawk Distribution,  Next: Unix Installation,  Up: Installation

B.1 The `gawk' Distribution
===========================

This minor node describes how to get the `gawk' distribution, how to
extract it, and then what is in the various files and subdirectories.

* Menu:

* Getting::                     How to get the distribution.
* Extracting::                  How to extract the distribution.
* Distribution contents::       What is in the distribution.


File: gawk.info,  Node: Getting,  Next: Extracting,  Up: Gawk Distribution

B.1.1 Getting the `gawk' Distribution
-------------------------------------

There are three ways to get GNU software:

   * Copy it from someone else who already has it.

   * Retrieve `gawk' from the Internet host `ftp.gnu.org', in the
     directory `/gnu/gawk'.  Both anonymous `ftp' and `http' access are
     supported.  If you have the `wget' program, you can use a command
     like the following:

          wget http://ftp.gnu.org/gnu/gawk/gawk-4.1.0.tar.gz

   The GNU software archive is mirrored around the world.  The
up-to-date list of mirror sites is available from the main FSF web site
(http://www.gnu.org/order/ftp.html).  Try to use one of the mirrors;
they will be less busy, and you can usually find one closer to your
site.


File: gawk.info,  Node: Extracting,  Next: Distribution contents,  Prev: Getting,  Up: Gawk Distribution

B.1.2 Extracting the Distribution
---------------------------------

`gawk' is distributed as several `tar' files compressed with different
compression programs: `gzip', `bzip2', and `xz'. For simplicity, the
rest of these instructions assume you are using the one compressed with
the GNU Zip program, `gzip'.

   Once you have the distribution (for example, `gawk-4.1.0.tar.gz'),
use `gzip' to expand the file and then use `tar' to extract it.  You
can use the following pipeline to produce the `gawk' distribution:

     # Under System V, add 'o' to the tar options
     gzip -d -c gawk-4.1.0.tar.gz | tar -xvpf -

   On a system with GNU `tar', you can let `tar' do the decompression
for you:

     tar -xvpzf gawk-4.1.0.tar.gz

Extracting the archive creates a directory named `gawk-4.1.0' in the
current directory.

   The distribution file name is of the form `gawk-V.R.P.tar.gz'.  The
V represents the major version of `gawk', the R represents the current
release of version V, and the P represents a "patch level", meaning
that minor bugs have been fixed in the release.  The current patch
level is 0, but when retrieving distributions, you should get the
version with the highest version, release, and patch level.  (Note,
however, that patch levels greater than or equal to 70 denote "beta" or
nonproduction software; you might not want to retrieve such a version
unless you don't mind experimenting.)  If you are not on a Unix or
GNU/Linux system, you need to make other arrangements for getting and
extracting the `gawk' distribution.  You should consult a local expert.


File: gawk.info,  Node: Distribution contents,  Prev: Extracting,  Up: Gawk Distribution

B.1.3 Contents of the `gawk' Distribution
-----------------------------------------

The `gawk' distribution has a number of C source files, documentation
files, subdirectories, and files related to the configuration process
(*note Unix Installation::), as well as several subdirectories related
to different non-Unix operating systems:

Various `.c', `.y', and `.h' files
     The actual `gawk' source code.

`ABOUT-NLS'
     Information about GNU `gettext' and translations.

`AUTHORS'
     A file with some information about the authorship of `gawk'.  It
     exists only to satisfy the pedants at the Free Software Foundation.

`README'
`README_d/README.*'
     Descriptive files: `README' for `gawk' under Unix and the rest for
     the various hardware and software combinations.

`INSTALL'
     A file providing an overview of the configuration and installation
     process.

`ChangeLog'
     A detailed list of source code changes as bugs are fixed or
     improvements made.

`ChangeLog.0'
     An older list of source code changes.

`NEWS'
     A list of changes to `gawk' since the last release or patch.

`NEWS.0'
     An older list of changes to `gawk'.

`COPYING'
     The GNU General Public License.

`POSIX.STD'
     A description of behaviors in the POSIX standard for `awk' which
     are left undefined, or where `gawk' may not comply fully, as well
     as a list of things that the POSIX standard should describe but
     does not.

`doc/awkforai.txt'
     Pointers to the original draft of a short article describing why
     `gawk' is a good language for Artificial Intelligence (AI)
     programming.

`doc/bc_notes'
     A brief description of `gawk''s "byte code" internals.

`doc/README.card'
`doc/ad.block'
`doc/awkcard.in'
`doc/cardfonts'
`doc/colors'
`doc/macros'
`doc/no.colors'
`doc/setter.outline'
     The `troff' source for a five-color `awk' reference card.  A
     modern version of `troff' such as GNU `troff' (`groff') is needed
     to produce the color version. See the file `README.card' for
     instructions if you have an older `troff'.

`doc/gawk.1'
     The `troff' source for a manual page describing `gawk'.  This is
     distributed for the convenience of Unix users.

`doc/gawktexi.in'
`doc/sidebar.awk'
     The Texinfo source file for this Info file.  It should be
     processed by `doc/sidebar.awk' before processing with `texi2dvi'
     or `texi2pdf' to produce a printed document, and with `makeinfo'
     to produce an Info or HTML file.  The `Makefile' takes care of
     this processing and produces printable output via `texi2dvi' or
     `texi2pdf'.

`doc/gawk.texi'
     The file produced after processing `gawktexi.in' with
     `sidebar.awk'.

`doc/gawk.info'
     The generated Info file for this Info file.

`doc/gawkinet.texi'
     The Texinfo source file for *note (General Introduction)Top::
     gawkinet, TCP/IP Internetworking with `gawk'.  It should be
     processed with TeX (via `texi2dvi' or `texi2pdf') to produce a
     printed document and with `makeinfo' to produce an Info or HTML
     file.

`doc/gawkinet.info'
     The generated Info file for `TCP/IP Internetworking with `gawk''.

`doc/igawk.1'
     The `troff' source for a manual page describing the `igawk'
     program presented in *note Igawk Program::.

`doc/Makefile.in'
     The input file used during the configuration process to generate
     the actual `Makefile' for creating the documentation.

`Makefile.am'
`*/Makefile.am'
     Files used by the GNU `automake' software for generating the
     `Makefile.in' files used by `autoconf' and `configure'.

`Makefile.in'
`aclocal.m4'
`bisonfix.awk'
`config.guess'
`configh.in'
`configure.ac'
`configure'
`custom.h'
`depcomp'
`install-sh'
`missing_d/*'
`mkinstalldirs'
`m4/*'
     These files and subdirectories are used when configuring and
     compiling `gawk' for various Unix systems.  Most of them are
     explained in *note Unix Installation::. The rest are there to
     support the main infrastructure.

`po/*'
     The `po' library contains message translations.

`awklib/extract.awk'
`awklib/Makefile.am'
`awklib/Makefile.in'
`awklib/eg/*'
     The `awklib' directory contains a copy of `extract.awk' (*note
     Extract Program::), which can be used to extract the sample
     programs from the Texinfo source file for this Info file. It also
     contains a `Makefile.in' file, which `configure' uses to generate
     a `Makefile'.  `Makefile.am' is used by GNU Automake to create
     `Makefile.in'.  The library functions from *note Library
     Functions::, and the `igawk' program from *note Igawk Program::,
     are included as ready-to-use files in the `gawk' distribution.
     They are installed as part of the installation process.  The rest
     of the programs in this Info file are available in appropriate
     subdirectories of `awklib/eg'.

`posix/*'
     Files needed for building `gawk' on POSIX-compliant systems.

`pc/*'
     Files needed for building `gawk' under MS-Windows and OS/2 (*note
     PC Installation::, for details).

`vms/*'
     Files needed for building `gawk' under VMS (*note VMS
     Installation::, for details).

`test/*'
     A test suite for `gawk'.  You can use `make check' from the
     top-level `gawk' directory to run your version of `gawk' against
     the test suite.  If `gawk' successfully passes `make check', then
     you can be confident of a successful port.


File: gawk.info,  Node: Unix Installation,  Next: Non-Unix Installation,  Prev: Gawk Distribution,  Up: Installation

B.2 Compiling and Installing `gawk' on Unix-like Systems
========================================================

Usually, you can compile and install `gawk' by typing only two
commands.  However, if you use an unusual system, you may need to
configure `gawk' for your system yourself.

* Menu:

* Quick Installation::               Compiling `gawk' under Unix.
* Additional Configuration Options:: Other compile-time options.
* Configuration Philosophy::         How it's all supposed to work.


File: gawk.info,  Node: Quick Installation,  Next: Additional Configuration Options,  Up: Unix Installation

B.2.1 Compiling `gawk' for Unix-like Systems
--------------------------------------------

The normal installation steps should work on all modern commercial
Unix-derived systems, GNU/Linux, BSD-based systems, and the Cygwin
environment for MS-Windows.

   After you have extracted the `gawk' distribution, `cd' to
`gawk-4.1.0'.  Like most GNU software, `gawk' is configured
automatically for your system by running the `configure' program.  This
program is a Bourne shell script that is generated automatically using
GNU `autoconf'.  (The `autoconf' software is described fully starting
with *note (Autoconf)Top:: autoconf,Autoconf--Generating Automatic
Configuration Scripts.)

   To configure `gawk', simply run `configure':

     sh ./configure

   This produces a `Makefile' and `config.h' tailored to your system.
The `config.h' file describes various facts about your system.  You
might want to edit the `Makefile' to change the `CFLAGS' variable,
which controls the command-line options that are passed to the C
compiler (such as optimization levels or compiling for debugging).

   Alternatively, you can add your own values for most `make' variables
on the command line, such as `CC' and `CFLAGS', when running
`configure':

     CC=cc CFLAGS=-g sh ./configure

See the file `INSTALL' in the `gawk' distribution for all the details.

   After you have run `configure' and possibly edited the `Makefile',
type:

     make

Shortly thereafter, you should have an executable version of `gawk'.
That's all there is to it!  To verify that `gawk' is working properly,
run `make check'.  All of the tests should succeed.  If these steps do
not work, or if any of the tests fail, check the files in the
`README_d' directory to see if you've found a known problem.  If the
failure is not described there, please send in a bug report (*note
Bugs::).

   Of course, once you've built `gawk', it is likely that you will wish
to install it.  To do so, you need to run the command `make check', as
a user with the appropriate permissions.  How to do this varies by
system, but on many systems you can use the `sudo' command to do so.
The command then becomes `sudo make install'. It is likely that you
will be asked for your password, and you will have to have been set up
previously as a user who is allowed to run the `sudo' command.


File: gawk.info,  Node: Additional Configuration Options,  Next: Configuration Philosophy,  Prev: Quick Installation,  Up: Unix Installation

B.2.2 Additional Configuration Options
--------------------------------------

There are several additional options you may use on the `configure'
command line when compiling `gawk' from scratch, including:

`--disable-extensions'
     Disable configuring and building the sample extensions in the
     `extension' directory. This is useful for cross-compiling.  The
     default action is to dynamically check if the extensions can be
     configured and compiled.

`--disable-lint'
     Disable all lint checking within `gawk'.  The `--lint' and
     `--lint-old' options (*note Options::) are accepted, but silently
     do nothing.  Similarly, setting the `LINT' variable (*note
     User-modified::) has no effect on the running `awk' program.

     When used with GCC's automatic dead-code-elimination, this option
     cuts almost 200K bytes off the size of the `gawk' executable on
     GNU/Linux x86 systems.  Results on other systems and with other
     compilers are likely to vary.  Using this option may bring you
     some slight performance improvement.

     Using this option will cause some of the tests in the test suite
     to fail.  This option may be removed at a later date.

`--disable-nls'
     Disable all message-translation facilities.  This is usually not
     desirable, but it may bring you some slight performance
     improvement.

`--with-whiny-user-strftime'
     Force use of the included version of the `strftime()' function for
     deficient systems.

   Use the command `./configure --help' to see the full list of options
that `configure' supplies.


File: gawk.info,  Node: Configuration Philosophy,  Prev: Additional Configuration Options,  Up: Unix Installation

B.2.3 The Configuration Process
-------------------------------

This minor node is of interest only if you know something about using
the C language and Unix-like operating systems.

   The source code for `gawk' generally attempts to adhere to formal
standards wherever possible.  This means that `gawk' uses library
routines that are specified by the ISO C standard and by the POSIX
operating system interface standard.  The `gawk' source code requires
using an ISO C compiler (the 1990 standard).

   Many Unix systems do not support all of either the ISO or the POSIX
standards.  The `missing_d' subdirectory in the `gawk' distribution
contains replacement versions of those functions that are most likely
to be missing.

   The `config.h' file that `configure' creates contains definitions
that describe features of the particular operating system where you are
attempting to compile `gawk'.  The three things described by this file
are: what header files are available, so that they can be correctly
included, what (supposedly) standard functions are actually available
in your C libraries, and various miscellaneous facts about your
operating system.  For example, there may not be an `st_blksize'
element in the `stat' structure.  In this case,
`HAVE_STRUCT_STAT_ST_BLKSIZE' is undefined.

   It is possible for your C compiler to lie to `configure'. It may do
so by not exiting with an error when a library function is not
available.  To get around this, edit the file `custom.h'.  Use an
`#ifdef' that is appropriate for your system, and either `#define' any
constants that `configure' should have defined but didn't, or `#undef'
any constants that `configure' defined and should not have.  `custom.h'
is automatically included by `config.h'.

   It is also possible that the `configure' program generated by
`autoconf' will not work on your system in some other fashion.  If you
do have a problem, the file `configure.ac' is the input for `autoconf'.
You may be able to change this file and generate a new version of
`configure' that works on your system (*note Bugs::, for information on
how to report problems in configuring `gawk').  The same mechanism may
be used to send in updates to `configure.ac' and/or `custom.h'.


File: gawk.info,  Node: Non-Unix Installation,  Next: Bugs,  Prev: Unix Installation,  Up: Installation

B.3 Installation on Other Operating Systems
===========================================

This minor node describes how to install `gawk' on various non-Unix
systems.

* Menu:

* PC Installation::             Installing and Compiling `gawk' on
                                MS-DOS and OS/2.
* VMS Installation::            Installing `gawk' on VMS.


File: gawk.info,  Node: PC Installation,  Next: VMS Installation,  Up: Non-Unix Installation

B.3.1 Installation on PC Operating Systems
------------------------------------------

This minor node covers installation and usage of `gawk' on x86 machines
running MS-DOS, any version of MS-Windows, or OS/2.  In this minor
node, the term "Windows32" refers to any of Microsoft
Windows-95/98/ME/NT/2000/XP/Vista/7.

   The limitations of MS-DOS (and MS-DOS shells under Windows32 or
OS/2) has meant that various "DOS extenders" are often used with
programs such as `gawk'.  The varying capabilities of Microsoft Windows
3.1 and Windows32 can add to the confusion.  For an overview of the
considerations, please refer to `README_d/README.pc' in the
distribution.

* Menu:

* PC Binary Installation::      Installing a prepared distribution.
* PC Compiling::                Compiling `gawk' for MS-DOS,
                                Windows32, and OS/2.
* PC Testing::                  Testing `gawk' on PC systems.
* PC Using::                    Running `gawk' on MS-DOS, Windows32
                                and OS/2.
* Cygwin::                      Building and running `gawk' for
                                Cygwin.
* MSYS::                        Using `gawk' In The MSYS Environment.


File: gawk.info,  Node: PC Binary Installation,  Next: PC Compiling,  Up: PC Installation

B.3.1.1 Installing a Prepared Distribution for PC Systems
.........................................................

If you have received a binary distribution prepared by the MS-DOS
maintainers, then `gawk' and the necessary support files appear under
the `gnu' directory, with executables in `gnu/bin', libraries in
`gnu/lib/awk', and manual pages under `gnu/man'.  This is designed for
easy installation to a `/gnu' directory on your drive--however, the
files can be installed anywhere provided `AWKPATH' is set properly.
Regardless of the installation directory, the first line of `igawk.cmd'
and `igawk.bat' (in `gnu/bin') may need to be edited.

   The binary distribution contains a separate file describing the
contents. In particular, it may include more than one version of the
`gawk' executable.

   OS/2 (32 bit, EMX) binary distributions are prepared for the `/usr'
directory of your preferred drive. Set `UNIXROOT' to your installation
drive (e.g., `e:') if you want to install `gawk' onto another drive
than the hardcoded default `c:'. Executables appear in `/usr/bin',
libraries under `/usr/share/awk', manual pages under `/usr/man',
Texinfo documentation under `/usr/info', and NLS files under
`/usr/share/locale'.  Note that the files can be installed anywhere
provided `AWKPATH' is set properly.

   If you already have a file `/usr/info/dir' from another package _do
not overwrite it!_ Instead enter the following commands at your prompt
(replace `x:' by your installation drive):

     install-info --info-dir=x:/usr/info x:/usr/info/gawk.info
     install-info --info-dir=x:/usr/info x:/usr/info/gawkinet.info

   The binary distribution may contain a separate file containing
additional or more detailed installation instructions.


File: gawk.info,  Node: PC Compiling,  Next: PC Testing,  Prev: PC Binary Installation,  Up: PC Installation

B.3.1.2 Compiling `gawk' for PC Operating Systems
.................................................

`gawk' can be compiled for MS-DOS, Windows32, and OS/2 using the GNU
development tools from DJ Delorie (DJGPP: MS-DOS only) or Eberhard
Mattes (EMX: MS-DOS, Windows32 and OS/2).  The file
`README_d/README.pc' in the `gawk' distribution contains additional
notes, and `pc/Makefile' contains important information on compilation
options.

   To build `gawk' for MS-DOS and Windows32, copy the files in the `pc'
directory (_except_ for `ChangeLog') to the directory with the rest of
the `gawk' sources, then invoke `make' with the appropriate target name
as an argument to build `gawk'.  The `Makefile' copied from the `pc'
directory contains a configuration section with comments and may need
to be edited in order to work with your `make' utility.

   The `Makefile' supports a number of targets for building various
MS-DOS and Windows32 versions.  A list of targets is printed if the
`make' command is given without a target.  As an example, to build
`gawk' using the DJGPP tools, enter `make djgpp'.  (The DJGPP tools
needed for the build may be found at
`ftp://ftp.delorie.com/pub/djgpp/current/v2gnu/'.)  To build a native
MS-Windows binary of `gawk', type `make mingw32'.

   The 32 bit EMX version of `gawk' works "out of the box" under OS/2.
However, it is highly recommended to use GCC 2.95.3 for the compilation.
In principle, it is possible to compile `gawk' the following way:

     $ ./configure
     $ make

   This is not recommended, though.  To get an OMF executable you should
use the following commands at your `sh' prompt:

     $ CFLAGS="-O2 -Zomf -Zmt"
     $ export CFLAGS
     $ LDFLAGS="-s -Zcrtdll -Zlinker /exepack:2 -Zlinker /pm:vio -Zstack 0x6000"
     $ export LDFLAGS
     $ RANLIB="echo"
     $ export RANLIB
     $ ./configure --prefix=c:/usr
     $ make AR=emxomfar

   These are just suggestions for use with GCC 2.x.  You may use any
other set of (self-consistent) environment variables and compiler flags.

   If you use GCC 2.95 it is recommended to use also:

     $ LIBS="-lgcc"
     $ export LIBS

   You can also get an `a.out' executable if you prefer:

     $ CFLAGS="-O2 -Zmt"
     $ export CFLAGS
     $ LDFLAGS="-s -Zstack 0x6000"
     $ LIBS="-lgcc"
     $ unset RANLIB
     $ ./configure --prefix=c:/usr
     $ make

     NOTE: Compilation of `a.out' executables also works with GCC 3.2.
     Versions later than GCC 3.2 have not been tested successfully.

   `make install' works as expected with the EMX build.

     NOTE: Ancient OS/2 ports of GNU `make' are not able to handle the
     Makefiles of this package.  If you encounter any problems with
     `make', try GNU Make 3.79.1 or later versions.  You should find
     the latest version on `ftp://hobbes.nmsu.edu/pub/os2/'.


File: gawk.info,  Node: PC Testing,  Next: PC Using,  Prev: PC Compiling,  Up: PC Installation

B.3.1.3 Testing `gawk' on PC Operating Systems
..............................................

Using `make' to run the standard tests and to install `gawk' requires
additional Unix-like tools, including `sh', `sed', and `cp'. In order
to run the tests, the `test/*.ok' files may need to be converted so
that they have the usual MS-DOS-style end-of-line markers.
Alternatively, run `make check CMP="diff -a"' to use GNU `diff' in text
mode instead of `cmp' to compare the resulting files.

   Most of the tests work properly with Stewartson's shell along with
the companion utilities or appropriate GNU utilities.  However, some
editing of `test/Makefile' is required. It is recommended that you copy
the file `pc/Makefile.tst' over the file `test/Makefile' as a
replacement. Details can be found in `README_d/README.pc' and in the
file `pc/Makefile.tst'.

   On OS/2 the `pid' test fails because `spawnl()' is used instead of
`fork()'/`execl()' to start child processes.  Also the `mbfw1' and
`mbprintf1' tests fail because the needed multibyte functionality is
not available.


File: gawk.info,  Node: PC Using,  Next: Cygwin,  Prev: PC Testing,  Up: PC Installation

B.3.1.4 Using `gawk' on PC Operating Systems
............................................

With the exception of the Cygwin environment, the `|&' operator and
TCP/IP networking (*note TCP/IP Networking::) are not supported for
MS-DOS or MS-Windows.  EMX (OS/2 only) does support at least the `|&'
operator.

   The MS-DOS and MS-Windows versions of `gawk' search for program
files as described in *note AWKPATH Variable::.  However, semicolons
(rather than colons) separate elements in the `AWKPATH' variable.  If
`AWKPATH' is not set or is empty, then the default search path for
MS-Windows and MS-DOS versions is `".;c:/lib/awk;c:/gnu/lib/awk"'.

   The search path for OS/2 (32 bit, EMX) is determined by the prefix
directory (most likely `/usr' or `c:/usr') that has been specified as
an option of the `configure' script like it is the case for the Unix
versions.  If `c:/usr' is the prefix directory then the default search
path contains `.' and `c:/usr/share/awk'.  Additionally, to support
binary distributions of `gawk' for OS/2 systems whose drive `c:' might
not support long file names or might not exist at all, there is a
special environment variable.  If `UNIXROOT' specifies a drive then
this specific drive is also searched for program files.  E.g., if
`UNIXROOT' is set to `e:' the complete default search path is
`".;c:/usr/share/awk;e:/usr/share/awk"'.

   An `sh'-like shell (as opposed to `command.com' under MS-DOS or
`cmd.exe' under MS-Windows or OS/2) may be useful for `awk' programming.
The DJGPP collection of tools includes an MS-DOS port of Bash, and
several shells are available for OS/2, including `ksh'.

   Under MS-Windows, OS/2 and MS-DOS, `gawk' (and many other text
programs) silently translate end-of-line `"\r\n"' to `"\n"' on input
and `"\n"' to `"\r\n"' on output.  A special `BINMODE' variable
(c.e.)  allows control over these translations and is interpreted as
follows:

   * If `BINMODE' is `"r"', or one, then binary mode is set on read
     (i.e., no translations on reads).

   * If `BINMODE' is `"w"', or two, then binary mode is set on write
     (i.e., no translations on writes).

   * If `BINMODE' is `"rw"' or `"wr"' or three, binary mode is set for
     both read and write.

   * `BINMODE=NON-NULL-STRING' is the same as `BINMODE=3' (i.e., no
     translations on reads or writes).  However, `gawk' issues a warning
     message if the string is not one of `"rw"' or `"wr"'.

The modes for standard input and standard output are set one time only
(after the command line is read, but before processing any of the `awk'
program).  Setting `BINMODE' for standard input or standard output is
accomplished by using an appropriate `-v BINMODE=N' option on the
command line.  `BINMODE' is set at the time a file or pipe is opened
and cannot be changed mid-stream.

   The name `BINMODE' was chosen to match `mawk' (*note Other
Versions::).  `mawk' and `gawk' handle `BINMODE' similarly; however,
`mawk' adds a `-W BINMODE=N' option and an environment variable that
can set `BINMODE', `RS', and `ORS'.  The files `binmode[1-3].awk'
(under `gnu/lib/awk' in some of the prepared distributions) have been
chosen to match `mawk''s `-W BINMODE=N' option.  These can be changed
or discarded; in particular, the setting of `RS' giving the fewest
"surprises" is open to debate.  `mawk' uses `RS = "\r\n"' if binary
mode is set on read, which is appropriate for files with the
MS-DOS-style end-of-line.

   To illustrate, the following examples set binary mode on writes for
standard output and other files, and set `ORS' as the "usual"
MS-DOS-style end-of-line:

     gawk -v BINMODE=2 -v ORS="\r\n" ...

or:

     gawk -v BINMODE=w -f binmode2.awk ...

These give the same result as the `-W BINMODE=2' option in `mawk'.  The
following changes the record separator to `"\r\n"' and sets binary mode
on reads, but does not affect the mode on standard input:

     gawk -v RS="\r\n" --source "BEGIN { BINMODE = 1 }" ...

or:

     gawk -f binmode1.awk ...

With proper quoting, in the first example the setting of `RS' can be
moved into the `BEGIN' rule.


File: gawk.info,  Node: Cygwin,  Next: MSYS,  Prev: PC Using,  Up: PC Installation

B.3.1.5 Using `gawk' In The Cygwin Environment
..............................................

`gawk' can be built and used "out of the box" under MS-Windows if you
are using the Cygwin environment (http://www.cygwin.com).  This
environment provides an excellent simulation of Unix, using the GNU
tools, such as Bash, the GNU Compiler Collection (GCC), GNU Make, and
other GNU programs.  Compilation and installation for Cygwin is the
same as for a Unix system:

     tar -xvpzf gawk-4.1.0.tar.gz
     cd gawk-4.1.0
     ./configure
     make

   When compared to GNU/Linux on the same system, the `configure' step
on Cygwin takes considerably longer.  However, it does finish, and then
the `make' proceeds as usual.

     NOTE: The `|&' operator and TCP/IP networking (*note TCP/IP
     Networking::) are fully supported in the Cygwin environment.  This
     is not true for any other environment on MS-Windows.


File: gawk.info,  Node: MSYS,  Prev: Cygwin,  Up: PC Installation

B.3.1.6 Using `gawk' In The MSYS Environment
............................................

In the MSYS environment under MS-Windows, `gawk' automatically uses
binary mode for reading and writing files.  Thus there is no need to
use the `BINMODE' variable.

   This can cause problems with other Unix-like components that have
been ported to MS-Windows that expect `gawk' to do automatic
translation of `"\r\n"', since it won't.  Caveat Emptor!


File: gawk.info,  Node: VMS Installation,  Prev: PC Installation,  Up: Non-Unix Installation

B.3.2 How to Compile and Install `gawk' on VMS
----------------------------------------------

This node describes how to compile and install `gawk' under VMS.  The
older designation "VMS" is used throughout to refer to OpenVMS.

* Menu:

* VMS Compilation::             How to compile `gawk' under VMS.
* VMS Installation Details::    How to install `gawk' under VMS.
* VMS Running::                 How to run `gawk' under VMS.
* VMS Old Gawk::                An old version comes with some VMS systems.


File: gawk.info,  Node: VMS Compilation,  Next: VMS Installation Details,  Up: VMS Installation

B.3.2.1 Compiling `gawk' on VMS
...............................

To compile `gawk' under VMS, there is a `DCL' command procedure that
issues all the necessary `CC' and `LINK' commands. There is also a
`Makefile' for use with the `MMS' utility.  From the source directory,
use either:

     $ @[.VMS]VMSBUILD.COM

or:

     $ MMS/DESCRIPTION=[.VMS]DESCRIP.MMS GAWK

   Older versions of `gawk' could be built with VAX C or GNU C on
VAX/VMS, as well as with DEC C, but that is no longer supported.  DEC C
(also briefly known as "Compaq C" and now known as "HP C," but referred
to here as "DEC C") is required.  Both `VMSBUILD.COM' and `DESCRIP.MMS'
contain some obsolete support for the older compilers but are set up to
use DEC C by default.

   `gawk' has been tested under Alpha/VMS 7.3-1 using Compaq C V6.4,
and on Alpha/VMS 7.3, Alpha/VMS 7.3-2, and IA64/VMS 8.3.(1)

   ---------- Footnotes ----------

   (1) The IA64 architecture is also known as "Itanium."


File: gawk.info,  Node: VMS Installation Details,  Next: VMS Running,  Prev: VMS Compilation,  Up: VMS Installation

B.3.2.2 Installing `gawk' on VMS
................................

To install `gawk', all you need is a "foreign" command, which is a
`DCL' symbol whose value begins with a dollar sign. For example:

     $ GAWK :== $disk1:[gnubin]GAWK

Substitute the actual location of `gawk.exe' for `$disk1:[gnubin]'. The
symbol should be placed in the `login.com' of any user who wants to run
`gawk', so that it is defined every time the user logs on.
Alternatively, the symbol may be placed in the system-wide
`sylogin.com' procedure, which allows all users to run `gawk'.

   Optionally, the help entry can be loaded into a VMS help library:

     $ LIBRARY/HELP SYS$HELP:HELPLIB [.VMS]GAWK.HLP

(You may want to substitute a site-specific help library rather than
the standard VMS library `HELPLIB'.)  After loading the help text, the
command:

     $ HELP GAWK

provides information about both the `gawk' implementation and the `awk'
programming language.

   The logical name `AWK_LIBRARY' can designate a default location for
`awk' program files.  For the `-f' option, if the specified file name
has no device or directory path information in it, `gawk' looks in the
current directory first, then in the directory specified by the
translation of `AWK_LIBRARY' if the file is not found.  If, after
searching in both directories, the file still is not found, `gawk'
appends the suffix `.awk' to the filename and retries the file search.
If `AWK_LIBRARY' has no definition, a default value of `SYS$LIBRARY:'
is used for it.


File: gawk.info,  Node: VMS Running,  Next: VMS Old Gawk,  Prev: VMS Installation Details,  Up: VMS Installation

B.3.2.3 Running `gawk' on VMS
.............................

Command-line parsing and quoting conventions are significantly different
on VMS, so examples in this Info file or from other sources often need
minor changes.  They _are_ minor though, and all `awk' programs should
run correctly.

   Here are a couple of trivial tests:

     $ gawk -- "BEGIN {print ""Hello, World!""}"
     $ gawk -"W" version
     ! could also be -"W version" or "-W version"

Note that uppercase and mixed-case text must be quoted.

   The VMS port of `gawk' includes a `DCL'-style interface in addition
to the original shell-style interface (see the help entry for details).
One side effect of dual command-line parsing is that if there is only a
single parameter (as in the quoted string program above), the command
becomes ambiguous.  To work around this, the normally optional `--'
flag is required to force Unix-style parsing rather than `DCL' parsing.
If any other dash-type options (or multiple parameters such as data
files to process) are present, there is no ambiguity and `--' can be
omitted.

   The default search path, when looking for `awk' program files
specified by the `-f' option, is `"SYS$DISK:[],AWK_LIBRARY:"'.  The
logical name `AWKPATH' can be used to override this default.  The format
of `AWKPATH' is a comma-separated list of directory specifications.
When defining it, the value should be quoted so that it retains a single
translation and not a multitranslation `RMS' searchlist.


File: gawk.info,  Node: VMS Old Gawk,  Prev: VMS Running,  Up: VMS Installation

B.3.2.4 Some VMS Systems Have An Old Version of `gawk'
......................................................

Some versions of VMS have an old version of `gawk'.  To access it,
define a symbol, as follows:

     $ gawk :== $sys$common:[syshlp.examples.tcpip.snmp]gawk.exe

   This is apparently version 2.15.6, which is extremely old. We
recommend compiling and using the current version.


File: gawk.info,  Node: Bugs,  Next: Other Versions,  Prev: Non-Unix Installation,  Up: Installation

B.4 Reporting Problems and Bugs
===============================

     There is nothing more dangerous than a bored archeologist.  -- The
     Hitchhiker's Guide to the Galaxy

   If you have problems with `gawk' or think that you have found a bug,
please report it to the developers; we cannot promise to do anything
but we might well want to fix it.

   Before reporting a bug, make sure you have actually found a real bug.
Carefully reread the documentation and see if it really says you can do
what you're trying to do.  If it's not clear whether you should be able
to do something or not, report that too; it's a bug in the
documentation!

   Before reporting a bug or trying to fix it yourself, try to isolate
it to the smallest possible `awk' program and input data file that
reproduces the problem.  Then send us the program and data file, some
idea of what kind of Unix system you're using, the compiler you used to
compile `gawk', and the exact results `gawk' gave you.  Also say what
you expected to occur; this helps us decide whether the problem is
really in the documentation.

   Please include the version number of `gawk' you are using.  You can
get this information with the command `gawk --version'.

   Once you have a precise problem, send email to <bug-gawk@gnu.org>.

   Using this address automatically sends a copy of your mail to me.
If necessary, I can be reached directly at <arnold@skeeve.com>.  The
bug reporting address is preferred since the email list is archived at
the GNU Project.  _All email should be in English, since that is my
native language._

     CAUTION: Do _not_ try to report bugs in `gawk' by posting to the
     Usenet/Internet newsgroup `comp.lang.awk'.  While the `gawk'
     developers do occasionally read this newsgroup, there is no
     guarantee that we will see your posting.  The steps described
     above are the official recognized ways for reporting bugs.  Really.

     NOTE: Many distributions of GNU/Linux and the various BSD-based
     operating systems have their own bug reporting systems.  If you
     report a bug using your distribution's bug reporting system,
     _please_ also send a copy to <bug-gawk@gnu.org>.

     This is for two reasons.  First, while some distributions forward
     bug reports "upstream" to the GNU mailing list, many don't, so
     there is a good chance that the `gawk'  maintainer won't even see
     the bug report!  Second, mail to the GNU list is archived, and
     having everything at the GNU project keeps things self-contained
     and not dependant on other web sites.

   Non-bug suggestions are always welcome as well.  If you have
questions about things that are unclear in the documentation or are
just obscure features, ask me; I will try to help you out, although I
may not have the time to fix the problem.  You can send me electronic
mail at the Internet address noted previously.

   If you find bugs in one of the non-Unix ports of `gawk', please send
an electronic mail message to the person who maintains that port.  They
are named in the following list, as well as in the `README' file in the
`gawk' distribution.  Information in the `README' file should be
considered authoritative if it conflicts with this Info file.

   The people maintaining the non-Unix ports of `gawk' are as follows:

MS-DOS with DJGPP       Scott Deifik, <scottd.mail@sbcglobal.net>.
MS-Windows with MINGW   Eli Zaretskii, <eliz@gnu.org>.
OS/2                    Andreas Buening, <andreas.buening@nexgo.de>.
VMS                     Pat Rankin, <r.pat.rankin@gmail.com>
z/OS (OS/390)           Dave Pitts, <dpitts@cozx.com>.

   If your bug is also reproducible under Unix, please send a copy of
your report to the <bug-gawk@gnu.org> email list as well.


File: gawk.info,  Node: Other Versions,  Prev: Bugs,  Up: Installation

B.5 Other Freely Available `awk' Implementations
================================================

     It's kind of fun to put comments like this in your awk code.
     `// Do C++ comments work? answer: yes! of course' -- Michael
     Brennan

   There are a number of other freely available `awk' implementations.
This minor node briefly describes where to get them:

Unix `awk'
     Brian Kernighan, one of the original designers of Unix `awk', has
     made his implementation of `awk' freely available.  You can
     retrieve this version via the World Wide Web from his home page
     (http://www.cs.princeton.edu/~bwk).  It is available in several
     archive formats:

    Shell archive
          `http://www.cs.princeton.edu/~bwk/btl.mirror/awk.shar'

    Compressed `tar' file
          `http://www.cs.princeton.edu/~bwk/btl.mirror/awk.tar.gz'

    Zip file
          `http://www.cs.princeton.edu/~bwk/btl.mirror/awk.zip'

     You can also retrieve it from Git Hub:

          git clone git://github.com/onetrueawk/awk bwkawk

     The above command creates a copy of the Git
     (http://www.git-scm.com) repository in a directory named `bwkawk'.
     If you leave that argument off the `git' command line, the
     repository copy is created in a directory named `awk'.

     This version requires an ISO C (1990 standard) compiler; the C
     compiler from GCC (the GNU Compiler Collection) works quite nicely.

     *Note Common Extensions::, for a list of extensions in this `awk'
     that are not in POSIX `awk'.

`mawk'
     Michael Brennan wrote an independent implementation of `awk',
     called `mawk'.  It is available under the GPL (*note Copying::),
     just as `gawk' is.

     The original distribution site for the `mawk' source code no
     longer has it.  A copy is available at
     `http://www.skeeve.com/gawk/mawk1.3.3.tar.gz'.

     In 2009, Thomas Dickey took on `mawk' maintenance.  Basic
     information is available on the project's web page
     (http://www.invisible-island.net/mawk).  The download URL is
     `http://invisible-island.net/datafiles/release/mawk.tar.gz'.

     Once you have it, `gunzip' may be used to decompress this file.
     Installation is similar to `gawk''s (*note Unix Installation::).

     *Note Common Extensions::, for a list of extensions in `mawk' that
     are not in POSIX `awk'.

`awka'
     Written by Andrew Sumner, `awka' translates `awk' programs into C,
     compiles them, and links them with a library of functions that
     provides the core `awk' functionality.  It also has a number of
     extensions.

     The `awk' translator is released under the GPL, and the library is
     under the LGPL.

     To get `awka', go to `http://sourceforge.net/projects/awka'.

     The project seems to be frozen; no new code changes have been made
     since approximately 2003.

`pawk'
     Nelson H.F. Beebe at the University of Utah has modified Brian
     Kernighan's `awk' to provide timing and profiling information.  It
     is different from `gawk' with the `--profile' option.  (*note
     Profiling::), in that it uses CPU-based profiling, not line-count
     profiling.  You may find it at either
     `ftp://ftp.math.utah.edu/pub/pawk/pawk-20030606.tar.gz' or
     `http://www.math.utah.edu/pub/pawk/pawk-20030606.tar.gz'.

Busybox Awk
     Busybox is a GPL-licensed program providing small versions of many
     applications within a single executable. It is aimed at embedded
     systems.  It includes a full implementation of POSIX `awk'.  When
     building it, be careful not to do `make install' as it will
     overwrite copies of other applications in your `/usr/local/bin'.
     For more information, see the project's home page
     (http://busybox.net).

The OpenSolaris POSIX `awk'
     The version of `awk' in `/usr/xpg4/bin' on Solaris is more-or-less
     POSIX-compliant. It is based on the `awk' from Mortice Kern
     Systems for PCs.  This author was able to make it compile and work
     under GNU/Linux with 1-2 hours of work.  Making it more generally
     portable (using GNU Autoconf and/or Automake) would take more
     work, and this has not been done, at least to our knowledge.

     The source code used to be available from the OpenSolaris web site.
     However, that project was ended and the web site shut down.
     Fortunately, the Illumos project
     (http://wiki.illumos.org/display/illumos/illumos+Home) makes this
     implementation available.  You can view the files one at a time
     from
     `https://github.com/joyent/illumos-joyent/blob/master/usr/src/cmd/awk_xpg4'.

`jawk'
     This is an interpreter for `awk' written in Java. It claims to be
     a full interpreter, although because it uses Java facilities for
     I/O and for regexp matching, the language it supports is different
     from POSIX `awk'.  More information is available on the project's
     home page (http://jawk.sourceforge.net).

Libmawk
     This is an embeddable `awk' interpreter derived from `mawk'. For
     more information see `http://repo.hu/projects/libmawk/'.

`pawk'
     This is a Python module that claims to bring `awk'-like features
     to Python. See `https://github.com/alecthomas/pawk' for more
     information. (This is not related to Nelson Beebe's modified
     version of Brian Kernighan's `awk', described earlier.)

QSE Awk
     This is an embeddable `awk' interpreter. For more information see
     `http://code.google.com/p/qse/' and `http://awk.info/?tools/qse'.

`QTawk'
     This is an independent implementation of `awk' distributed under
     the GPL. It has a large number of extensions over standard `awk'
     and may not be 100% syntactically compatible with it.  See
     `http://www.quiktrim.org/QTawk.html' for more information,
     including the manual and a download link.

Other Versions
     See also the Wikipedia article
     (http://en.wikipedia.org/wiki/Awk_language#Versions_and_implementations),
     for information on additional versions.



File: gawk.info,  Node: Notes,  Next: Basic Concepts,  Prev: Installation,  Up: Top

Appendix C Implementation Notes
*******************************

This appendix contains information mainly of interest to implementers
and maintainers of `gawk'.  Everything in it applies specifically to
`gawk' and not to other implementations.

* Menu:

* Compatibility Mode::          How to disable certain `gawk'
                                extensions.
* Additions::                   Making Additions To `gawk'.
* Future Extensions::           New features that may be implemented one day.
* Implementation Limitations::  Some limitations of the implementation.
* Extension Design::            Design notes about the extension API.
* Old Extension Mechanism::     Some compatibility for old extensions.


File: gawk.info,  Node: Compatibility Mode,  Next: Additions,  Up: Notes

C.1 Downward Compatibility and Debugging
========================================

*Note POSIX/GNU::, for a summary of the GNU extensions to the `awk'
language and program.  All of these features can be turned off by
invoking `gawk' with the `--traditional' option or with the `--posix'
option.

   If `gawk' is compiled for debugging with `-DDEBUG', then there is
one more option available on the command line:

`-Y'
`--parsedebug'
     Prints out the parse stack information as the program is being
     parsed.

   This option is intended only for serious `gawk' developers and not
for the casual user.  It probably has not even been compiled into your
version of `gawk', since it slows down execution.


File: gawk.info,  Node: Additions,  Next: Future Extensions,  Prev: Compatibility Mode,  Up: Notes

C.2 Making Additions to `gawk'
==============================

If you find that you want to enhance `gawk' in a significant fashion,
you are perfectly free to do so.  That is the point of having free
software; the source code is available and you are free to change it as
you want (*note Copying::).

   This minor node discusses the ways you might want to change `gawk'
as well as any considerations you should bear in mind.

* Menu:

* Accessing The Source::        Accessing the Git repository.
* Adding Code::                 Adding code to the main body of
                                `gawk'.
* New Ports::                   Porting `gawk' to a new operating
                                system.
* Derived Files::               Why derived files are kept in the
                                `git' repository.


File: gawk.info,  Node: Accessing The Source,  Next: Adding Code,  Up: Additions

C.2.1 Accessing The `gawk' Git Repository
-----------------------------------------

As `gawk' is Free Software, the source code is always available.  *note
Gawk Distribution::, describes how to get and build the formal,
released versions of `gawk'.

   However, if you want to modify `gawk' and contribute back your
changes, you will probably wish to work with the development version.
To do so, you will need to access the `gawk' source code repository.
The code is maintained using the Git distributed version control system
(http://git-scm.com/).  You will need to install it if your system
doesn't have it.  Once you have done so, use the command:

     git clone git://git.savannah.gnu.org/gawk.git

This will clone the `gawk' repository.  If you are behind a firewall
that will not allow you to use the Git native protocol, you can still
access the repository using:

     git clone http://git.savannah.gnu.org/r/gawk.git

   Once you have made changes, you can use `git diff' to produce a
patch, and send that to the `gawk' maintainer; see *note Bugs::, for
how to do that.

   Once upon a time there was Git-CVS gateway for use by people who
could not install Git. However, this gateway no longer works, so you
may have better luck using a more modern version control system like
Bazaar, that has a Git plug-in for working with Git repositories.


File: gawk.info,  Node: Adding Code,  Next: New Ports,  Prev: Accessing The Source,  Up: Additions

C.2.2 Adding New Features
-------------------------

You are free to add any new features you like to `gawk'.  However, if
you want your changes to be incorporated into the `gawk' distribution,
there are several steps that you need to take in order to make it
possible to include your changes:

  1. Before building the new feature into `gawk' itself, consider
     writing it as an extension module (*note Dynamic Extensions::).
     If that's not possible, continue with the rest of the steps in
     this list.

  2. Be prepared to sign the appropriate paperwork.  In order for the
     FSF to distribute your changes, you must either place those
     changes in the public domain and submit a signed statement to that
     effect, or assign the copyright in your changes to the FSF.  Both
     of these actions are easy to do and _many_ people have done so
     already. If you have questions, please contact me (*note Bugs::),
     or <assign@gnu.org>.

  3. Get the latest version.  It is much easier for me to integrate
     changes if they are relative to the most recent distributed
     version of `gawk'.  If your version of `gawk' is very old, I may
     not be able to integrate them at all.  (*Note Getting::, for
     information on getting the latest version of `gawk'.)

  4. See *note (Version)Top:: standards, GNU Coding Standards.  This
     document describes how GNU software should be written. If you
     haven't read it, please do so, preferably _before_ starting to
     modify `gawk'.  (The `GNU Coding Standards' are available from the
     GNU Project's web site
     (http://www.gnu.org/prep/standards_toc.html).  Texinfo, Info, and
     DVI versions are also available.)

  5. Use the `gawk' coding style.  The C code for `gawk' follows the
     instructions in the `GNU Coding Standards', with minor exceptions.
     The code is formatted using the traditional "K&R" style,
     particularly as regards to the placement of braces and the use of
     TABs.  In brief, the coding rules for `gawk' are as follows:

        * Use ANSI/ISO style (prototype) function headers when defining
          functions.

        * Put the name of the function at the beginning of its own line.

        * Put the return type of the function, even if it is `int', on
          the line above the line with the name and arguments of the
          function.

        * Put spaces around parentheses used in control structures
          (`if', `while', `for', `do', `switch', and `return').

        * Do not put spaces in front of parentheses used in function
          calls.

        * Put spaces around all C operators and after commas in
          function calls.

        * Do not use the comma operator to produce multiple side
          effects, except in `for' loop initialization and increment
          parts, and in macro bodies.

        * Use real TABs for indenting, not spaces.

        * Use the "K&R" brace layout style.

        * Use comparisons against `NULL' and `'\0'' in the conditions of
          `if', `while', and `for' statements, as well as in the `case's
          of `switch' statements, instead of just the plain pointer or
          character value.

        * Use `true' and `false' for `bool' values, the `NULL' symbolic
          constant for pointer values, and the character constant
          `'\0'' where appropriate, instead of `1' and `0'.

        * Provide one-line descriptive comments for each function.

        * Do not use the `alloca()' function for allocating memory off
          the stack.  Its use causes more portability trouble than is
          worth the minor benefit of not having to free the storage.
          Instead, use `malloc()' and `free()'.

        * Do not use comparisons of the form `! strcmp(a, b)' or
          similar.  As Henry Spencer once said, "`strcmp()' is not a
          boolean!"  Instead, use `strcmp(a, b) == 0'.

        * If adding new bit flag values, use explicit hexadecimal
          constants (`0x001', `0x002', `0x004', and son on) instead of
          shifting one left by successive amounts (`(1<<0)', `(1<<1)',
          and so on).

          NOTE: If I have to reformat your code to follow the coding
          style used in `gawk', I may not bother to integrate your
          changes at all.

  6. Update the documentation.  Along with your new code, please supply
     new sections and/or chapters for this Info file.  If at all
     possible, please use real Texinfo, instead of just supplying
     unformatted ASCII text (although even that is better than no
     documentation at all).  Conventions to be followed in `GAWK:
     Effective AWK Programming' are provided after the `@bye' at the
     end of the Texinfo source file.  If possible, please update the
     `man' page as well.

     You will also have to sign paperwork for your documentation
     changes.

  7. Submit changes as unified diffs.  Use `diff -u -r -N' to compare
     the original `gawk' source tree with your version.  I recommend
     using the GNU version of `diff', or best of all, `git diff' or
     `git format-patch'.  Send the output produced by `diff' to me when
     you submit your changes.  (*Note Bugs::, for the electronic mail
     information.)

     Using this format makes it easy for me to apply your changes to the
     master version of the `gawk' source code (using `patch').  If I
     have to apply the changes manually, using a text editor, I may not
     do so, particularly if there are lots of changes.

  8. Include an entry for the `ChangeLog' file with your submission.
     This helps further minimize the amount of work I have to do,
     making it easier for me to accept patches.

   Although this sounds like a lot of work, please remember that while
you may write the new code, I have to maintain it and support it. If it
isn't possible for me to do that with a minimum of extra work, then I
probably will not.


File: gawk.info,  Node: New Ports,  Next: Derived Files,  Prev: Adding Code,  Up: Additions

C.2.3 Porting `gawk' to a New Operating System
----------------------------------------------

If you want to port `gawk' to a new operating system, there are several
steps:

  1. Follow the guidelines in *note Adding Code::, concerning coding
     style, submission of diffs, and so on.

  2. Be prepared to sign the appropriate paperwork.  In order for the
     FSF to distribute your code, you must either place your code in
     the public domain and submit a signed statement to that effect, or
     assign the copyright in your code to the FSF.  Both of these
     actions are easy to do and _many_ people have done so already. If
     you have questions, please contact me, or <gnu@gnu.org>.

  3. When doing a port, bear in mind that your code must coexist
     peacefully with the rest of `gawk' and the other ports. Avoid
     gratuitous changes to the system-independent parts of the code. If
     at all possible, avoid sprinkling `#ifdef's just for your port
     throughout the code.

     If the changes needed for a particular system affect too much of
     the code, I probably will not accept them.  In such a case, you
     can, of course, distribute your changes on your own, as long as
     you comply with the GPL (*note Copying::).

  4. A number of the files that come with `gawk' are maintained by other
     people.  Thus, you should not change them unless it is for a very
     good reason; i.e., changes are not out of the question, but
     changes to these files are scrutinized extra carefully.  The files
     are `dfa.c', `dfa.h', `getopt1.c', `getopt.c', `getopt.h',
     `install-sh', `mkinstalldirs', `regcomp.c', `regex.c',
     `regexec.c', `regexex.c', `regex.h', `regex_internal.c', and
     `regex_internal.h'.

  5. Be willing to continue to maintain the port.  Non-Unix operating
     systems are supported by volunteers who maintain the code needed
     to compile and run `gawk' on their systems. If noone volunteers to
     maintain a port, it becomes unsupported and it may be necessary to
     remove it from the distribution.

  6. Supply an appropriate `gawkmisc.???' file.  Each port has its own
     `gawkmisc.???' that implements certain operating system specific
     functions. This is cleaner than a plethora of `#ifdef's scattered
     throughout the code.  The `gawkmisc.c' in the main source
     directory includes the appropriate `gawkmisc.???' file from each
     subdirectory.  Be sure to update it as well.

     Each port's `gawkmisc.???' file has a suffix reminiscent of the
     machine or operating system for the port--for example,
     `pc/gawkmisc.pc' and `vms/gawkmisc.vms'. The use of separate
     suffixes, instead of plain `gawkmisc.c', makes it possible to move
     files from a port's subdirectory into the main subdirectory,
     without accidentally destroying the real `gawkmisc.c' file.
     (Currently, this is only an issue for the PC operating system
     ports.)

  7. Supply a `Makefile' as well as any other C source and header files
     that are necessary for your operating system.  All your code
     should be in a separate subdirectory, with a name that is the same
     as, or reminiscent of, either your operating system or the
     computer system.  If possible, try to structure things so that it
     is not necessary to move files out of the subdirectory into the
     main source directory.  If that is not possible, then be sure to
     avoid using names for your files that duplicate the names of files
     in the main source directory.

  8. Update the documentation.  Please write a section (or sections)
     for this Info file describing the installation and compilation
     steps needed to compile and/or install `gawk' for your system.

   Following these steps makes it much easier to integrate your changes
into `gawk' and have them coexist happily with other operating systems'
code that is already there.

   In the code that you supply and maintain, feel free to use a coding
style and brace layout that suits your taste.


File: gawk.info,  Node: Derived Files,  Prev: New Ports,  Up: Additions

C.2.4 Why Generated Files Are Kept In `git'
-------------------------------------------

If you look at the `gawk' source in the `git' repository, you will
notice that it includes files that are automatically generated by GNU
infrastructure tools, such as `Makefile.in' from `automake' and even
`configure' from `autoconf'.

   This is different from many Free Software projects that do not store
the derived files, because that keeps the repository less cluttered,
and it is easier to see the substantive changes when comparing versions
and trying to understand what changed between commits.

   However, there are two reasons why the `gawk' maintainer likes to
have everything in the repository.

   First, because it is then easy to reproduce any given version
completely, without relying upon the availability of (older, likely
obsolete, and maybe even impossible to find) other tools.

   As an extreme example, if you ever even think about trying to
compile, oh, say, the V7 `awk', you will discover that not only do you
have to bootstrap the V7 `yacc' to do so, but you also need the V7
`lex'.  And the latter is pretty much impossible to bring up on a
modern GNU/Linux system.(1)

   (Or, let's say `gawk' 1.2 required `bison' whatever-it-was in 1989
and that there was no `awkgram.c' file in the repository.  Is there a
guarantee that we could find that `bison' version? Or that _it_ would
build?)

   If the repository has all the generated files, then it's easy to
just check them out and build. (Or _easier_, depending upon how far
back we go.  `:-)')

   And that brings us to the second (and stronger) reason why all the
files really need to be in `git'.  It boils down to who do you cater
to--the `gawk' developer(s), or the user who just wants to check out a
version and try it out?

   The `gawk' maintainer wants it to be possible for any interested
`awk' user in the world to just clone the repository, check out the
branch of interest and build it. Without their having to have the
correct version(s) of the autotools.(2) That is the point of the
`bootstrap.sh' file.  It touches the various other files in the right
order such that

     # The canonical incantation for building GNU software:
     ./bootstrap.sh && ./configure && make

will _just work_.

   This is extremely important for the `master' and `gawk-X.Y-stable'
branches.

   Further, the `gawk' maintainer would argue that it's also important
for the `gawk' developers. When he tried to check out the `xgawk'
branch(3) to build it, he couldn't. (No `ltmain.sh' file, and he had no
idea how to create it, and that was not the only problem.)

   He felt _extremely_ frustrated.  With respect to that branch, the
maintainer is no different than Jane User who wants to try to build
`gawk-4.0-stable' or `master' from the repository.

   Thus, the maintainer thinks that it's not just important, but
critical, that for any given branch, the above incantation _just works_.

   What are some of the consequences and/or actions to take?

  1. We don't mind that there are differing files in the different
     branches as a result of different versions of the autotools.

       A. It's the maintainer's job to merge them and he will deal with
          it.

       B. He is really good at `git diff x y > /tmp/diff1 ; gvim
          /tmp/diff1' to remove the diffs that aren't of interest in
          order to review code. `:-)'

  2. It would certainly help if everyone used the same versions of the
     GNU tools as he does, which in general are the latest released
     versions of `automake', `autoconf', `bison', and `gettext'.

       A. Installing from source is quite easy. It's how the maintainer
          worked for years under Fedora.  He had `/usr/local/bin' at
          the front of his `PATH' and just did:

               wget http://ftp.gnu.org/gnu/PACKAGE/PACKAGE-X.Y.Z.tar.gz
               tar -xpzvf PACKAGE-X.Y.Z.tar.gz
               cd PACKAGE-X.Y.Z
               ./configure && make && make check
               make install    # as root

       B. These days the maintainer uses Ubuntu 12.04 which is medium
          current, but he is already doing the above for `autoconf',
          `automake' and `bison'.



   Most of the above was originally written by the maintainer to other
`gawk' developers.  It raised the objection from one of the developers
"... that anybody pulling down the source from `git' is not an end
user."

   However, this is not true. There are "power `awk' users" who can
build `gawk' (using the magic incantation shown previously) but who
can't program in C.  Thus, the major branches should be kept buildable
all the time.

   It was then suggested that there be a `cron' job to create nightly
tarballs of "the source."  Here, the problem is that there are source
trees, corresponding to the various branches! So, nightly tar balls
aren't the answer, especially as the repository can go for weeks
without significant change being introduced.

   Fortunately, the `git' server can meet this need. For any given
branch named BRANCHNAME, use:

     wget http://git.savannah.gnu.org/cgit/gawk.git/snapshot/gawk-BRANCHNAME.tar.gz

to retrieve a snapshot of the given branch.

   ---------- Footnotes ----------

   (1) We tried. It was painful.

   (2) There is one GNU program that is (in our opinion) severely
difficult to bootstrap from the `git' repository. For example, on the
author's old (but still working) PowerPC macintosh with Mac OS X 10.5,
it was necessary to bootstrap a ton of software, starting with `git'
itself, in order to try to work with the latest code.  It's not
pleasant, and especially on older systems, it's a big waste of time.

   Starting with the latest tarball was no picnic either. The
maintainers had dropped `.gz' and `.bz2' files and only distribute
`.tar.xz' files.  It was necessary to bootstrap `xz' first!

   (3) A branch created by one of the other developers that did not
include the generated files.


File: gawk.info,  Node: Future Extensions,  Next: Implementation Limitations,  Prev: Additions,  Up: Notes

C.3 Probable Future Extensions
==============================

     AWK is a language similar to PERL, only considerably more elegant.
     -- Arnold Robbins Hey!  -- Larry Wall

   The `TODO' file in the `gawk' Git repository lists possible future
enhancements.  Some of these relate to the source code, and others to
possible new features.  Please see that file for the list.  *Note
Additions::, if you are interested in tackling any of the projects
listed there.


File: gawk.info,  Node: Implementation Limitations,  Next: Extension Design,  Prev: Future Extensions,  Up: Notes

C.4 Some Limitations of the Implementation
==========================================

This following table describes limits of `gawk' on a Unix-like system
(although it is variable even then). Other systems may have different
limits.

Item                          Limit
-------------------------------------------------------------------------- 
Characters in a character     2^(number of bits per byte)
class                         
Length of input record        `MAX_INT '
Length of output record       Unlimited
Length of source line         Unlimited
Number of fields in a record  `MAX_LONG'
Number of file redirections   Unlimited
Number of input records in    `MAX_LONG'
one file                      
Number of input records       `MAX_LONG'
total                         
Number of pipe redirections   min(number of processes per user, number
                              of open files)
Numeric values                Double-precision floating point (if not
                              using MPFR)
Size of a field               `MAX_INT '
Size of a literal string      `MAX_INT '
Size of a printf string       `MAX_INT '


File: gawk.info,  Node: Extension Design,  Next: Old Extension Mechanism,  Prev: Implementation Limitations,  Up: Notes

C.5 Extension API Design
========================

This minor node documents the design of the extension API, including a
discussion of some of the history and problems that needed to be solved.

   The first version of extensions for `gawk' was developed in the
mid-1990s and released with `gawk' 3.1 in the late 1990s.  The basic
mechanisms and design remained unchanged for close to 15 years, until
2012.

   The old extension mechanism used data types and functions from
`gawk' itself, with a "clever hack" to install extension functions.

   `gawk' included some sample extensions, of which a few were really
useful.  However, it was clear from the outset that the extension
mechanism was bolted onto the side and was not really well thought out.

* Menu:

* Old Extension Problems::           Problems with the old mechanism.
* Extension New Mechanism Goals::    Goals for the new mechanism.
* Extension Other Design Decisions:: Some other design decisions.
* Extension Future Growth::          Some room for future growth.


File: gawk.info,  Node: Old Extension Problems,  Next: Extension New Mechanism Goals,  Up: Extension Design

C.5.1 Problems With The Old Mechanism
-------------------------------------

The old extension mechanism had several problems:

   * It depended heavily upon `gawk' internals.  Any time the `NODE'
     structure(1) changed, an extension would have to be recompiled.
     Furthermore, to really write extensions required understanding
     something about `gawk''s internal functions.  There was some
     documentation in this Info file, but it was quite minimal.

   * Being able to call into `gawk' from an extension required linker
     facilities that are common on Unix-derived systems but that did
     not work on Windows systems; users wanting extensions on Windows
     had to statically link them into `gawk', even though Windows
     supports dynamic loading of shared objects.

   * The API would change occasionally as `gawk' changed; no
     compatibility between versions was ever offered or planned for.

   Despite the drawbacks, the `xgawk' project developers forked `gawk'
and developed several significant extensions. They also enhanced
`gawk''s facilities relating to file inclusion and shared object access.

   A new API was desired for a long time, but only in 2012 did the
`gawk' maintainer and the `xgawk' developers finally start working on
it together.  More information about the `xgawk' project is provided in
*note gawkextlib::.

   ---------- Footnotes ----------

   (1) A critical central data structure inside `gawk'.


File: gawk.info,  Node: Extension New Mechanism Goals,  Next: Extension Other Design Decisions,  Prev: Old Extension Problems,  Up: Extension Design

C.5.2 Goals For A New Mechanism
-------------------------------

Some goals for the new API were:

   * The API should be independent of `gawk' internals.  Changes in
     `gawk' internals should not be visible to the writer of an
     extension function.

   * The API should provide _binary_ compatibility across `gawk'
     releases as long as the API itself does not change.

   * The API should enable extensions written in C or C++ to have
     roughly the same "appearance" to `awk'-level code as `awk'
     functions do. This means that extensions should have:

        - The ability to access function parameters.

        - The ability to turn an undefined parameter into an array
          (call by reference).

        - The ability to create, access and update global variables.

        - Easy access to all the elements of an array at once ("array
          flattening") in order to loop over all the element in an easy
          fashion for C code.

        - The ability to create arrays (including `gawk''s true
          multidimensional arrays).

   Some additional important goals were:

   * The API should use only features in ISO C 90, so that extensions
     can be written using the widest range of C and C++ compilers. The
     header should include the appropriate `#ifdef __cplusplus' and
     `extern "C"' magic so that a C++ compiler could be used.  (If
     using C++, the runtime system has to be smart enough to call any
     constructors and destructors, as `gawk' is a C program. As of this
     writing, this has not been tested.)

   * The API mechanism should not require access to `gawk''s symbols(1)
     by the compile-time or dynamic linker, in order to enable creation
     of extensions that also work on Windows.

   During development, it became clear that there were other features
that should be available to extensions, which were also subsequently
provided:

   * Extensions should have the ability to hook into `gawk''s I/O
     redirection mechanism.  In particular, the `xgawk' developers
     provided a so-called "open hook" to take over reading records.
     During development, this was generalized to allow extensions to
     hook into input processing, output processing, and two-way I/O.

   * An extension should be able to provide a "call back" function to
     perform clean up actions when `gawk' exits.

   * An extension should be able to provide a version string so that
     `gawk''s `--version' option can provide information about
     extensions as well.

   The requirement to avoid access to `gawk''s symbols is, at first
glance, a difficult one to meet.

   One design, apparently used by Perl and Ruby and maybe others, would
be to make the mainline `gawk' code into a library, with the `gawk'
utility a small C `main()' function linked against the library.

   This seemed like the tail wagging the dog, complicating build and
installation and making a simple copy of the `gawk' executable from one
system to another (or one place to another on the same system!) into a
chancy operation.

   Pat Rankin suggested the solution that was adopted.  *Note Extension
Mechanism Outline::, for the details.

   ---------- Footnotes ----------

   (1) The "symbols" are the variables and functions defined inside
`gawk'.  Access to these symbols by code external to `gawk' loaded
dynamically at runtime is problematic on Windows.


File: gawk.info,  Node: Extension Other Design Decisions,  Next: Extension Future Growth,  Prev: Extension New Mechanism Goals,  Up: Extension Design

C.5.3 Other Design Decisions
----------------------------

As an arbitrary design decision, extensions can read the values of
built-in variables and arrays (such as `ARGV' and `FS'), but cannot
change them, with the exception of `PROCINFO'.

   The reason for this is to prevent an extension function from
affecting the flow of an `awk' program outside its control.  While a
real `awk' function can do what it likes, that is at the discretion of
the programmer.  An extension function should provide a service or make
a C API available for use within `awk', and not mess with `FS' or
`ARGC' and `ARGV'.

   In addition, it becomes easy to start down a slippery slope. How
much access to `gawk' facilities do extensions need?  Do they need
`getline'?  What about calling `gsub()' or compiling regular
expressions?  What about calling into `awk' functions? (_That_ would be
messy.)

   In order to avoid these issues, the `gawk' developers chose to start
with the simplest, most basic features that are still truly useful.

   Another decision is that although `gawk' provides nice things like
MPFR, and arrays indexed internally by integers, these features are not
being brought out to the API in order to keep things simple and close to
traditional `awk' semantics.  (In fact, arrays indexed internally by
integers are so transparent that they aren't even documented!)

   Additionally, all functions in the API check that their pointer
input parameters are not `NULL'. If they are, they return an error.
(It is a good idea for extension code to verify that pointers received
from `gawk' are not `NULL'.  Such a thing should not happen, but the
`gawk' developers are only human, and they have been known to
occasionally make mistakes.)

   With time, the API will undoubtedly evolve; the `gawk' developers
expect this to be driven by user needs. For now, the current API seems
to provide a minimal yet powerful set of features for creating
extensions.


File: gawk.info,  Node: Extension Future Growth,  Prev: Extension Other Design Decisions,  Up: Extension Design

C.5.4 Room For Future Growth
----------------------------

The API can later be expanded, in two ways:

   * `gawk' passes an "extension id" into the extension when it first
     loads the extension.  The extension then passes this id back to
     `gawk' with each function call.  This mechanism allows `gawk' to
     identify the extension calling into it, should it need to know.

   * Similarly, the extension passes a "name space" into `gawk' when it
     registers each extension function.  This accommodates a possible
     future mechanism for grouping extension functions and possibly
     avoiding name conflicts.

   Of course, as of this writing, no decisions have been made with
respect to any of the above.


File: gawk.info,  Node: Old Extension Mechanism,  Prev: Extension Design,  Up: Notes

C.6 Compatibility For Old Extensions
====================================

*note Dynamic Extensions::, describes the supported API and mechanisms
for writing extensions for `gawk'.  This API was introduced in version
4.1.  However, for many years `gawk' provided an extension mechanism
that required knowledge of `gawk' internals and that was not as well
designed.

   In order to provide a transition period, `gawk' version 4.1
continues to support the original extension mechanism.  This will be
true for the life of exactly one major release.  This support will be
withdrawn, and removed from the source code, at the next major release.

   Briefly, original-style extensions should be compiled by including
the `awk.h' header file in the extension source code. Additionally, you
must define the identifier `GAWK' when building (use `-DGAWK' with
Unix-style compilers).  Otherwise, the definitions in `gawkapi.h' will
cause conflicts with those in `awk.h' and your extension will not
compile.

   Just as in previous versions, you load an old-style extension with
the `extension()' built-in function (which is not otherwise documented).
This function in turn finds and loads the shared object file containing
the extension and calls its `dl_load()' C routine.

   Because original-style and new-style extensions use different
initialization routines (`dl_load()' versus `dlload()'), they may safely
be installed in the same directory (to be found by `AWKLIBPATH')
without conflict.

   The `gawk' development team strongly recommends that you convert any
old extensions that you may have to use the new API described in *note
Dynamic Extensions::.


File: gawk.info,  Node: Basic Concepts,  Next: Glossary,  Prev: Notes,  Up: Top

Appendix D Basic Programming Concepts
*************************************

This major node attempts to define some of the basic concepts and terms
that are used throughout the rest of this Info file.  As this Info file
is specifically about `awk', and not about computer programming in
general, the coverage here is by necessity fairly cursory and
simplistic.  (If you need more background, there are many other
introductory texts that you should refer to instead.)

* Menu:

* Basic High Level::            The high level view.
* Basic Data Typing::           A very quick intro to data types.


File: gawk.info,  Node: Basic High Level,  Next: Basic Data Typing,  Up: Basic Concepts

D.1 What a Program Does
=======================

At the most basic level, the job of a program is to process some input
data and produce results. See *note figure-general-flow::.

                  _______
+------+         /       \         +---------+
| Data | -----> < Program > -----> | Results |
+------+         \_______/         +---------+
Figure D.1: General Program Flow

   The "program" in the figure can be either a compiled program(1)
(such as `ls'), or it may be "interpreted".  In the latter case, a
machine-executable program such as `awk' reads your program, and then
uses the instructions in your program to process the data.

   When you write a program, it usually consists of the following, very
basic set of steps, as shown in *note figure-process-flow:::

                              ______
+----------------+           / More \  No       +----------+
| Initialization | -------> <  Data  > -------> | Clean Up |
+----------------+    ^      \   ?  /           +----------+
                      |       +--+-+
                      |          | Yes
                      |          |
                      |          V
                      |     +---------+
                      +-----+ Process |
                            +---------+
Figure D.2: Basic Program Steps

Initialization
     These are the things you do before actually starting to process
     data, such as checking arguments, initializing any data you need
     to work with, and so on.  This step corresponds to `awk''s `BEGIN'
     rule (*note BEGIN/END::).

     If you were baking a cake, this might consist of laying out all the
     mixing bowls and the baking pan, and making sure you have all the
     ingredients that you need.

Processing
     This is where the actual work is done.  Your program reads data,
     one logical chunk at a time, and processes it as appropriate.

     In most programming languages, you have to manually manage the
     reading of data, checking to see if there is more each time you
     read a chunk.  `awk''s pattern-action paradigm (*note Getting
     Started::) handles the mechanics of this for you.

     In baking a cake, the processing corresponds to the actual labor:
     breaking eggs, mixing the flour, water, and other ingredients, and
     then putting the cake into the oven.

Clean Up
     Once you've processed all the data, you may have things you need to
     do before exiting.  This step corresponds to `awk''s `END' rule
     (*note BEGIN/END::).

     After the cake comes out of the oven, you still have to wrap it in
     plastic wrap to keep anyone from tasting it, as well as wash the
     mixing bowls and utensils.

   An "algorithm" is a detailed set of instructions necessary to
accomplish a task, or process data.  It is much the same as a recipe
for baking a cake.  Programs implement algorithms.  Often, it is up to
you to design the algorithm and implement it, simultaneously.

   The "logical chunks" we talked about previously are called "records",
similar to the records a company keeps on employees, a school keeps for
students, or a doctor keeps for patients.  Each record has many
component parts, such as first and last names, date of birth, address,
and so on.  The component parts are referred to as the "fields" of the
record.

   The act of reading data is termed "input", and that of generating
results, not too surprisingly, is termed "output".  They are often
referred to together as "input/output," and even more often, as "I/O"
for short.  (You will also see "input" and "output" used as verbs.)

   `awk' manages the reading of data for you, as well as the breaking
it up into records and fields.  Your program's job is to tell `awk'
what to do with the data.  You do this by describing "patterns" in the
data to look for, and "actions" to execute when those patterns are
seen.  This "data-driven" nature of `awk' programs usually makes them
both easier to write and easier to read.

   ---------- Footnotes ----------

   (1) Compiled programs are typically written in lower-level languages
such as C, C++, or Ada, and then translated, or "compiled", into a form
that the computer can execute directly.


File: gawk.info,  Node: Basic Data Typing,  Prev: Basic High Level,  Up: Basic Concepts

D.2 Data Values in a Computer
=============================

In a program, you keep track of information and values in things called
"variables".  A variable is just a name for a given value, such as
`first_name', `last_name', `address', and so on.  `awk' has several
predefined variables, and it has special names to refer to the current
input record and the fields of the record.  You may also group multiple
associated values under one name, as an array.

   Data, particularly in `awk', consists of either numeric values, such
as 42 or 3.1415927, or string values.  String values are essentially
anything that's not a number, such as a name.  Strings are sometimes
referred to as "character data", since they store the individual
characters that comprise them.  Individual variables, as well as
numeric and string variables, are referred to as "scalar" values.
Groups of values, such as arrays, are not scalars.

   *note General Arithmetic::, provided a basic introduction to numeric
types (integer and floating-point) and how they are used in a computer.
Please review that information, including a number of caveats that were
presented.

   While you are probably used to the idea of a number without a value
(i.e., zero), it takes a bit more getting used to the idea of
zero-length character data.  Nevertheless, such a thing exists.  It is
called the "null string".  The null string is character data that has
no value.  In other words, it is empty.  It is written in `awk' programs
like this: `""'.

   Humans are used to working in decimal; i.e., base 10.  In base 10,
numbers go from 0 to 9, and then "roll over" into the next column.
(Remember grade school? 42 is 4 times 10 plus 2.)

   There are other number bases though.  Computers commonly use base 2
or "binary", base 8 or "octal", and base 16 or "hexadecimal".  In
binary, each column represents two times the value in the column to its
right. Each column may contain either a 0 or a 1.  Thus, binary 1010
represents 1 times 8, plus 0 times 4, plus 1 times 2, plus 0 times 1,
or decimal 10.  Octal and hexadecimal are discussed more in *note
Nondecimal-numbers::.

   At the very lowest level, computers store values as groups of binary
digits, or "bits".  Modern computers group bits into groups of eight,
called "bytes".  Advanced applications sometimes have to manipulate
bits directly, and `gawk' provides functions for doing so.

   Programs are written in programming languages.  Hundreds, if not
thousands, of programming languages exist.  One of the most popular is
the C programming language.  The C language had a very strong influence
on the design of the `awk' language.

   There have been several versions of C.  The first is often referred
to as "K&R" C, after the initials of Brian Kernighan and Dennis Ritchie,
the authors of the first book on C.  (Dennis Ritchie created the
language, and Brian Kernighan was one of the creators of `awk'.)

   In the mid-1980s, an effort began to produce an international
standard for C.  This work culminated in 1989, with the production of
the ANSI standard for C.  This standard became an ISO standard in 1990.
In 1999, a revised ISO C standard was approved and released.  Where it
makes sense, POSIX `awk' is compatible with 1999 ISO C.


File: gawk.info,  Node: Glossary,  Next: Copying,  Prev: Basic Concepts,  Up: Top

Glossary
********

Action
     A series of `awk' statements attached to a rule.  If the rule's
     pattern matches an input record, `awk' executes the rule's action.
     Actions are always enclosed in curly braces.  (*Note Action
     Overview::.)

Amazing `awk' Assembler
     Henry Spencer at the University of Toronto wrote a retargetable
     assembler completely as `sed' and `awk' scripts.  It is thousands
     of lines long, including machine descriptions for several eight-bit
     microcomputers.  It is a good example of a program that would have
     been better written in another language.  You can get it from
     `http://awk.info/?awk100/aaa'.

Ada
     A programming language originally defined by the U.S. Department of
     Defense for embedded programming. It was designed to enforce good
     Software Engineering practices.

Amazingly Workable Formatter (`awf')
     Henry Spencer at the University of Toronto wrote a formatter that
     accepts a large subset of the `nroff -ms' and `nroff -man'
     formatting commands, using `awk' and `sh'.  It is available from
     `http://awk.info/?tools/awf'.

Anchor
     The regexp metacharacters `^' and `$', which force the match to
     the beginning or end of the string, respectively.

ANSI
     The American National Standards Institute.  This organization
     produces many standards, among them the standards for the C and
     C++ programming languages.  These standards often become
     international standards as well. See also "ISO."

Array
     A grouping of multiple values under the same name.  Most languages
     just provide sequential arrays.  `awk' provides associative arrays.

Assertion
     A statement in a program that a condition is true at this point in
     the program.  Useful for reasoning about how a program is supposed
     to behave.

Assignment
     An `awk' expression that changes the value of some `awk' variable
     or data object.  An object that you can assign to is called an
     "lvalue".  The assigned values are called "rvalues".  *Note
     Assignment Ops::.

Associative Array
     Arrays in which the indices may be numbers or strings, not just
     sequential integers in a fixed range.

`awk' Language
     The language in which `awk' programs are written.

`awk' Program
     An `awk' program consists of a series of "patterns" and "actions",
     collectively known as "rules".  For each input record given to the
     program, the program's rules are all processed in turn.  `awk'
     programs may also contain function definitions.

`awk' Script
     Another name for an `awk' program.

Bash
     The GNU version of the standard shell (the Bourne-Again SHell).
     See also "Bourne Shell."

BBS
     See "Bulletin Board System."

Bit
     Short for "Binary Digit."  All values in computer memory
     ultimately reduce to binary digits: values that are either zero or
     one.  Groups of bits may be interpreted differently--as integers,
     floating-point numbers, character data, addresses of other memory
     objects, or other data.  `awk' lets you work with floating-point
     numbers and strings.  `gawk' lets you manipulate bit values with
     the built-in functions described in *note Bitwise Functions::.

     Computers are often defined by how many bits they use to represent
     integer values.  Typical systems are 32-bit systems, but 64-bit
     systems are becoming increasingly popular, and 16-bit systems have
     essentially disappeared.

Boolean Expression
     Named after the English mathematician Boole. See also "Logical
     Expression."

Bourne Shell
     The standard shell (`/bin/sh') on Unix and Unix-like systems,
     originally written by Steven R. Bourne.  Many shells (Bash, `ksh',
     `pdksh', `zsh') are generally upwardly compatible with the Bourne
     shell.

Built-in Function
     The `awk' language provides built-in functions that perform various
     numerical, I/O-related, and string computations.  Examples are
     `sqrt()' (for the square root of a number) and `substr()' (for a
     substring of a string).  `gawk' provides functions for timestamp
     management, bit manipulation, array sorting, type checking, and
     runtime string translation.  (*Note Built-in::.)

Built-in Variable
     `ARGC', `ARGV', `CONVFMT', `ENVIRON', `FILENAME', `FNR', `FS',
     `NF', `NR', `OFMT', `OFS', `ORS', `RLENGTH', `RSTART', `RS', and
     `SUBSEP' are the variables that have special meaning to `awk'.  In
     addition, `ARGIND', `BINMODE', `ERRNO', `FIELDWIDTHS', `FPAT',
     `IGNORECASE', `LINT', `PROCINFO', `RT', and `TEXTDOMAIN' are the
     variables that have special meaning to `gawk'.  Changing some of
     them affects `awk''s running environment.  (*Note Built-in
     Variables::.)

Braces
     See "Curly Braces."

Bulletin Board System
     A computer system allowing users to log in and read and/or leave
     messages for other users of the system, much like leaving paper
     notes on a bulletin board.

C
     The system programming language that most GNU software is written
     in.  The `awk' programming language has C-like syntax, and this
     Info file points out similarities between `awk' and C when
     appropriate.

     In general, `gawk' attempts to be as similar to the 1990 version
     of ISO C as makes sense.

C++
     A popular object-oriented programming language derived from C.

Character Set
     The set of numeric codes used by a computer system to represent the
     characters (letters, numbers, punctuation, etc.) of a particular
     country or place. The most common character set in use today is
     ASCII (American Standard Code for Information Interchange).  Many
     European countries use an extension of ASCII known as ISO-8859-1
     (ISO Latin-1).  The Unicode character set (http://www.unicode.org)
     is becoming increasingly popular and standard, and is particularly
     widely used on GNU/Linux systems.

CHEM
     A preprocessor for `pic' that reads descriptions of molecules and
     produces `pic' input for drawing them.  It was written in `awk' by
     Brian Kernighan and Jon Bentley, and is available from
     `http://netlib.sandia.gov/netlib/typesetting/chem.gz'.

Cookie
     A peculiar goodie, token, saying or remembrance produced by or
     presented to a program. (With thanks to Doug McIlroy.)

Coprocess
     A subordinate program with which two-way communications is
     possible.

Compiler
     A program that translates human-readable source code into
     machine-executable object code.  The object code is then executed
     directly by the computer.  See also "Interpreter."

Compound Statement
     A series of `awk' statements, enclosed in curly braces.  Compound
     statements may be nested.  (*Note Statements::.)

Concatenation
     Concatenating two strings means sticking them together, one after
     another, producing a new string.  For example, the string `foo'
     concatenated with the string `bar' gives the string `foobar'.
     (*Note Concatenation::.)

Conditional Expression
     An expression using the `?:' ternary operator, such as `EXPR1 ?
     EXPR2 : EXPR3'.  The expression EXPR1 is evaluated; if the result
     is true, the value of the whole expression is the value of EXPR2;
     otherwise the value is EXPR3.  In either case, only one of EXPR2
     and EXPR3 is evaluated. (*Note Conditional Exp::.)

Comparison Expression
     A relation that is either true or false, such as `a < b'.
     Comparison expressions are used in `if', `while', `do', and `for'
     statements, and in patterns to select which input records to
     process.  (*Note Typing and Comparison::.)

Curly Braces
     The characters `{' and `}'.  Curly braces are used in `awk' for
     delimiting actions, compound statements, and function bodies.

Dark Corner
     An area in the language where specifications often were (or still
     are) not clear, leading to unexpected or undesirable behavior.
     Such areas are marked in this Info file with "(d.c.)" in the text
     and are indexed under the heading "dark corner."

Data Driven
     A description of `awk' programs, where you specify the data you
     are interested in processing, and what to do when that data is
     seen.

Data Objects
     These are numbers and strings of characters.  Numbers are
     converted into strings and vice versa, as needed.  (*Note
     Conversion::.)

Deadlock
     The situation in which two communicating processes are each waiting
     for the other to perform an action.

Debugger
     A program used to help developers remove "bugs" from (de-bug)
     their programs.

Double Precision
     An internal representation of numbers that can have fractional
     parts.  Double precision numbers keep track of more digits than do
     single precision numbers, but operations on them are sometimes
     more expensive.  This is the way `awk' stores numeric values.  It
     is the C type `double'.

Dynamic Regular Expression
     A dynamic regular expression is a regular expression written as an
     ordinary expression.  It could be a string constant, such as
     `"foo"', but it may also be an expression whose value can vary.
     (*Note Computed Regexps::.)

Environment
     A collection of strings, of the form NAME`='VAL, that each program
     has available to it. Users generally place values into the
     environment in order to provide information to various programs.
     Typical examples are the environment variables `HOME' and `PATH'.

Empty String
     See "Null String."

Epoch
     The date used as the "beginning of time" for timestamps.  Time
     values in most systems are represented as seconds since the epoch,
     with library functions available for converting these values into
     standard date and time formats.

     The epoch on Unix and POSIX systems is 1970-01-01 00:00:00 UTC.
     See also "GMT" and "UTC."

Escape Sequences
     A special sequence of characters used for describing nonprinting
     characters, such as `\n' for newline or `\033' for the ASCII ESC
     (Escape) character. (*Note Escape Sequences::.)

Extension
     An additional feature or change to a programming language or
     utility not defined by that language's or utility's standard.
     `gawk' has (too) many extensions over POSIX `awk'.

FDL
     See "Free Documentation License."

Field
     When `awk' reads an input record, it splits the record into pieces
     separated by whitespace (or by a separator regexp that you can
     change by setting the built-in variable `FS').  Such pieces are
     called fields.  If the pieces are of fixed length, you can use the
     built-in variable `FIELDWIDTHS' to describe their lengths.  If you
     wish to specify the contents of fields instead of the field
     separator, you can use the built-in variable `FPAT' to do so.
     (*Note Field Separators::, *note Constant Size::, and *note
     Splitting By Content::.)

Flag
     A variable whose truth value indicates the existence or
     nonexistence of some condition.

Floating-Point Number
     Often referred to in mathematical terms as a "rational" or real
     number, this is just a number that can have a fractional part.
     See also "Double Precision" and "Single Precision."

Format
     Format strings are used to control the appearance of output in the
     `strftime()' and `sprintf()' functions, and are used in the
     `printf' statement as well.  Also, data conversions from numbers
     to strings are controlled by the format strings contained in the
     built-in variables `CONVFMT' and `OFMT'. (*Note Control Letters::.)

Free Documentation License
     This document describes the terms under which this Info file is
     published and may be copied. (*Note GNU Free Documentation
     License::.)

Function
     A specialized group of statements used to encapsulate general or
     program-specific tasks.  `awk' has a number of built-in functions,
     and also allows you to define your own.  (*Note Functions::.)

FSF
     See "Free Software Foundation."

Free Software Foundation
     A nonprofit organization dedicated to the production and
     distribution of freely distributable software.  It was founded by
     Richard M. Stallman, the author of the original Emacs editor.  GNU
     Emacs is the most widely used version of Emacs today.

`gawk'
     The GNU implementation of `awk'.

General Public License
     This document describes the terms under which `gawk' and its source
     code may be distributed. (*Note Copying::.)

GMT
     "Greenwich Mean Time."  This is the old term for UTC.  It is the
     time of day used internally for Unix and POSIX systems.  See also
     "Epoch" and "UTC."

GNU
     "GNU's not Unix".  An on-going project of the Free Software
     Foundation to create a complete, freely distributable,
     POSIX-compliant computing environment.

GNU/Linux
     A variant of the GNU system using the Linux kernel, instead of the
     Free Software Foundation's Hurd kernel.  The Linux kernel is a
     stable, efficient, full-featured clone of Unix that has been
     ported to a variety of architectures.  It is most popular on
     PC-class systems, but runs well on a variety of other systems too.
     The Linux kernel source code is available under the terms of the
     GNU General Public License, which is perhaps its most important
     aspect.

GPL
     See "General Public License."

Hexadecimal
     Base 16 notation, where the digits are `0'-`9' and `A'-`F', with
     `A' representing 10, `B' representing 11, and so on, up to `F' for
     15.  Hexadecimal numbers are written in C using a leading `0x', to
     indicate their base.  Thus, `0x12' is 18 (1 times 16 plus 2).
     *Note Nondecimal-numbers::.

I/O
     Abbreviation for "Input/Output," the act of moving data into and/or
     out of a running program.

Input Record
     A single chunk of data that is read in by `awk'.  Usually, an
     `awk' input record consists of one line of text.  (*Note
     Records::.)

Integer
     A whole number, i.e., a number that does not have a fractional
     part.

Internationalization
     The process of writing or modifying a program so that it can use
     multiple languages without requiring further source code changes.

Interpreter
     A program that reads human-readable source code directly, and uses
     the instructions in it to process data and produce results.  `awk'
     is typically (but not always) implemented as an interpreter.  See
     also "Compiler."

Interval Expression
     A component of a regular expression that lets you specify repeated
     matches of some part of the regexp.  Interval expressions were not
     originally available in `awk' programs.

ISO
     The International Organization for Standardization.  This
     organization produces international standards for many things,
     including programming languages, such as C and C++.  In the
     computer arena, important standards like those for C, C++, and
     POSIX become both American national and ISO international
     standards simultaneously.  This Info file refers to Standard C as
     "ISO C" throughout.  See the ISO website
     (http://www.iso.org/iso/home/about.htm) for more information about
     the name of the organization and its language-independent
     three-letter acronym.

Java
     A modern programming language originally developed by Sun
     Microsystems (now Oracle) supporting Object-Oriented programming.
     Although usually implemented by compiling to the instructions for
     a standard virtual machine (the JVM), the language can be compiled
     to native code.

Keyword
     In the `awk' language, a keyword is a word that has special
     meaning.  Keywords are reserved and may not be used as variable
     names.

     `gawk''s keywords are: `BEGIN', `BEGINFILE', `END', `ENDFILE',
     `break', `case', `continue', `default' `delete', `do...while',
     `else', `exit', `for...in', `for', `function', `func', `if',
     `nextfile', `next', `switch', and `while'.

Lesser General Public License
     This document describes the terms under which binary library
     archives or shared objects, and their source code may be
     distributed.

Linux
     See "GNU/Linux."

LGPL
     See "Lesser General Public License."

Localization
     The process of providing the data necessary for an
     internationalized program to work in a particular language.

Logical Expression
     An expression using the operators for logic, AND, OR, and NOT,
     written `&&', `||', and `!' in `awk'. Often called Boolean
     expressions, after the mathematician who pioneered this kind of
     mathematical logic.

Lvalue
     An expression that can appear on the left side of an assignment
     operator.  In most languages, lvalues can be variables or array
     elements.  In `awk', a field designator can also be used as an
     lvalue.

Matching
     The act of testing a string against a regular expression.  If the
     regexp describes the contents of the string, it is said to "match"
     it.

Metacharacters
     Characters used within a regexp that do not stand for themselves.
     Instead, they denote regular expression operations, such as
     repetition, grouping, or alternation.

No-op
     An operation that does nothing.

Null String
     A string with no characters in it.  It is represented explicitly in
     `awk' programs by placing two double quote characters next to each
     other (`""').  It can appear in input data by having two successive
     occurrences of the field separator appear next to each other.

Number
     A numeric-valued data object.  Modern `awk' implementations use
     double precision floating-point to represent numbers.  Ancient
     `awk' implementations used single precision floating-point.

Octal
     Base-eight notation, where the digits are `0'-`7'.  Octal numbers
     are written in C using a leading `0', to indicate their base.
     Thus, `013' is 11 (one times 8 plus 3).  *Note
     Nondecimal-numbers::.

P1003.1
     See "POSIX."

Pattern
     Patterns tell `awk' which input records are interesting to which
     rules.

     A pattern is an arbitrary conditional expression against which
     input is tested.  If the condition is satisfied, the pattern is
     said to "match" the input record.  A typical pattern might compare
     the input record against a regular expression. (*Note Pattern
     Overview::.)

PEBKAC
     An acronym describing what is possibly the most frequent source of
     computer usage problems. (Problem Exists Between Keyboard And
     Chair.)

POSIX
     The name for a series of standards that specify a Portable
     Operating System interface.  The "IX" denotes the Unix heritage of
     these standards.  The main standard of interest for `awk' users is
     `IEEE Standard for Information Technology, Standard 1003.1-2008'.
     The 2008 POSIX standard can be found online at
     `http://www.opengroup.org/onlinepubs/9699919799/'.

Precedence
     The order in which operations are performed when operators are used
     without explicit parentheses.

Private
     Variables and/or functions that are meant for use exclusively by
     library functions and not for the main `awk' program. Special care
     must be taken when naming such variables and functions.  (*Note
     Library Names::.)

Range (of input lines)
     A sequence of consecutive lines from the input file(s).  A pattern
     can specify ranges of input lines for `awk' to process or it can
     specify single lines. (*Note Pattern Overview::.)

Recursion
     When a function calls itself, either directly or indirectly.  As
     long as this is not clear, refer to the entry for "recursion."  If
     this is clear, stop, and proceed to the next entry.

Redirection
     Redirection means performing input from something other than the
     standard input stream, or performing output to something other
     than the standard output stream.

     You can redirect input to the `getline' statement using the `<',
     `|', and `|&' operators.  You can redirect the output of the
     `print' and `printf' statements to a file or a system command,
     using the `>', `>>', `|', and `|&' operators.  (*Note Getline::,
     and *note Redirection::.)

Regexp
     See "Regular Expression."

Regular Expression
     A regular expression ("regexp" for short) is a pattern that
     denotes a set of strings, possibly an infinite set.  For example,
     the regular expression `R.*xp' matches any string starting with
     the letter `R' and ending with the letters `xp'.  In `awk',
     regular expressions are used in patterns and in conditional
     expressions.  Regular expressions may contain escape sequences.
     (*Note Regexp::.)

Regular Expression Constant
     A regular expression constant is a regular expression written
     within slashes, such as `/foo/'.  This regular expression is chosen
     when you write the `awk' program and cannot be changed during its
     execution. (*Note Regexp Usage::.)

Rule
     A segment of an `awk' program that specifies how to process single
     input records.  A rule consists of a "pattern" and an "action".
     `awk' reads an input record; then, for each rule, if the input
     record satisfies the rule's pattern, `awk' executes the rule's
     action.  Otherwise, the rule does nothing for that input record.

Rvalue
     A value that can appear on the right side of an assignment
     operator.  In `awk', essentially every expression has a value.
     These values are rvalues.

Scalar
     A single value, be it a number or a string.  Regular variables are
     scalars; arrays and functions are not.

Search Path
     In `gawk', a list of directories to search for `awk' program
     source files.  In the shell, a list of directories to search for
     executable programs.

Seed
     The initial value, or starting point, for a sequence of random
     numbers.

`sed'
     See "Stream Editor."

Shell
     The command interpreter for Unix and POSIX-compliant systems.  The
     shell works both interactively, and as a programming language for
     batch files, or shell scripts.

Short-Circuit
     The nature of the `awk' logical operators `&&' and `||'.  If the
     value of the entire expression is determinable from evaluating just
     the lefthand side of these operators, the righthand side is not
     evaluated.  (*Note Boolean Ops::.)

Side Effect
     A side effect occurs when an expression has an effect aside from
     merely producing a value.  Assignment expressions, increment and
     decrement expressions, and function calls have side effects.
     (*Note Assignment Ops::.)

Single Precision
     An internal representation of numbers that can have fractional
     parts.  Single precision numbers keep track of fewer digits than
     do double precision numbers, but operations on them are sometimes
     less expensive in terms of CPU time.  This is the type used by
     some very old versions of `awk' to store numeric values.  It is
     the C type `float'.

Space
     The character generated by hitting the space bar on the keyboard.

Special File
     A file name interpreted internally by `gawk', instead of being
     handed directly to the underlying operating system--for example,
     `/dev/stderr'.  (*Note Special Files::.)

Stream Editor
     A program that reads records from an input stream and processes
     them one or more at a time.  This is in contrast with batch
     programs, which may expect to read their input files in entirety
     before starting to do anything, as well as with interactive
     programs which require input from the user.

String
     A datum consisting of a sequence of characters, such as `I am a
     string'.  Constant strings are written with double quotes in the
     `awk' language and may contain escape sequences.  (*Note Escape
     Sequences::.)

Tab
     The character generated by hitting the `TAB' key on the keyboard.
     It usually expands to up to eight spaces upon output.

Text Domain
     A unique name that identifies an application.  Used for grouping
     messages that are translated at runtime into the local language.

Timestamp
     A value in the "seconds since the epoch" format used by Unix and
     POSIX systems.  Used for the `gawk' functions `mktime()',
     `strftime()', and `systime()'.  See also "Epoch" and "UTC."

Unix
     A computer operating system originally developed in the early
     1970's at AT&T Bell Laboratories.  It initially became popular in
     universities around the world and later moved into commercial
     environments as a software development system and network server
     system. There are many commercial versions of Unix, as well as
     several work-alike systems whose source code is freely available
     (such as GNU/Linux, NetBSD (http://www.netbsd.org), FreeBSD
     (http://www.freebsd.org), and OpenBSD (http://www.openbsd.org)).

UTC
     The accepted abbreviation for "Universal Coordinated Time."  This
     is standard time in Greenwich, England, which is used as a
     reference time for day and date calculations.  See also "Epoch"
     and "GMT."

Whitespace
     A sequence of space, TAB, or newline characters occurring inside
     an input record or a string.


File: gawk.info,  Node: Copying,  Next: GNU Free Documentation License,  Prev: Glossary,  Up: Top

GNU General Public License
**************************

                        Version 3, 29 June 2007

     Copyright (C) 2007 Free Software Foundation, Inc. `http://fsf.org/'

     Everyone is permitted to copy and distribute verbatim copies of this
     license document, but changing it is not allowed.

Preamble
========

The GNU General Public License is a free, copyleft license for software
and other kinds of works.

   The licenses for most software and other practical works are designed
to take away your freedom to share and change the works.  By contrast,
the GNU General Public License is intended to guarantee your freedom to
share and change all versions of a program--to make sure it remains
free software for all its users.  We, the Free Software Foundation, use
the GNU General Public License for most of our software; it applies
also to any other work released this way by its authors.  You can apply
it to your programs, too.

   When we speak of free software, we are referring to freedom, not
price.  Our General Public Licenses are designed to make sure that you
have the freedom to distribute copies of free software (and charge for
them if you wish), that you receive source code or can get it if you
want it, that you can change the software or use pieces of it in new
free programs, and that you know you can do these things.

   To protect your rights, we need to prevent others from denying you
these rights or asking you to surrender the rights.  Therefore, you
have certain responsibilities if you distribute copies of the software,
or if you modify it: responsibilities to respect the freedom of others.

   For example, if you distribute copies of such a program, whether
gratis or for a fee, you must pass on to the recipients the same
freedoms that you received.  You must make sure that they, too, receive
or can get the source code.  And you must show them these terms so they
know their rights.

   Developers that use the GNU GPL protect your rights with two steps:
(1) assert copyright on the software, and (2) offer you this License
giving you legal permission to copy, distribute and/or modify it.

   For the developers' and authors' protection, the GPL clearly explains
that there is no warranty for this free software.  For both users' and
authors' sake, the GPL requires that modified versions be marked as
changed, so that their problems will not be attributed erroneously to
authors of previous versions.

   Some devices are designed to deny users access to install or run
modified versions of the software inside them, although the
manufacturer can do so.  This is fundamentally incompatible with the
aim of protecting users' freedom to change the software.  The
systematic pattern of such abuse occurs in the area of products for
individuals to use, which is precisely where it is most unacceptable.
Therefore, we have designed this version of the GPL to prohibit the
practice for those products.  If such problems arise substantially in
other domains, we stand ready to extend this provision to those domains
in future versions of the GPL, as needed to protect the freedom of
users.

   Finally, every program is threatened constantly by software patents.
States should not allow patents to restrict development and use of
software on general-purpose computers, but in those that do, we wish to
avoid the special danger that patents applied to a free program could
make it effectively proprietary.  To prevent this, the GPL assures that
patents cannot be used to render the program non-free.

   The precise terms and conditions for copying, distribution and
modification follow.

TERMS AND CONDITIONS
====================

  0. Definitions.

     "This License" refers to version 3 of the GNU General Public
     License.

     "Copyright" also means copyright-like laws that apply to other
     kinds of works, such as semiconductor masks.

     "The Program" refers to any copyrightable work licensed under this
     License.  Each licensee is addressed as "you".  "Licensees" and
     "recipients" may be individuals or organizations.

     To "modify" a work means to copy from or adapt all or part of the
     work in a fashion requiring copyright permission, other than the
     making of an exact copy.  The resulting work is called a "modified
     version" of the earlier work or a work "based on" the earlier work.

     A "covered work" means either the unmodified Program or a work
     based on the Program.

     To "propagate" a work means to do anything with it that, without
     permission, would make you directly or secondarily liable for
     infringement under applicable copyright law, except executing it
     on a computer or modifying a private copy.  Propagation includes
     copying, distribution (with or without modification), making
     available to the public, and in some countries other activities as
     well.

     To "convey" a work means any kind of propagation that enables other
     parties to make or receive copies.  Mere interaction with a user
     through a computer network, with no transfer of a copy, is not
     conveying.

     An interactive user interface displays "Appropriate Legal Notices"
     to the extent that it includes a convenient and prominently visible
     feature that (1) displays an appropriate copyright notice, and (2)
     tells the user that there is no warranty for the work (except to
     the extent that warranties are provided), that licensees may
     convey the work under this License, and how to view a copy of this
     License.  If the interface presents a list of user commands or
     options, such as a menu, a prominent item in the list meets this
     criterion.

  1. Source Code.

     The "source code" for a work means the preferred form of the work
     for making modifications to it.  "Object code" means any
     non-source form of a work.

     A "Standard Interface" means an interface that either is an
     official standard defined by a recognized standards body, or, in
     the case of interfaces specified for a particular programming
     language, one that is widely used among developers working in that
     language.

     The "System Libraries" of an executable work include anything,
     other than the work as a whole, that (a) is included in the normal
     form of packaging a Major Component, but which is not part of that
     Major Component, and (b) serves only to enable use of the work
     with that Major Component, or to implement a Standard Interface
     for which an implementation is available to the public in source
     code form.  A "Major Component", in this context, means a major
     essential component (kernel, window system, and so on) of the
     specific operating system (if any) on which the executable work
     runs, or a compiler used to produce the work, or an object code
     interpreter used to run it.

     The "Corresponding Source" for a work in object code form means all
     the source code needed to generate, install, and (for an executable
     work) run the object code and to modify the work, including
     scripts to control those activities.  However, it does not include
     the work's System Libraries, or general-purpose tools or generally
     available free programs which are used unmodified in performing
     those activities but which are not part of the work.  For example,
     Corresponding Source includes interface definition files
     associated with source files for the work, and the source code for
     shared libraries and dynamically linked subprograms that the work
     is specifically designed to require, such as by intimate data
     communication or control flow between those subprograms and other
     parts of the work.

     The Corresponding Source need not include anything that users can
     regenerate automatically from other parts of the Corresponding
     Source.

     The Corresponding Source for a work in source code form is that
     same work.

  2. Basic Permissions.

     All rights granted under this License are granted for the term of
     copyright on the Program, and are irrevocable provided the stated
     conditions are met.  This License explicitly affirms your unlimited
     permission to run the unmodified Program.  The output from running
     a covered work is covered by this License only if the output,
     given its content, constitutes a covered work.  This License
     acknowledges your rights of fair use or other equivalent, as
     provided by copyright law.

     You may make, run and propagate covered works that you do not
     convey, without conditions so long as your license otherwise
     remains in force.  You may convey covered works to others for the
     sole purpose of having them make modifications exclusively for
     you, or provide you with facilities for running those works,
     provided that you comply with the terms of this License in
     conveying all material for which you do not control copyright.
     Those thus making or running the covered works for you must do so
     exclusively on your behalf, under your direction and control, on
     terms that prohibit them from making any copies of your
     copyrighted material outside their relationship with you.

     Conveying under any other circumstances is permitted solely under
     the conditions stated below.  Sublicensing is not allowed; section
     10 makes it unnecessary.

  3. Protecting Users' Legal Rights From Anti-Circumvention Law.

     No covered work shall be deemed part of an effective technological
     measure under any applicable law fulfilling obligations under
     article 11 of the WIPO copyright treaty adopted on 20 December
     1996, or similar laws prohibiting or restricting circumvention of
     such measures.

     When you convey a covered work, you waive any legal power to forbid
     circumvention of technological measures to the extent such
     circumvention is effected by exercising rights under this License
     with respect to the covered work, and you disclaim any intention
     to limit operation or modification of the work as a means of
     enforcing, against the work's users, your or third parties' legal
     rights to forbid circumvention of technological measures.

  4. Conveying Verbatim Copies.

     You may convey verbatim copies of the Program's source code as you
     receive it, in any medium, provided that you conspicuously and
     appropriately publish on each copy an appropriate copyright notice;
     keep intact all notices stating that this License and any
     non-permissive terms added in accord with section 7 apply to the
     code; keep intact all notices of the absence of any warranty; and
     give all recipients a copy of this License along with the Program.

     You may charge any price or no price for each copy that you convey,
     and you may offer support or warranty protection for a fee.

  5. Conveying Modified Source Versions.

     You may convey a work based on the Program, or the modifications to
     produce it from the Program, in the form of source code under the
     terms of section 4, provided that you also meet all of these
     conditions:

       a. The work must carry prominent notices stating that you
          modified it, and giving a relevant date.

       b. The work must carry prominent notices stating that it is
          released under this License and any conditions added under
          section 7.  This requirement modifies the requirement in
          section 4 to "keep intact all notices".

       c. You must license the entire work, as a whole, under this
          License to anyone who comes into possession of a copy.  This
          License will therefore apply, along with any applicable
          section 7 additional terms, to the whole of the work, and all
          its parts, regardless of how they are packaged.  This License
          gives no permission to license the work in any other way, but
          it does not invalidate such permission if you have separately
          received it.

       d. If the work has interactive user interfaces, each must display
          Appropriate Legal Notices; however, if the Program has
          interactive interfaces that do not display Appropriate Legal
          Notices, your work need not make them do so.

     A compilation of a covered work with other separate and independent
     works, which are not by their nature extensions of the covered
     work, and which are not combined with it such as to form a larger
     program, in or on a volume of a storage or distribution medium, is
     called an "aggregate" if the compilation and its resulting
     copyright are not used to limit the access or legal rights of the
     compilation's users beyond what the individual works permit.
     Inclusion of a covered work in an aggregate does not cause this
     License to apply to the other parts of the aggregate.

  6. Conveying Non-Source Forms.

     You may convey a covered work in object code form under the terms
     of sections 4 and 5, provided that you also convey the
     machine-readable Corresponding Source under the terms of this
     License, in one of these ways:

       a. Convey the object code in, or embodied in, a physical product
          (including a physical distribution medium), accompanied by the
          Corresponding Source fixed on a durable physical medium
          customarily used for software interchange.

       b. Convey the object code in, or embodied in, a physical product
          (including a physical distribution medium), accompanied by a
          written offer, valid for at least three years and valid for
          as long as you offer spare parts or customer support for that
          product model, to give anyone who possesses the object code
          either (1) a copy of the Corresponding Source for all the
          software in the product that is covered by this License, on a
          durable physical medium customarily used for software
          interchange, for a price no more than your reasonable cost of
          physically performing this conveying of source, or (2) access
          to copy the Corresponding Source from a network server at no
          charge.

       c. Convey individual copies of the object code with a copy of
          the written offer to provide the Corresponding Source.  This
          alternative is allowed only occasionally and noncommercially,
          and only if you received the object code with such an offer,
          in accord with subsection 6b.

       d. Convey the object code by offering access from a designated
          place (gratis or for a charge), and offer equivalent access
          to the Corresponding Source in the same way through the same
          place at no further charge.  You need not require recipients
          to copy the Corresponding Source along with the object code.
          If the place to copy the object code is a network server, the
          Corresponding Source may be on a different server (operated
          by you or a third party) that supports equivalent copying
          facilities, provided you maintain clear directions next to
          the object code saying where to find the Corresponding Source.
          Regardless of what server hosts the Corresponding Source, you
          remain obligated to ensure that it is available for as long
          as needed to satisfy these requirements.

       e. Convey the object code using peer-to-peer transmission,
          provided you inform other peers where the object code and
          Corresponding Source of the work are being offered to the
          general public at no charge under subsection 6d.


     A separable portion of the object code, whose source code is
     excluded from the Corresponding Source as a System Library, need
     not be included in conveying the object code work.

     A "User Product" is either (1) a "consumer product", which means
     any tangible personal property which is normally used for personal,
     family, or household purposes, or (2) anything designed or sold for
     incorporation into a dwelling.  In determining whether a product
     is a consumer product, doubtful cases shall be resolved in favor of
     coverage.  For a particular product received by a particular user,
     "normally used" refers to a typical or common use of that class of
     product, regardless of the status of the particular user or of the
     way in which the particular user actually uses, or expects or is
     expected to use, the product.  A product is a consumer product
     regardless of whether the product has substantial commercial,
     industrial or non-consumer uses, unless such uses represent the
     only significant mode of use of the product.

     "Installation Information" for a User Product means any methods,
     procedures, authorization keys, or other information required to
     install and execute modified versions of a covered work in that
     User Product from a modified version of its Corresponding Source.
     The information must suffice to ensure that the continued
     functioning of the modified object code is in no case prevented or
     interfered with solely because modification has been made.

     If you convey an object code work under this section in, or with,
     or specifically for use in, a User Product, and the conveying
     occurs as part of a transaction in which the right of possession
     and use of the User Product is transferred to the recipient in
     perpetuity or for a fixed term (regardless of how the transaction
     is characterized), the Corresponding Source conveyed under this
     section must be accompanied by the Installation Information.  But
     this requirement does not apply if neither you nor any third party
     retains the ability to install modified object code on the User
     Product (for example, the work has been installed in ROM).

     The requirement to provide Installation Information does not
     include a requirement to continue to provide support service,
     warranty, or updates for a work that has been modified or
     installed by the recipient, or for the User Product in which it
     has been modified or installed.  Access to a network may be denied
     when the modification itself materially and adversely affects the
     operation of the network or violates the rules and protocols for
     communication across the network.

     Corresponding Source conveyed, and Installation Information
     provided, in accord with this section must be in a format that is
     publicly documented (and with an implementation available to the
     public in source code form), and must require no special password
     or key for unpacking, reading or copying.

  7. Additional Terms.

     "Additional permissions" are terms that supplement the terms of
     this License by making exceptions from one or more of its
     conditions.  Additional permissions that are applicable to the
     entire Program shall be treated as though they were included in
     this License, to the extent that they are valid under applicable
     law.  If additional permissions apply only to part of the Program,
     that part may be used separately under those permissions, but the
     entire Program remains governed by this License without regard to
     the additional permissions.

     When you convey a copy of a covered work, you may at your option
     remove any additional permissions from that copy, or from any part
     of it.  (Additional permissions may be written to require their own
     removal in certain cases when you modify the work.)  You may place
     additional permissions on material, added by you to a covered work,
     for which you have or can give appropriate copyright permission.

     Notwithstanding any other provision of this License, for material
     you add to a covered work, you may (if authorized by the copyright
     holders of that material) supplement the terms of this License
     with terms:

       a. Disclaiming warranty or limiting liability differently from
          the terms of sections 15 and 16 of this License; or

       b. Requiring preservation of specified reasonable legal notices
          or author attributions in that material or in the Appropriate
          Legal Notices displayed by works containing it; or

       c. Prohibiting misrepresentation of the origin of that material,
          or requiring that modified versions of such material be
          marked in reasonable ways as different from the original
          version; or

       d. Limiting the use for publicity purposes of names of licensors
          or authors of the material; or

       e. Declining to grant rights under trademark law for use of some
          trade names, trademarks, or service marks; or

       f. Requiring indemnification of licensors and authors of that
          material by anyone who conveys the material (or modified
          versions of it) with contractual assumptions of liability to
          the recipient, for any liability that these contractual
          assumptions directly impose on those licensors and authors.

     All other non-permissive additional terms are considered "further
     restrictions" within the meaning of section 10.  If the Program as
     you received it, or any part of it, contains a notice stating that
     it is governed by this License along with a term that is a further
     restriction, you may remove that term.  If a license document
     contains a further restriction but permits relicensing or
     conveying under this License, you may add to a covered work
     material governed by the terms of that license document, provided
     that the further restriction does not survive such relicensing or
     conveying.

     If you add terms to a covered work in accord with this section, you
     must place, in the relevant source files, a statement of the
     additional terms that apply to those files, or a notice indicating
     where to find the applicable terms.

     Additional terms, permissive or non-permissive, may be stated in
     the form of a separately written license, or stated as exceptions;
     the above requirements apply either way.

  8. Termination.

     You may not propagate or modify a covered work except as expressly
     provided under this License.  Any attempt otherwise to propagate or
     modify it is void, and will automatically terminate your rights
     under this License (including any patent licenses granted under
     the third paragraph of section 11).

     However, if you cease all violation of this License, then your
     license from a particular copyright holder is reinstated (a)
     provisionally, unless and until the copyright holder explicitly
     and finally terminates your license, and (b) permanently, if the
     copyright holder fails to notify you of the violation by some
     reasonable means prior to 60 days after the cessation.

     Moreover, your license from a particular copyright holder is
     reinstated permanently if the copyright holder notifies you of the
     violation by some reasonable means, this is the first time you have
     received notice of violation of this License (for any work) from
     that copyright holder, and you cure the violation prior to 30 days
     after your receipt of the notice.

     Termination of your rights under this section does not terminate
     the licenses of parties who have received copies or rights from
     you under this License.  If your rights have been terminated and
     not permanently reinstated, you do not qualify to receive new
     licenses for the same material under section 10.

  9. Acceptance Not Required for Having Copies.

     You are not required to accept this License in order to receive or
     run a copy of the Program.  Ancillary propagation of a covered work
     occurring solely as a consequence of using peer-to-peer
     transmission to receive a copy likewise does not require
     acceptance.  However, nothing other than this License grants you
     permission to propagate or modify any covered work.  These actions
     infringe copyright if you do not accept this License.  Therefore,
     by modifying or propagating a covered work, you indicate your
     acceptance of this License to do so.

 10. Automatic Licensing of Downstream Recipients.

     Each time you convey a covered work, the recipient automatically
     receives a license from the original licensors, to run, modify and
     propagate that work, subject to this License.  You are not
     responsible for enforcing compliance by third parties with this
     License.

     An "entity transaction" is a transaction transferring control of an
     organization, or substantially all assets of one, or subdividing an
     organization, or merging organizations.  If propagation of a
     covered work results from an entity transaction, each party to that
     transaction who receives a copy of the work also receives whatever
     licenses to the work the party's predecessor in interest had or
     could give under the previous paragraph, plus a right to
     possession of the Corresponding Source of the work from the
     predecessor in interest, if the predecessor has it or can get it
     with reasonable efforts.

     You may not impose any further restrictions on the exercise of the
     rights granted or affirmed under this License.  For example, you
     may not impose a license fee, royalty, or other charge for
     exercise of rights granted under this License, and you may not
     initiate litigation (including a cross-claim or counterclaim in a
     lawsuit) alleging that any patent claim is infringed by making,
     using, selling, offering for sale, or importing the Program or any
     portion of it.

 11. Patents.

     A "contributor" is a copyright holder who authorizes use under this
     License of the Program or a work on which the Program is based.
     The work thus licensed is called the contributor's "contributor
     version".

     A contributor's "essential patent claims" are all patent claims
     owned or controlled by the contributor, whether already acquired or
     hereafter acquired, that would be infringed by some manner,
     permitted by this License, of making, using, or selling its
     contributor version, but do not include claims that would be
     infringed only as a consequence of further modification of the
     contributor version.  For purposes of this definition, "control"
     includes the right to grant patent sublicenses in a manner
     consistent with the requirements of this License.

     Each contributor grants you a non-exclusive, worldwide,
     royalty-free patent license under the contributor's essential
     patent claims, to make, use, sell, offer for sale, import and
     otherwise run, modify and propagate the contents of its
     contributor version.

     In the following three paragraphs, a "patent license" is any
     express agreement or commitment, however denominated, not to
     enforce a patent (such as an express permission to practice a
     patent or covenant not to sue for patent infringement).  To
     "grant" such a patent license to a party means to make such an
     agreement or commitment not to enforce a patent against the party.

     If you convey a covered work, knowingly relying on a patent
     license, and the Corresponding Source of the work is not available
     for anyone to copy, free of charge and under the terms of this
     License, through a publicly available network server or other
     readily accessible means, then you must either (1) cause the
     Corresponding Source to be so available, or (2) arrange to deprive
     yourself of the benefit of the patent license for this particular
     work, or (3) arrange, in a manner consistent with the requirements
     of this License, to extend the patent license to downstream
     recipients.  "Knowingly relying" means you have actual knowledge
     that, but for the patent license, your conveying the covered work
     in a country, or your recipient's use of the covered work in a
     country, would infringe one or more identifiable patents in that
     country that you have reason to believe are valid.

     If, pursuant to or in connection with a single transaction or
     arrangement, you convey, or propagate by procuring conveyance of, a
     covered work, and grant a patent license to some of the parties
     receiving the covered work authorizing them to use, propagate,
     modify or convey a specific copy of the covered work, then the
     patent license you grant is automatically extended to all
     recipients of the covered work and works based on it.

     A patent license is "discriminatory" if it does not include within
     the scope of its coverage, prohibits the exercise of, or is
     conditioned on the non-exercise of one or more of the rights that
     are specifically granted under this License.  You may not convey a
     covered work if you are a party to an arrangement with a third
     party that is in the business of distributing software, under
     which you make payment to the third party based on the extent of
     your activity of conveying the work, and under which the third
     party grants, to any of the parties who would receive the covered
     work from you, a discriminatory patent license (a) in connection
     with copies of the covered work conveyed by you (or copies made
     from those copies), or (b) primarily for and in connection with
     specific products or compilations that contain the covered work,
     unless you entered into that arrangement, or that patent license
     was granted, prior to 28 March 2007.

     Nothing in this License shall be construed as excluding or limiting
     any implied license or other defenses to infringement that may
     otherwise be available to you under applicable patent law.

 12. No Surrender of Others' Freedom.

     If conditions are imposed on you (whether by court order,
     agreement or otherwise) that contradict the conditions of this
     License, they do not excuse you from the conditions of this
     License.  If you cannot convey a covered work so as to satisfy
     simultaneously your obligations under this License and any other
     pertinent obligations, then as a consequence you may not convey it
     at all.  For example, if you agree to terms that obligate you to
     collect a royalty for further conveying from those to whom you
     convey the Program, the only way you could satisfy both those
     terms and this License would be to refrain entirely from conveying
     the Program.

 13. Use with the GNU Affero General Public License.

     Notwithstanding any other provision of this License, you have
     permission to link or combine any covered work with a work licensed
     under version 3 of the GNU Affero General Public License into a
     single combined work, and to convey the resulting work.  The terms
     of this License will continue to apply to the part which is the
     covered work, but the special requirements of the GNU Affero
     General Public License, section 13, concerning interaction through
     a network will apply to the combination as such.

 14. Revised Versions of this License.

     The Free Software Foundation may publish revised and/or new
     versions of the GNU General Public License from time to time.
     Such new versions will be similar in spirit to the present
     version, but may differ in detail to address new problems or
     concerns.

     Each version is given a distinguishing version number.  If the
     Program specifies that a certain numbered version of the GNU
     General Public License "or any later version" applies to it, you
     have the option of following the terms and conditions either of
     that numbered version or of any later version published by the
     Free Software Foundation.  If the Program does not specify a
     version number of the GNU General Public License, you may choose
     any version ever published by the Free Software Foundation.

     If the Program specifies that a proxy can decide which future
     versions of the GNU General Public License can be used, that
     proxy's public statement of acceptance of a version permanently
     authorizes you to choose that version for the Program.

     Later license versions may give you additional or different
     permissions.  However, no additional obligations are imposed on any
     author or copyright holder as a result of your choosing to follow a
     later version.

 15. Disclaimer of Warranty.

     THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
     APPLICABLE LAW.  EXCEPT WHEN OTHERWISE STATED IN WRITING THE
     COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS"
     WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED,
     INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
     MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE
     RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.
     SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL
     NECESSARY SERVICING, REPAIR OR CORRECTION.

 16. Limitation of Liability.

     IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
     WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES
     AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU
     FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
     CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE
     THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA
     BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
     PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
     PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF
     THE POSSIBILITY OF SUCH DAMAGES.

 17. Interpretation of Sections 15 and 16.

     If the disclaimer of warranty and limitation of liability provided
     above cannot be given local legal effect according to their terms,
     reviewing courts shall apply local law that most closely
     approximates an absolute waiver of all civil liability in
     connection with the Program, unless a warranty or assumption of
     liability accompanies a copy of the Program in return for a fee.


END OF TERMS AND CONDITIONS
===========================

How to Apply These Terms to Your New Programs
=============================================

If you develop a new program, and you want it to be of the greatest
possible use to the public, the best way to achieve this is to make it
free software which everyone can redistribute and change under these
terms.

   To do so, attach the following notices to the program.  It is safest
to attach them to the start of each source file to most effectively
state the exclusion of warranty; and each file should have at least the
"copyright" line and a pointer to where the full notice is found.

     ONE LINE TO GIVE THE PROGRAM'S NAME AND A BRIEF IDEA OF WHAT IT DOES.
     Copyright (C) YEAR NAME OF AUTHOR

     This program is free software: you can redistribute it and/or modify
     it under the terms of the GNU General Public License as published by
     the Free Software Foundation, either version 3 of the License, or (at
     your option) any later version.

     This program is distributed in the hope that it will be useful, but
     WITHOUT ANY WARRANTY; without even the implied warranty of
     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
     General Public License for more details.

     You should have received a copy of the GNU General Public License
     along with this program.  If not, see `http://www.gnu.org/licenses/'.

   Also add information on how to contact you by electronic and paper
mail.

   If the program does terminal interaction, make it output a short
notice like this when it starts in an interactive mode:

     PROGRAM Copyright (C) YEAR NAME OF AUTHOR
     This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
     This is free software, and you are welcome to redistribute it
     under certain conditions; type `show c' for details.

   The hypothetical commands `show w' and `show c' should show the
appropriate parts of the General Public License.  Of course, your
program's commands might be different; for a GUI interface, you would
use an "about box".

   You should also get your employer (if you work as a programmer) or
school, if any, to sign a "copyright disclaimer" for the program, if
necessary.  For more information on this, and how to apply and follow
the GNU GPL, see `http://www.gnu.org/licenses/'.

   The GNU General Public License does not permit incorporating your
program into proprietary programs.  If your program is a subroutine
library, you may consider it more useful to permit linking proprietary
applications with the library.  If this is what you want to do, use the
GNU Lesser General Public License instead of this License.  But first,
please read `http://www.gnu.org/philosophy/why-not-lgpl.html'.


File: gawk.info,  Node: GNU Free Documentation License,  Next: Index,  Prev: Copying,  Up: Top

GNU Free Documentation License
******************************

                     Version 1.3, 3 November 2008

     Copyright (C) 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc.
     `http://fsf.org/'

     Everyone is permitted to copy and distribute verbatim copies
     of this license document, but changing it is not allowed.

  0. PREAMBLE

     The purpose of this License is to make a manual, textbook, or other
     functional and useful document "free" in the sense of freedom: to
     assure everyone the effective freedom to copy and redistribute it,
     with or without modifying it, either commercially or
     noncommercially.  Secondarily, this License preserves for the
     author and publisher a way to get credit for their work, while not
     being considered responsible for modifications made by others.

     This License is a kind of "copyleft", which means that derivative
     works of the document must themselves be free in the same sense.
     It complements the GNU General Public License, which is a copyleft
     license designed for free software.

     We have designed this License in order to use it for manuals for
     free software, because free software needs free documentation: a
     free program should come with manuals providing the same freedoms
     that the software does.  But this License is not limited to
     software manuals; it can be used for any textual work, regardless
     of subject matter or whether it is published as a printed book.
     We recommend this License principally for works whose purpose is
     instruction or reference.

  1. APPLICABILITY AND DEFINITIONS

     This License applies to any manual or other work, in any medium,
     that contains a notice placed by the copyright holder saying it
     can be distributed under the terms of this License.  Such a notice
     grants a world-wide, royalty-free license, unlimited in duration,
     to use that work under the conditions stated herein.  The
     "Document", below, refers to any such manual or work.  Any member
     of the public is a licensee, and is addressed as "you".  You
     accept the license if you copy, modify or distribute the work in a
     way requiring permission under copyright law.

     A "Modified Version" of the Document means any work containing the
     Document or a portion of it, either copied verbatim, or with
     modifications and/or translated into another language.

     A "Secondary Section" is a named appendix or a front-matter section
     of the Document that deals exclusively with the relationship of the
     publishers or authors of the Document to the Document's overall
     subject (or to related matters) and contains nothing that could
     fall directly within that overall subject.  (Thus, if the Document
     is in part a textbook of mathematics, a Secondary Section may not
     explain any mathematics.)  The relationship could be a matter of
     historical connection with the subject or with related matters, or
     of legal, commercial, philosophical, ethical or political position
     regarding them.

     The "Invariant Sections" are certain Secondary Sections whose
     titles are designated, as being those of Invariant Sections, in
     the notice that says that the Document is released under this
     License.  If a section does not fit the above definition of
     Secondary then it is not allowed to be designated as Invariant.
     The Document may contain zero Invariant Sections.  If the Document
     does not identify any Invariant Sections then there are none.

     The "Cover Texts" are certain short passages of text that are
     listed, as Front-Cover Texts or Back-Cover Texts, in the notice
     that says that the Document is released under this License.  A
     Front-Cover Text may be at most 5 words, and a Back-Cover Text may
     be at most 25 words.

     A "Transparent" copy of the Document means a machine-readable copy,
     represented in a format whose specification is available to the
     general public, that is suitable for revising the document
     straightforwardly with generic text editors or (for images
     composed of pixels) generic paint programs or (for drawings) some
     widely available drawing editor, and that is suitable for input to
     text formatters or for automatic translation to a variety of
     formats suitable for input to text formatters.  A copy made in an
     otherwise Transparent file format whose markup, or absence of
     markup, has been arranged to thwart or discourage subsequent
     modification by readers is not Transparent.  An image format is
     not Transparent if used for any substantial amount of text.  A
     copy that is not "Transparent" is called "Opaque".

     Examples of suitable formats for Transparent copies include plain
     ASCII without markup, Texinfo input format, LaTeX input format,
     SGML or XML using a publicly available DTD, and
     standard-conforming simple HTML, PostScript or PDF designed for
     human modification.  Examples of transparent image formats include
     PNG, XCF and JPG.  Opaque formats include proprietary formats that
     can be read and edited only by proprietary word processors, SGML or
     XML for which the DTD and/or processing tools are not generally
     available, and the machine-generated HTML, PostScript or PDF
     produced by some word processors for output purposes only.

     The "Title Page" means, for a printed book, the title page itself,
     plus such following pages as are needed to hold, legibly, the
     material this License requires to appear in the title page.  For
     works in formats which do not have any title page as such, "Title
     Page" means the text near the most prominent appearance of the
     work's title, preceding the beginning of the body of the text.

     The "publisher" means any person or entity that distributes copies
     of the Document to the public.

     A section "Entitled XYZ" means a named subunit of the Document
     whose title either is precisely XYZ or contains XYZ in parentheses
     following text that translates XYZ in another language.  (Here XYZ
     stands for a specific section name mentioned below, such as
     "Acknowledgements", "Dedications", "Endorsements", or "History".)
     To "Preserve the Title" of such a section when you modify the
     Document means that it remains a section "Entitled XYZ" according
     to this definition.

     The Document may include Warranty Disclaimers next to the notice
     which states that this License applies to the Document.  These
     Warranty Disclaimers are considered to be included by reference in
     this License, but only as regards disclaiming warranties: any other
     implication that these Warranty Disclaimers may have is void and
     has no effect on the meaning of this License.

  2. VERBATIM COPYING

     You may copy and distribute the Document in any medium, either
     commercially or noncommercially, provided that this License, the
     copyright notices, and the license notice saying this License
     applies to the Document are reproduced in all copies, and that you
     add no other conditions whatsoever to those of this License.  You
     may not use technical measures to obstruct or control the reading
     or further copying of the copies you make or distribute.  However,
     you may accept compensation in exchange for copies.  If you
     distribute a large enough number of copies you must also follow
     the conditions in section 3.

     You may also lend copies, under the same conditions stated above,
     and you may publicly display copies.

  3. COPYING IN QUANTITY

     If you publish printed copies (or copies in media that commonly
     have printed covers) of the Document, numbering more than 100, and
     the Document's license notice requires Cover Texts, you must
     enclose the copies in covers that carry, clearly and legibly, all
     these Cover Texts: Front-Cover Texts on the front cover, and
     Back-Cover Texts on the back cover.  Both covers must also clearly
     and legibly identify you as the publisher of these copies.  The
     front cover must present the full title with all words of the
     title equally prominent and visible.  You may add other material
     on the covers in addition.  Copying with changes limited to the
     covers, as long as they preserve the title of the Document and
     satisfy these conditions, can be treated as verbatim copying in
     other respects.

     If the required texts for either cover are too voluminous to fit
     legibly, you should put the first ones listed (as many as fit
     reasonably) on the actual cover, and continue the rest onto
     adjacent pages.

     If you publish or distribute Opaque copies of the Document
     numbering more than 100, you must either include a
     machine-readable Transparent copy along with each Opaque copy, or
     state in or with each Opaque copy a computer-network location from
     which the general network-using public has access to download
     using public-standard network protocols a complete Transparent
     copy of the Document, free of added material.  If you use the
     latter option, you must take reasonably prudent steps, when you
     begin distribution of Opaque copies in quantity, to ensure that
     this Transparent copy will remain thus accessible at the stated
     location until at least one year after the last time you
     distribute an Opaque copy (directly or through your agents or
     retailers) of that edition to the public.

     It is requested, but not required, that you contact the authors of
     the Document well before redistributing any large number of
     copies, to give them a chance to provide you with an updated
     version of the Document.

  4. MODIFICATIONS

     You may copy and distribute a Modified Version of the Document
     under the conditions of sections 2 and 3 above, provided that you
     release the Modified Version under precisely this License, with
     the Modified Version filling the role of the Document, thus
     licensing distribution and modification of the Modified Version to
     whoever possesses a copy of it.  In addition, you must do these
     things in the Modified Version:

       A. Use in the Title Page (and on the covers, if any) a title
          distinct from that of the Document, and from those of
          previous versions (which should, if there were any, be listed
          in the History section of the Document).  You may use the
          same title as a previous version if the original publisher of
          that version gives permission.

       B. List on the Title Page, as authors, one or more persons or
          entities responsible for authorship of the modifications in
          the Modified Version, together with at least five of the
          principal authors of the Document (all of its principal
          authors, if it has fewer than five), unless they release you
          from this requirement.

       C. State on the Title page the name of the publisher of the
          Modified Version, as the publisher.

       D. Preserve all the copyright notices of the Document.

       E. Add an appropriate copyright notice for your modifications
          adjacent to the other copyright notices.

       F. Include, immediately after the copyright notices, a license
          notice giving the public permission to use the Modified
          Version under the terms of this License, in the form shown in
          the Addendum below.

       G. Preserve in that license notice the full lists of Invariant
          Sections and required Cover Texts given in the Document's
          license notice.

       H. Include an unaltered copy of this License.

       I. Preserve the section Entitled "History", Preserve its Title,
          and add to it an item stating at least the title, year, new
          authors, and publisher of the Modified Version as given on
          the Title Page.  If there is no section Entitled "History" in
          the Document, create one stating the title, year, authors,
          and publisher of the Document as given on its Title Page,
          then add an item describing the Modified Version as stated in
          the previous sentence.

       J. Preserve the network location, if any, given in the Document
          for public access to a Transparent copy of the Document, and
          likewise the network locations given in the Document for
          previous versions it was based on.  These may be placed in
          the "History" section.  You may omit a network location for a
          work that was published at least four years before the
          Document itself, or if the original publisher of the version
          it refers to gives permission.

       K. For any section Entitled "Acknowledgements" or "Dedications",
          Preserve the Title of the section, and preserve in the
          section all the substance and tone of each of the contributor
          acknowledgements and/or dedications given therein.

       L. Preserve all the Invariant Sections of the Document,
          unaltered in their text and in their titles.  Section numbers
          or the equivalent are not considered part of the section
          titles.

       M. Delete any section Entitled "Endorsements".  Such a section
          may not be included in the Modified Version.

       N. Do not retitle any existing section to be Entitled
          "Endorsements" or to conflict in title with any Invariant
          Section.

       O. Preserve any Warranty Disclaimers.

     If the Modified Version includes new front-matter sections or
     appendices that qualify as Secondary Sections and contain no
     material copied from the Document, you may at your option
     designate some or all of these sections as invariant.  To do this,
     add their titles to the list of Invariant Sections in the Modified
     Version's license notice.  These titles must be distinct from any
     other section titles.

     You may add a section Entitled "Endorsements", provided it contains
     nothing but endorsements of your Modified Version by various
     parties--for example, statements of peer review or that the text
     has been approved by an organization as the authoritative
     definition of a standard.

     You may add a passage of up to five words as a Front-Cover Text,
     and a passage of up to 25 words as a Back-Cover Text, to the end
     of the list of Cover Texts in the Modified Version.  Only one
     passage of Front-Cover Text and one of Back-Cover Text may be
     added by (or through arrangements made by) any one entity.  If the
     Document already includes a cover text for the same cover,
     previously added by you or by arrangement made by the same entity
     you are acting on behalf of, you may not add another; but you may
     replace the old one, on explicit permission from the previous
     publisher that added the old one.

     The author(s) and publisher(s) of the Document do not by this
     License give permission to use their names for publicity for or to
     assert or imply endorsement of any Modified Version.

  5. COMBINING DOCUMENTS

     You may combine the Document with other documents released under
     this License, under the terms defined in section 4 above for
     modified versions, provided that you include in the combination
     all of the Invariant Sections of all of the original documents,
     unmodified, and list them all as Invariant Sections of your
     combined work in its license notice, and that you preserve all
     their Warranty Disclaimers.

     The combined work need only contain one copy of this License, and
     multiple identical Invariant Sections may be replaced with a single
     copy.  If there are multiple Invariant Sections with the same name
     but different contents, make the title of each such section unique
     by adding at the end of it, in parentheses, the name of the
     original author or publisher of that section if known, or else a
     unique number.  Make the same adjustment to the section titles in
     the list of Invariant Sections in the license notice of the
     combined work.

     In the combination, you must combine any sections Entitled
     "History" in the various original documents, forming one section
     Entitled "History"; likewise combine any sections Entitled
     "Acknowledgements", and any sections Entitled "Dedications".  You
     must delete all sections Entitled "Endorsements."

  6. COLLECTIONS OF DOCUMENTS

     You may make a collection consisting of the Document and other
     documents released under this License, and replace the individual
     copies of this License in the various documents with a single copy
     that is included in the collection, provided that you follow the
     rules of this License for verbatim copying of each of the
     documents in all other respects.

     You may extract a single document from such a collection, and
     distribute it individually under this License, provided you insert
     a copy of this License into the extracted document, and follow
     this License in all other respects regarding verbatim copying of
     that document.

  7. AGGREGATION WITH INDEPENDENT WORKS

     A compilation of the Document or its derivatives with other
     separate and independent documents or works, in or on a volume of
     a storage or distribution medium, is called an "aggregate" if the
     copyright resulting from the compilation is not used to limit the
     legal rights of the compilation's users beyond what the individual
     works permit.  When the Document is included in an aggregate, this
     License does not apply to the other works in the aggregate which
     are not themselves derivative works of the Document.

     If the Cover Text requirement of section 3 is applicable to these
     copies of the Document, then if the Document is less than one half
     of the entire aggregate, the Document's Cover Texts may be placed
     on covers that bracket the Document within the aggregate, or the
     electronic equivalent of covers if the Document is in electronic
     form.  Otherwise they must appear on printed covers that bracket
     the whole aggregate.

  8. TRANSLATION

     Translation is considered a kind of modification, so you may
     distribute translations of the Document under the terms of section
     4.  Replacing Invariant Sections with translations requires special
     permission from their copyright holders, but you may include
     translations of some or all Invariant Sections in addition to the
     original versions of these Invariant Sections.  You may include a
     translation of this License, and all the license notices in the
     Document, and any Warranty Disclaimers, provided that you also
     include the original English version of this License and the
     original versions of those notices and disclaimers.  In case of a
     disagreement between the translation and the original version of
     this License or a notice or disclaimer, the original version will
     prevail.

     If a section in the Document is Entitled "Acknowledgements",
     "Dedications", or "History", the requirement (section 4) to
     Preserve its Title (section 1) will typically require changing the
     actual title.

  9. TERMINATION

     You may not copy, modify, sublicense, or distribute the Document
     except as expressly provided under this License.  Any attempt
     otherwise to copy, modify, sublicense, or distribute it is void,
     and will automatically terminate your rights under this License.

     However, if you cease all violation of this License, then your
     license from a particular copyright holder is reinstated (a)
     provisionally, unless and until the copyright holder explicitly
     and finally terminates your license, and (b) permanently, if the
     copyright holder fails to notify you of the violation by some
     reasonable means prior to 60 days after the cessation.

     Moreover, your license from a particular copyright holder is
     reinstated permanently if the copyright holder notifies you of the
     violation by some reasonable means, this is the first time you have
     received notice of violation of this License (for any work) from
     that copyright holder, and you cure the violation prior to 30 days
     after your receipt of the notice.

     Termination of your rights under this section does not terminate
     the licenses of parties who have received copies or rights from
     you under this License.  If your rights have been terminated and
     not permanently reinstated, receipt of a copy of some or all of
     the same material does not give you any rights to use it.

 10. FUTURE REVISIONS OF THIS LICENSE

     The Free Software Foundation may publish new, revised versions of
     the GNU Free Documentation License from time to time.  Such new
     versions will be similar in spirit to the present version, but may
     differ in detail to address new problems or concerns.  See
     `http://www.gnu.org/copyleft/'.

     Each version of the License is given a distinguishing version
     number.  If the Document specifies that a particular numbered
     version of this License "or any later version" applies to it, you
     have the option of following the terms and conditions either of
     that specified version or of any later version that has been
     published (not as a draft) by the Free Software Foundation.  If
     the Document does not specify a version number of this License,
     you may choose any version ever published (not as a draft) by the
     Free Software Foundation.  If the Document specifies that a proxy
     can decide which future versions of this License can be used, that
     proxy's public statement of acceptance of a version permanently
     authorizes you to choose that version for the Document.

 11. RELICENSING

     "Massive Multiauthor Collaboration Site" (or "MMC Site") means any
     World Wide Web server that publishes copyrightable works and also
     provides prominent facilities for anybody to edit those works.  A
     public wiki that anybody can edit is an example of such a server.
     A "Massive Multiauthor Collaboration" (or "MMC") contained in the
     site means any set of copyrightable works thus published on the MMC
     site.

     "CC-BY-SA" means the Creative Commons Attribution-Share Alike 3.0
     license published by Creative Commons Corporation, a not-for-profit
     corporation with a principal place of business in San Francisco,
     California, as well as future copyleft versions of that license
     published by that same organization.

     "Incorporate" means to publish or republish a Document, in whole or
     in part, as part of another Document.

     An MMC is "eligible for relicensing" if it is licensed under this
     License, and if all works that were first published under this
     License somewhere other than this MMC, and subsequently
     incorporated in whole or in part into the MMC, (1) had no cover
     texts or invariant sections, and (2) were thus incorporated prior
     to November 1, 2008.

     The operator of an MMC Site may republish an MMC contained in the
     site under CC-BY-SA on the same site at any time before August 1,
     2009, provided the MMC is eligible for relicensing.


ADDENDUM: How to use this License for your documents
====================================================

To use this License in a document you have written, include a copy of
the License in the document and put the following copyright and license
notices just after the title page:

       Copyright (C)  YEAR  YOUR NAME.
       Permission is granted to copy, distribute and/or modify this document
       under the terms of the GNU Free Documentation License, Version 1.3
       or any later version published by the Free Software Foundation;
       with no Invariant Sections, no Front-Cover Texts, and no Back-Cover
       Texts.  A copy of the license is included in the section entitled ``GNU
       Free Documentation License''.

   If you have Invariant Sections, Front-Cover Texts and Back-Cover
Texts, replace the "with...Texts." line with this:

         with the Invariant Sections being LIST THEIR TITLES, with
         the Front-Cover Texts being LIST, and with the Back-Cover Texts
         being LIST.

   If you have Invariant Sections without Cover Texts, or some other
combination of the three, merge those two alternatives to suit the
situation.

   If your document contains nontrivial examples of program code, we
recommend releasing these examples in parallel under your choice of
free software license, such as the GNU General Public License, to
permit their use in free software.


File: gawk.info,  Node: Index,  Prev: GNU Free Documentation License,  Up: Top

Index
*****